Articles on this page are available in 1 other language: Serbian (Latin) (1) (learn more)

Overview

Brief Summary

Biology

Tigers are predominately solitary creatures, they occupy territories that are defended against intruders of the same sex and are marked with urine and scrapes at the boundaries (2). Males have larger territories that overlap those of several females, with whom they mate (2). Mating occurs throughout the year and the female gives birth to a litter of around two to three cubs after a four month gestation period (3). Cubs learn to hunt and kill from around six months of age but remain dependent on their mother for at least 15 months, after which time they will disperse to find their own territory (2). Tigers are 'stalk and ambush' predators and their stripy coat provides effective camouflage in tall grass and forest (2). Hunting mainly occurs at night and the principal prey consists of deer and wild pigs, although tigers prey on a variety of other animals and will also eat carrion (3). Unlike other species of cats, tigers are competent swimmers; they will readily enter the water, and can be found lying half-submerged in streams and lakes in the mid-day heat (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Taxonomy

Panthera tigris amoyensis is believed by some scientists to be a relict population of the ancestor from which all other tigers evolved - the ‘stem’ tiger.

Tiger subspecies
8 subspecies of tiger have traditionally been recognised on the basis of:
  • geographic isolation
  • morphological characteristics
They are:
  1. Siberian or Amur tiger, P. t. altaica
  2. South China tiger, P. t. amoyensis
  3. Bali tiger, P. t. balica
  4. Northern Indochinese tiger, P. t. corbetti
  5. Javan tiger, P. t. sondaica
  6. Sumatran tiger, P. t. sumatrae
  7. Bengal tiger, P. t. tigris
  8. Caspian tiger, P. t. virgata
The Bali, Caspian and Javan subspecies are extinct.

Morphology
The South China tiger is one of the smallest tiger subspecies.
Male tigers:
  • Length: 2.3-2.6m (from head to tail)
  • Weight: 130-150kg
Female tigers:
  • Length: smaller than males, at 2.2-2.4m
  • Weight: 100-115kg


Skull morphology
This has been used to distinguish different tiger subspecies, although there are strong similarities between P. t. tigris and P t. corbetti, and some overlap of P. t. corbetti and P. t. sumatrae.P. t. amoyensis has distinctive primitive skull morphology including:
  • a shortened cranial region
  • close-set, more forward facing eye sockets


Colouring and markings
The South China tiger has a similar coat color to other Asian tigers. Its short, broad stripes are spaced far apart compared to those of Bengal and Siberian tigers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

One of the largest of the 'big cats', the tiger is an instantly recognisable and emotive animal. Nine different subspecies are recognised, three of which became extinct in the latter part of the 20th Century; the Bali (P. t. balica), Javan (P. t. sondaica) and Caspian tigers (P. t. virgata). The remaining subspecies are the Siberian (P. t. altaica), South China (P. t. amoyensis), Sumatran (P. t. sumatrae), Indochinese (P. t. corbetti), Malayan (P. t. jacksoni)and Bengal tigers (P. t. tigris) (3) (10). The different subspecies vary in their body size, coat colour and markings, with the Sumatran tiger being the smallest and darkest, whilst the Siberian tiger is the largest and palest subspecies (4). Markings and coat colour can overlap between subspecies and are not often used to differentiate (10). Generally however, tigers have a reddish-orange to yellow-ochre coat with a white belly and black markings, the pattern of which is unique (2). Like the other big cats, tigers are well adapted for hunting large prey and have short, heavily-muscled forelimbs and long, sharp, retractable claws (2). Extreme colour varieties are occasionally seen in the wild, such as whitish-grey tigers with chocolate stripes which are the result of two tigers with a recessive gene breeding (2). However, whilst this colour variation is popular with zoos, it is not of conservation significance (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description of Panthera tigris

The tiger (Panthera tigris) is the largest cat species, reaching a total body length of up to 3.3 metres (11 ft) and weighing up to 306 kg (670 lb). Their most recognizable feature is a pattern of dark vertical stripes on reddish-orange fur with lighter underparts. They have exceptionally stout teeth, and their canines are the longest among living felids with a crown height of as much as 74.5 mm (2.93 in) or even 90 mm (3.5 in). Tigers once ranged widely across Asia, from Turkey in the west to the eastern coast of Russia. Over the past 100 years, they have lost 93% of their historic range, and have been extirpated from southwest and central Asia, from the islands of Java and Bali, and from large areas of Southeast and Eastern Asia. Today, they range from the Siberian taiga to open grasslands and tropical mangrove swamps. The remaining six tiger subspecies have been classified as endangered by IUCN. The global population in the wild is estimated to number between 3,062 to 3,948 individuals, with most remaining populations occurring in small pockets that are isolated from each other. Major reasons for population decline include habitat destruction, habitat fragmentation and poaching.[1] The extent of area occupied by tigers is estimated at less than 1,184,911 km2 (457,497 sq mi), a 41% decline from the area estimated in the mid-1990s. Tigers are territorial and generally solitary but social animals, often requiring large contiguous areas of habitat that support their prey requirements. This, coupled with the fact that they are indigenous to some of the more densely populated places on earth, has caused significant conflicts with humans. In zoos, tigers have lived for 20 to 26 years, which also seems to be their longevity in the wild. Tigers have featured prominently in ancient mythology and folklore, and continue to be depicted in modern films and literature. Tigers appear on many flags, coats of arms, and as mascots for sporting teams. The Bengal tiger is the national animal of Bangladesh and India.
Creative Commons Attribution 3.0 (CC BY 3.0)

David

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Lifespan:
Tigers can live up to 26 years in captivity, but in the wild 8-10 years is more usual.

Reproduction patterns of tigers
Tigers appear to reach sexual maturity at about 3-6 years of age and can breed at any time of the year. Gestation: around 103 days.Litter size: up to 7 cubs, 2 or 3 is usual.Birth to maturity:Cubs are born blind and do not open their eyes until about 6-14 days after birth. For the first 8 weeks the cubs consume only their mother's milk. When cubs are 2 months old they start following their mother, begin eating solids and leave the den for the first time. They continue to be suckled until they are 3-6 months old and they are totally dependent on their mother until they learn to kill at about 6 months old. By the time they are 18 months to 3 years old they can hunt for themselves, and become fully independent.

Territory
South China tigers are solitary, except during mating season.Male territory may sometimes overlap.

Diet
South China tigers, like all other tiger subspecies, are pure carnivores.Their most common prey is:
  • deer
  • antelope
  • wild boar
  • wild pigs
  • other hooved mammals (ungulates) native to this region
Tigers have also been known to attack livestock and even humans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

The South China tiger, Panthera tigris amoyensis, is one of the world's most endangered animals.It is the most critically endangered of all of the living tiger subspecies and is possibly already extinct in the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Tiger once ranged widely across Asia, from Turkey in the west to the eastern coast of Russia (Nowell and Jackson 1996). Over the past 100 years Tigers have disappeared from southwest and central Asia, from two Indonesian islands (Java and Bali) and from large areas of Southeast and Eastern Asia. Tigers have lost over 93% of their historic range (Sanderson et al. 2006, Walston et al. 2010b). Tigers are currently found in thirteen Asian range states: Bangladesh, Bhutan, Cambodia, China, India, Indonesia, Lao PDR, Malaysia, Myanmar, Nepal, Russia, Thailand and Viet Nam. They may still persist in North Korea, although there has been no recent confirmed evidence.

In 1994, the first comprehensive assessment to delineate Tiger range was carried out (Dinerstein et al. 1997). Priority areas for Tiger conservation were estimated to total 1.64 million km² in 159 Tiger Conservation Units (TCUs), roughly equivalent to discrete meta-populations, not including Russia (later estimated at 270,0000 km²: Sanderson et al. 2006) and China. While this was generally considered representative of current distribution, Tiger presence was confirmed in just 47% the TCUs, and 89% were scored as undergoing medium to high levels of poaching of Tigers and their prey.

This exercise was revised and updated ten years later, and in delineating Tiger Conservation Landscapes (TCLs), greater emphasis was placed on actual records of Tiger presence and breeding (Sanderson et al. 2006). TCLs were defined as areas where there is sufficient habitat to conserve at least five Tigers, and Tigers have been confirmed to occur in the past decade. Tiger range was estimated at 1.1 million km² in 76 TCLs (again, roughly equivalent to discrete meta-populations). This represented a 41% decline from the range described a decade earlier (in South and Southeast Asia, a drop from 1.55 million km² to 914,000 km²: Sanderson et al. 2006: 63), attributed primarily to poaching pressure (Dinerstein et al. 2007). Habitat loss due to deforestation was also to blame, notable particularly in Sumatra and Myanmar (Wikramanayake et al. 2010). In India, landscapes with Tigers found to be much smaller and more fragmented than in the original assessment (Sanderson et al. 2006: 63 and Figure 4.12).

Records of Tigers were collected over a ten-year period (1995–2004), a period which may have been too liberal for places like Cambodia which underwent a sharp rise in poaching pressure in the 1990s (Sanderson et al. 2006: Appendix 6). While 53% of the TCU survey respondents reported evidence of Tiger breeding in the time period 1995–2004, out of over 2,500 point records collected in 2005, just 8% had confirmed evidence of breeding Tigers (Sanderson et al. 2006: 11-17). Large areas of habitat were defined as Tiger landscapes based on suitability, but given data paucity on Tiger presence there were often few records of breeding and actual Tiger occupancy to substantiate these (Sanderson et al. 2006: Figures 2.3 and 4.8).

A review of land management within Tiger Conservation Landscapes described the TCLs as “potential habitat for Tigers” and found only 21% of their area to be legally protected. Management effectiveness was generally poor in the protected areas, with regulatory, budgetary and enforcement constraints, and hunting cited as the main threat. Significant portions of the TCLs are designated concessions for resource extraction (timber, oil and gas, minerals, etc.) (Forrest et al. 2011).

Tiger range was revisited again in 2009, by which time the extent of the Tiger’s range collapse had become evident. “Vast areas of Southeast Asia [were] recently found to be void of Tigers and depleted of prey by hunters” (Walston et al. 2010a: 5). The exercise used a different methodology to prioritize areas for Tiger conservation. Source Sites were defined as areas with confirmed current presence of Tigers and evidence of breeding, population estimates of >25 breeding females, legal protection, and embedded in a larger habitat landscape with the potential to hold >50 breeding females. An extensive review of scientific literature as well as correspondence with Tiger scientists and protected area managers resulted in the identification of just 42 source sites totalling approximately 90,000 km². Many Southeast Asian countries, previously considered to have large areas with Tigers, are now considered, on the basis of extensive survey effort over the past decade or more, to have essentially no healthy breeding populations: Myanmar, Cambodia, Vietnam and Bhutan have no confirmed source sites (although some sites with potential), and Laos just one (Walston et al. 2010a,b).

On the range map accompanying this Red List assessment, the Source Sites are delineated as Extant range, and the Tiger Conservation Landscapes as Probably Extant, as they are based primarily on “realistic inferences (e.g., based on distribution of suitable habitat at appropriate altitudes and proximity to areas where the taxon is known or thought very likely to remain extant,” as defined by the IUCN Red List of Threatened Species).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The range of tigers once extended across Asia from eastern Turkey and the Caspian Sea south of the Tibetan plateau eastward to Manchuria and the Sea of Okhotsk. Tigers were also found in northern Iran, Afghanistan, the Indus valley of Pakistan, Laos, Thailand, Vietnam, Cambodia, Malaysia, and the islands of Java and Bali. Tigers are now extinct or nearly extinct in most of these areas. Populations remain relatively stable in northeastern China, Korea, Russia, and parts of India and the Himalayan region.

There are eight recognized subspecies of Panthera tigris. Siberian tigers, P. t. altaica, are currently found only in a small part of Russia, including the Amurussuri region of Primorye and Khabarovsk. Bengal tigers, P. t. tigris, are found in India, Bangladesh, Nepal, Bhutan, and China. Indochinese tigers, P. t. corbetti, are found in Cambodia, China, Laos, Malaysia, Myanmar, Thailand, and Vietnam. South China tigers, P. t. amoyensis, are found in three isolated areas in southcentral China. Sumatran tigers, P. t. sumatrae, are found only on the Indonesian island of Sumatra. Bali tigers (P. t. balica), Javan tigers (P. t. sondaica), and Caspian tigers (P. t. virgata) are thought to be extinct. Those subspecies occurred on the islands of Bali (P. t. balica), Java (P. t. sondaica), and in Turkey, the Transcaucasus region, Iran, and central Asia (P. t. virgata).

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Sunquist, M., F. Sunquist. 2002. Wild Cats of the World. Chicago: University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution habitat

Distribution
At the beginning of the 20th century, when the South China tiger was abundant, it was distributed in ranges throughout central, eastern and southern China and Hong Kong.However, there has been no official sighting of this subspecies in the wild for over 25 years and the last confirmed sighting in Hong Kong was in 1947.It appears that what few individuals may remain in the wild have a reduced range. A 1990 survey by Chinese scientists failed to find any tigers, although anecdotal evidence from former hunters suggested that there could be small and scattered populations in the remote mountains of the Guangdong, Hunan, and Fujian provinces of southern China.

Habitat
Like other tiger subspecies, South China tigers live where there is:
  • some form of dense vegetative cover (this subspecies prefers moist forests)
  • access to water and prey
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Temperate and tropical Asia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Tigers were once known throughout central and southern Asia and as far west as eastern Turkey but currently survive only in scattered populations from India to Southeast Asia, and in Sumatra, China and the Russian Far East (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tigers have a reddish-orange coat with vertical black stripes along the flanks and shoulders that vary in size, length, and spacing. Some subspecies have paler fur and some are almost fully white with either black or dark brown stripes along the flanks and shoulders. The underside of the limbs and belly, chest, throat, and muzzle are white or light. White is found above the eyes and extends to the cheeks. A white spot is present on the back of each ear. The dark lines about the eyes tend to be symmetrical, but the marks on each side of the face are often asymmetrical. The tail is reddish-orange and ringed with several dark bands.

Body size and morphology varies considerably among subspecies of tigers. Siberian tigers, also know as Amur tigers (P. t. altaica), are the largest. Male Siberian tigers can grow to 3.7 meters and weigh over 423 kg; females are up to 2.4 meters in length and 168 kg. Male Indochinese tigers (P. t. corbetti), though smaller than Siberian tigers in body size at 2.85 meters in length and 195 kg, have the longest skull of all tiger subspecies, measuring 319 to 365 mm. Sumatran tigers (P. t. sumatrae) are the smallest living subspecies. Male Sumatran tigers measure 2.34 meters and weigh 136 kg; females measure 1.98 meters and weigh 91 kg.

Tigers are powerful animals, one is known to have dragged a gaur bull weighing 700 kg. Tigers have short, thick necks, broad shoulders, and massive forelimbs, ideal for grappling with prey while holding on with long retractible claws and broad forepaws. A tiger’s tongue is covered with hard papillae, to scrape flesh off the bones of prey.

All tigers have a dental formula of 3/3, 1/1, 3/2, 1/1. Bengal tigers (P. t. tigris) have the longest canines of any living large cat; from 7.5 to 10 cm in length. A tiger's skull is robust, short, and broad with wide zygomatic arches. The nasal bones are high, projecting little further than the maxillary, where the canines fit. Tigers have a well-developed sagittal crest and coronoid processes, providing muscle attachment for their strong bite.

Range mass: 91 to 423 kg.

Range length: 1.98 to 3.7 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 133.859 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Tigers are found mainly in the forests of tropical Asia, although they historically occurred more widely in drier and colder climes. One subspecies, the Amur Tiger P.t. altaica, persists in the Russian Far East. Photos of Tigers up to 4,500 m have been obtained in Bhutan (Wang 2008).

Availability of a sufficient prey base of large ungulates is the Tiger's major habitat requirement: "wild pigs and deer of various species are the two prey types that make up the bulk of the Tiger's diet, and in general Tigers require a good population of these species in order to survive and reproduce" (Sunquist and Sunquist 2002). Based on studies, Karanth et al. (2004) estimate that Tigers need to kill 50 large prey animals per year. Tigers are opportunistic predators, however, and their diet includes birds, fish, rodents, insects, amphibians, reptiles in addition to other mammals such as primates and porcupines. Tigers can also take ungulate prey much larger than themselves, including large bovids (water buffalo, gaur, banteng), elephants and rhinos (Nowell and Jackson 1996).

Tigers are generally solitary, with adults maintaining exclusive territories, or home ranges. Adult female home ranges seldom overlap, whereas male ranges typically overlap from 1–3 females, a typical felid pattern of social organization. Tiger home ranges are small where prey is abundant - e.g., female home ranges in Chitwan averaged 20 km², while in the Russian Far East they are much larger at 450 km² (Sunquist and Sunquist 2002). Similarly, reported Tiger densities range from 11.65 adult Tigers per 100 km² where prey is abundant (India's Nagarhole National Park) to as low as 0.13–0.45 per 100 km² where prey is more thinly distributed, as in Russia's Sikhote Alin Mountains (Nowell and Jackson 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Tigers live in a wide variety of habitats, suggested by their distribution across a wide range of ecological conditions. They are known to occur in tropical lowland evergreen forest, monsoonal forest, dry thorn forest, scrub oak and birch woodlands, tall grass jungles, and mangrove swamps. Tigers are able to cope with a broad range of climatic variation, from warm moist areas, to areas of extreme snowfall where temperatures may be as low as –40 degrees Celsius. Tigers have been found at elevations of 3,960 meters. In general, tigers require only some vegetative cover, a source of water, and sufficient prey.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: tundra ; taiga ; savanna or grassland ; forest ; rainforest ; scrub forest ; mountains

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Varies widely across its range from tropical forests to tall grass jungles, encompassing coniferous woodlands, mangrove swamps and dry thorn forests. In general however, tigers require dense cover, access to water and sufficient large prey (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Tigers prefer to hunt at night, when their ungulate prey are most active. In a study done in India by Schaller (1967), tigers were most active before 0800 and after 1600 hours. Tigers are thought to locate their prey using hearing and sight more than olfaction (Schaller, 1967). They use a stealthy approach, taking advantage of every rock, tree and bush as cover and rarely chase prey far. Tigers are silent, taking cautious steps and keeping low to the ground so they are not sighted or heard by the prey. They typically kill by ambushing prey, throwing the prey off balance with their mass as they leap onto it. Tigers are successful predators but only 1 out of 10 to 20 attacks result in a successful hunt.

Tigers use one of two tactics when they get close enough to kill. Small animals, weighing less than half the body weight of the tiger, are killed by a bite to the back of the neck. The canines are inserted between the neck vertebrae forcing them apart and breaking the spinal cord. For larger animals, a bite to the throat is used to crush the animal’s trachea and suffocate it. The throat bite is the safer killing tactic because it minimizes any physical assault the tiger may receive while trying to kill its prey. After the prey is taken to cover, tigers feed first on the buttocks using the carnassials to rip open the carcass. As the tiger progresses it opens the body cavity and removes the stomach. Not all of the prey is eaten; some parts are rejected. Prey are usually dragged to cover and may be left there and revisited over several days.

The majority of the tiger diet consists of various large ungulate species, including sambar (Rusa unicolor), chital (Axis axis), hog deer (Axis porcinus), barasingha (Rucervus duvaucelii), barking deer (Muntiacus muntjak), elk (Cervus elaphus), sika deer (Cervus nippon), Eurasian elk (Alces alces), roe deer (Capreolus capreolus), muskdeer (Moschus moschiferus), nilgai (Boselaphus tragocamelus), black buck (Antilope cervicapra), gaur (Bos frontalis), banteng (Bos javanicus), water buffalo (Bubalus bubalis), and wild pigs (Sus). Domestic ungulates are also taken, including cattle (Bos taurus), water buffalo (Bubalus bubalis), horses (Equus caballus), and goats (Capra hircus). In rare cases tigers attack Malayan tapirs (Tapirus indicus), Indian elephants (Elephas maximus), and young Indian rhinoceroses (Rhinoceros unicornis). Tigers regularly attack and eat brown bears (Ursus arctos), Asiatic black bears (Ursus thibetanus), and sloth bears (Melursus ursinus). Smaller animals are sometimes taken when larger prey is unavailable, this includes large birds such as pheasants (Phasianinae), leopards (Panthera pardus), fish, crocodiles (Crocodylus), turtles, porcupines (Hystrix), rats, and frogs. A very few tigers begin to hunt humans (Homo sapiens). Tigers will eat between 18 and 40 kg of meat when they successfully take large prey, they do not typically eat every day.

Animal Foods: birds; mammals; reptiles; fish

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Tigers help regulate populations of their large herbivore prey, which put pressure on plant communities. Because of their role as top predators, they may be considered keystone species.

Tiger parasites include the nematode, trematode, and cestode worms: Paragonimus westermani, Toxocara species, Uiteinarta species, Physaloptera praeputhostoma, Dirofilaria species, Gnathostoma spinigerum, Diphyllobothrium erinacei, Taenia bubesei, and Taenia pisiformis. Ticks known from tigers are Rhipicephalus annulatus, Dermacentor silvarum, Hyalomma truncatum, Hyalomma kumari, Hyalomma marginata, and Rhipicelphalus turanicus.

Ecosystem Impact: keystone species

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Tigers have no natural predators, except for humans. Adult tigers are potential predators of younger cubs.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication among tigers is maintained by scent markings, visual signals, and vocalization. Scent markings are deposited in the form of an odorous musky liquid that is mixed with urine and sprayed on objects like grass, trees, or rocks.  A facial expression called “flehmen” is often associated with scent detection. During flehmen, the tongue hangs over the incisors, the nose is wrinkled, and the upper canines are bared. Flehmen is commonly seen in males that have just sniffed urine, scent marks, an estrous tigress, or a cub of their own species.

Visual signals made by tigers include spots that have been sprayed, scrapes made by raking the ground, and claw marks left on trees or other objects. Schaller (1967) described a “defense threat” facial expression observed when a tiger is attacking. This involved pulling the corners of the open mouth back, exposing the canines, fattening the ears, and enlarging the pupils of the eyes. The spots on the back of their ears and their pattern of stripes may also be used in intraspecific communication.

Tigers can also communicate vocally with roars, growls, snarls, grunts, moans, mews, and hisses. Each sound has its own purpose, and appears to reflect the tiger's intent or mood. For example, a tiger’s roar is usually a signal of dominance; it tells other individuals how big it is and its location. A moan communicates submission. The ability of tigers to roar comes from having a flexible hyoid apparatus and vocal fold with a thick fibro- elastic pad that allows sound to travel long distances.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: choruses ; pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Tigers usually live 8 to 10 years in the wild, although they can reach ages into their 20's. In captivity tigers have been known to live up to 26 years old, although a typical captive lifespan is 16 to 18 years. It is estimated that most adult tigers die as a result of human persecution and hunting, although their large prey can occasionally wound them fatally. Young tigers face numerous dangers when they disperse from their mother's home range, including being attacked and eaten by male tigers. Some researchers estimate a 50% survival rate for young tigers.

Range lifespan

Status: captivity:
26 (high) years.

Typical lifespan

Status: wild:
8 to 10 years.

Average lifespan

Status: wild:
8 to 10 years.

Typical lifespan

Status: captivity:
16 to 18 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.3 years (captivity) Observations: One tiger lived 26.3 years at Adelaide Zoo. A hybrid between a tiger and a lion lived 24.2 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Tigers are solitary and do not associate with mates except for mating. Local males may compete for access to females in estrus.

Mating System: polygynandrous (promiscuous)

Female tigers come into estrus every 3 to 9 weeks and are receptive for 3 to 6 days. They have a gestation period of about 103 days (from 96 to 111 days), after which they give birth to from 1 to 7 altricial cubs. Average litter sizes are 2 to 3 young. In Siberian tigers the average litter size is 2.65 (n=123), similar averages have been found in other tiger subspecies. Newborn cubs are blind and helpless, weighing from 780 to 1600 g. The eyes do not open until 6 to 14 days after birth and the ears from 9 to 11 days after birth. The mother spends most of her time nursing the young during this vulnerable stage. Weaning occurs at 90 to 100 days old. Cubs start following their mother at about 2 months old and begin to take some solid food at that time. From 5 to 6 months old the cubs begin to take part in hunting expeditions. Cubs stay with their mother until they are 18 months to 3 years old. Young tigers do not reach sexual maturity until around 3 to 4 years of age for females and 4 to 5 years of age for males.

Breeding interval: Female tigers give birth every 3 to 4 years, depending on the length of dependence of previous cubs.

Breeding season: Tigers can breed at any time of the year, but breeding is most common from November to April.

Range number of offspring: 1 to 7.

Average number of offspring: 2.65.

Range gestation period: 96 to 111 days.

Average gestation period: 103 days.

Average weaning age: 90 to 100 days.

Average time to independence: 18 months.

Average age at sexual or reproductive maturity (female): 3 to 4 years.

Average age at sexual or reproductive maturity (male): 4 to 5 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; viviparous

Average birth mass: 1190 g.

Average number of offspring: 2.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
1415 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1268 days.

Like other mammals, females care for and nurse their dependent young. Weaning occurs at 3 to 6 months, but cubs are dependent on their mother until they become proficient hunters themselves, when they reach 18 months to 3 years old. Young tigers must learn to stalk, attack, and kill prey from their mother. A mother caring for cubs must increase her killing rate by 50% in order to get enough nutrition to satisfy herself and her offspring. Male tigers do not provide parental care.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Sunquist, M., F. Sunquist. 2002. Wild Cats of the World. Chicago: University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panthera tigris

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1884-08|EF551003|Panthera tigris| AACCGCTGACTATTTTCAACCAATCACAAGGATATTGGAACTCTTTACCTTTTATTTGGCGCCTGGGCTGGTATAGTGGGGACTGCCCTC---AGTCTCCTAATTCGAGCCGAACTGGGTCAACCTGGCACACTACTAGGAGAT---GACCAAATTTATAATGTAGTAGTTACTGCCCATGCCTTTGTGATAATCTTTTTTATAGTAATGCCTATTATAATTGGAGGATTCGGAAACTGGCTAGTTCCGTTAATA---ATCGGAGCCCCCGATATGGCATTCCCTCGAATGAATAACATAAGCTTCTGACTCCTTCCCCCATCCTTCCTACTTCTGCTCGCATCGTCTATGGTAGAAGCTGGGGCAGGAACTGGGTGGACAGTATACCCACCCCTAGCTGGCAACCTAGCCCATGCAGGAGCATCCGTGGATCTA---ACTATTTTTTCACTACACCTAGCAGGCGTCTCCTCAATCTTAGGTGCTATTAATTTTATTACTACTATTATTAATATAAAACCGCCCGCTATGTCCCAATACCAAACACCCCTGTTTGTTTGATCGGTTCTAATTACTGCTGTGTTGCTACTTCTATCACTGCCAGTTTTAGCAGCA---GGCATCACCATGCTACTGACAGATCGAAATCTAAATACCACATTTTTTGATCCTGCCGGGGGAGGAGACCCCATCTTATATCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTATATCTTAATCCTGCCCGGGTTTGGAATAATTTCACATATTGTCACCTACTACTCAGGCAAAAAA---GAACCTTTTGGCTACATGGGGATAGTCTGAGCCATAATGTCAATTGGCTTTCTGGGCTTTATCGTATGGGCCCATCACATGTTTACTGTAGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panthera tigris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Species: 34
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bcd+4bcd;C1+2a(i)

Version
3.1

Year Assessed
2011

Assessor/s
Chundawat, R.S., Habib, B., Karanth, U., Kawanishi, K., Ahmad Khan, J., Lynam, T., Miquelle, D., Nyhus, P., Sunarto, S., Tilson, R. & Sonam Wang

Reviewer/s
Nowell, K., Breitenmoser, U. & Breitenmoser-Wursten, C.

Contributor/s

Justification
Listed as Endangered under A2bcd+4bcd. Tiger range appears to have declined by over 50% over the last three generations (21–27 years) (Dinerstein et al. 2007, Walston et al. 2010b). Comparing present Tiger population estimates (approximately 3,000) to those in the 1990s (5,000–7,000), despite the imprecision of the earlier estimate, also suggests a decline of at least 50% over this time period. The declining trend is likely to persist in the near future. The causes of population reduction may not be reversible in some areas.

Also listed under C1+2a(i), as a precautionary approach finds that the population of breeding adult Tigers is likely fewer than 2,500 mature individuals. Estimates of the Tiger populations in 42 protected source sites where there is evidence of breeding total 2,154 Tigers (see Table) (Walston et al. 2010a). Although this is not a complete estimate of the global Tiger population (for example, most Amur Tigers in Russia are found in unprotected areas), generally Tiger status outside the source sites is poor and poorly known. IUCN Guidelines (IUCN Standards and Petitions Subcommittee 2010) define population as the number of mature individuals, defined as “individuals known, estimated or inferred to be capable of reproduction.” While in general this refers to all reproductive-age adults in the population, the Guidelines also “stress that the intention of the definition of mature individuals is to allow the estimate of the number of mature individuals to take account of all the factors that may make a taxon more vulnerable than otherwise might be expected.” Tigers require large populations to persist, and the survival rate of breeding adult females is a key parameter, with models suggesting population declines when mortality of breeding females rises over 15% (Chapron et al. 2008). Population declines in recent years have been most pronounced outside protected areas (Walston et al. 2010b). The IUCN Guidelines advise that “mature individuals that will never produce new recruits should not be counted.” For the purposes of Red List assessment, the estimated population in the Source Sites is used as a proxy for the breeding population of adult Tigers. This population has declined by over 20% during the last two generations (13–20 years); the decline continues and may not be reversible; and no subpopulation is greater than 250 mature individuals.

History
  • 2010
    Endangered
    (IUCN 2010.2)
  • 2002
    Endangered
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Siberian (P. t. altaica), South China (P. t. amoyensis), and Sumatran tigers (P. t. sumatrae) are all critically endangered. Bengal (P. tigris tigris) and Indochinese tigers (P. tigris corbetti) are endangered. Bali (P. t. balica), Javan (P. t. sondaica), and Caspian tigers (P. tigris virgata) are extinct. The specific threats to tigers vary regionally, but human persecution, hunting, and human-induced habitat destruction are universal factors in threatening tiger populations.

US Federal List: endangered; threatened

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Panthera tigris , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation status
2009 IUCN Red List of Threatened Species category: critically endangered (possibly extinct in the wild)The South China tiger is the most critically endangered of all of the living tiger subspecies. Its current status is uncertain.Some scientists believe there is no viable wild population left and consider the subspecies to be functionally extinct. It is generally believed that if a wild population does still exist it includes less than 30 animals.3 other tiger subspecies were lost to extinction in the 20th century. If the South China tiger follows suit, it would mean that 4 out of the 8 tiger subspecies have been wiped out forever.Around 80 South China tigers are thought to exist in captivity.

Threats
South China tigers were once considered pests by the Chinese government. This status led to them being hunted to the brink of extinction in the wild. However, in 1977 it became illegal to hunt them.Currently the biggest threats to any that remain in the wild are:
  • destruction of their prey base
  • poaching
  • population fragmentation
  • loss of habitat due to conversion for livestock or commercial tree farms


What is being done to try to save the South China tiger?
The Chinese State Forestry Administration is supporting 2 parallel programmes to help re-establish the South China tiger in the wild. It is hoped that together these projects will result in self-sustaining populations of the tigers in forest habitats with sufficient prey.
  1. Nature reserves

    This programme involves establishing special nature reserves in suitable areas to help the recovery of wild populations. It is a long-term effort being developed together with the South China Tiger Advisory Office and will involve habitat recovery, removal of threats to prey and prey breeding, as well as tiger reintroductions.
  2. Captive breeding and rewilding

    Another organisation, Save China’s Tigers, is collaborating on a scheme to teach a selection of captive-bred South China tiger cubs to hunt live prey on a private reserve in South Africa. The offspring of these trained tigers will then be released onto pilot reserves in China. The first cub was born in 2007, the first to be born outside of China.

    Unfortunately inbreeding is a significant concern for these tigers. When the scheme was officially approved in 2005, the captive population of South China tigers consisted of around 60 individuals in China, all descended from just 6 animals. This means there is very limited genetic diversity available for a successful breeding programme.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2002 (1) and listed on Appendix I on CITES (8). Subspecies: Siberian tiger (P. t. altaica) classified as Critically Endangered (CR) and listed on Appendix I of CITES; Amoy tiger (P. t. amoyensis) classified as Critically Endangered (CR) and listed on Appendix I of CITES; Sumatran tiger (P. t. sumatrae) classified as Critically Endangered (CR); Indochinese tiger (P. t. corbetti) and the Bengal tiger (P. t. tigris) are not entered on the IUCN Red List (1); The Bali (P. t. balica), Javan (P. t. sondaica) and Caspian tigers (P. t. virgata) are now extinct (9). These subspecies' classifications are taken from the 2002 Red List – they are not listed on the 2004 Red List as they are under review (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The thirteen Tiger Range Countries have come together in an unprecedented pledge to double the world’s Tiger population by 2022, the next Year of the Tiger on the Asian lunar calendar, with a goal of achieving at least 6,000 Tigers. This figure was based on a baseline global population of 3,200, agreed upon at a preparatory workshop held in Kathmandu, Nepal in October 2009; 3,200 Tigers was the IUCN Red List population estimate at that time. Since then, Tiger Range Countries have adjusted their baseline national Tiger estimates, finalized in the Global Tiger Recovery Program adopted at the International Tiger Forum in St Petersburg, Russia in November 2010 (GTRP 2010). These estimates now total approximately 4,000 adult Tigers (see Table, which updates the GTRP’s figure for India based on its most recent national census results [Jhala et al. 2011]).

However, estimates of the Tiger populations in 42 protected source sites where there is evidence of breeding total 2,154 Tigers (Walston et al. 2010a, modified from their 2,126 to include the most recent published estimates from Nepal of Tiger populations in Chitwan, Bardia and Shuklaphanta). Although this is not a complete estimate of the global Tiger population (for example, most Amur Tigers in Russia are found in unprotected areas), generally Tiger status outside the source sites is poor and poorly known. IUCN Guidelines (IUCN Standards and Petitions Subcommittee 2010) define population as the number of mature individuals, defined as “individuals known, estimated or inferred to be capable of reproduction.” While in general this refers to all reproductive-age adults in the population, the Guidelines also “stress that the intention of the definition of mature individuals is to allow the estimate of the number of mature individuals to take account of all the factors that may make a taxon more vulnerable than otherwise might be expected.” Tigers require large populations to persist, and the survival rate of breeding adult females is a key parameter, with models suggesting population declines when mortality of breeding females rises over 15% (Chapron et al. 2008). Population declines in recent years have been most pronounced outside protected areas (Walston et al. 2010b). The IUCN Guidelines advise that “mature individuals that will never produce new recruits should not be counted.” For the purposes of Red List assessment, the estimated population in the Source Sites is used as a proxy for the breeding population of adult Tigers.

In 1998, the global Tiger population was estimated, less rigorously, at 5,000 to 7,000 Tigers (Seidensticker et al. 1999). Although to some extent the new numbers represent improved knowledge, it is clear that there have been substantial population declines, with Tigers all but eliminated from much of their recent forest range, particularly in Southeast Asia.

Follow the link below for further information about national Tiger population estimates.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Illegal trade in high-value Tiger products including skins, bones, meat and tonics is a primary threat to Tigers, which has led to their recent disappearance from broad areas of otherwise suitable habitat, and continues at unsustainable rates.

Asia is a densely populated and rapidly developing region, bringing huge pressures to bear on the large wild areas required for viable Tiger populations. Conversion of forest land to agriculture and silviculture, commercial logging, and human settlement are the main drivers of Tiger habitat loss. With their substantial dietary requirements, Tigers require a healthy large ungulate prey base, but these species are also under heavy human subsistence hunting pressure and competition from domestic livestock.

Tiger attacks on livestock and people can lead to intolerance of Tigers by neighbouring communities and presents an ongoing challenge to managers to build local support for Tiger conservation. In some areas there have been many human deaths - for example, 41 people were killed by Tigers in the Sundarbans mangrove forest of Bangladesh during an 18-month period in 2001–2003 (Khan 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Human activities are the principal cause of declining tiger numbers. Hunting was a major cause of mortality in the past; both for trophies and as part of organised pest control measures (3). Poaching and illegal killing, for example by livestock owners, today remains one of the major threats to the survival of the species, particularly with the growing demand for tiger bones in Oriental 'medicine' (5). The demand for remedies made from tiger parts has increased due to increasing affluence in Asia, and laws preventing international trade in tiger parts are largely ignored. Hong Kong is the main importer of tiger products, with tiger bone the most used part. The bones are crushed to be used in anti-inflammatory drugs for rheumatism and arthritis, amongst many other uses. The trade in tiger skins is also increasing (11). Habitat loss has occurred through much of the tiger's range and also threatens survival; as land becomes rapidly developed to meet the increasing demand of the Asian population explosion (3), tiger populations become isolated in remaining fragments of wilderness and ultimately die out (2). The tiger's natural prey species have declined in numbers due to over-hunting, leading individuals to turn to domestic livestock, which inevitably causes conflict with local farmers (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In 2010, the Year of the Tiger on the Asian lunar calendar, Tigers were the focus of substantial conservation effort and investment. At a “Tiger Summit” held in St. Petersburg, Russia in November 2010, the 13 Tiger Range Countries adopted a Global Tiger Recovery Program (GTRP 2010). The goal is to effectively double the number of wild Tigers by 2022 through actions to: i) effectively preserve, manage, enhance and protect Tiger habitats; ii) eradicate poaching, smuggling and illegal trade of Tigers, their parts and derivatives; iii) cooperate in transboundary landscape management and in combating illegal trade; iv) engage with indigenous and local communities; v) increase the effectiveness of Tiger and habitat management; and vi) restore Tigers to their former range. The Tiger Summit was attended by Heads of State including Russia, China, Laos, Nepal and Bangladesh, and represents a policy commitment to Tiger conservation of unprecedented significance.

The future of Tiger range depends upon the Asian governments creating effective Tiger landscapes by conserving large areas of suitable habitat. Within these landscapes, the most urgent need is to first secure the source sites—protected areas with viable Tiger populations—where most of the global Tiger population is now clustered, and many of which are currently too threatened to deliver their potential as the wellspring of species recovery (Walston et al. 2010b).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The tiger is classified as Endangered by the IUCN (the World Conservation Union), and of the six surviving subspecies the futures of the South China tiger and the Siberian tiger seem particularly bleak. Recent extensive surveys resulted in no sightings (10). India has the greatest number of tigers but even the Bengal tiger population is estimated at no more than 3,000 to 3,500 individuals (3). TRAFFIC (the trade monitoring arm of the WWF and IUCN) monitors the level of international trade of tiger products and brings it to the attention of the relevant authorities (6). The Indian government established Project Tiger in 1973 (7) with the aim of conserving the tiger population. Within India there are currently 21 tiger reserves, although, these are increasingly threatened by human pressures on the land (3). The key to the survival of the tiger is the maintenance of large tracts of contiguous habitat, but protection of this species is complicated by its man-eater reputation and by the threat posed to livestock (2). The involvement and commitment of local people will be vital for the future sustainability of this most regal of cats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Normally tigers avoid human contact, very rarely tigers may become “man eaters”. A man-eating tigress was rumored to have killed over 430 people, including 234 over the course of four years. It is thought that man-eating tigers are those that cannot effectively prey on large ungulated because they have become crippled, are old, or no longer have suitable native habitat and prey available. Because human populations are rapidly increasing, competition over natural resources is increasing pressure on tigers and their habitat and increasing the likelihood of negative human-tiger interactions.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Live tigers are of economic importance in zoos where they are displayed to the public and in wildlife areas where they may bring in tourism. Tigers are illegally killed for their fur to make rugs and wall hangings. In addition, for more than 3000 years traditional Chinese medicine has used tiger parts to treat sickness and injury. The humerus (upper leg bone), for example, has been prescribed to treat rheumatism even though there is no evidence that it has any affect on the disease. Some believe that tiger bones will help them become as strong and ferocious as the tiger.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Endangered subspecies of tiger

There were nine subspecies of Tiger in the world: the Siberian Tiger, the South China Tiger, Indochinese Tiger, the Sumatran Tiger, the Bengal Tiger, the Malayan Tiger, the Balinese Tiger, the Javan Tiger, and the Caspian Tiger or Persian Tiger. Three of these nine subspecies of tiger have gone extinct in the last century and one of them is believed to become extinct in the near future because of human influences.[4] The historical range of these nine subspecies ranges from Russia to Siberia, Iran, Afghanistan, India, China and southeast Asia, and the Indonesian islands. Today though, with a third of the subspecies extinct, their range has greatly diminished.

Contents

Subspecies still existing

Siberian tiger

The Siberian tiger is also known as the Amur, Manchurian or North China tiger. It is the largest tiger. It is classified as endangered because its population is not sufficiently large enough for it to be sustainable. There are only 400 of these tigers in the wild, however many of these populations are no longer genetically viable so there is a very large chance of inbreeding. It practically only lives in a very restricted part of Eastern Russia. The Siberian tiger is by far the largest subspecies with its males as long as 10 feet, weighing approximately 800 pounds. This tiger can also be recognized for its thick coat that is pale gold and has very few stripes.

South China tiger

The South China tiger is also known as "Amoy" or "Xiamen" tiger. This subspecies of tiger is expected to become extinct and is currently in extremely critical danger. No live South China tiger has been seen in its natural habitat in the last 20 years, and the last known wild tiger was shot in 1994. In 1959, Chinese leader Mao Zedong declared the South China tiger a "pest," and the overall population of this subspecies quickly dropped from about 4,000 to 200 in only 17 years. In 1977, however, the Chinese government reversed this policy. Extinction is now considered inevitable because of a lack of genetic diversity; there are only 59 of these tigers captive in China, and they are all descended from the same six tigers.

Indochinese tiger

The Indochinese tiger is also known as the Corbett's tiger. It is found in Cambodia, China, Laos, Myanmar, Thailand, and Vietnam. The population of this tiger ranges from 800 to 1000, however it is more likely that it is in the lower part of this range. The Indochinese tiger now mainly exists in Malaysia where illegal poaching is very strictly controlled. In all the populations of this tiger, there are risks of inbreeding and they are at risk for habitat fragmentation. In Vietnam, two thirds of the tigers killed provide stock for Chinese pharmacies. These tigers are also used as resources to try and eliminate poverty.

Sumatran Tiger

The Sumatran Tiger is only found on the Indonesian Island of Sumatra and its population is estimated to be between 400 and 500 animals. If it is not made extinct it is believed that this species of tiger will evolve into a separate species because in recent genetic testing, unique genetic markers have been revealed. This gives the Sumatran tiger a greater chance of conservation that any other subspecies. This tigers major threat is habitat destruction, and also shootings which killed almost 20% of this subspecies population in only 2 years.[citation needed]

Bengal Tiger

The Bengal Tiger is also known as the Royal Bengal Tiger. It is found in the Sunderbans, which is a national forest of Bangladesh and West Bengal in India. The Bengal tiger is the national animal of both Bangladesh and India. Of all the subspecies of tiger. The Bengal Tiger has the biggest population.

Malayan Tiger

The Malayan Tiger is found in the southern part of the Malay Peninsula. Up until 2004 the Malayan tiger wasn't considered a subspecies in its own right. It became classified as a subspecies after a study from the Laboratory of Genomic Diversity, which is part of the National Cancer Institute, US. Other than the Bengal Tiger, the Malayan Tiger had the population ranging from 600-800 in the wild.

Extinct Subspecies

Balinese Tiger

The Balinese Tiger once lived on the island of Bali, however it was hunted to extinction. It is believed that the last tiger was killed at Sumbar Kima, West Bali on September 27 in 1937 and that it was an adult female. This tiger to this day plays an important role in Balinese Hindu religion. It has never been held in captivity.

Javan Tiger

The Javan Tiger once lived on the Indonesian island of Java. It was made extinct anywhere from the 1950s to the 1980s because its habitat was destroyed and it was hunted. It is believed that the last tiger was spotted in 1979.

Caspian Tiger

The Caspian Tiger was also known as the Persian tiger. It was yellow with black stripes. It either became extinct in the late 1960s with the last sighting in 1968 or in 1970 when it is claimed that the last one was shot in south-eastern-most Turkey. This tiger lived in Afghanistan, Iran, Iraq, Pakistan, the former Soviet Union and Turkey.

See also

References

  1. ^ Chundawat, R.S., Habib, B., Karanth, U., Kawanishi, K., Ahmad Khan, J., Lynam, T., Miquelle, D., Nyhus, P., Sunarto, Tilson, R. & Sonam Wang (2008). Panthera tigris. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 9 October 2008.
  2. ^ "Wild Tiger Conservation". Save The Tiger Fund. http://www.savethetigerfund.org. Retrieved 2009-03-07. 
  3. ^ Linnaeus, Carolus (1758). Systema naturae per regna tria naturae:secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis.. 1 (10th ed.). Holmiae (Laurentii Salvii). p. 41. http://www.biodiversitylibrary.org/page/726936. Retrieved 2008-09-08. 
  4. ^ http://www.catchannel.com/Magazines/CatFancy/april-2008/tiger-subspecies.aspx, Tiger Subspecies, Brad Collus, BowTie Inc., 2009, 10/18/09
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Tiger

The tiger (Panthera tigris) is the largest cat species, reaching a total body length of up to 3.3 metres (11 ft) and weighing up to 306 kg (670 lb). Their most recognizable feature is a pattern of dark vertical stripes on reddish-orange fur with lighter underparts. They have exceptionally stout teeth, and their canines are the longest among living felids with a crown height of as much as 74.5 mm (2.93 in) or even 90 mm (3.5 in).[4] In zoos, tigers have lived for 20 to 26 years, which also seems to be their longevity in the wild.[5] They are territorial and generally solitary but social animals, often requiring large contiguous areas of habitat that support their prey requirements. This, coupled with the fact that they are indigenous to some of the more densely populated places on Earth, has caused significant conflicts with humans.

Tigers once ranged widely across Asia, from Turkey in the west to the eastern coast of Russia. Over the past 100 years, they have lost 93% of their historic range, and have been extirpated from southwest and central Asia, from the islands of Java and Bali, and from large areas of Southeast and Eastern Asia. Today, they range from the Siberian taiga to open grasslands and tropical mangrove swamps. The remaining six tiger subspecies have been classified as endangered by IUCN. The global population in the wild is estimated to number between 3,062 to 3,948 individuals, with most remaining populations occurring in small pockets that are isolated from each other. Major reasons for population decline include habitat destruction, habitat fragmentation and poaching.[1] The extent of area occupied by tigers is estimated at less than 1,184,911 km2 (457,497 sq mi), a 41% decline from the area estimated in the mid-1990s.[6]

Tigers are among the most recognisable and popular of the world's charismatic megafauna. They have featured prominently in ancient mythology and folklore, and continue to be depicted in modern films and literature. Tigers appear on many flags, coats of arms, and as mascots for sporting teams.[7] The Bengal tiger is the national animal of Bangladesh and India.[8]

Contents

Taxonomy and etymology

In 1758, Linnaeus first described the species in his work Systema Naturae under the scientific name Felis tigris.[3] In 1929, the British taxonomist Reginald Innes Pocock subordinated the species under the genus Panthera using the scientific name Panthera tigris.[9]

The word Panthera is probably of Oriental origin and retraceable to the Ancient Greek word panther, the Latin word panthera, the Old French word pantere, most likely meaning "the yellowish animal", or from pandarah meaning whitish-yellow. The derivation from Greek pan- ("all") and ther ("beast") may be folk etymology that led to many curious fables.[10]

The word "tiger" is retraceable to the Latin word tigris meaning a spotted tigerhound of Actaeon.[11] The Greek word tigris is possibly derived from a Persian source.[12]

Range of the tiger in 1900 and 1990

Characteristics and evolution

The oldest remains of a tiger-like cat, called Panthera palaeosinensis, have been found in China and Java. This species lived about 2 million years ago, at the beginning of the Pleistocene, and was smaller than a modern tiger. The earliest fossils of true tigers are known from Java, and are between 1.6 and 1.8 million years old. Distinct fossils from the early and middle Pleistocene were also discovered in deposits from China, and Sumatra. A subspecies called the Trinil tiger (Panthera tigris trinilensis) lived about 1.2 million years ago and is known from fossils found at Trinil in Java.[13]

Tigers first reached India and northern Asia in the late Pleistocene, reaching eastern Beringia (but not the American Continent), Japan, and Sakhalin. Fossils found in Japan indicate that the local tigers were, like the surviving island subspecies, smaller than the mainland forms. This may be due to the phenomenon in which body size is related to environmental space (see insular dwarfism), or perhaps the availability of prey. Until the Holocene, tigers also lived in Borneo, as well as on the island of Palawan in the Philippines.[14]

Characteristics

Siberian tiger

Tigers have muscular bodies with particularly powerful forelimbs and large heads. The pelage coloration varies between shades of orange or brown with white ventral areas and distinctive black stripes. The face has long whiskers, which are especially long in males. The pupils are circular with yellow irises. The small, rounded ears have black markings on the back, surrounding a white spot.[4] These spots, called ocelli, play an important role in intraspecific communication.[15]

The pattern of stripes is unique to each animal, these unique markings can be used by researchers to identify individuals (both in the wild and captivity), much in the same way that fingerprints are used to identify humans. It seems likely that the function of stripes is camouflage, serving to help tigers conceal themselves amongst the dappled shadows and long grass of their environment as they stalk their prey. The stripe pattern is also found on the skin of the tiger. If a tiger were to be shaved, its distinctive camouflage pattern would be preserved.

Skeleton

The tiger are the most variable in size of all big cats, even more so than the leopard and much more so than lions.[16] The Bengal, Caspian and Siberian tiger subspecies represent the largest living felids, and rank among the biggest felids that ever existed. Females vary in size from 240 to 275 cm (94 to 108 in), weigh 85 to 167 kg (190 to 370 lb) with a greatest length of skull ranging from 268 to 318 mm (10.6 to 12.5 in). Males vary in size from 270 to 330 cm (110 to 130 in), weigh 170 to 306 kg (370 to 670 lb) with a greatest length of skull ranging from 316 to 383 mm (12.4 to 15.1 in). Body size of different populations seems to be correlated with climate—Bergmann's Rule—and can be explained from the point of view of thermoregulation.[4] Large male Siberian tigers can reach a total length of more than 3.5 m (11 ft) "over curves", 3.3 m (11 ft) "between pegs" and a weight of 306 kg (670 lb). This is considerably larger than the size reached by the smallest living tiger subspecies, the Sumatran tiger, which reach a body weight of 75 to 140 kg (170 to 310 lb). At the shoulder, tigers may variously stand 0.7 to 1.22 m (2.3 to 4.0 ft) tall.[5]

Tigresses are smaller than the males in each subspecies, although the size difference between male and female tigers tends to be more pronounced in the larger tiger subspecies, with males weighing up to 1.7 times more than the females.[17] In addition, male tigers have wider forepaw pads than females. Biologists use this difference to determine gender based on tiger tracks.[18] The skull of the tiger is very similar to that of the lion, though the frontal region is usually not as depressed or flattened, with a slightly longer postorbital region. The skull of a lion has broader nasal openings. However, due to the amount of skull variation in the two species, usually, only the structure of the lower jaw can be used as a reliable indicator of species.[19]

Subspecies

A Bengal tiger with a cub.

There are nine subspecies of tiger, three of which are extinct. Their historical range in Bangladesh, Siberia, Iran, Afghanistan, India, China, and southeast Asia, including three Indonesian islands is severely diminished today. The surviving subspecies, in descending order of wild population, are:

  • The Bengal tiger (Panthera tigris tigris) lives in India, Nepal, Bhutan and Bangladesh, and is the most common subspecies with populations estimated at less than 2,500 adult individuals. In 2011 the total population of adult tigers is estimated at 1,520–1,909 in India, 440 in Bangladesh, 155 in Nepal and 75 in Bhutan.[20] It lives in alluvial grasslands, subtropical and tropical rainforests, scrub forests, wet and dry deciduous forests, and mangroves. Male Bengal tigers had a total length, including the tail, of 270 to 310 cm (110 to 120 in), while females range from 240 to 265 cm (94 to 104 in). The weight of males range from 175 to 260 kg (390 to 570 lb), while that of the females range from 100 to 181 kg (220 to 400 lb).[4][21] In northern India and Nepal, tigers tend to be of larger size. Males often average 235 kilograms (520 lb), while females average 141 kilograms (310 lb).[22] In 1972, Project Tiger was founded in India aiming at ensuring a viable population of tigers in the country and preserving areas of biological importance as a natural heritage for the people.[23] But the illicit demand for bones and body parts from wild tigers for use in Traditional Chinese medicine is the reason for the unrelenting poaching pressure on tigers on the Indian subcontinent.[24] Between 1994 and 2009, the Wildlife Protection Society of India has documented 893 cases of tigers killed in India, which is just a fraction of the actual poaching and illegal trade in tiger parts during those years.[25] An area of special conservation interest lies in the Terai Arc Landscape in the Himalayan foothills of northern India and southern Nepal, where 11 protected areas comprising dry forest foothills and tall grass savannas harbor tigers in a 49,000 square kilometres (19,000 sq mi) landscape. The goals are to manage tigers as a single metapopulation, the dispersal of which between core refuges can help maintain genetic, demographic, and ecological integrity, and to ensure that species and habitat conservation becomes mainstreamed into the rural development agenda. In Nepal, a community-based tourism model has been developed with a strong emphasis on sharing benefits with local people and on the regeneration of degraded forests. The approach has been successful in reducing poaching, restoring habitats, and creating a local constituency for conservation.[26]
  • The Indochinese Tiger (Panthera tigris corbetti), also called Corbett's tiger, is found in Cambodia, China, Laos, Burma, Thailand, and Vietnam. These tigers are smaller and darker than Bengal tigers: Males weigh from 150–190 kg (330–420 lb) while females are smaller at 110–140 kg (240–310 lb). Their preferred habitat is forests in mountainous or hilly regions. According to government estimates of national tiger populations, the subspecies numbers around a total of 350 individuals.[27] All existing populations are at extreme risk from poaching, prey depletion as a result of poaching of primary prey species such as deer and wild pigs, habitat fragmentation and inbreeding. In Vietnam, almost three-quarters of the tigers killed provide stock for Chinese pharmacies.
  • The Malayan Tiger (Panthera tigris jacksoni), exclusively found in the southern part of the Malay Peninsula, was not considered a subspecies in its own right until 2004. The new classification came about after a study by Luo et al. from the Laboratory of Genomic Diversity Study,[28] part of the National Cancer Institute of the United States. According to official government figures, the population in the wild may number around 500 individuals, but is under considerable poaching pressure. The Malayan tiger is the smallest of the mainland tiger subspecies, and the second smallest living subspecies, with males averaging about 120 kg and females about 100 kg in weight. The Malayan tiger is a national icon in Malaysia, appearing on its coat of arms and in logos of Malaysian institutions, such as Maybank.
  • The Sumatran Tiger (Panthera tigris sumatrae) is found only on the Indonesian island of Sumatra, and is critically endangered.[29] It is the smallest of all living tiger subspecies, with adult males weighing between 100–140 kg (220–310 lb) and females 75–110 kg (170–240 lb).[30] Their small size is an adaptation to the thick, dense forests of the island of Sumatra where they reside, as well as the smaller-sized prey. The wild population is estimated at between 400 and 500, seen chiefly in the island's national parks. Recent genetic testing has revealed the presence of unique genetic markers, indicating that it may develop into a separate species,[specify] if it does not go extinct.[31] This has led to suggestions that Sumatran tigers should have greater priority for conservation than any other subspecies. While habitat destruction is the main threat to existing tiger population (logging continues even in the supposedly protected national parks), 66 tigers were recorded as being shot and killed between 1998 and 2000, or nearly 20% of the total population.
  • The Siberian tiger (Panthera tigris altaica), also known as the Amur tiger, inhabits the Amur-Ussuri region of Primorsky Krai and Khabarovsk Krai in far eastern Siberia.[32] It ranks among the biggest felids that have ever existed with a head and body length of 160–180 cm (63–71 in) for females and 190–230 cm (75–91 in) for males, plus a tail of about 60–110 cm (24–43 in) and an average weight of around 227 kg (500 lb) for males. Siberian tigers have thick coats and a paler golden hue and fewer stripes.[4] The heaviest wild Siberian tiger weighed 384 kg (850 lb) but according to Mazák this record is not reliable.[5] In 2005, there were 331–393 adult-subadult Siberian tigers in the region, with a breeding adult population of about 250 individuals. The population has been stable for more than a decade, but partial surveys conducted after 2005 indicate that the Russian tiger population is declining.[33] At the turn of the century, the phylogenetic relationships of tiger subspecies was re-assessed, and a remarkable similarity between the Siberian and Caspian tiger observed indicating that the Siberian tiger population is the genetically closest living relative of the extinct Caspian tiger, and strongly implying a very recent common ancestry for the two groups.[34]
  • The South China tiger (Panthera tigris amoyensis), also known as the Amoy or Xiamen tiger, is the most critically endangered subspecies of tiger and is listed as one of the 10 most endangered animals in the world.[35] One of the smaller tiger subspecies, the length of the South China tiger ranges from 2.2–2.6 m (87–100 in) for both males and females. Males weigh between 127 and 177 kg (280 and 390 lb) while females weigh between 100 and 118 kg (220 and 260 lb). From 1983 to 2007, no South China tigers were sighted.[36] In 2007 a farmer spotted a tiger and handed in photographs to the authorities as proof.[36][37] The photographs in question, however, were later exposed as fake, copied from a Chinese calendar and digitally altered, and the "sighting" turned into a massive scandal.[38][39][40]
    In 1977, the Chinese government passed a law banning the killing of wild tigers, but this may have been too late to save the subspecies, since it is possibly already extinct in the wild. There are currently 59 known captive South China tigers, all within China, but these are known to be descended from only six animals. Thus, the genetic diversity required to maintain the subspecies may no longer exist.[citation needed] Currently, there are breeding efforts to reintroduce these tigers to the wild.[citation needed]

Extinct subspecies

A hunted down Bali tiger
A photograph of a Javan tiger.
  • The Bali tiger (Panthera tigris balica) was limited to the Indonesian island of Bali, and was the smallest subspecies with a weight of 90–100 kg (200–220 lb) in males and 65–80 kg (140–180 lb) in females.[5] Bali tigers were hunted to extinction — the last Bali tiger, an adult female, is thought to have been killed at Sumbar Kima, West Bali on 27 September 1937. There is no Bali tiger in captivity. The tiger still plays an important role in Balinese Hinduism.
  • The Caspian tiger (Panthera tigris virgata), also known as the Hyrcanian tiger or Turan tiger was found in the sparse forest habitats and riverine corridors west and south of the Caspian Sea and west through Central Asia into the Takla-Makan desert of Xinjiang, and has been recorded in the wild until the early 1970s.[41] The Amur tiger is the genetically closest living relative of the Caspian tiger.[34]
  • The Javan tiger (Panthera tigris sondaica) was limited to the island of Java, and has been recorded until the mid-1970s.[42] Javan tigers were larger than Bali tigers; males weighed 100–140 kg (220–310 lb) and females 75–115 kg (170–250 lb).[43] After 1979, there were no more confirmed sightings in the region of Mount Betiri.[44] An expedition to Mount Halimun Salak National Park in 1990 did not yield any definite, direct evidence for the continued existence of tigers.[45]

Hybrids

Hybridisation among the big cats, including the tiger, was first conceptualised in the 19th century, when zoos were particularly interested in the pursuit of finding oddities to display for financial gain.[46] Lions have been known to breed with tigers (most often the Amur and Bengal subspecies) to create hybrids called ligers and tigons.[47] Such hybrids were once commonly bred in zoos, but this is now discouraged due to the emphasis on conserving species and subspecies. Hybrids are still bred in private menageries and in zoos in China.

The liger is a cross between a male lion and a tigress.[48] Because the lion sire passes on a growth-promoting gene, but the corresponding growth-inhibiting gene from the female tiger is absent, ligers grow far larger than either parent. They share physical and behavioural qualities of both parent species (spots and stripes on a sandy background). Male ligers are sterile, but female ligers are often fertile. Males have about a 50% chance of having a mane, but, even if they do, their manes will be only around half the size of that of a pure lion. Ligers are typically between 10 to 12 feet in length, and can be between 800 and 1,000 pounds or more.[48]

The less common tigon is a cross between the lioness and the male tiger.[49]

Colour variations

White tigers

A Bengal white tiger in Bannerghatta National Park in Bangalore
A pair of white tigers at the Singapore Zoo.

There is a well-known allele that produces the white tiger, technically known as chinchilla albinistic,[50] an animal which is rare in the wild, but widely bred in zoos due to its popularity. Breeding of white tigers will often lead to inbreeding (as the trait is recessive). Many initiatives have taken place in white and orange tiger mating in an attempt to remedy the issue, often mixing subspecies in the process. Such inbreeding has led to white tigers having a greater likelihood of being born with physical defects, such as cleft palates and scoliosis (curvature of the spine).[51][52] Furthermore, white tigers are prone to having crossed eyes (a condition known as strabismus). Even apparently healthy white tigers generally do not live as long as their orange counterparts. Recordings of white tigers were first made in the early 19th century.[53] They can only occur when both parents carry the rare gene found in white tigers; this gene has been calculated to occur in only one in every 10,000 births. The white tiger is not a separate sub-species, but only a colour variation; since the only white tigers that have been observed in the wild have been Bengal tigers[54] (and all white tigers in captivity are at least part Bengal), it is commonly thought that the recessive gene that causes the white colouring is probably carried only by Bengal tigers, although the reasons for this are not known.[51][55] Nor are they in any way more endangered than tigers are generally, this being a common misconception. Another misconception is that white tigers are albinos, despite the fact that pigment is evident in the white tiger's stripes. They are distinct not only because of their white hue; they also have blue eyes.

Golden tigers

A rare golden tiger at the Buffalo Zoo.

In addition, another recessive gene may create a very unusual "golden" or "golden tabby" colour variation, sometimes known as "strawberry." Golden tigers have light gold fur, pale legs and faint orange stripes. Their fur tends to be much thicker than normal.[56] There are extremely few golden tigers in captivity, around 30 in all. Like white tigers, golden tigers are invariably at least part Bengal. Some golden tigers carry the white tiger gene, and when two such tigers are mated, can produce some stripeless white offspring. Both white and golden tigers tend to be larger than average Bengal tigers.

Other colour variations

There is no authenticated case of a black tiger, with the possible exception of one dead specimen examined in Chittagong in 1846.[57] There are unconfirmed reports of a "blue" or slate-coloured tiger, the Maltese tiger. Largely or totally black tigers are assumed, if real, to be intermittent mutations rather than distinct species.[50]

Distribution and habitat

In the past, tigers were found throughout Asia, from the Caucasus and the Caspian Sea to Siberia and the Indonesian islands of Java, Bali and Sumatra. During the 20th century, tigers have been extirpated in western Asia and became restricted to isolated pockets in the remaining parts of their range. Today, their fragmented and partly degraded range extends from India in the west to China and Southeast Asia. The northern limit of their range is close to the Amur River in south eastern Siberia. The only large island inhabited by tigers today is Sumatra.[1]

Tigers were extirpated on the island of Bali in the 1940s, around the Caspian Sea in the 1970s, and on Java in the 1980s. Loss of habitat and the persistent killing of tigers and tiger prey precipitated these extirpations, a process that continues to leave forests devoid of tigers and other large mammals across South and Southeast Asia. Since the beginning of the 21st century, their historical range has shrunk by 93%. In the decade from 1997 to 2007, the estimated area known to be occupied by tigers has declined by 41%.[2]

Fossil remains indicate that tigers were present in Borneo and Palawan in the Philippines during the late Pleistocene and Holocene.[58][59]

Tiger habitats will usually include sufficient cover, proximity to water, and an abundance of prey. Bengal tigers live in many types of forests, including wet, evergreen, the semi-evergreen of Assam and eastern Bengal; the mangrove forest of the Ganges Delta; the deciduous forest of Nepal, and the thorn forests of the Western Ghats. Compared to the lion, the tiger prefers denser vegetation, for which its camouflage colouring is ideally suited, and where a single predator is not at a disadvantage compared with the multiple felines in a pride.

Biology and behaviour

Territorial behaviour

Adult tigers lead solitary lives and congregate only on an ad hoc and transitory basis when special conditions permit, such as plentiful supply of food. They establish and maintain home ranges. Resident adults of either sex tend to confine their movements to a definite area of habitat, within which they satisfy their needs, and in the case of tigresses, those of their growing cubs. Those sharing the same ground are well aware of each other's movements and activities.[57]

The size of a tiger's home range mainly depends on prey abundance, and, in the case of male tigers, on access to females. A tigress may have a territory of 20 km2 (7.7 sq mi), while the territories of males are much larger, covering 60 to 100 km2 (23 to 39 sq mi). The range of a male tends to overlap those of several females.[citation needed]

Tigers are strong swimmers, and are often found bathing in ponds, lakes, and rivers. During the extreme heat of the day, they often cool off in pools. They are able to carry prey through the water.

Tigers for the most part are solitary animals.

The relationships between individuals can be quite complex, and it appears that there is no set "rule" that tigers follow with regards to territorial rights and infringing territories. For instance, although for the most part tigers avoid each other, both male and female tigers have been documented sharing kills. George Schaller observed a male tiger share a kill with two females and four cubs. Females are often reluctant to let males near their cubs, but Schaller saw that these females made no effort to protect or keep their cubs from the male, suggesting that the male might have been the father of the cubs. In contrast to male lions, male tigers will allow the females and cubs to feed on the kill first. Furthermore, tigers seem to behave relatively amicably when sharing kills, in contrast to lions, which tend to squabble and fight. Unrelated tigers have also been observed feeding on prey together. The following quotation is from Stephen Mills' book Tiger, as he describes an event witnessed by Valmik Thapar and Fateh Singh Rathore in Ranthambhore National Park:[60]

A dominant tigress they called Padmini killed a 250 kg (550 lb) male nilgai – a very large antelope. They found her at the kill just after dawn with her three 14-month-old cubs and they watched uninterrupted for the next ten hours. During this period the family was joined by two adult females and one adult male – all offspring from Padmini's previous litters and by two unrelated tigers, one female the other unidentified. By three o'clock there were no fewer than nine tigers round the kill.

When young female tigers first establish a territory, they tend to do so fairly close to their mother's area. The overlap between the female and her mother's territory tends to wane with increasing time. Males, however, wander further than their female counterparts, and set out at a younger age to mark out their own area. A young male will acquire territory either by seeking out a range devoid of other male tigers, or by living as a transient in another male's territory until he is old and strong enough to challenge the resident male. The highest mortality rate (30–35% per year) amongst adult tigers occurs for young male tigers who have just left their natal area, seeking out territories of their own.[60]

Two male Bengal tiger siblings play with each other in the Pilibhit Tiger Reserve, India.
Tiger dentition (above), compared with that of an Asian black bear (below). The large canines are used to make the killing bite, but they tear meat when feeding using the carnassial teeth.

Male tigers are generally more intolerant of other males within their territory than females are of other females. For the most part, however, territorial disputes are usually solved by displays of intimidation, rather than outright aggression. Several such incidents have been observed, in which the subordinate tiger yielded defeat by rolling onto its back, showing its belly in a submissive posture.[61] Once dominance has been established, a male may actually tolerate a subordinate within his range, as long as they do not live in too close quarters.[60] The most violent disputes tend to occur between two males when a female is in oestrus, and may result in the death of one of the males, although this is a rare occurrence.[60][61]

To identify his territory, the male marks trees by spraying of urine and anal gland secretions, as well as marking trails with scat. Males show a grimacing face, called the Flehmen response, when identifying a female's reproductive condition by sniffing their urine markings. Like the other Panthera cats, tigers can roar. Tigers will roar for both aggressive and non-aggressive reasons. Other tiger vocal communications include moans, hisses, growls and chuffs.

Tigers have been studied in the wild using a variety of techniques. The populations of tigers were estimated in the past using plaster casts of their pugmarks. This method was criticized as being inaccurate.[62] Attempts were made to use camera trapping instead. Newer techniques based on DNA from their scat are also being evaluated. Radio collaring has also been a popular approach to tracking them for study in the wild.

Hunting and diet

In the wild, tigers mostly feed on larger and medium sized animals. Sambar, gaur, chital, barasingha, wild boar, nilgai and both water buffalo and domestic buffalo are the tiger's favoured prey in India. Sometimes, they also prey on leopards, pythons, sloth bears and crocodiles. In Siberia the main prey species are manchurian wapiti, wild boar, sika deer, moose, roe deer, and musk deer. In Sumatra, sambar, muntjac, wild boar, and malayan tapir are preyed on. In the former Caspian tiger's range, prey included saiga antelope, camels, caucasian wisent, yak, and wild horses. Like many predators, they are opportunistic and will eat much smaller prey, such as monkeys, peafowls, hares, and fish.

Adult elephants are too large to serve as common prey, but conflicts between tigers and elephants do sometimes take place. A case where a tiger killed an adult Indian Rhinoceros has been observed. Young elephant and rhino calves are occasionally taken. Tigers also sometimes prey on domestic animals such as dogs, cows, horses, and donkeys. These individuals are termed cattle-lifters or cattle-killers in contrast to typical game-killers.[63]

Old tigers, or those wounded and rendered incapable of catching their natural prey, have turned into man-eaters; this pattern has recurred frequently across India. An exceptional case is that of the Sundarbans, where healthy tigers prey upon fishermen and villagers in search of forest produce, humans thereby forming a minor part of the tiger's diet.[64] Tigers will occasionally eat vegetation for dietary fiber, the fruit of the Slow Match Tree being favoured.[63]

Tiger with kill

Tigers are thought to be nocturnal predators, hunting at night.[65] However, in areas where humans are absent, they have been observed via remote controlled, hidden cameras hunting during the daylight hours.[66] They generally hunt alone and ambush their prey as most other cats do, overpowering them from any angle, using their body size and strength to knock large prey off balance. Even with their great masses, tigers can reach speeds of about 49–65 kilometres per hour (35–40 miles per hour), although they can only do so in short bursts, since they have relatively little stamina; consequently, tigers must be relatively close to their prey before they break their cover. Tigers have great leaping ability; horizontal leaps of up to 10 metres have been reported, although leaps of around half this amount are more typical. However, only one in twenty hunts ends in a successful kill.[65]

When hunting large prey, tigers prefer to bite the throat and use their forelimbs to hold onto the prey, bringing it to the ground. The tiger remains latched onto the neck until its prey dies of strangulation.[15] By this method, gaurs and water buffalos weighing over a ton have been killed by tigers weighing about a sixth as much.[67] With small prey, the tiger bites the nape, often breaking the spinal cord, piercing the windpipe, or severing the jugular vein or common carotid artery.[68] Though rarely observed, some tigers have been recorded to kill prey by swiping with their paws, which are powerful enough to smash the skulls of domestic cattle,[63] and break the backs of sloth bears.[69]

During the 1980s, a tiger named "Genghis" in Ranthambhore National Park was observed frequently hunting prey through deep lake water,[70] a pattern of behaviour that had not been previously witnessed in over 200 years of observations. Moreover, he appeared to be extraordinarily successful for a tiger, with as many as 20% of hunts ending in a kill.

Reproduction

A tigress with her cubs in the Kanha Tiger Reserve, India.
A Bengal tigress with her cubs at the Bandhavgarh National Park, India

Mating can occur all year round, but is generally more common between November and April.[71] A female is only receptive for a few days and mating is frequent during that time period. A pair will copulate frequently and noisily, like other cats. The gestation period is 16 weeks. The litter size usually consists of around 3–4 cubs of about 1 kilogram (2.2 lb) each, which are born blind and helpless. The females rear them alone, sheltering them in dens such as thickets and rocky crevices. The father of the cubs generally takes no part in rearing them. Unrelated wandering male tigers may even kill cubs to make the female receptive, since the tigress may give birth to another litter within 5 months if the cubs of the previous litter are lost.[71] The mortality rate of tiger cubs is fairly high – approximately half do not survive to be more than two years old.[71]

There is generally a dominant cub in each litter, which tends to be male but may be of either sex.[70] This cub generally dominates its siblings during play and tends to be more active, leaving its mother earlier than usual. At 8 weeks, the cubs are ready to follow their mother out of the den, although they do not travel with her as she roams her territory until they are older. The cubs become independent around 18 months of age, but it is not until they are around 2–2½ years old that they leave their mother. Females reach sexual maturity at 3–4 years, whereas males reach sexual maturity at 4–5 years.[71]

Over the course of her life, a female tiger will give birth to an approximately equal number of male and female cubs. Tigers breed well in captivity, and the captive population in the United States may rival the wild population of the world.[72]

Interspecific predatory relationships

Tiger hunted by wild dogs (dholes) as illustrated in Samuel Howett & Edward Orme, Hand Coloured, Aquatint Engravings, Published London 1807.

Tigers may kill such formidable predators as leopards, pythons and even crocodiles on occasion,[73][74][75] although predators typically avoid one another. When seized by a crocodile, a tiger will strike at the reptile's eyes with its paws.[63] Eighteenth century Physician Oliver Goldsmith described the frequent conflicts between mugger crocodiles and tigers that occurred during that time. Thirsty tigers would frequently descend to the rivers to drink and on occasion were seized and killed by the muggers, though more often the tiger escaped and the reptile was disabled.[76] Leopards dodge competition from tigers by hunting in different times of the day and hunting different prey.[77] With relatively abundant prey, tigers and leopards were seen to successfully coexist without competitive exclusion or inter-species dominance hierarchies that may be more common to the savanna.[78] Tigers have been known to suppress wolf populations in areas where the two species coexist.[79][80] Dhole packs have been observed to attack and kill tigers in disputes over food, though not usually without heavy losses.[69] Lone golden jackals expelled from their pack have been known to form commensal relationships with tigers. These solitary jackals, known as kol-bahl, will attach themselves to a particular tiger, trailing it at a safe distance in order to feed on the big cat's kills. A kol-bahl will even alert a tiger to a kill with a loud pheal. Tigers have been known to tolerate these jackals: one report describes how a jackal confidently walked in and out between three tigers walking together a few feet away from each other.[81] Siberian tigers and brown bears can be competitors and usually avoid confrontation; however, tigers will kill bear cubs and even some adults on occasion. Bears (Asiatic black bears and brown bears) make up 5–8% of the tiger's diet in the Russian Far East.[5] There are also a few records of brown bears killing tigers, either in self defense or in disputes over kills.[19] Some bears emerging from hibernation will try to steal tigers' kills, although the tiger will sometimes defend its kill. Sloth bears are quite aggressive and will sometimes drive young tigers away from their kills, although it is more common for Bengal tigers to prey on sloth bears.[5]

Conservation efforts

Poaching for fur and destruction of habitat have greatly reduced tiger populations in the wild. At the start of the 20th century, it is estimated there were over 100,000 tigers in the world but the population has dwindled to between 1,500 and 3,500 in the wild.[82] Demand for tiger parts for the purposes of Traditional Chinese Medicine has also been cited as a threat to tiger populations.[83][84] Some estimates suggest that there are less than 2,500 mature breeding individuals, with no subpopulation containing more than 250 mature breeding individuals.[1]

India

A Bengal tiger in a national park in southern India. Indian officials successfully reintroduced two Bengal tigers in the Sariska Tiger Reserve in July 2008.[85]

India is home to the world's largest population of tigers in the wild.[86] According to the World Wildlife Fund, of the 3,500 tigers around the world, 1,400 are found in India. Only 11% of original Indian tiger habitat remains, and it is becoming significantly fragmented and often degraded.[87][88]

A major concerted conservation effort, known as Project Tiger, has been underway since 1973, initially spearheaded by Indira Gandhi. The fundamental accomplishment has been the establishment of over 25 well-monitored tiger reserves in reclaimed land where human development is categorically forbidden. The program has been credited with tripling the number of wild Bengal tigers from roughly 1,200 in 1973 to over 3,500 in the 1990s. However, a tiger census carried out in 2007, whose report was published on February 12, 2008, stated that the wild tiger population in India declined by 60% to approximately 1,411.[89] It is noted in the report that the decrease of tiger population can be attributed directly to poaching.[90]

An Indian Tiger at Guwahati Zoo in Assam, India.

Following the release of the report, the Indian government pledged $153 million to further fund the Project Tiger initiative, set up a Tiger Protection Force to combat poachers, and fund the relocation of up to 200,000 villagers to minimise human-tiger interaction.[91] Additionally, eight new tiger reserves in India were set up.[92] Indian officials successfully started a project to reintroduce the tigers into the Sariska Tiger Reserve.[93] The Ranthambore National Park is often cited as a major success by Indian officials against poaching.[94]

Tigers Forever is a collaboration between the Wildlife Conservation Society and Panthera Corporation to serve as both a science-based action plan and a business model to ensure that tigers live in the wild forever. Initial field sites of Tigers Forever include the world's largest tiger reserve, the 21,756 km2 (8,400 sq mi) Hukaung Valley in Myanmar, the Western Ghats in India, Thailand's Huai Khai Khaeng-Thung Yai protected areas, and other sites in Laos PDR, Cambodia, the Russian Far East and China covering approximately 260,000 km2 (100,000 sq mi) of critical tiger habitat.[95]

Russia

Tiger headcount in 1990

The Siberian tiger was on the brink of extinction with only about 40 animals in the wild in the 1940s. Under the Soviet Union, anti-poaching controls were strict and a network of protected zones (zapovedniks) were instituted, leading to a rise in the population to several hundred. Poaching again became a problem in the 1990s, when the economy of Russia collapsed, local hunters had access to a formerly sealed off lucrative Chinese market, and logging in the region increased. While an improvement in the local economy has led to greater resources being invested in conservation efforts, an increase of economic activity has led to an increased rate of development and deforestation. The major obstacle in preserving the species is the enormous territory individual tigers require (up to 450 km2 needed by a single female and more for a single male).[96] Current conservation efforts are led by local governments and NGO's in consort with international organisations, such as the World Wide Fund and the Wildlife Conservation Society.[97] The competitive exclusion of wolves by tigers has been used by Russian conservationists to convince hunters in the Far East to tolerate the big cats, as they limit ungulate populations less than wolves, and are effective in controlling the latter's numbers.[98] Currently, there are about 400–550 animals in the wild.

Tibet

The trade in tiger skins is illegal in the People's Republic of China, of which Tibet is a part. However, the law banning the trade in endangered animal parts is not enforced in Tibet. An undercover investigation in 2000 by the Wildlife Protection Society of India produced much news about the tiger skin trade and pictures of Tibetans wearing tiger skins. The tigers poached for their skins, subsequent investigations found, originated in India, in a "highly sophisticated" smuggling operation that crossed through Nepal, that "had less to do with old customs than new money" and even attracted European tourists for the tiger skin products of Lhasa. When in 2005, officials in Tibet intercepted "32 tiger, 579 leopard and 665 otter skins", the 14th Dalai Lama called on exiled Tibetans, who are involved in the trade, to cease their activity.[99] The 14th Dalai Lama had spoken out about wearing furs before, but he repeated his condemnation during the 2006 Kalachakra festival in India to expatriate Tibetans.[100] Afterwards, the Dalai Lama issued a press release claiming to have received video of Tibetans burning their animal skin coats, and reports of arrests of eight Tibetans involved for conspiring with the Dalai Lama's government.[101]

Population estimate

The global wild tiger population is estimated at anywhere between 3,062 and 3,948 individuals. The World Wide Fund for Nature estimates the tiger population at 3,200.[102] The exact number of wild tigers is unknown, as many estimates are outdated or come from educated guesses. Few estimates are considered reliable, coming from comprehensive scientific censuses. The table shows estimates per country according to IUCN and range country governments.[103]

CountryEstimate
Bangladesh Bangladesh440
Bhutan Bhutan75
Cambodia Cambodia20
China China45
India India1,706
Indonesia Indonesia325
Laos Laos17
Malaysia Malaysia500
Myanmar Myanmar85
Nepal Nepal155
North Korea North Korean/a
Russia Russia360
Thailand Thailand200
Vietnam Vietnam20
Total3,948

Rewilding

Origin

Although the term "rewilding" was used in conservation in other contexts since at least 1990,[104] it was first applied to the restoration of a single species of carnivores by conservationist and ex-carnivore manager of Pilanesberg National Park, Gus Van Dyk in 2003.[citation needed]

In 1978, the Indian conservationist Billy Arjan Singh attempted to rewild the tigress Tara in Dudhwa National Park that was born and reared in a zoo.[105] This was soon followed by a large number of people being eaten by a tigress who was later shot. Government officials claim that this tigress was Tara, an assertion hotly contested by Singh and conservationists. Later on, this rewilding gained further disrepute when it was found that the local gene pool had been sullied by Tara's introduction as she was partly Siberian tiger, a fact not known at the time of release, ostensibly due to poor record-keeping at Twycross Zoo, where she had been raised.[106][107][108][109][110][111]

Save China's Tigers

A South China tiger of the Save China's Tigers project with his blesbuck kill

The organisation Save China's Tigers, working with the Wildlife Research Centre of the State Forestry Administration of China and the Chinese Tigers South Africa Trust, secured an agreement on the reintroduction of Chinese tigers into the wild. The agreement, which was signed in Beijing on 26 November 2002, calls for the establishment of a Chinese tiger conservation model through the creation of a pilot reserve in China where indigenous wildlife, including the South China Tiger, will be reintroduced. Save China's Tigers aims to rewild the critically endangered South China Tiger by bringing a few captive-bred individuals to South Africa for rehabilitation training for them to regain their hunting instincts. At the same time, a pilot reserve in China is being set up and the Tigers will be relocated and release back in China when the reserve in China is ready.[112] The offspring of the trained tigers will be released into the pilot reserves in China, while the original animals will stay in South Africa to continue breeding.[113]

South Africa was chosen as a springboard thanks to its leadership in wildlife management, readily available land, and abundant game. SCT has also been working with the Chinese government to identify suitable sites for the establishment of pilot reserves in China. The South China Tigers of the project have since been successfully rewilded and are fully capable of hunting and surviving on their own.[112] This project is also very successful in the breeding of these rewilded South China Tigers and 5 cubs have been born in the project, these cubs of the 2nd generation would be able to learn their survival skills from their successfully rewilded mothers directly.[114]

Success story of rewilding

A rewilded South China Tiger of the Save China's Tigers rewilding project hunting blesbuck

Save China's Tigers' South China Tiger rewilding and reintroduction project has been deemed a success. Recently, renown scientists have confirmed the role of Rewilding captive populations to save the South China Tiger. A rewilding workshop conducted in the October 2010, in Laohu Valley reserve, South Africa to access the progress of the rewilding and reintroduction program of Save China's Tigers. The experts present includes Dr. Peter Crawshaw of Centro Nacional de Pesquisa e Conservacão de Mamiferos Carnivoros, Cenap/ICMBIO, Dr. Gary Koehler, Dr. Laurie Marker of Cheetah Conservation Fund, Dr. Jim Sanderson of Small Wild Cat Conservation Foundation, Dr. Nobuyuki Yamaguchi of Department of Biological and Environmental Sciences of Qatar University, and Dr. David Smith of Minnesota University, Chinese government scientists as well as representatives of Save China's Tigers.

The tigers involved, were born in captive conditions, in concrete cages and their parents are all captive animals who are unable to sustain in the wild. They were sent to South Africa as part of the Save China's Tigers project to rewilding and ensure that they regain the necessary skills needed for a predator to survive in the wild.

Results of the workshop confirmed the important role of the South China Tiger Rewilding Project in tiger conservation. ""Having seen the tigers hunting in an open environment at Laohu Valley Reserve, I believe that these rewilded tigers have the skill to hunt in any environment." Dr. David Smith remarked. Furthermore, Save China's Tigers recovered natural habitat both in China and in South Africa during their attempt to reintroduce South China Tigers back into the wild.[115]

The goal is of preparing tigers born in captivity for introduction to wild habitat in China where tigers once lived seems to be very possible in the near future based on the success of the rewilding and reintroduction program.[116]

Relation with humans

Tiger as prey

Tiger hunting on elephant-back, India, 1808.
Stereographic photograph (1903) of a captured man-eating tiger in the Calcutta zoo; the tiger had claimed 200 human victims.

The tiger has been one of the Big Five game animals of Asia. Tiger hunting took place on a large scale in the early nineteenth and twentieth centuries, being a recognised and admired sport by the British in colonial India as well as the maharajas and aristocratic class of the erstwhile princely states of pre-independence India. Tiger hunting was done by some hunters on foot; others sat up on machans with a goat or buffalo tied out as bait; yet others on elephant-back.[117] In some cases, villagers beating drums were organised to drive the animals into the killing zone. Elaborate instructions were available for the skinning of tigers and there were taxidermists who specialised in the preparation of tiger skins.

Man-eating tigers

Although humans are not regular prey for tigers, they have killed more people than any other cat, particularly in areas where population growth, logging, and farming have put pressure on tiger habitats. Most man-eating tigers are old and missing teeth, acquiring a taste for humans because of their inability to capture preferred prey.[118] Almost all tigers that are identified as man-eaters are quickly captured, shot, or poisoned. Unlike man-eating leopards, even established man-eating tigers will seldom enter human settlements, usually remaining at village outskirts.[119] Nevertheless, attacks in human villages do occur.[120] Man-eaters have been a particular problem in India and Bangladesh, especially in Kumaon, Garhwal and the Sundarbans mangrove swamps of Bengal, where some healthy tigers have been known to hunt humans. Because of rapid habitat loss due to climate change, tiger attacks have increased in the Sundarbans.[121]

A female tiger Tatiana escaped from her enclosure in the San Francisco Zoo, killing one person and seriously injuring two more before being shot and killed by the police. The enclosure had walls that were lower than they were legally required to be, allowing the tiger to climb the wall and escape.

Traditional Asian medicine

Many people in China have a belief that various tiger parts have medicinal properties, including as pain killers and aphrodisiacs.[122] There is no scientific evidence to support these beliefs. The use of tiger parts in pharmaceutical drugs in China is already banned, and the government has made some offenses in connection with tiger poaching punishable by death. Furthermore, all trade in tiger parts is illegal under the Convention on International Trade in Endangered Species of Wild Fauna and Flora and a domestic trade ban has been in place in China since 1993. Still, there are a number of tiger farms in the country specialising in breeding the cats for profit. It is estimated that between 5,000 and 10,000 captive-bred, semi-tame animals live in these farms today.[123][124][125]

In captivity

In recent years, captive breeding of tigers in China has accelerated to the point where the captive population of several tiger subspecies exceeds 4,000 animals. Three thousand specimens are reportedly held by 10–20 "significant" facilities, with the remainder scattered among some 200 facilities. This makes China home to the second largest captive tiger population in the world, after the USA, which in 2005 had an estimated 4,692 captive tigers.[126] In a census conducted by the US based Feline Conservation Federation in 2011, 2,884 tigers were documented as residing in 468 American facilities.[127]

Part of the reason for America's large tiger population relates to legislation. Only nineteen states have banned private ownership of tigers, fifteen require only a license, and sixteen states have no regulations at all.[128] The success of breeding programmes at American zoos and circuses led to an overabundance of cubs in the 1980s and 1990s, which drove down prices for the animals. The Society for the Prevention of Cruelty to Animals of Texas estimate there are now 500 lions, tigers and other big cats in private ownership just in the Houston, Texas.[verification needed] A private zoo in Zanesville, Ohio owned 18 Bengal tigers, all of which were shot dead by Ohio authorities after their owner released them, along with many other dangerous animals, before committing suicide on October 18, 2011.

Genetic ancestry of 105 captive tigers from 14 countries and regions was assessed by using Bayesian analysis and diagnostic genetic markers defined by a prior analysis of 134 voucher tigers of significant genetic distinctiveness. Of the 105 captive tigers, 49 specimen were assigned to one of five subspecies; 52 specimen had admixed subspecies origins.[129]

The Tiger Species Survival Plan devised by the Association of Zoos and Aquariums has condemned the breeding of white tigers on the allegation that they are of mixed ancestry, hybridized with other subspecies and are of unknown lineage. The genes responsible for white colour are represented by 0.001% of the population. The disproportionate growth in numbers of white tigers points to the relentless inbreeding resorted to among homozygous recessive individuals for selectively multiplying the white animals. This progressively increasing process will eventually lead to inbreeding depression and loss of genetic variability.[130]

Cultural depictions

19th century painting of a tiger by Kuniyoshi Utagawa.

The Bengal tiger is the national animal of India and Bangladesh.[8] The Malaysian tiger is the national animal of Malaysia.[131] The Siberian Tiger is the national animal of South Korea.

The tiger replaces the lion as King of the Beasts in cultures of eastern Asia representing royalty, fearlessness and wrath.[132] Its forehead has a marking which resembles the Chinese character 王, which means "king"; consequently, many cartoon depictions of tigers in China and Korea are drawn with 王 on their forehead.

Of great importance in Chinese myth and culture, the tiger is one of the 12 Chinese zodiac animals. Also in various Chinese art and martial art, the tiger is depicted as an earth symbol and equal rival of the Chinese dragon - the two representing matter and spirit respectively. In fact, the Southern Chinese martial art Hung Ga is based on the movements of the Tiger and the Crane. In Imperial China, a tiger was the personification of war and often represented the highest army general (or present day defense secretary),[132] while the emperor and empress were represented by a dragon and phoenix, respectively. The White Tiger (Chinese: 白虎; pinyin: Bái Hǔ) is one of the Four Symbols of the Chinese constellations. It is sometimes called the White Tiger of the West (西方白虎), and it represents the west and the autumn season.[132]

In Buddhism, it is also one of the Three Senseless Creatures, symbolising anger, with the monkey representing greed and the deer lovesickness.[132]

Goddess Durga riding a tiger

The Tungusic people considered the Siberian tiger a near-deity and often referred to it as "Grandfather" or "Old man". The Udege and Nanai called it "Amba". The Manchu considered the Siberian tiger as Hu Lin, the king.[18]

The widely worshiped Hindu goddess Durga, an aspect of Devi-Parvati, is a ten-armed warrior who rides the tigress (or lioness) Damon into battle. In southern India the god Ayyappan was associated with a tiger.[133]

The weretiger replaces the werewolf in shapeshifting folklore in Asia;[134] in India they were evil sorcerers while in Indonesia and Malaysia they were somewhat more benign.[135]

The tiger continues to be a subject in literature; both Rudyard Kipling, in The Jungle Book, and William Blake, in Songs of Experience, depict the tiger as a menacing and fearful animal. In The Jungle Book, the tiger, Shere Khan, is the wicked mortal enemy of the protagonist, Mowgli. However, other depictions are more benign: Tigger, the tiger from A. A. Milne's Winnie-the-Pooh stories, is cuddly and likable. In the Man Booker Prize winning novel "Life of Pi", the protagonist, Pi Patel, sole human survivor of a ship wreck in the Pacific Ocean, befriends another survivor: a large Bengal Tiger. The famous comic strip Calvin and Hobbes features Calvin and his stuffed tiger, Hobbes. A tiger is also featured on the cover of the popular cereal Frosted Flakes (also marketed as "Frosties") bearing the name "Tony the Tiger".

World's favourite animal

In a poll conducted by Animal Planet, the tiger was voted the world's favourite animal, narrowly beating the dog. More than 50,000 viewers from 73 countries voted in the poll. Tigers received 21% of the vote, dogs 20%, dolphins 13%, horses 10%, lions 9%, snakes 8%, followed by elephants, chimpanzees, orangutans and whales.[136][137][138][139]

Animal behaviourist Candy d'Sa, who worked with Animal Planet on the list, said: "We can relate to the tiger, as it is fierce and commanding on the outside, but noble and discerning on the inside".[136]

Callum Rankine, international species officer at the World Wildlife Federation conservation charity, said the result gave him hope. "If people are voting tigers as their favourite animal, it means they recognise their importance, and hopefully the need to ensure their survival," he said.[136]

See also

Cited references

  1. ^ a b c d Chundawat, R.S., Habib, B., Karanth, U., Kawanishi, K., Ahmad Khan, J., Lynam, T., Miquelle, D., Nyhus, P., Sunarto, S., Tilson, R., Wang, S. (2011). "Panthera tigris". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/15955. 
  2. ^ a b Dinerstein, E., Loucks, C., Wikramanayake, E., Ginsberg, Jo., Sanderson, E., Seidensticker, J., Forrest, J., Bryja, G., Heydlauff, A. (2007). "The Fate of Wild Tigers". BioScience 57 (6): 508–514. doi:10.1641/B570608. http://www.carnivoreconservation.org/files/issues/tiger_bioscience_cites.pdf. 
  3. ^ a b (Latin)Linnaeus, C. (1758) Felis tigris In: Caroli Linnæi Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Halae Magdeburgicae. Page 41.
  4. ^ a b c d e Mazák, V. (1981) Panthera tigris. Mammalian Species 152: 1–8.
  5. ^ a b c d e f (German) Mazák, V. (1965) Der Tiger Panthera tigris Linnaeus 1758. Volume 356 of Die Neue Brehm-Bücherei. A. Ziemsen, Wittenberg Lutterstadt.
  6. ^ Sanderson, E., Forrest, J., Loucks, C., Ginsberg, J., Dinerstein, E., Seidensticker, J., Leimgruber, P., Songer, M., Heydlauff, A., O'Brien, T., Bryja, G., Klenzendorf, S., Wikramanayake, E. (2006). The Technical Assessment: Setting Priorities for the Conservation and Recovery of Wild Tigers: 2005-2015. WCS, WWF, Smithsonian, and NFWF-STF, New York and Washington, DC, USA.
  7. ^ "National Animal". Govt. of India Official website. http://india.gov.in/knowindia/national_animal.php. 
  8. ^ a b Gupta, O. (2006). Encyclopaedia of India, Pakistan and Bangladesh. Delhi: Gyan Publishing. p. 313. ISBN 81-8205-389-7. http://books.google.com/books?id=ZsswQ9oTa0wC&pg=PA313#v=onepage&q&f=false. 
  9. ^ Pocock, R.I. (1939) Panthera tigris. In The Fauna of British India, Including Ceylon and Burma. Mammalia: Volume 1. Taylor and Francis, Ltd., London. Pages 197–210.
  10. ^ Harper, D. (2001–2011). "Panther". Online Etymology Dictionary. Douglas Harper. http://www.etymonline.com/index.php?term=panther. Retrieved 2011-10-24. 
  11. ^ Lewis, C. T. (1890) Tigris. An Elementary Latin Dictionary. American Book Company, New York, Cincinnati, Chicago.
  12. ^ Harper, D. (2001–2011). "Tiger". Online Etymology Dictionary. Etymonline.com. http://www.etymonline.com/index.php?term=tiger. Retrieved 2011-10-24. 
  13. ^ Van den Hoek Ostende. 1999. Javan Tiger – Ruthlessly hunted down. 300 Pearls – Museum highlights of natural diversity. Downloaded on August 11, 2006.
  14. ^ Piper, Philip J.; Ochoa, Janine; Lewis, Helen; Paz, Victor; Ronquillo, Wilfredo P. (2008). "The first evidence for the past presence of the tiger Panthera tigris (L.) on the island of Palawan, Philippines: Extinction in an island population". Palaeogeography, Palaeoclimatology, Palaeoecology 264: 123. doi:10.1016/j.palaeo.2008.04.003. 
  15. ^ a b Schaller, G. (1967) The Deer and the Tiger: A Study of Wildlife in India. Chicago Press, Chicago.
  16. ^ Brakefield, T. (1993). Big Cats: Kingdom of Might. ISBN 0-89658-329-5. 
  17. ^ Matthiessen, P. (2000) Tigers in the Snow. The Harvill Press, London.
  18. ^ a b Matthiessen, Peter; Hornocker, Maurice (2001). Tigers In The Snow. North Point Press. ISBN 0-86547-596-2. 
  19. ^ a b Geptner, V. G., Sludskii, A. A. (1972) Mlekopitaiuščie Sovetskogo Soiuza. Vysšaia Škola, Moskva. (In Russian; English translation: Heptner, V. G.; Sludskii, A. A.; Bannikov, A. G.; (1992) Mammals of the Soviet Union. Volume II, Part 2: Carnivora (Hyaenas and Cats). Smithsonian Institute and the National Science Foundation, Washington DC). pp. 95–202.
  20. ^ Chundawat, R. S., Khan, J. A., Mallon, D. P. (2011). "Panthera tigris tigris". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/136899. 
  21. ^ Karanth, K. U. (2003). Tiger ecology and conservation in the Indian subcontinent. Journal of the Bombay Natural History Society 100 (2&3): 169–189.
  22. ^ Smith, J. L. D., Sunquist, M. E., Tamang, K. M., Rai, P. B. (1983). A technique for capturing and immobilizing tigers. The Journal of Wildlife Management 47 (1): 255–259.
  23. ^ Panwar, H. S. (1987). Project Tiger: The reserves, the tigers, and their future. In: Tilson, R. L., Seal, U. S., Minnesota Zoological Garden, IUCN/SSC Captive Breeding Group, IUCN/SSC Cat Specialist Group. Tigers of the world: the biology, biopolitics, management, and conservation of an endangered species. Noyes Publications, Park Ridge, N.J. pp. 110–117.
  24. ^ Hemley, G., Mills, J. A. (1999). The beginning of the end of tigers in trade? In: Seidensticker, J., Christie, S., Jackson, P. (eds.) Riding the Tiger. Tiger Conservation in human-dominated landscapes. Cambridge University Press, Cambridge. hardback ISBN 0-521-64057-1, paperback ISBN 0-521-64835-1
  25. ^ Wildlife Protection Society of India (2009). WPSI's Tiger Poaching Statistics.
  26. ^ Damania, R., Seidensticker, J., Whitten, T., Sethi, G., Mackinnon, K., Kiss, A., Kushlin, A. (2008). A Future for Wild Tigers. World Bank, Washington, D.C.
  27. ^ Lynam, A.J. & Nowell, K. (2011). Panthera tigris ssp. corbetti. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 November 2011. Database entry includes a brief justification of why this species is of endangered.
  28. ^ "Laboratory of Genomic Diversity LGD". http://home.ncifcrf.gov/ccr/lgd/. 
  29. ^ Linkie, M., Wibisono, H.T., Martyr, D.J. & Sunarto, S. (2008). "Panthera tigris ssp. sumatrae (Sumatran Tiger)". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/15966. Retrieved 9 August 2011. 
  30. ^ *Nowak, Ronald M. (1999) Walker's Mammals of the World. Johns Hopkins University Press. ISBN 0-8018-5789-9
  31. ^ Cracraft, Joel; Feinstein, Julie; Vaughn, Jeffrey; Helm-Bychowski, Kathleen (1998). "Sorting out tigers (Panthera tigris): mitochondrial sequences, nuclear inserts, systematics, and conservation genetics". Animal Conservation 1 (2): 139. doi:10.1111/j.1469-1795.1998.tb00021.x. http://research.amnh.org/vz/ornithology/pdfs/1998c.%20tiger%20conservation.pdf. 
  32. ^ Kerley, L.L., Goodrich, J.M. Miquelle, D.G. Smirnov, E.N. Quigley, H.G., Hornocker, M.G. (2003). "Reproductive parameters of wild female Amur (Siberian) tigers (Panthera tigris altaica)". Journal of Mammalogy 84: 288–298. doi:10.1644/1545-1542(2003)084<0288:RPOWFA>2.0.CO;2. JSTOR 1383657. 
  33. ^ Miquelle, D., Darman, Y., Seryodkin, I. (2011). "Panthera tigris ssp. altaica". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/15956. 
  34. ^ a b Driscoll, C. A., Yamaguchi, N., Bar-Gal, G. K., Roca, A. L., Luo, S., Macdonald, D. W., O'Brien, S. J. 2009. Mitochondrial Phylogeography Illuminates the Origin of the Extinct Caspian Tiger and Its Relationship to the Amur Tiger. PLoS ONE 4 (1): e4125. doi:10.1371/journal.pone.0004125.
  35. ^ www.china.org.cn Retrieved on 6 October 2007
  36. ^ a b "绝迹24年华南虎重现陕西 村民冒险拍下照片". News.xinhuanet.com. http://news.xinhuanet.com/newscenter/2007-10/13/content_6873252.htm. Retrieved 2009-03-07. 
  37. ^ "Rare China tiger seen in the wild". BBC News. 2007-10-12. http://news.bbc.co.uk/1/hi/world/asia-pacific/7042257.stm. Retrieved 2009-03-07. 
  38. ^ "South China tiger photos are 'fake'". China Daily. 2007-11-17. http://www.chinadaily.com.cn/china/2007-11/17/content_6261263.htm. Retrieved 2009-03-07. 
  39. ^ "South China tiger photos are fake: provincial authorities". China Daily. 2008-06-29. http://www.chinadaily.com.cn/china/2008-06/29/content_6803353.htm. Retrieved 2009-03-07. 
  40. ^ Page, Jeremy (2008-06-30). "Farmer's photo of rare South China tiger is exposed as fake". London: The Times. http://www.timesonline.co.uk/tol/news/world/asia/china/article4237441.ece. Retrieved 2009-03-07. 
  41. ^ Jackson, P., Nowell, K. (2008). "Panthera tigris ssp. virgata.". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41505. 
  42. ^ Jackson, P., Nowell, K. (2008). "Panthera tigris ssp. sondaica". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41681. 
  43. ^ Mazák, J.H., Groves, C.P. (2006). A taxonomic revision of the tigers (Panthera tigris). Mammalian Biology 71 (5): 268–287.
  44. ^ Seidensticker, J. (1987). Bearing Witness: Observations on the Extinction of Panthera tigris balica and Panthera tigris sondaica'. Pages 1–8 in: Tilson, R. L., Seal, U. S. (eds.) Tigers of the World: the biology, biopolitics, management, and conservation of an endangered species. Noyes Publications, New Jersey.
  45. ^ Istiadi, Y., Panekenan, N., Priatna, D., Novendri, Y., Mathys, A., Mathys, Y. (1991). Untersuchung über die Carnivoren des Gunung Halimun Naturschutzgebietes. Zoologische Gesellschaft für Arten- und Populationsschutz e.V. Mitteilungen 7 (2): 3–5.
  46. ^ "History of big cat hybridisation". http://www.lairweb.org.nz/tiger/hybridisation.html. Retrieved 28 September 2007. 
  47. ^ Guggisberg, C. A. W. (1975). Wild Cats of the World. New York: Taplinger Publishing. ISBN 0-8008-8324-1. 
  48. ^ a b Markel, Scott; Darryl León (2003). Sequence Analysis in a Nutshell: a guide to common tools and databases. Sebastopol, California: O'Reily. ISBN 0-596-00494-X. 
  49. ^ "tigon – Encyclopædia Britannica Article". http://www.britannica.com/eb/article-9001344/tigon. Retrieved 12 September 2007. 
  50. ^ a b "White tigers". http://www.lairweb.org.nz/tiger/white.html. Retrieved 25 September 2007. 
  51. ^ a b "The white tiger today and the unusual white lion". Lairweb.org.nz. http://www.lairweb.org.nz/tiger/white.html. Retrieved 2010-06-10. 
  52. ^ "White Tigers". Bigcatrescue.org. http://www.bigcatrescue.org/cats/wild/white_tigers.htm. Retrieved 2010-06-10. 
  53. ^ "White Tiger Facts". http://www.indiantiger.org/white-tigers/white-tiger-facts.html. Retrieved 26 September 2007. 
  54. ^ "White Tigers". Bigcathaven.org. Archived from the original on 2010-09-08. http://web.archive.org/web/20100908075603/http://bigcathaven.org/cats/wild/white_tigers_genetics.htm. Retrieved 2012-02-02. 
  55. ^ "Snow Tigers". Bigcatrescue.org. http://www.bigcatrescue.org/cats/wild/snowtigers.htm. Retrieved 2010-06-10. 
  56. ^ "Golden tabby Bengal tigers". Lairweb.org.nz. http://www.lairweb.org.nz/tiger/tabby.html. Retrieved 2009-03-07. 
  57. ^ a b McDougal, C. (1977) The Face of the Tiger. Rivington Books and André Deutsch, London.
  58. ^ Piper, P.J.; Earl of Cranbrook, Rabett, R.J. (2007). "Confirmation of the presence of the tiger Panthera tigris (L.) in Late Pleistocene and Holocene Borneo". Malayan Nature Journal 59 (3): 259–267. 
  59. ^ Piper, P.J., Philip J.; Ochoa, J., Paz, V., Lewis, H., Ronquillo, W.P. (2008). "The first evidence for the past presence of the tiger Panthera tigris (L.) on the island of Palawan, Philippines: extinction in an island population". Palaeogeography, Palaeoclimatology, Palaeoecology 264: 123–127. doi:10.1016/j.palaeo.2008.04.003. 
  60. ^ a b c d Mills, S. (2004). Tiger. p. 89. BBC Books, London
  61. ^ a b Thapar, V. (1989). Tiger: Portrait of a Predator. Smithmark Pub, New York
  62. ^ Karanth, K.U., Nichols, J.D., Seidensticker, J., Dinerstein, E., Smith, J.L.D., McDougal, C., Johnsingh, A.J.T., Chundawat, R.S. (2003) Science deficiency in conservation practice: the monitoring of tiger populations in India. Animal Conservation (61): 141–146.
  63. ^ a b c d Perry, Richard (1965). The World of the Tiger. p. 260. ASIN: B0007DU2IU. 
  64. ^ "Man-eaters. The tiger and lion, attacks on humans". Lairweb.org.nz. http://www.lairweb.org.nz/tiger/maneating7.html. Retrieved 2009-03-07. 
  65. ^ a b ADW:Panthera tigris: Information, animaldiversity.ummz.umich.edu
  66. ^ Tiger: Spy In The Jungle. John Downer Productions. BBC (2008)
  67. ^ Sankhala 1997, p. 17
  68. ^ Sankhala 1997, p. 23
  69. ^ a b Mills, Stephen (2004). Tiger. Richmond Hill., Ont.: Firefly Books. p. 168. ISBN 1-55297-949-0. 
  70. ^ a b Thapar, Valmik. (1992). The Tiger's Destiny. Kyle Cathie Ltd: Publishers, London
  71. ^ a b c d Nowak, Ronald M. (1999). Walker's Mammals of the World. Baltimore: Johns Hopkins University Press. ISBN 0-8018-5789-9
  72. ^ "Zoogoer – Tiger, Panthera tigris". http://nationalzoo.si.edu/Publications/ZooGoer/1998/2/tigerfacts.cfm. Retrieved 5 October 2007. 
  73. ^ "Tiger –". Bangalinet.com. http://www.bangalinet.com/tiger1.htm. Retrieved 2009-03-07. 
  74. ^ "Tiger – Oakland Zoo". Oaklandzoo.org. http://www.oaklandzoo.org/meet_the_animals/tiger. Retrieved 2009-03-07. 
  75. ^ Sunquist, Fiona & Mel Sunquist. 2002. Tiger Moon, The University of Chicago Press, Chicago, ISBN 0-226-77997-1
  76. ^ Goldsmith, Oliver (2010). A History Of The Earth, And Animated Nature, Volume 2. Nabu Press. p. 297. ISBN 1-145-11108-4. 
  77. ^ "Sympatric Tiger and Leopard: How two big cats coexist in the same area". Archived from the original on 2008-02-13. http://web.archive.org/web/20080213000715/http://www.ecology.info/tiger-leopard.htm. Ecology.info
  78. ^ Karanth, K. Ullas; Sunquist, Melvin E. (2000). "Behavioural correlates of predation by tiger (Panthera tigris), leopard (Panthera pardus) and dhole (Cuon alpinus) in Nagarahole, India". Journal of Zoology 250 (2): 255–265. doi:10.1111/j.1469-7998.2000.tb01076.x. 
  79. ^ "The IUCN-Reuters Media Awards 2000". IUCN. Archived from the original on February 9, 2006. http://web.archive.org/web/20060209182238/http://www.iucn.org/reuters/2000/eeurope.html. Retrieved 2007-08-17. 
  80. ^ "Amur Tiger". Save The Tiger Fund. Archived from the original on July 12, 2007. http://web.archive.org/web/20070712180823/http://www.savethetigerfund.org/Content/NavigationMenu2/Community/GeneralPublic/TigerSubspecies/AmurSiberianTigers/default.htm. Retrieved 2007-08-17. 
  81. ^ Perry, Richard (1965). The World of the Tiger. p. 260. ASIN B0007DU2IU. ISBN 0-89747-230-6. 
  82. ^ "Tiger". Big Cat Rescue. http://www.bigcatrescue.org/cats/wild/tiger.htm. Retrieved 2009-03-07. 
  83. ^ "TRADITIONAL CHINESE MEDICINE". World Wildlife Foundation. http://www.worldwildlife.org/what/globalmarkets/wildlifetrade/traditionalchinesemedicine.html. Retrieved 3 March 2012. 
  84. ^ Jacobs, Andrew. "Tiger Farms in China Feed Thirst for Parts". New York Times. http://www.nytimes.com/2010/02/13/world/asia/13tiger.html?_r=1. Retrieved 3 March 2012. 
  85. ^ Tigress joins lone tiger in Sariska, Times of India, 4 July 2008.
  86. ^ Students' Britannica India – By Dale Hoiberg, Indu Ramchandani. Books.google.com. 2000. ISBN 978-0-85229-760-5. http://books.google.com/?id=DPP7O3nb3g0C&pg=PA153&dq=india+tiger+largest. Retrieved 2010-06-10. 
  87. ^ Independent Online. "'World tiger population shrinking fast'". Iol.co.za. http://www.iol.co.za/index.php?sf=143&set_id=1&click_id=31&art_id=nw20080312141948377C153394. Retrieved 2010-06-10. 
  88. ^ Dinerstein, E., Loucks, C., Heydlauff, A., Wikramanayake, E., Bryja, G., Forrest, J., Ginsberg, J., Klenzendorf, S., Leimgruber, P., O'Brien, T., Sanderson, E., Seidensticker, J., Songer, M. (2006) Setting Priorities for the Conservation and Recovery of Wild Tigers: 2005–2015. A User's Guide. 1–50. Washington, D.C., New York, WWF, WCS, Smithsonian, and NFWF-STF.
  89. ^ Only 3500 tigers left worldwide – WWF[dead link]
  90. ^ "Front Page : Over half of tigers lost in 5 years: census". The Hindu. 2008-02-13. http://www.hindu.com/2008/02/13/stories/2008021357240100.htm. Retrieved 2010-06-10. 
  91. ^ Page, Jeremy (2008-07-05). "Tigers flown by helicopter to Sariska reserve to lift numbers in western India". The Times (London). http://www.timesonline.co.uk/tol/news/world/asia/article4272945.ece. Retrieved 2010-05-25. 
  92. ^ "India Reports Sharp Decline in Wild Tigers". News.nationalgeographic.com. http://news.nationalgeographic.com/news/2008/02/080213-AP-india-disap.html. Retrieved 2010-06-10. 
  93. ^ "It's the tale of a tiger, two tigresses in wilds of Sariska". Economictimes.indiatimes.com. 2009-03-02. http://economictimes.indiatimes.com/Earth/Its-the-tale-of-a-tiger-two-tigresses-in-wilds-of-Sariska/rssarticleshow/4212845.cms. Retrieved 2010-06-10. 
  94. ^ "Tigers galore in Ranthambhore National Park". Hindu.com. 2009-03-11. http://www.hindu.com/2009/03/11/stories/2009031152382000.htm. Retrieved 2010-06-10. 
  95. ^ Rabinowitz, A. (2009) Stop the bleeding: implementing a strategic Tiger Conservation Protocol Cat News 51: 30–31.
  96. ^ Goodrich, J.M., Miquelle, D.G., Smirnov, E.M., Kerley, L.L., Quigley, H.B., Hornocker, M.G. (2010) Spatial structure of Amur (Siberian) tigers (Panthera tigris altaica) on Sikhote-Alin Biosphere Zapovednik, Russia. Journal of Mammalogy 91 (3): 737–748.
  97. ^ "WWF: Amur (Siberian) tiger – species factsheet". http://www.panda.org/about_wwf/what_we_do/species/about_species/species_factsheets/tigers/amur_tiger/index.cfm. Retrieved 2007-12-19. 
  98. ^ Timothy, E. Fulbright, D., Hewitt, G. (2007) Wildlife Science: Linking Ecological Theory and Management Applications CRC Press. ISBN 0-8493-7487-1
  99. ^ "Dalai Lama campaigns for wildlife". BBC News. April 6, 2005. http://news.bbc.co.uk/1/hi/sci/tech/4415929.stm. Retrieved 2007-07-20. 
  100. ^ Justin Huggler (February 18, 2006). "Fur flies over tiger plight". New Zealand Herald. Tibet.com. Archived from the original on July 14, 2007. http://web.archive.org/web/20070714113644/http://www.tibet.com/NewsRoom/animalright2.htm. Retrieved 2007-07-20. 
  101. ^ "Animal Skin Clothes Burned In Tibet After Dalai Lamas Call". The Office of His Holiness the Dalai Lama. 2006-02-17. http://www.dalailama.com/news/post/27-animal-skin-clothes-burned-in-tibet-after-dalai-lamas-call. Retrieved 2010-12-04. 
  102. ^ WWF – Tiger – Overview. Worldwildlife.org (2011-08-10). Retrieved on 2011-09-27.
  103. ^ http://www.iucnredlist.org/documents/attach/15955.pdf
  104. ^ Jennifer Foote, "Trying to Take Back the Planet," Newsweek, 5 February 1990, pp. 24–25
  105. ^ Singh, A. (1981) Tara, a tigress. Quartet Books, London and New York.
  106. ^ Menon, S. (1997). Tainted Royalty. India Today, 17 November 1997
  107. ^ Bagla, P. (1998). Indian tiger isn't 100 per cent "swadeshi". The Indian Express, 19 November 1998
  108. ^ Shankaranarayanan, P., Singh, L. (1998). Mitochondrial DNA sequence divergence among big cats and their hybrids. Current Science 75 (9): 919–923.
  109. ^ Tiger Territory The Tale of Tara, 4: Tara's Heritage
  110. ^ Tiger Territory Genetic pollution in wild Bengal tigers
  111. ^ Singh, R.K. (2000). Tara: The Cocktail Tigress. Print World, Allahabad.
  112. ^ a b "FAQs | Save China's Tigers". English.savechinastigers.org. 2004-07-25. http://english.savechinastigers.org/node/255. Retrieved 2010-06-10. 
  113. ^ "FAQs | Save China's Tigers". English.savechinastigers.org. 2004-07-25. http://english.savechinastigers.org/node/255#14. Retrieved 2009-03-07. 
  114. ^ "The Baby Tiger That's Beating Extinction | Youtube Channel-SkyNews". Youtube.com. 2007-12-04. http://www.youtube.com/watch?v=iAnmxhTd1OA. Retrieved 2010-06-10. 
  115. ^ "Scientists Confirm the Role of Rewilding Captive Populations to Save the South China Tiger". English.savechinastigers.org. http://english.savechinastigers.org/node/572. Retrieved 2010-12-12. 
  116. ^ "Tiger cubs saved by catwoman". Express.co.uk. 2010-10-05. http://www.express.co.uk/posts/view/203605/Tiger-cubs-saved-by-Catwoman. Retrieved 2010-12-12. 
  117. ^ vide Royal Tiger (nom-de-plume) in The Manpoora Tiger – about a Tiger Hunt in Rajpootanah. (1836) Bengal Sporting Magazine, Vol IV. reproduced in The Treasures of Indian Wildlife
  118. ^ "Man-eaters. The tiger and lion, attacks on humans". Lairweb.org.nz. http://www.lairweb.org.nz/tiger/maneating.html. Retrieved 2009-03-07. 
  119. ^ "Man-eaters. The tiger and lion, attacks on humans". Lairweb.org.nz. http://www.lairweb.org.nz/tiger/maneating3.html. Retrieved 2009-03-07. 
  120. ^ "Increasing tiger attacks trigger panic around Tadoba-Andhari reserve". Indianexpress.com. 2007-10-18. http://www.indianexpress.com/news/increasing-tiger-attacks-trigger-panic-around-tadobaandhari-reserve/229533/. Retrieved 2009-03-07. 
  121. ^ "Climate change linked to Indian tiger attacks". http://www.enn.com/wildlife/article/38442. Retrieved 27 October 2008. 
  122. ^ Harding, Andrew (2006-09-23). "Programmes | From Our Own Correspondent | Beijing's penis emporium". BBC News. http://news.bbc.co.uk/2/hi/programmes/from_our_own_correspondent/5371500.stm. Retrieved 2009-03-07. 
  123. ^ "Chinese tiger farms must be investigated". WWF. http://www.wwf.org.uk/news/n_0000003865.asp. Retrieved 2009-03-07. [dead link]
  124. ^ "WWF: Breeding tigers for trade soundly rejected at cites". Panda.org. http://www.panda.org/about_wwf/where_we_work/asia_pacific/where/bhutan/index.cfm?uNewsID=106740. Retrieved 2009-03-07. [dead link]
  125. ^ Jackson, Patrick (29 January 2010). "Tigers and other farmyard animals". BBC News. http://news.bbc.co.uk/2/hi/asia-pacific/8487122.stm. Retrieved 29 January 2010. 
  126. ^ Nowell, K., Ling, X. (2007) Taming the tiger trade: China's markets for wild and captive tiger products since the 1993 domestic trade ban. TRAFFIC East Asia, Hong Kong, China.
  127. ^ Wildlife Watch Group (2011) Less than 3,000 Pet Tigers in America . Wildlife Times 5 (37): 12–13.
  128. ^ "Summary of State Laws Relating to Private Possession of Exotic Animals". Bornfreeusa.org. http://www.bornfreeusa.org/b4a2_exotic_animals_summary.php. Retrieved 2010-12-12. 
  129. ^ Luo,S., Johnson,W. E., Martenson, J., Antunes, A., Martelli, P., Uphyrkina, O., Traylor-Holzer, K., Smith, J. L.D., O’Brien, S. J. (2008) Subspecies Genetic Assignments of Worldwide Captive Tigers Increase Conservation Value of Captive Populations. Current Biology 18: 592–596.
  130. ^ Xavier, N. (2010) A new conservation policy needed for reintroduction of Bengal tiger-white. Current Science 99 (7): 894–895.
  131. ^ DiPiazza, F. (2006). Malaysia in Pictures. Twenty-First Century Books. p. 14. ISBN 978-0-8225-2674-2. http://books.google.com/books?id=o1Yhov_ejW0C&pg=PA14. 
  132. ^ a b c d Cooper, J. C. (1992). Symbolic and Mythological Animals. London: Aquarian Press. pp. 226–27. ISBN 1-85538-118-4. 
  133. ^ Balambal, V (1997). "19. Religion – Identity – Human Values – Indian Context". Bioethics in India: Proceedings of the International Bioethics Workshop in Madras: Biomanagement of Biogeoresources, 16–19 January 1997. Eubios Ethics Institute. http://www.eubios.info/india/BII19.HTM. Retrieved 2007-10-08. 
  134. ^ Summers, Montague (1966). The Werewolf. University Books. p. 21. ISBN 0-517-18093-6. 
  135. ^ Encyclopædia Britannica Eleventh Edition. 1910–1911. 
  136. ^ a b c Independent Online. "Tiger tops dog as world's favourite animal". Int.iol.co.za. http://www.int.iol.co.za/index.php?newslett=1&em=28164a99a20041206ah&click_id=29&art_id=qw1102325040750B216&set_id=1. Retrieved 2009-03-07. 
  137. ^ Pers – The Tiger is the World's Favorite Animal[dead link]
  138. ^ "CBBC Newsround | Animals | Tiger 'is our favourite animal'". BBC News. 2004-12-06. http://news.bbc.co.uk/cbbcnews/hi/newsid_4070000/newsid_4073100/4073151.stm. Retrieved 2009-03-07. 
  139. ^ "Endangered tiger earns its stripes as the world's most popular beast | Independent, The (London) | Find Articles at BNET.com". Findarticles.com. 2004-12-06. Archived from the original on January 20, 2008. http://web.archive.org/web/20080120222416/http://findarticles.com/p/articles/mi_qn4158/is_20041206/ai_n12814678. Retrieved 2009-03-07. 

References

  • Brakefield, T. (1993). Big cats kingdom of might, Voyageur press.
  • Dr. Tony Hare. (2001) Animal Habitats P. 172 ISBN 0-8160-4594-1
  • Kothari, Ashok S. & Chhapgar, Boman F. (eds). 2005. The Treasures of Indian Wildlife. Bombay Natural History Society and Oxford University Press, Mumbai.
  • Mazák, V. (1981). Panthera tigris. (PDF). Mammalian Species, 152: 1–8. American Society of Mammalogists.
  • Nowak, Ronald M. (1999) Walker's Mammals of the World. Johns Hopkins University Press. ISBN 0-8018-5789-9
  • Sankhala, K. (1997). Der indische Tiger und sein Reich. Bechtermuenz Verlag. ISBN 3-86047-734-X.  Abridged German translation of Return of the Tiger, Lustre Press, 1993.
  • Seidensticker, John. (1999) Riding the Tiger. Tiger Conservation in Human-dominated Landscapes Cambridge University Press. ISBN 0-521-64835-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

White tiger

White tigers are a kind of tiger whose fur is white or almost white. This coloration is caused by a recessive gene. White tigers have been known to inhabit many parts of East Asia, including India and China. However, their current range has been much reduced due to over-hunting of their pelts.

Compared to orange tigers without the white gene, white tigers tend to be larger both at birth and at full adult size.[4] This may have given them an advantage in the wild despite their unusual coloration. Heterozygous orange tigers also tend to be larger than other orange tigers. Kailash Sankhala, the director of the New Delhi Zoo in the 1960s, said "one of the functions of the white gene may have been to keep a size gene in the population, in case it's ever needed."[5]

Dark-striped white individuals are well-documented in the Bengal Tiger subspecies, also known as the Royal Bengal or Indian tiger, (Panthera tigris tigris or P. t. bengalensis), may also have occurred in captive Siberian Tigers (Panthera tigris altaica), and may have been reported historically in several other subspecies. White pelage is most closely associated with the Bengal, or Indian subspecies. Currently, several hundred white tigers are in captivity worldwide with about 100 of them in India, and their numbers are on the increase. The modern population includes both pure Bengals and hybrid Bengal–Siberians, but it is unclear whether the recessive gene for white came only from Bengals, or from any of the Siberian ancestors as well.

The unusual coloration of white tigers has made them popular in zoos and entertainment that showcases exotic animals. The magicians Siegfried & Roy are famous for having bred and trained two white tigers for their performances, referring to them as "royal white tigers" perhaps from the white tiger's association with the Maharaja of Rewa. The exotic-tiger performance trio of Ron Holiday, Joy Holiday and Chuck Lizza—subjects of the HBO documentary film Cat Dancers—worked with a white tiger which ended up killing two of them.

Contents

White tigers in the wild

Two white Bengals at the Singapore Zoo.

An article appeared in the Miscellaneous Notes of the Journal Of The Bombay Natural History Society on November 15, 1909, which reported that a white tigress was shot in the Mulin Sub-Division Forest of the Dhenkanal State in Orissa. The report originally appeared in the Indian Forester in May 1909, and was made by Mr. Bavis Singh, Forest Officer. The ground colour of the white tigress was described as pure white and the stripes as deep reddish-black. It was shot over a buffalo kill and "was in good condition not showing any signs of disease." Col. F.T. Pollock wrote in Wild Sports of Burma and Assam, "Occasionally white tigers are met with. I saw a magnificent skin of one at Edwin Wards in Wimpole Street, and Mr. Shadwall, Assistant Commissioner in Cossyah and Jynteah Hills, also has two skins quite white." Mr. Lydekker wrote in Game Animals of India (1907) about five more white tiger skins: "A white tiger was exhibited alive at Exeter Change about 1820; a second was killed in Poona about 1892; in March 1899, a white tiger was shot in Upper Assam and the skin sent to Calcutta, where a fourth specimen was received about the same time. The Maharaja of Kuch-Behar also possesses a white tiger-skin."[6] The white tiger exhibited at Exeter Change in London in 1820 was the first white tiger in Europe.

S.H. Prater wrote in The book of Indian Animals (1948) that "White or partially white tigers are not uncommon in some of the dry open jungles of central India."[7] It is a myth that white tigers did not thrive in the wild. India planned to reintroduce captive-bred white tigers to the wild to a special reserve near Rewa.[8] In the wild, white tigers reproduced and bred for generations. A.A. Dunbar Brander wrote in Wild animals in central India (1923) that "White tigers occasionally occur. There is a regular breed of these animals in the neighborhood of Amarkantak at the junction of the Rewa state and the Mandla and Bilaspur districts. When I was last in Mandla in 1919, a white tigress and two three parts grown white cubs existed. In 1915 a male was trapped by the Rewa state and confined. An excellent description of the animal, by Mr. Scott of the Indian police, has been published in Vol. XXVII No. 47 of the Bombay Natural History Society's journal."[9]

The previously mentioned article from The Journal Of The Bombay Natural History Society "Miscellaneous Notes: No. 1-A WHITE TIGER IN CAPTIVITY (with a photo)" states that "The white tiger in captivity in Rewa was caught in December 1915 in the jungles of the State near Sohagpur. He was about two years of age at the time. There were two more white tigers in Southern Rewa related to this tiger but it was believed that the mother of this animal was not white... A white tiger was killed by a Sardar in Sohargpur Tahasil, Southern Rewa, about 10 or 12 years ago. Two other tigers appeared in the beat near Shahdol and Annuppur, B.N.Ry., but His late Highness' orders were that these should not be shot. The one at Annuppur (Bhilam Dungari Jungle) was said to be the brother of the one in captivity. These white tigers roam in the neighboring British Districts of the Central Provinces and seem to be living in the Maikal ranges of mountains." There is ample evidence that white tigers survived as adults in the wild.[10][11] There were reports of white tigers from Burma and the Jynteah Hills of Meghalaya made by Pollock in the 1900s. Between 1892 and 1922, white tigers were shot in Poona, Upper Assam, Orissa, Balispur, and Cooch Behar. White tigers were shot in different regions in the 1920s and 1930s. Fifteen were shot in Bihar in this same time period. Trophies are on display in the Calcutta Museum and at Mica Camp, Tisri, in Bihar. There are more records of white tigers in Rowland Ward's Records of Big Game.

Victor H. Cahalane reported white tigers in northern China in 1943: "...north China has produced a number of albinos, with the inevitable faint brown stripe. Very rare melanistic (black) tigers are known."[12] However, white tigers are not albinos. These tigers were white individuals of the Amur tiger subspecies (Panthera tigris altaica), also known as the Siberian tiger. White tigers were reported in northern China and Korea.[13][14] White tigers have cultural significance in both countries. They are also part of the folklore on Sumatra and Java.

Jim Corbett filmed a white tigress in the wild which had two orange cubs. This film footage was used in the 1984 National Geographic movie Man Eaters Of India, which is based on Jim Corbett's 1957 book by the same title. This is further proof that white tigers survived and reproduced in the wild. The website of the Bandhavgarh National Park, in the former princely state of Rewa, in Madhya Pradesh, features pictures of white tigers, and states "The forests of Bandhavgarh are the white tiger jungles of yesteryears." Today, there are 46 to 52 orange tigers living in Bandhavgarh, the largest population of tigers in any national park in India.[15]

White Siberian Tigers

The existence of pure white Siberian tigers has not been scientifically proven, despite occasional reports of sightings of white tigers in the regions where wild Siberian tigers live. It is quite possible that the gene for white coating does not exist in the Siberian tiger population, since no pure white Siberian tigers have been born in captivity even though the Siberian tiger has been extensively bred during the last few decades. The wild Siberian tiger population nearly went extinct during the middle of the 20th century, so it is also possible that the Siberian tigers carrying the gene for white coating died out during this period. More research is necessary before scientists can fully understand the genetic make up of the Siberian tiger.

The famous white Siberian tigers found in captivity are actually not pure Siberian tigers. They are instead the result of Siberian tigers breeding with Bengal tigers. The gene for white coating is quite common among Bengal tigers, but the natural birth of a white Bengal tiger is still a very rare occasion in the wild, where white tigers are not bred selectively. A white tiger is caused by the occurrence of a double recessive allele in the genome. Estimations show that around one in 10,000 wild tiger births will result in a white tiger.

The white tiger is not considered a tiger subspecies, but rather a mutant variant of the existing tiger subspecies. If a pure white Siberian tiger were to be born, it would therefore not be selectively bred within the tiger conservation programs. It would, however, probably still be selectively bred outside the program in an effort to create more white Siberian tigers. Due to the popularity of white tigers, they are used to attract visitors to zoos and will hopefully help raise awareness about all tigers and their situation.

Stripeless white tigers and golden tabby tigers

A nearly stripeless tiger on display at The Mirage

An additional genetic condition can remove most of the striping of a white tiger, making the animal almost pure white. One such specimen was exhibited at Exeter Change in England in 1820, and described by Georges Cuvier as "A white variety of Tiger is sometimes seen, with the stripes very opaque, and not to be observed except in certain angles of light."[16] Naturalist Richard Lydekker said that, "a white tiger, in which the fur was of a creamy tint, with the usual stripes faintly visible in certain parts, was exhibited at the old menagerie at Exeter Change about the year 1820."[17] Hamilton Smith said, "A wholly white tiger, with the stripe-pattern visible only under reflected light, like the pattern of a white tabby cat, was exhibited in the Exeter Change Menagerie in 1820.", and John George Wood stated that, "a creamy white, with the ordinary tigerine stripes so faintly marked that they were only visible in certain lights." Edwin Henry Landseer also drew this tigress in 1824.

The modern strain of snow white tigers came from repeated brother–sister matings of Bhim and Sumita at Cincinnati Zoo. The gene involved may have come from a Siberian tiger, via their part-Siberian ancestor Tony. Continued inbreeding appears to have caused a recessive gene for stripelessness to show up. About one fourth of Bhim and Sumita's offspring were stripeless. Their striped white offspring, which have been sold to zoos around the world, may also carry the stripeless gene. Because Tony's genome is present in many white tiger pedigrees, the gene may also be present in other captive white tigers. As a result, stripeless white tigers have appeared in zoos as far afield as the Czech Republic, Spain and Mexico. Stage magicians Siegfried & Roy were the first to attempt to selectively breed tigers for stripelessness; they owned snow-white Bengal tigers taken from Cincinnati Zoo (Tsumura, Mantra, Mirage and Akbar-Kabul) and Guadalajara, Mexico (Vishnu and Jahan), as well as a stripeless Siberian tiger called Apollo.[18]

In 2004, a blue-eyed, stripeless white tiger was born in a wildlife refuge in Alicante, Spain. Its parents are normal orange Bengals. The cub was named Artico ("Arctic").

Stripeless white tigers were thought to be sterile until Siegfried & Roy's stripeless white tigress Sitarra, a daughter of Bhim and Sumita, gave birth. Another variation which came out of the white strains were unusually light-orange tigers called "golden tabby tigers". These are probably orange tigers which carry the stripeless white gene as a recessive. Some white tigers in India are very dark, between white and orange.

Genetics and albinism

A white tiger in captivity at a zoo. The presence of stripes indicates it is not a true albino.
White tigers at Singapore zoo

A white tiger's pale coloration is caused by the presence of a recessive gene. Another genetic characteristic makes the stripes of the tiger very pale; white tigers of this type are called snow-white or "pure white". White tigers are not albinos and do not constitute a separate subspecies of their own and can breed with orange ones, although (approx.) half of the resulting offspring will be heterozygous for the recessive white gene, and their fur will be orange. The only exception would be if the orange parent was itself already a heterozygous tiger, which would give each cub a 50% chance of being either double-recessive white or heterozygous orange. If two heterozygous tigers, or heterozygotes, breed on average 25% of their offspring will be white, 50% will be heterozygous orange (white gene carriers) and 25% will be homozygous orange, with no white genes. In the 1970s a pair of heterozygous orange tigers named Sashi and Ravi produced 13 cubs in Alipore Zoo, of which 3 were white.[19] If two white tigers breed, 100% of their cubs will be homozygous white tigers. A tiger which is homozygous for the white gene may also be heterozygous or homozygous for many different genes. The question of whether a tiger is heterozygous (a heterozygote) or homozygous (a homozygote) depends on the context of which gene is being discussed. Inbreeding promotes homozygosity and has been used as a strategy to produce white tigers.

Contrary to popular belief, white tigers are not albinos; true albino tigers would have no stripes. Even the "stripeless" white tigers known today actually have very pale stripes.

Part of the confusion is due to the misidentification of the so-called chinchilla gene (for white) as an allele of the albino series (publications prior to the 1980s refer to it as an albino gene). The mutation is recessive to normal colour, which means that two orange tigers carrying the mutant gene may produce white offspring, and white tigers bred together will produce only white cubs. The stripe colour varies due to the influence and interaction of other genes.

While the inhibitor ("chinchilla") gene affects the colour of the hair shaft, there is a separate "wide-band" gene affecting the distance between the dark bands of colour on agouti hairs.[20] An orange tiger who inherits two copies of this wide-band gene becomes a golden tabby; a white who inherits two copies becomes almost or completely stripeless. Inbreeding allows the effect of recessive genes to show up, hence the ground and stripe colour variations among white tigers.

As early as 1907, naturalist Richard Lydeker doubted the existence of albino tigers.[21] However, we do have a report of true albinism: in 1922, two pink-eyed albino cubs were shot along with their mother at Mica Camp, Tisri, in the Cooch Behar district, according to Victor N. Narayan in a ”Miscellaneous Note” in the Journal of the Bombay Natural History Society. The albinos were described as sickly-looking sub-adults, with extended necks and pink eyes.

White tigers, Siamese cats, and Himalayan rabbits have enzymes in their fur which react to temperature, causing them to grow darker in the cold. A white tiger named Mohini was whiter than her relatives in the Bristol Zoo, who showed more cream tones. This may have been because she spent less time outdoors in the winter.[22] White tigers produce a mutated form of tyrosinase, an enzyme used in the production of melanin, which only functions at certain temperatures (below 98° Fahrenheit). This is why Siamese cats and Himalayan rabbits are darker on their faces, ears, legs, and tails (the colour points), where the cold penetrates more easily. This is called acromelanism, and other cats breeds derived from the Siamese, such as the Himalayan and the snowshoe cat, also exhibit the condition.[23] K.S. Sankhala, who was director of the New Delhi Zoo in the 1960s, observed that white tigers were always whiter in Rewa, even when they were born in New Delhi and returned there. "In spite of living in a dusty courtyard, they were always snow white."[8] A weakened immune system is directly linked to reduced pigmentation in white tigers.

Genetic issues

Outside of India, white tigers have been prone to crossed eyes, a condition known as strabismus, an example of which is "Clarence the cross-eyed lion",[24] due to incorrectly routed visual pathways in the brains of white tigers. When stressed or confused, all white tigers cross their eyes, according to tiger trainer Andy Goldfarb. Strabismus is associated with white tigers of mixed Bengal/Siberian ancestry. The only pure-Bengal white tiger reported to be cross-eyed was Mohini's daughter Rewati. Strabismus is directly linked to the white gene and is not a separate consequence of inbreeding.[25][26][27] The orange littermates of white tigers are not prone to strabismus. Siamese cats and albinos of every species which have been studied all exhibit the same visual pathway abnormality found in white tigers. Siamese cats are also sometimes cross-eyed, as are some albino ferrets. The visual pathway abnormality was first documented in white tigers in the brain of a white tiger called Moni after he died, although his eyes were of normal alignment. The abnormality is that there is a disruption in the optic chiasm. The examination of Moni's brain suggested the disruption is less severe in white tigers than it is in Siamese cats. Because of the visual pathway abnormality, by which some of the optic nerves are routed to the wrong side of the brain, white tigers have a problem with spatial orientation, and bump into things until they learn to compensate. Some tigers compensate by crossing their eyes. When the neurons pass from the retina to the brain and reach the optic chiasma, some cross and some do not, so that visual images are projected to the wrong hemisphere of the brain. White tigers cannot see as well as normal tigers and suffer from photophobia, like albinos.[28]

There is a 450 lbs. male cross-eyed white tiger, named Namaste, at the Pana'ewa Rainforest Zoo in Hawaii, which was donated to the zoo by Las Vegas magician Dirk Arthur.[29] There is a picture of a white tiger which appears to be cross-eyed on just one side in Siegfried & Roy's book "Mastering The Impossible". A white tiger, named Scarlett O'Hara, who was Tony's sister, was cross-eyed only on the right side. Scarlett was the only one of three white tigers born at Kingdoms 3, the Henry County, Georgia animal park in June 1977 to survive. Scarlett was to have undergone an operation to tighten and loosen two muscles to turn the eye straight, which is a fairly routine operation in humans. She was sent to the Grady Memorial Hospital's animal research clinic in Atlanta. Her owner, Baron Julius Von Uhl, was the lion tamer at the park, and his ophthalmologist was to perform the surgery.[30] Scarlett had an adverse reaction to the anaesthesia and died. The Atlanta Zoo veterinarian Morton Silberman said "There is always a chance of there being other genetic defects" and some of these could have effected her ability to withstand anaesthesia.[31] Tiger trainer Alan Gold said that attempts to correct crossed eyes in white tigers through surgery have been unsuccessful because the problem is not in their eyes, it's in their brain. White tigers with crossed eyes are not always born that way; they may develop the condition later in life. Ika, one of the male white tigers from Kesari's 1976 litter, was not cross-eyed as a cub. He developed strabismus later on. Rewati was also not cross-eyed as a cub. Cincinnati Zoo director Ed Maruska commented on white tigers having crossed eyes: "In 52 white tiger births, there were four cases of strabismus, all from the four white offspring of Kesari and Tony. Bhim and Sumita (siblings) were retained and all of their offspring had normal set eyes except one male from their first litter. Because strabismus is of rare occurrence and probably linked to the white coat gene, it is probable that it might be further reduced or even eliminated by selective breeding."[32]

A male white tiger named Cheytan, a son of Bhim and Sumita born at the Cincinnati Zoo, died at the San Antonio Zoo in 1992 from anaesthesia complications during a root canal. It appears that white tigers also react strangely to anaesthesia. The best drug for immobilizing a tiger is CI 744, but a few tigers, white ones in particular, undergo a re-sedation effect 24–36 hours later.[33] This is due to their inability to produce normal tyrosinase, a trait they share with albinos, according to zoo veterinarian David Taylor. He treated a pair of white tigers from the Cincinnati Zoo at Fritz Wurm's safari park in Stukenbrock, Germany, for salmonella poisoning, which reacted strangely to the anaesthesia.[34]

Mohini was checked for Chédiak-Higashi syndrome in 1960, but the results were inconclusive.[35][36] This condition is similar to albino mutations and causes bluish lightening of the fur colour, crossed eyes, and prolonged bleeding after surgery. Also, in the event of an injury, the blood is slow to coagulate. This condition has been observed in domestic cats, but there has never been a case of a white tiger having Chédiak-Higashi syndrome. There has been a single case of a white tiger having central retinal degeneration, reported from the Milwaukee County Zoo, which could be related to reduced pigmentation in the eye.[36][37] The white tiger in question was a male named Mota on loan from the Cincinnati Zoo.

There is a myth, that white tigers have an 80% infant mortality rate. However, the infant mortality rate for white tigers is no higher than it is for normal orange tigers bred in captivity. Cincinnati Zoo director Ed Maruska said: "We have not experienced premature death among our white tigers. Forty-two animals born in our collection are still alive. Mohan, a large white tiger, died just short of his 20th birthday, an enviable age for a male of any subspecies, since most males live shorter captive lives. Premature deaths in other collections may be artifacts of captive environmental conditions... In 52 births we had four stillbirths, one of which was an unexplained loss. We lost two additional cubs from viral pneumonia, which is not excessive. Without data from non-inbred tiger lines, it is difficult to determine whether this number is high or low with any degree of accuracy."[38] Ed Maruska also addressed the issue of deformities: "Other than a case of hip dysplasia that occurred in a male white tiger, we have not encountered any other body deformities or any physiological or neurological disorders. Some of these reported maladies in mutant tigers in other collections may be a direct result of inbreeding or improper rearing management of tigers generally."[39]

Other genetic problems include shortened tendons of the forelegs, club foot , kidney problems, arched or crooked backbone and twisted neck. Reduced fertility and miscarriages, noted by ”tiger man” Kailash Sankhala in pure-Bengal white tigers were attributed to inbreeding depression.[8] A condition known as "star-gazing", which is associated with inbreeding in big cats, has also been reported in white tigers.[40] Some of the white tigers born to North American lines have bulldog faces with a snub nose, jutting jaw, domed head and wide-set eyes with an indentation between the eyes. However, some of these traits may be linked to poor diet rather than inbreeding.

Inbreeding and outcrossing

White tiger at the ZooParc de Beauval in France

Because of the extreme rarity of the white tiger allele in the wild,[8] the breeding pool was limited to the small number of white tigers in captivity. According to Kailash Sankhala, the last white tiger ever seen in the wild was shot in 1958.[8][41][42] Today, there is such a large number of white tigers in captivity that inbreeding is no longer necessary. A white Amur tiger may have been born at Center Hill and has given rise to a strain of white Amur tigers. The white tiger pictured on the right is at the ZooParc de Beauval in France, and came from Center Hill. A man named Robert Baudy realized that his tigers had white genes when a tiger he sold to Marwell Zoo in England developed white spots, and bred them accordingly.[43] The Lowry Park Zoo in Tampa Bay has four of these white Amur tigers, descended from Robert Baudy's stock.

White tiger at the New Delhi Zoo

It has also been possible to expand the white-gene pool by outcrossing white tigers with unrelated orange tigers and then using the cubs to produce more white tigers. The white tigers Ranjit, Bharat, Priya and Bhim were all outcrossed, in some instances to more than one tiger. Bharat was bred to an unrelated orange tiger named Jack from the San Francisco Zoo and had an orange daughter named Kanchana.[44] Bharat and Priya were also bred with an unrelated orange tiger from Knoxville Zoo, and Ranjit was bred to this tiger's sister, also from Knoxville Zoo. Bhim fathered several litters with an unrelated orange tigress named Kimanthi at the Cincinnati Zoo. Ranjit had several mates at the Omaha Zoo.[45]

The last descendants of Bristol Zoo's white tigers were a group of orange tigers from outcrosses which were bought by a Pakistani senator and shipped to Pakistan. Rajiv, Pretoria Zoo's white tiger, who was born in the Cincinnati Zoo, was also outcrossed and sired at least two litters of orange cubs at Pretoria Zoo. Outcrossing is not necessarily done with the intent of producing more white cubs by resuming inbreeding further down the line.

White tiger at the Miami Metrozoo

Outcrossing is a way of bringing fresh blood into the white strain. The New Delhi Zoo loaned out white tigers to some of India's better zoos for outcrossing, and the government had to impose a whip to force zoos to return either the white tigers or their orange offspring.
Siegfried & Roy performed at least one outcross.[46] In the mid-1980s they offered to work with the Indian government in the creation of a healthier strain of white tigers. The Indian government reportedly considered the offer;[47] however, India had a moratorium on breeding white tigers after cubs were born at New Delhi Zoo with arched backs and clubbed feet, necessitating euthanasia.[48] Siegfried & Roy have bred white tigers in collaboration with the Nashville Zoo and they appeared on Larry King with white tiger cubs born at said zoo.

Historical records

White tiger sleeping at the Audubon Zoo in New Orleans, Louisiana

In Rewa, hunters' diaries recorded 9 white tigers in the fifty years prior to 1960. The Journal of The Bombay Natural History Society reported 17 white tigers shot between 1907 and 1933. E.P. Gee collected accounts of 35 white tigers from the wild up to 1959, with still more uncounted from Assam where he had his tea plantation, although Assam, with its humid jungles, was considered a likelier haunt for black tigers by Gee. Some white tigers in the wild had reddish stripes, and were known as "red tigers." The Boga-bagh, or "white tiger," Tea Estate in upper Assam, was named that after two white tigers were shot there in the early 1900s. Arthur Locke writing in "The Tigers Of Trengganu" (1954) mentions white tigers.

In some regions, the animal is part of local tradition. In China, it was revered as the god of the West, Baihu (Byakko in Japan and Baek-ho in Korea), associated with autumn and metal. In South Korea, a white tiger is represented on the taegeuk emblem on the flag – the white tiger symbolising evil, opposite the green dragon for good. In Indian superstition, the white tiger was the incarnation of a Hindu deity, and anyone who killed it would die within a year. Sumatran and Javan royalty claimed descent from white tigers, and the animals were regarded as the reincarnations of royalty. In Java, the white tiger was associated with the vanished Hindu kingdoms and with ghosts and spirits. It was also the icon guardian of the seventeenth century court.

White tigers with dark stripes were recorded in the wild in India during the Mughal Empire (1556–1605). A painting from 1590 of Akbar hunting near Gwalior depicts four tigers, two of which appear white.[11] As many as 17 instances of white tigers were recorded in India between 1907 and 1933 in several separate locations: Orissa, Bilaspur, Sohagpur and Rewa. On January 22, 1939, the Prime Minister of Nepal shot a white tiger at Barda camp in Terai, Nepal. The last observed wild white tiger was shot in 1958, and the mutation is believed to be extinct in the wild.[8] There have been rumors of white tigers in the wild in India since then, but none have been considered credible. It has been suggested from the casual way that Jim Corbett makes reference to a white tigress, which he filmed with two orange cubs, in his "Man-Eaters of Kumaon"[49] that white tigers were nothing out of the ordinary to him. Corbett's black and white film footage is probably the only film in existence of a white tiger in the wild. It illustrates again that white tigers survived and reproduced in the wild. The film was used in a National Geographic docu-drama "Man-eaters of India", about Corbett's life, based on his 1957 book by the same title. One theory of white tigers holds that they were symptomatic of inbreeding as a consequence of over hunting and habitat loss, as tiger populations became isolated. In 1965, there was a chair upholstered with a white tiger skin in the "India collection" of Marjorie Merriweather Post, at her Hillwood estate in Washington D.C., which is now operated as a museum. A color photograph of this item appeared in the November 5, 1965 issue of Life magazine.[50] In the October 1975 issue of National Geographic, there is a photograph of the minister of defense for the United Arab Emirates with a stuffed white tiger in his office.[51] The actor Cesar Romero owned a white tiger skin.

Popular culture

White tigers appear frequently in literature, video games, television and comic books. Such examples include the Swedish rock band Kent, which featured a white tiger on the cover of their best-selling album Vapen & ammunition in 2002. This was a tribute to the band's home town Eskilstuna, as the local zoo in town had white tigers from the Hawthorn Circus as its main attraction. The white tiger has also been featured in the video for the song "Human" by the popular American synth-rock band The Killers. White Tiger is also the name of an American glam metal band from the 1980s.

Aravind Adiga's novel, "The White Tiger", won the Man Booker Prize in 2008. The central character and narrator refers to himself as "The White Tiger". It was a nickname given to him as a child to denote that he was unique in the "jungle" (his hometown), that he was smarter than the others.

Games including white tigers include Zoo Tycoon and the Warcraft universe. Both the Mighty Morphin Power Rangers, and the Japanese Super Sentai series from which the Power Rangers series are based have used White Tiger themed mecha. The White Ranger from Power Rangers: Wild Force and its Sentai counterpart also has the powers of the White Tiger, as well as the White Tiger-themed mecha.

A trained white tiger from the Bowmanville Zoo in Ontario, Canada, was used in the Animorphs TV series. White Tigers are also seen in Heroes of Might and Magic IV, where they are a lvl 2 unit for the nature team. Even White Tiger and The Justice Friends were on Dexter's Laboratory, and a white tiger named White Blaze is frequently shown in the anime Ronin Warriors. White Tigers are featured as a wild, tamable "pet" companion in Guild Wars Factions. Finally, the popularity of white tigers has led private users to create mods or game patches for Elder Scrolls IV: Oblivion which changes the Khajit species to possess white tiger aspects, including realistic height and body sizes in relation to the standard orange Khajit.

Other popular culture mentions include the Beast Wars character Tigatron who transformed into a white tiger, the White Tiger comic book hero and also the outstanding former member of the Kansas State Wildcats men's basketball team Darren "White Tiger" Kent. In the film The Chronicles of Narnia: The Lion, the Witch and the Wardrobe, white tigers are seen fighting for the White Witch.

See also

References

  1. ^ Chundawat, R.S., Habib, B., Karanth, U., Kawanishi, K., Ahmad Khan, J., Lynam, T., Miquelle, D., Nyhus, P., Sunarto, Tilson, R. & Sonam Wang (2008). Panthera tigris. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 9 October 2008.
  2. ^ "Wild Tiger Conservation". Save The Tiger Fund. http://www.savethetigerfund.org. Retrieved 2009-03-07. 
  3. ^ Linnaeus, Carolus (1758). Systema naturae per regna tria naturae:secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis.. 1 (10th ed.). Holmiae (Laurentii Salvii). p. 41. http://www.biodiversitylibrary.org/page/726936. Retrieved 2008-09-08. 
  4. ^ Mills, Stephen, Tiger, Firefly Publications, BBC Books 2004 pg. 133
  5. ^ Leyhausen, Paul, & Reed, Theodore H., "White tiger care and breeding of a genetic freak" Smithsonian April 1971
  6. ^ Miscellaneous Notes. No. I-A WHITE TIGRESS IN ORISSA., Journal Of The Bombay Natural History Society Vol. XIX Nov. 15, 1909 p. 744 http://www.messybeast.com/genetics/tigers-white.htm
  7. ^ Prater, S.H., C.M.Z.S, Curator, Bombay Natural History Society, The book of Indian Animals, Bombay Natural History Society and Prince Of Wales Museum Of Western India, Second (revised) edition 1965, First published in 1948 pg. 54
  8. ^ a b c d e f Sankhala, K.S., Tiger ! The Story Of The Indian Tiger, Simon & Schuster, New York 1977
  9. ^ Dunbar Brander, A.A. (Archibald Alexander), Wild animals in central India, London: E. Arnold, 1923
  10. ^ Miscellaneous Notes: No. 1-A WHITE TIGER IN CAPTIVITY (with a photo) The Journal Of The Bombay Natural History Society Vol. XXVII No. 47 1921 http://www.messybeast.com/genetics/tigers-white.htm
  11. ^ a b "Mutant Big Cats". Messybeast.com. http://www.messybeast.com/genetics/tigers-white.htm. Retrieved May 28, 2009. 
  12. ^ Cahalane, Vicor H., King Of Cats And His Court, National Geographic February 1943 pg. 236
  13. ^ Perry, Richard, The world of the tiger, New York: Athenum 1965 (c. 1964)
  14. ^ Cherfas, Jeremy, Zoo 2000, London, British Broadcasting Corp. 1984
  15. ^ Garhwal Himalayan Expedition, India, Delhi. "Bandhavgarh National Park, National Park in Madhya Pradesh, National Park India, National Park Tour in Madhya Pradesh". Bandhavgarhnationalpark.com. http://bandhavgarhnationalpark.com. Retrieved May 28, 2009. 
  16. ^ Cuvier, Georges (1832). The Animal Kingdomtthey can grow to as tall as. G & C & H Carvill. 
  17. ^ Lydekker, Richard (1893). The Royal Natural History. Frederick Warne. 
  18. ^ Litter of white tigers debuts in Mexico: Zoo known for providing cats for Siegfried and Roy's Las Vegas act July 6, 2007 http://msnbc.msn.com/id/19627911
  19. ^ Sankhala, K.S., Tiger ! The Story Of The Indian Tiger, Simon & Schuster New York 1977
  20. ^ Robinson et al., Roy (1999). Genetics for Cat Breeders and Veterinarians. Butterworth-Heinemann. ISBN 978-0750640695. 
  21. ^ Lydekker, Richard (1907). The Game animals of India, Burma, Malaya and Tibet: Being a now and Rev. Ed. of The Great and Small Game of India, Burma and Tibet. Rowland Ward. 
  22. ^ Leyhausen, Paul and Reed, Theodore H., "The white tiger: care and breeding of a genetic freak." Smithsonian April 1971
  23. ^ McCann Collier, Marjorie, The Siamese Cat A Complete Owner's Manual, Barron's 1992 pg. 39
  24. ^ Geringer, Dan, "Now He's The Cat's Meow" Sports Illustrated Vol. 65 No. July 3, 21, 1986
  25. ^ "Cross-eyed tigers", Scientific American, 229:43 August 1973
  26. ^ Guillery, R.W., & Kaas, J.H., "Genetic abnormality of the visual pathways in a "white tiger", Science June 22, 1973
  27. ^ Bernays, M.E., & Smith, Rie, "Convergent strabismus in a white tiger" Australian Vet J. Vol 77 No. March 3, 1999 http://www.ava.com/avj/9903/99030152.pdf
  28. ^ Gorham, Mary Ellen, Genetic defects do little to mar beauty of India's rare white tigers, DVM March 1986,
  29. ^ Hilo Attractions http://gohawaii.about.com/od/bigisland/ss/hilo_attraction_9.htm
  30. ^ Taylor, Ron, Scarlett Sets Sights On Grady, The Atlanta Journal, Jan. 18, 1978 pg. 2A
  31. ^ Shealy, Larry, Scarlett's Beauty May Have Been Cub's Fatal Flaw, The Atlanta Journal Fri. Jan. 20, 1978 pgs. 1A, 19A
  32. ^ Maruska, Edward J., "White Tiger Phantom Or Freak?", Chapter 33, Part IV White Tiger Politics, Tigers Of The World The Biology, Biopolitics, Management, And Conservation Of An Endangered Species, Noyes Publications, Park Ridge New Jeresey USA 1987 pgs. 377-378
  33. ^ Bush, Mitchell; Phillips, Lindsay G.; & Montali, Richard J.; Clinical Management of Captive Tigers, Tigers Of The World, Biopolitics, Management, And Conservation Of An Endangered Species, Noyes Publications, Park Ridge, New Jersey USA 1987 pg. 186
  34. ^ Taylor, David, Vet On The Wild Side, St. Martin's Press 1991 isbn 978-0312055295
  35. ^ Berrier, H.H., Robinson, F.R., Reed, T.H., & Gray, C.W., "The white tiger enigma" Veterinary Medicine/Small Animal Clinician 1975 467-472;
  36. ^ a b Maruska, Edward J., "White Tiger Phantom Or Freak?", Chapter 33, Part IV White Tiger Politics, Tigers Of The World The Biology, Biopolitics, Management, And Conservation Of An Endangered Species, Noyes Publications, Park Ridge, New Jersey USA 1987
  37. ^ *Beehler, B.A., Moore, C.P., Picket, J.P., "Central retinal degeneration in a white Bengal tiger (Panthera tigris tigris)" Proc. Am. Assoc. Zoo Vet., 1984;
  38. ^ Maruska, Edward J., "White Tiger Phantom Or Freak?", Chapter 33, Part IV White Tiger Politics, Tigers Of The World The Biology, Biopolitics, Management, And Conservation Of An Endangered Species, Noyes Publications, Park Ridge, New Jersey USA 1987 pg. 374
  39. ^ Maruska, Edward J., "White Tiger Phantom Or Freak?", Chapter 33, Part IV White Tiger Politics, Tigers Of The World The Biology, Biopolitics, Management, And Conservation Of An Endangered Species, Noyes Publications, Park Ridge, New Jersey USA 1987 pg. 377
  40. ^ Gorham, Mary Ellen, Genetic defects do little to mar beauty of India's rare white tigers, DVM March 1986
  41. ^ Sunquist, Fiona, "The Secret Of The White Tiger", National Geographic World, Dec. 2000 pg 26
  42. ^ Iverson, S.J., (1982) Breeding White Tigers, Zoogoer 11:5-12;
  43. ^ Mutant Big Cats-White Tigers(Page 2) http://www.messybeast.com/genetics/tigers-white2.htm
  44. ^ Tongren, Sally, To keep them alive, New York: Dembner Books: Distributed by Norton, c 1985.-
  45. ^ Iverson, S.J. (1982) "Breeding white tigers." Zoogoer 11:5-12;
  46. ^ Fischbacher, Siegfried; Horn, Roy Uwe Ludwig, & Tapert, Annette, Siegfried and Roy: mastering the impossible, New York: W. Morrow, c 1992
  47. ^ Rai, Usha, 1987 Will they outlast this century? Times Of India, New Delhi March 15
  48. ^ Rai, Usha, 1987 Will they outlast this century? Times Of India, New Delhi, March 15
  49. ^ Corbett, Jim, "Man-Eaters of Kumaon", Oxford University Press 1946
  50. ^ Mrs. Post's Magnificent World, Life Vol. 59 No. Nov 19. 5, 1965
  51. ^ Putman, John J., "The Arab World Inc." National Geographic Oct. 1975 pgs. 494-533
  • Park, Edwards "Around The Mall And Beyond." Smithsonian September 1979
  • Reed, Elizabeth C., "White Tiger In My House." National Geographic May 1970
  • "Genetic abnormality of the visual pathways in a "white" tiger" R.W. Guillery and J.H. Kaas Science June 22, 1973
  • "Cross-eyed tigers" Scientific American 229:43 August 1973
  • "Now He's The Cat's Meow" Dan Geringer Sports Illustrated Vol. 65 No. July 3, 21, 1986
  • "Here Kitty Kitty: Cincinnati Zoo Breeds Five Rare White Tigers" People Weekly 21:97-9 January 23, 1984
  • "White Tiger: An Indian Maharaja Is Trying To Sell His Rare Cub To A U.S. Zoo." Life 31:69 October 15, 1951
  • "White Tiger From India" Life 49: 47-8 December 19, 1960
  • "Grrr! Ownership of a rare white tiger disputed." The Detroit News February 11, 1975 Section A pg. 3;
  • Sankhala, Kailash, "Tiger !: The story of the Indian tiger/Kailash Sankhala New York Simon & Schuster c1977. (see above references)
  • Bernays, M.E., Smith, Rie "Convergent strabismus in a white tiger." Australian Vet. J. Vol. 77, No. 3, March 1999;
  • "Indian rajah offers to sell rare white cub", N.Y. Times and London Times ads June 22, 1951;
  • "White tiger exports banned, India, N.Y. Times D. 4, 1960 12:2;
  • "'White' Tigress Arrives by Air On Way to Zoo in Washington." N.Y. Times Dec. 1, 1960 pg. 37 L+;
  • "Eisenhower Is Wary as He meets a 'White' Tiger." N.Y. Times Dec. 6, 1960 pg. 47 L+;
  • Husain, Dawar "Breeding And Hand-Rearing Of White Tiger Cubs Panthera tigris At Delhi Zoo." The International Zoo Yearbook Vol VI 1966
  • Bruning, Fred, "Hall Has A White Tiger by the Handle." The Miami Herald Jan. 14, 1968;
  • "Lady Is A Tiger." The Miami Herald Jan. 19, 1968;
  • Roychoudhury, A.K., The Indian White Tiger Studbook (1989);\
  • "2 tiger cubs, rare Siberian, born at fair" The Baltimore Sun, Monday, June 28, 1976 page C.1;
  • "President Gets White Tiger for National Zoo" The Philadelphia Inquirer Tuesday Morning Dec. 6, 1960
  • "Death of white tiger" Washington Post July 9, 1971 pgs. B1, B5
  • Greenberg, Robert I, "White Tigress Visits Zoo for 3 Days And Monkeys See Red" The Philadelphia Inquirer Saturday Morning Dec. 3, 1960
  • "White Tiger At Zoo For Three-Day Visit" The Evening Bulletin, Philadelphia, Friday Dec. 2, 1960
  • "He's Not Enchanted: Eisenhower Accepts Tigress-Distantly" The Bulletin, Philadelphia, Dec. 6, 1960
  • "20 year old Mohini Rewa put to death at National Zoo" Washington Post April 3, 1979 pg. B1
  • D.C. born white tiger killed by mate in Columbus (Ohio) zoo" Washington Post July 8, 1983 pg. B3
  • Greed, R.E., "White Tigers, Panthera tigris, At Bristol Zoo" The International Zoo Yearbook Vol. V 1965
  • Sankhala, Kailash "Breeding Behavior of The Tiger Panthera tigris In Rajasthan" International Zoo Yearbook Vol. VII 1967 pg. 133
  • "White Bengal tiger imported for Longleat safari park" The London Times March 22, 1989 pg. 3d
  • "White tigers at Bristol Zoo" The London Times August 17, 1963 pg. 8b.
  • "Siberian tiger cubs born at Como Zoo" The New York Times July 23, 1958 pg. 40:2
  • Hanna, Jack "Monkeys On The Interstate" Doubleday Dell Publishing Group Inc. 666 Fifth Ave. New York New York 10103 1989 pgs. 206-209, 211, 216-217
  • Maruska, Edward J., 33. "White Tiger Phantom or Freak?", Part VI White Tiger Politics, Tigers of The World The Biology, Biopolitics, Management, and Conservation of an Endangered, Species Noyes Publications, Park Ridge, New Jersey USA 1987
  • Roychoudhury, A.K., 34. "White Tigers and Their Conservation" White Tiger Politics 1987
  • Simmons, Lee G., 35. "White Tigers The Realities" White Tiger Politics 1987
  • Latinen, Catherine, 36. "White Tigers and Species Survival Plans" White Tiger Politics 1987
  • Isaac, J., 1984 Tiger Tale. Geo 6 (August) 82-86
  • Gee, E.P., 1964 "The White Tigers" Animals 3:282-286
  • Gee, E.P., 1964 "The Wildlife of India" London: Collins.
  • Stracey, P.D., "Tigers" London: Barker; New York: Golden P., 1968
  • Mazak, Vratislav, Der Tiger, Wittenberg Lutherstadt: Ziemensen, 1983
  • Perry, Richard, The World of the Tiger, New York: Atheneum 1965 (c. 1964)
  • Gee, E.P., "Albinism And Partial Albinism In Tigers", Journal of the Bombay Natural History Society, 1959, Vol. 56, pages. 581-587
  • Van Nostrand, Mary L., "Mohan The Ghost Tiger of Rewa", Zoonooz May 1984 pgs. 4-7
  • Sunquist, Fiona "The Secret Of The White Tiger" National Geographic World Dec. 2000 pg. 26
  • "Verdict upheld in cubs case", The Baton Rouge Advocate, Nov. 16, 1986 (story concerning the theft of five white tiger cubs by a veterinarian from the Hawthorn Circus in 1984. Two died. The cubs were taken to Louisiana.)
  • "Rewati", Columbus ZooViews, Autumn 1981
  • Sayler, H.L., The White Tiger Of Nepal, Reilly & Britton Co. 1912
  • Culver, Lynn, White Tigers; History, Breeding, And Genetics http://www.exoticcatz.com/sptigerwhite.html
  • An Albino Tiger From The Central Provinces, Journal Of The Bombay Natural History Society, Miscellaneous Notes. Vol. XXIV No. 4 pg. 819 1916 http://www.messybeast.com/genetics/tigers-white.htm
  • Miscellaneous Notes. No. I-A WHITE TIGRESS IN ORISSA, The Journal Of The Bombay Natural History Society, Vol. XIX Nov. 15, 1909 pg. 744 http://www.messybeast.com/genetics/tigers-white.htm
  • Guggisberg, C.A.W., Wild Cats Of The World, Taplinger Publishing Co. INC. New York, New York 1975 pg. 186
  • Rare tigers born at fair, The New York Times June 28, 1976
  • First white tiger in Africa, Zoon No.29 1988-4
  • How to breed a white tiger, Zoon No.29 1988-4
  • Tahir, Zulqernain, Virus claims lives of two zoo tigers, Dawn April 20, 2006 http://www.dawn.com/2006/04/20/nat31.htm
  • Ahmed, Shoaib, Another zoo tiger dies, Dawn Monday March 19, 2007 http://www.dawn.com/2007/03/19/nat6.htm
  • Das, Prafulla, Ten tigers die at Nandankanan Zoo, The Hindu Thursday July 6, 2000 http://www.hindu.com/2000/07/06/stories/01060002.htm
  • Chattopadhayay, Suhrid Sankar, in Bhubaneswar, The Nandankanan tragedy: The death of 12 tigers in an Orissa zoo raises important questions about the care and management of wild animals in captivity, Frontline Vol. 17 issue 15, July 22- Aug. 04, 2000 http://www.hindu.com/thehindu/fline/fl1715/17150820.htm
  • Photo News: White tigers at Nandankanan Zoo http://www.newkerala.com/photo-news.php?action=fullnews&id=136
  • Roychoudhury, A.K., 1978 A study of inbreeding in white tigers. Sci. Cul. 44:371-72
  • Roychoudhury, A.K., & L.N. Acharjyo. 1983. Origin of white tigers at Nandankanan Biological Park, Orissa. Indian J. Exper. Biol. 21:350-52
  • Roychoudhury, A.K., & K.S. Sankhala. 1979. Inbreeding in white tigers. Proc. Indian Acad. Sci. 88:311-23.
  • Simmons, J. 1981. White tiger enchantment. American Way Oct.: 82-84
  • Anonymous. 1983 The rare propagating white tigers of the Cincinnati Zoo. Marathon World No. 2:18-21
  • Geringer, Dan, Now He's The Cat's Meow, Sports Illustrated Vol. 65 No. July 3, 21, 1986
  • Bhadura, R.S., 1987 An enigma birth of white tiger at Kanpur Zoological Park, Zoo's Print 2(8): 9-10
  • Roychoudhury, A.K., White Tigers Their Roots and Branches, Centre of Demographic and Population Genetics, University of Texas, Health Science Centre, Houston, Texas 77025
  • Sharma, K.K., 1988 Birth of a White Tiger in Jaipur Zoo, Zoo's Print 3(11):6
  • Roychoudhury, A.K., 1980 Is There Any Lethal Gene In The White Tiger Of Rewa? Current Science 49:518-520
  • Divyabhanusinh, 1980 The Earliest Record Of A White Tiger (Panthera tigris), Journal Of The Bombay Natural History Society. 83 (Supplement):163-165
  • Mishra, C.G., Acharjo, L.N., Choudhury L.N., 1982 Birth Of A White Tiger Cub (Panthera tigris) To Normal-Coloured Tigers In Captivity Journal Of The Bombay Natural History Society, 79:404-406
  • Roychoudhury, A.K., 1980 White Tigers Threat To Their Survival, Probe (India) Issue March 1980 pgs. 10-11
  • Murtaugh, J.,1980, A Genetic Analysis Of The North American Population Of White Tigers with Recommendations for Future Management. Natl. Zool. Park Rep. Washington D.C.
  • Fay, J. 1983 White tigers, A rare cat makes zoo news. 3-2-1-Contact, Feb. :4-8.
  • Acus, D., The coming of the white tiger. Anim. Keeper's Forum 13(2):43
  • Roychoudhury A.K. 1985 Tiger! Tiger! Burning white, Sci Today 19(3):16-8
  • Roychoudhury A.K. 1988 Origin of white tiger at Patna Zoo, Zoo's Print 4:8-9
  • Ross, J. 1983 El tigre blanco: El "Tiger Fantasma" de la India, Geo Mundo 466-473
  • Kelly, D.F., H. Pearson, A.I. Wright & L.W. Greenham. 1980 Morbidity in captive white tigers. In: The Comparative Pathology of Zoo Animals, eds. R.J. Montali & G.M. Migaki pp. 183–8 Smithsonian Institution Pr. Washington DC
  • Oswald, A. 1960 The White Tigers of Rewa, Cheetal 2(2):63-7
  • Sandhu, J.S., & Dhindsa, M.S. 1986 On breeding and conservation of White Tiger. Tiger Paper. 13(4):25-7
  • Pant, M.M., & I.D. Dhariya. 1979 White tiger progeny-its economic potentialities. In International Symposium on Tiger, pp. 294–7. Project Tiger, Govt. India. Dept. Environ. New Delhi
  • Naidu, M.K., 1987 White tiger at National Zoo, New Delhi. Zoo's Print 2(10):13-4
  • Anonymous. 1987. White tigers weak in sex. Hindustan Times (New Delhi) July 9
  • Anonymous. 1979 Brown cubs to white tigress. Times of India (new Delhi) Oct. 10
  • Anonymous. 1989. White tigers for Texas. Zoo's Print 4(3):3-4
  • Naidu, M.K., 1978. White tigress of Nehru Zoological Park, Wild News 6(1):7
  • Robinson, R. 1969 The white tigers of Rewa and Gene Homology in the Felidae, Genetica 40:198-200
  • Robinson, R. 1969 The white tigers of Rewa, Carnivore Genetics Newsletter 8:192-3
  • Ross, J. 1982 The white tiger enigma, Your Cincinnati Zoo News Spring 10-4
  • Sankhala, K.S., 1969 The white tigers, Cheetal 12(1):78-81.
  • Street, P. 1964 The fabulous white tigers. Animal Life Jul: 36-7
  • Thomas, W.D., 1982 The ghost tigers of Asia, Zooview 16(3):15
  • Walker, S., 1984 Gnu's Letter 2(11):8-12.
  • Tilson, R.L., 1992 No stamp of approval for white tiger postage stamp. Zoo Biology 11:71-3.
  • Anonymous 1979 White tigers paralyzed. Hindustan Times (New Delhi) December 6.
  • Anonymous 1980 White tigress dead. Times of India (New Delhi) September 19.
  • Saharia, V.B., 1979 Population dynamics in captive tigers. Wild News 7:37-40.
  • Wallace, J., 1987 Tiger, Tiger, Safari: The Magazine of the Toledo Zoo. 3(2):13.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!