Overview

Brief Summary

The Leopard (Panthera pardus) has an extremely broad distribution across Africa and South and Southeast Asia. Leopards are found throughout Africa where there is sufficient cover and from the Arabian Peninsula through Asia to Manchuria and Korea. In the African rainforests and Sri Lanka, the Leopard is the only large predator. The black spot seen in the center of each rosette on a Jaguar's coat is typically lacking in Leopards. Melanistic Leopards ("black panthers"; melanistic Jaguars may also be referred to by this name) sometimes occur in several parts of Africa, but are more common in Thailand, Malaysia, and Java (Indonesia).

Leopards are found in an extraordinary range of habitats. In sub-Saharan Africa, they may be found in any habitats with annual rainfall greater than 50 mm, as well as along rivers penetrating true deserts. Leopards in the Kalahari Desert can reportedly go 10 days without drinking. In deserts with temperatures reaching 70 C, Leopards can survive by seeking shelter during the day in caves, animal burrows, and dense vegetation. In Central and West Africa, Leopards occur in rainforests receiving more than 1500 mm annual rainfall. Leopards are common throughout the Indian subcontinent in savannahs, acacia grasslands, deciduous and evergreen forests, and scrub woodlands. They may occur to 5200 m elevation in the mountains of Pakistan and Kashmir. In Southeast Asia, they occur in dense primary rainforest, among other habitats. In the Russian Far East, they may be found in forested mountainous regions where the snow is less than 15 cm deep. Leopards are capable of persisting in close proximity to humans.

The diet of the Leopard is highly varied, including both large and small prey. It often consists mainly of small and medium-sized mammals (5 to 45 kg), but may range from large beetles to ungulates (hoofed mammals) several times their size. Most hunting occurs at night. Sunquist and Sunquist (2009) review the diet of Leopards as reported from different portions of their range.

Like other felids (i.e., members of the cat family), Leopards commonly kill their prey with a bite to the throat, although smaller prey may be dispatched with a bite to the nape or back of the head. Large prey items may be dragged up into a tree and cached there, especially in Africa, where carcasses may otherwise be taken over by hyenas or lions. In Sri Lanka, where the Leopard is the only large carnivore, Leopards are reportedly often seen in open areas during the day.

In the wild, mating associations last just a day or two. The gestation period is around 96 days and young are born at 400 to 600 g. Litter size is typically one to three young (usually two, maximum six). Young travel with their mother starting at three to six months (when they weigh around three or four kg) and begin to eat meat. Permanent canines are emerged at around seven to eight months and the young are typically independent by 12 to 18 months (athough sometimes significantly later). Sexual maturity is reached at two to three years of age.

In some parts of their range, Leopards are endangered, whereas in other places they are considered pests.

(Estes 1991; Sunquist and Sunquist 2009)
  • Estes, R.D. 1991. The Behavior Guide to African Mammals. University of California Press, Berkeley.
  • Sunquist, M.E. and F.C. Sunquist. 2009. Family Felidae (Cats). Pp. 54-168 in: Wilson, D.E. and R.A. Mittermeier (eds.). Handbook of the Mammals of the World. Vol. 1. Carnivores. Lynx Edicions, Barcelona.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Leo Shapiro

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Comprehensive Description

Description

Male bigger and heavier than female. A large, powerfully-built cat. Orange-buff to pale yellow above, white below. Spotted all over though less densely below and inside the legs. Spots arranged in rosettes (especially on the flanks and hindquarters), the inside of each rosette being slightly darker than the background color. Head large and powerful, spotted more finely than rest of body. Chin white. Ears rather small, marked black and white behind. Tail long, spotted as body for basal half after which the spots amalgamate to form incomplete rings. Underside white. Cub, based on one poorly preserved skin, is paler and grayer with longer fur.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leopards are large spotted cats with long muscular bodies, but a sizable portion of their population is melanistic (solid black), especially in forest habitats. Whether spotted or black, this species’ camouflage is so effective that biologists report being unable to see them, even when only a few yards away.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The leopard occurs across most of sub-Saharan Africa, as remnant populations in North Africa, and then in the Arabian peninsula and Sinai/Judean Desert (Egypt/Israel/Jordan), south-western and eastern Turkey, and through Southwest Asia and the Caucasus into the Himalayan foothills, India, China and the Russian Far East, as well as on the islands of Java and Sri Lanka (Nowell and Jackson 1996; Sunquist and Sunquist 2002; Hunter et al. in press).

In sub-Saharan Africa, leopards remain widely, albeit now patchily, distributed within historical limits (see Hunter et al. in press, and references therein). Ray et al. (2005) estimated that leopards have disappeared from at least 36.7% of their historical range in Africa. The most marked range loss has been in the Sahel belt, as well as in Nigeria and South Africa. They have been locally extirpated from areas densely populated with people or where habitat conversion is extreme (Hunter et al. in press). They are likely extinct on Zanzibar, where there have been no confirmed records since 1996 (Hunter et al. in press).

In North Africa, a tiny relict population persists in the Atlas Mountains of Morocco (Cuzin 2003), and there was a probable observation on the Morocco-Algerian border in Figuig in 2007 (F. Cuzin pers. comm.), while a population was recently found in the Ahaggar of south-eastern Algeria, a region from which they had not previously been recorded (Busby et al. 2006). Leopard are likely extinct in Egypt, although they may occur in the Eastern Desert (Hunter et al. in press).

A 2006 Arabian Fauna Conservation Workshop estimated there were fewer than 200 leopards remaining on the Arabian peninsula, in three confirmed separate subpopulations: the Negev desert, the Wada'a mountains of Yemen, and the Dhofar mountains of Oman. Presence in Saudi Arabia is uncertain (Breitenmoser 2006, Spalton and Al Hikmani 2006).

I. Khorozyan (pers. comm. 2008) compiled detailed country information on the distribution of the Endangered Persian leopard as follows:

Russian North Caucasus: mountain ridges in the headwaters of the Avarskoe Koisu and Andiiskoe Koisu rivers (Republic of Dagestan). Possibly exists in the Chegem River canyon (Kabardino-Balkarian Republic); Erzi Reserve, Assa River valley (Republic of Ingushetia); Armkhi River basin (Republic of North Osetia-Alania), headwaters of the Sharoargun and Argun rivers (Chechen Republic) (Akkiev and Mokaev, 2006; Khorozyan and Abramov, 2007; Lukarevsky et al., 2007).

Georgia: Vashlovani Reserve in the south-east; Arkhoti River canyon in the upper part of the Assa River basin and the headwaters of the Andiiskoe Koisu River in the north-east (Lukarevsky et al., 2007). Some anecdotal records from south-western Georgia are either unreliable or can be attributed to individuals coming from north-eastern Turkey (Arabuli, 2006; Khorozyan and Abramov, 2007).

Armenia: south-western and southern parts of the country from Khosrov Reserve to the Armenian-Iranian state border throughout the Geghama, Zangezur, Aiotsdzor, Bargushat and Meghri ridges. The range boundaries are the Azat River in the north-west; Vardenis Ridge in the north; semi-desert of the Ararat Valley in the west; state border with Azerbaijan and the alpine meadow/nival belt transition zone in the south-west and east; Arax River basin along the Armenian-Iranian border in the south. Until the early 1970s it lived also in north-eastern parts of Armenia (Khorozyan et al., 2005; Khorozyan and Abramov, 2007).

Azerbaijan: Talysh Mts. in the extreme south-east, Akhar-Bakhar Ridge of the Iori-Mingechaur Highland in the north-west and the Zangezur Ridge in the Nakhichevan Republic along the state border with Armenia in the west (Lukarevsky et al., 2007).

Nagorno-Karabakh Republic: distribution in Shushi, Mardakert and Hadrut districts and in the adjoining Kelbajar district was recorded in 1941-1967 (Alekperov, 1966; Sludsky, 1973). Up-to-date information on leopard status is impossible to obtain for the political tension between Armenia and Azerbaijan over this republic, even though it plays a vital role as a corridor between the southern (Armenia, Azerbaijan?s Nakhichevan Republic), central (Iori-Mingechaur Highland in Azerbaijan and Vashlovani Reserve in Georgia) and northern (Russian North Caucasus) parts of the Caucasus (Khorozyan and Abramov, 2007).

Iran: virtually all country, except the vast deserts of Desht-e-Kevir and Desht-e-Lut in central and eastern parts. Particularly common in the Alborz Mts. along the southern fringe of the Caspian Sea. Quite common in protected areas (e.g., Tandooreh, Sarigol, Bafgh, Golestan, Kolah?ghazy, Touran, Kavir, Khojir, Khabr and Bamu national parks; Kiamaki and Naybandan wildlife refuges; Jahan Nama, Central Alborz, Varjin, Arasbaran, Dena and Bahram?gur protected areas) and some unprotected lands (Chapur-Ghoymeh, Safee Abad-Dozain or Minoo Dasht, Ramsar, Khaeez and Darestan-Rudbar) (Joslin and Shoemaker 1988; Kiabi et al., 2002; Farhadinia et al. 2007; Abdoli et al. 2008; M Farhadinia and A. Ghoddousi pers. comms., 2008).

Turkey: north-east (around the Artvin city), east (vicinities of Mt. Ararat or Agri) and south-east (Bitlis Ridge). Possibly exists in the mountains of the Black Sea coast and south-westwards to the Taurus Mts. (H. Diker pers. comm., 2008). It is unclear whether leopards still survive in western Turkey.

Turkmenistan: western Kopetdag Ridge, central Kopetdag Ridge, eastern Kopetdag Ridge, Badkhyz Reserve and Giaz-Gyadyk Ridge (Lukarevsky, 2001).

Afghanistan: central (Hindu Kush, Kohe Baba, Kohe Paghman and Safed Koh ranges of the central highlands), north-eastern (Wakhan corridor) and northern (Darkad peninsula of Badakshan) parts of the country (Habibi, 2004).

In the Central Asian republics, leopard distribution is poorly known. Historically, leopards had a wider distribution in Turkmenistan, and were found in parts of Uzbekistan and Tajikistan. An old male leopard was killed by a local hunter in January 2000 in Kazakhstan, the first record of the species in this country, in a location over 600 km from possible occurrences in Uzbekistan and Tajikistan, and over 1,200 km from known occurrences in Turkmenistan. It is aplso possible that the leopard travelled along the foothills of the Pamirs, then proceeded via the Ugam and Pskem ranges into the Talas river valley. Habitat appears to be suitable, but the existence of any leopard subpopulation in any of these three countries is uncertain (Shakula 2004).

In Pakistan, the leopard is thinly distributed in montane areas, and there have only been a handful of confirmed records in recent years (Ahmed 2001).

Leopards occur widely in the forests of the Indian sub-continent, through Southeast Asia and into China, although they are becoming increasingly rare outside protected areas. They are not found on the islands of Borneo or Sumatra (Nowell and Jackson 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

There are nine subspecies of Panthera pardus, which are distributed as follows: Panthera pardus pardus is in Africa; Panthera pardus nimr, Arabia; Panthera pardus saxicolor, Central Asia; Panthera pardus melas, Java; Panthera pardus kotiya, Sri Lanka; Panthera pardus fusca, the Indian sub-continent; Panthera pardus delacourii, southeast Asia into southern China; Panthera pardus japonensis, northern China; and Panthera pardus orientalis, far east Russia, on the Korean peninsula and in north-eastern China.

Biogeographic Regions: palearctic (Native ); oriental (Native ); ethiopian (Native )

  • Breitenmoser, U., C. Breitenmoser-Wursten, P. Henschel, L. Hunter. 2008. "IUCN Red List" (On-line). Panthera Pardus. Accessed March 18, 2009 at http://www.iucnredlist.org/details/15961.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

31 records. Latest in 1996 (Wadi El-Omaiyed, South Sinai).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Localized (South Sinai). AOO=92.4 km². EOO=259274 km². 7 locations. Records from mainland Egypt (Red Sea, Western Desert) are old and probably imply extinction here; clear indications of decline in occupancy in Sinai since 1950, and may already be extinct. Still extant in neighbouring Saudi Arabia where sites nearest to Sinai are between Tabuk and El Ula (Al Johany 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (Africa east to China, Vietnam and Java).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Africa, Asia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Body size and color patterns of leopards varies geographically and probably reflects adaptations to particular habitats. Leopards have short legs relative to their long body. They have a broad head, and their massive skull allows for powerful jaw muscles. The leopard's scapula has specialized attachment sites for climbing muscles. They have small round ears, long whiskers extending from dark spots on the upper lip, and long whiskers in their eyebrows that protect their eyes while moving through dense vegetation. Their coat ranges from tawny or light yellow in warm, dry habitats to reddish-orange in dense forests. Subspecies are distinguished according to unique pelage characteristics. Their body is covered with black rosettes, which are circular in East Africa and square in South Africa. They have solid black spots on their chest, feet, and face and rings on their tail. Cubs have a smoky gray coat and their rosettes are not yet distinct. Each individual has a unique coat, which can be used for identification. Black panthers, which are most populous in humid forests, are leopards with recessive melanistic genes. Savannah and woodland leopards tend to be relatively large while mountain and desert leopards tend to be relatively small. Leopards are sexually dimorphic as males tend to be larger than females. Females range in body mass from 17 to 58 kg and in length from 1.7 to 1.9 m. Males range in mass from 31 to 65 kg and in length from 1.6 to 2.3 m.

Range mass: 17 to 65 kg.

Range length: 1.6 to 2.3 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Nowell, K., P. Jackson. 1996. Wild Cats: status survey and conservation action plan. Gland, Switzerland: IUCN.
  • 1997. "Thinkquest: Library" (On-line). Wild Habitat: Leopard (Panthera pardus). Accessed March 18, 2009 at http://library.thinkquest.org/11234/leopard_any.html.
  • Hunter, L., G. Hinde. 2005. Cats of Africa: Behavior, Ecology, and Conservation. United Kingdom: New Holland Publisher.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length 95-100 cm, weight 37-90 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Panthera pardus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): E. Heller
Year Collected: 1910
Locality: Gondokoro, Sudan, Africa
  • Type: Heller, E. 1913 Nov 08. Smithsonian Miscellaneous Collections. 61 (19): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Panthera pardus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): P. Rainey & E. Heller
Year Collected: 1911
Locality: S. N'Guaso Nyiro River, Loita Plains, Aggate'S Farm, Kenya, Africa
  • Type: Heller, E. 1913 Nov 08. Smithsonian Miscellaneous Collections. 61 (19): 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Taxonomy

Osborn & Helmy (1980) suggested two ssp in Egypt, the type spp (Egypt) and nimr Hemprich & Ehrenberg (Sinai).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The leopard has the widest habitat tolerance of any Old World felid, ranging from rainforest to desert. In Africa, they are most successful in woodland, grassland savanna and forest but also occur widely in mountain habitats, coastal scrub, swampy areas, shrubland, semi-desert and desert. They range from sea level to as much as 4,600 m on Mt Kenya (Hunter et al. in press). In Southwest and Central Asia, leopards formerly occupied a range of habitats, but now are confined chiefly to the more remote montane and rugged foothill areas. Through India and Southeast Asia, Leopard are found in all forest types, from tropical rainforest to the temperate deciduous and alpine coniferous (up to 5,200 m in the Himalaya), and also occur in dry scrub and grasslands (Nowell and Jackson 1996).

Leopards have extremely catholic diets including more than 90 species in sub-Saharan Africa, ranging from arthropods to large antelope up to the size of adult male Eland Tragelaphus oryx (Hunter et al. in press). Densities vary with habitat, prey availability, and degree of threat, from fewer than one per 100 km² to over 30 per 100 km², with highest densities obtained in protected East and southern African mesic woodland savannas (Hunter et al. in press).

A study in Thailand found a home range of 8.8 km² for a radio-collared female, and 17.3-18 km² for two adult males (Grassman 1998). Important prey species were hog badger Arctonyx collaris (45.9%), muntjac Muntiacus muntjak (20.9%) and wild pig Sus scrofa (6.3%).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Leopards inhabit a variety of terrain. They are most populous in mesic woodlands, grassland savannas, and forests. They also occupy mountainous, scrub, and desert habitats. They favor trees throughout their entire geographic distribution, and have been recorded at 5638 meters on Mt. Kilimanjaro.

Range elevation: 5638 m (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest ; mountains

  • 2009. "African Wildlife Foundation" (On-line). Leopard. Accessed March 18, 2009 at http://www.awf.org/content/wildlife/detail/leopard.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Very wide, ranging from deep forest to near desert. In Egypt, the Leopard, with the exception of the Western Desert record, has been found in mountainous areas of Gebel Elba that are lightly wooded with Acacia spp.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leopards could, at one time, be found throughout the Old World from Europe and Africa to Asia. Although fragmented Asian populations exist, Africa is their remaining stronghold. The versatile leopard inhabits dense lowland forests, rugged mountains, savanna, bush and even semi-deserts.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Leopards are ambush predators, pouncing on their prey before it chance to react. They approach potential prey by crouching low to the ground, getting as close as 3 to 10 m to prey before pouncing. Leopards are not likely to chase prey after the first pounce. Once a prey item is captured, they immediately break the prey's neck, causing paralysis. After breaking the prey's neck, leopards asphyxiate them and carry the carcass to a secluded feeding location, typically in a nearby tree. They may also cover prey carcasses in leaves and soil. Their tremendous strength allows them to tackle prey up to 10 times their own weight.

Leopards generally prey upon mid-sized ungulates, which includes small antelopes (Bovidae), gazelles (Gazella), deer (Cervidae), pigs (Sus), primates (Primates) and domestic livestock. They are opportunistic carnivores and eat birds (Aves), reptiles (Reptilia), rodents (Rodentia), arthropods (Arthropoda), and carrion when available. Leopards prefer prey that weigh between 10 and 40 kg. They are also known to scavenge from cheetahs (Acinonyx jubatus), solitary hyenas (Hyaenidae), and smaller carnivores as well. They are known to cache food and may continue hunting despite having multiple carcasses already cached.

Animal Foods: birds; mammals; reptiles; fish; carrion ; insects

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

  • Hayward, M., P. Henschel, J. O'Brien, M. Hofmeyr, G. Balme, G. Kerley. 2006. Prey Preferences of the Leopard (Panthera pardus). Journal of Zoology, 270/2: 298-313. Accessed April 08, 2009 at http://www3.interscience.wiley.com.proxy.lib.umich.edu/journal/118623979/abstract?CRETRY=1&SRETRY=0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Leopards compete for food with lions (Panthera leo), tigers (Panthera tigris), spotted hyenas (Crocuta crocuta), and African wild dogs (Lycaon pictus). To avoid attacks from potential predators, leopards tend to hunt at different times of the day and avoid areas where potential predators are most populous. When competition for larger prey items is high, leopards prey on smaller animals, which reduces interspecific competition. Leopards are host to many common felid parasites, including lung flukes (Paragominus westermani), flat worms (Pseudophyllidea), spirurian nematodes (Spiruroidea), hookworms (Ancylostomatidae), lung worms (Aelurostrongylus), intestinal and hepatic parasites (Capillaria), and parasitic protozoa (Sarcocystis).

Commensal/Parasitic Species:

  • Patton, S., A. Rabinowitz. 1994. Parasites of Wild Felidae in Thailand: a Coprological Survey. Journal of Wildlife Diseases, 30(3): 472-475. Accessed April 08, 2009 at http://www.jwildlifedis.org/cgi/content/abstract/30/3/472.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans are the primary predator of leopards. Leopards are hunted as trophy animals for their fur, and retaliatory killings by farmers protecting their livestock are not uncommon. Lions (Panthera leo), tigers (Panthera tigris), spotted hyenas (Crocuta crocuta), and African wild dogs (Lycaon pictus) prey upon leopard cubs and are capable of killing adult leopards. Typically, when an adult is killed it is due to a territorial confrontation. Many of the characteristics that make leopards great predators also serve as excellent predator defense mechanisms. For example, a leopard's spots allows them to travel inconspicuously and avoid detection.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Panthera pardus is prey of:
Crocodylidae
Canis lupus
Panthera leo
Panthera tigris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predator: prey includes wildebeest, impalas, reed-bucks, Thomson's gazelles, jackals, baboons and storks.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Although leopards are silent most of the time, they may give a hoarse, rasping cough at repeated intervals to advertise their presence to conspecifics. Males use this unique call to announce territorial boundaries. If another leopard is in the vicinity, it may answer with a similar vocalization and continue vocalizing as it exits the area. Males also grunt at each other and females call to potential mates when in estrous. Some leopards may purr while feeding.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Heavily persecuted in Egypt and probably only active at night. Extremely wary and elusive. Diet large to small mammals, birds, reptiles, large insects, eggs, and livestock. The intensively stud­ied Leopard population in the neighboring Negev Desert feeds large­ly on Capra ibex. Older animals, not able to take Ibex, switch to Rock Hyrax Procavia capensis. Hunts by hearing and sight. Needs water but can go a month without. Scent good. Solitary and territo­rial though nothing known of territory size in Egypt. Likely to be large due to low density of prey species. Nothing known of repro­duction in Egypt. Elsewhere, gestation 90-112 days, female giving birth to 1-6 cubs (2-3 norm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leopards are probably the most accomplished stalkers and climbers of the big cats. Their varied diet includes wildebeest, impalas, reed-bucks, Thomson's gazelles, jackals, baboons and storks. They routinely drag carcasses bigger than themselves into trees to avoid losing prey to other carnivores.

Leopards are most active at night and generally solitary. Females den in caves, crevices, thickets, or hollow trees and give birth to two to three cubs, of which only one or two will survive. Cubs hunt with their mother at about three months of age and remain with her for another two years.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In captivity, leopards can live to be 21 to 23 years old, with the oldest known individual being 27 years old. Wild leopards may live to be 10 to 12 years old, with the oldest known individual being 17 years old. Survival rates for cubs range from 41% to 50%.

Range lifespan

Status: wild:
17 (high) years.

Range lifespan

Status: captivity:
27 (high) years.

Typical lifespan

Status: wild:
10 to 12 years.

Typical lifespan

Status: captivity:
21 to 23 years.

  • Guggisberg, C. 1975. Wild Cats of the World. New York: Taplinger Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.3 years (captivity) Observations: One specimen lived 27.3 years at Madrid Zoo. A hybrid between a leopard and a lion lived for 24 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Leopards are promiscuous, as both males and females have multiple mates. Females attract potential mates by excreting pheromones in their urine. Females initiate mating by walking back and forth in front of a male and brushing up against him or swatting him with her tail. The male then mounts the female while frequently biting her nape. Copulation last an average of three seconds with six minute intervals between each copulation bout. A single breeding pair may copulate up to 100 times per day for several days, during which time they share food resources.

Mating System: polygynandrous (promiscuous)

The reproductive season is year-round but peaks during the rainy season in May. In China and southern Siberia, leopards mainly breed in January and February. Females are in estrus for 7 days and have a 46 day long cycle. Gestation last 96 days and females usually give birth once every 15 to 24 months. Typically, females stop reproducing around 8.5 years old.

Breeding interval: Leopards breed every 15 to 24 months

Breeding season: Leopards breed year-round, with a peak during the rainy season

Range number of offspring: 2 to 3.

Average gestation period: 96 days.

Average birth mass: 500 g.

Average weaning age: 3 months.

Range time to independence: 13 to 18 months.

Average age at sexual or reproductive maturity (female): 2.5 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 550 g.

Average gestation period: 97 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
771 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
937 days.

Leopard cubs weigh less than 1 kg at birth, and their eyes remain closed for the first week. Mothers leave their cubs in the protection of dense bush, rock clefts, or hollow tree trunks for up to 36 hours while hunting and feeding. They move den sites frequently, which helps prevent cubs from falling prey to lions and other predators. Cubs learn to walk at 2 weeks of age and regularly leave the den at 6 to 8 weeks old, around which time they begin to eat solid food. Mothers share less than a third of their food with their cubs. Cubs are completely weaned by 3 months old and independent at just under 20 months old. Often, siblings maintain contact during the early years of independence. Territories are flexible and young may linger in their natal area.

Parental Investment: altricial ; female parental care ; pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Friedman, H., V. Case. 2002. "Davidson" (On-line). Leopard (Panthera Pardus). Accessed March 25, 2009 at http://www.bio.davidson.edu/people/vecase/behavior/Spring2002/Friedman/friedman.html.
  • Hunter, L., G. Hinde. 2005. Cats of Africa: Behavior, Ecology, and Conservation. United Kingdom: New Holland Publisher.
  • Laman, T., C. Knott. 1997. An Observation of Leopard (Panthera pardus Linnaeus) mating behavior in Serengeti National Park, Tanzania. African Journal of Ecology, 35/2: 165-167. Accessed April 08, 2009 at http://www3.interscience.wiley.com.proxy.lib.umich.edu/cgi-bin/fulltext/119170005/PDFSTART.
  • Macaskill, S. 2009. "Wildlife Pictures Online" (On-line). Leopard Information. Accessed March 25, 2009 at http://www.wildlife-pictures-online.com/leopard-information.html.
  • Stander, P., P. Haden, G. Kaqece. 1997. The Ecology of Associality in Namibian Leopards. Journal of Zoology, 242: 343-364. Accessed April 08, 2009 at http://apps.isiknowledge.com.proxy.lib.umich.edu/full_record.do?product=WOS&search_mode=GeneralSearch&qid=4&SID=2F21jJFPOHbMGP5IDa9&page=1&doc=1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panthera pardus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1885-08|EF551002|Panthera pardus| AACCGCTGACTATTTTCAACCAATCACAAAGATATTGGAACTCTTTACCTTCTATTTGGTGCCTGGGCTGGCATGGTGGGGACTGCTCTC---AGTCTCTTAATCCGAGCCGAACTGGGTCAACCTGGCACACTGCTAGGGGAC---GACCAAATTTATAATGTAGTCGTTACCGCCCATGCTTTTGTAATAATCTTCTTTATAGTAATGCCCATCATGATTGGAGGATTCGGAAACTGATTGGTCCCATTAATA---ATTGGAGCCCCCGATATAGCATTCCCTCGAATGAATAATATGAGCTTTTGACTCCTTCCCCCATCTTTCCTACTTTTGCTCGCATCATCTATGGTAGAGGCTGGGGCAGGAACTGGATGAACAGTATACCCACCCCTAGCCGGCAACCTAGCCCATGCAGGGGCATCCGTAGATTTA---ACTATTTTTTCACTACACCTGGCAGGTGTCTCCTCAATCTTAGGCGCTATTAATTTTATTACTACTATTATTAATATAAAACCCCCTGCTATATCCCAATACCAAACACCTCTATTCGTCTGATCGGTCTTAATCACTGCTGTATTGCTACTCCTATCACTGCCAGTTTTAGCAGCA---GGCATCACTATGCTACTGACAGATCGAAATCTGAACACCACATTCTTTGACCCTGCCGGAGGGGGGGATCCTATCTTATACCAGCACCTATTCTGATTTTTTGGTCACCCAGAAGTTTATATTTTAATTTTACCCGGGTTCGGAATAATTTCACACATTGTCACCTATTACTCAGGTAAAAAA---GAGCCTTTTGGCTATATGGGAATAGTTTGAGCTATAATATCGATTGGCTTCCTGGGCTTTATCGTGTGAGCCCACCACATGTTTACTGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panthera pardus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 18
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Henschel, P., Hunter, L., Breitenmoser, U., Purchase, N., Packer, C., Khorozyan, I., Bauer, H., Marker, L., Sogbohossou, E. & Breitenmoser-Wursten, C.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Contributor/s

Justification
Leopards have a wide range and are locally common in some parts of Africa and tropical Asia. However, they are declining in large parts of their range due to habitat loss and fragmentation, and hunting for trade and pest control. These threats may be significant enough that the species could soon qualify for Vulnerable under criterion A.

History
  • 2002
    Least Concern
  • 1996
    Lower Risk/least concern
  • 1990
    Threatened
    (IUCN 1990)
  • 1988
    Threatened
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Leopards are declining in parts of their geographic range due to habitat loss and fragmentation, and hunting for trade and pest control. As a result, leopards are listed as "near threatened" on the IUCN Red List of Threatened Species. Leopards appear to show some resistance to minor habitat disturbances and are relatively tolerant of humans. Currently, leopards are protected throughout most of their range in west Asia; however, populations in this part of their range are too small to maintain stable growth. Although habitat reserves and national parks exist throughout their geographic range in Africa, a majority of leopards live outside these protected areas. Although leopards are the most populous of the "great cats", 5 of 9 subspecies are listed as endangered or critically endangered.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, extinct?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Critically Endangered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Probably already extinct, but extreme wariness makes assessment dificult.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed: except where threatened

Status: Threatened
Date Listed: 01/28/1982
Lead Region: Foreign (Region 10) 
Where Listed: Gabon to Kenya & southward


Population detail:

Population location: In Africa, in the wild, south of, and including, the following countries: Gabon, Congo, Zaire, Uganda, Kenya
Listing status: T

Population location: Wherever found, except where it is listed as Threatened as set forth below
Listing status: E

For most current information and documents related to the conservation status and management of Panthera pardus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Status: NEAR THREATENED

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The leopard is an adaptable, widespread species that nonetheless has many threatened subpopulations. While still numerous and even thriving in some marginal habitats from which other big cats have disappeared in many parts of sub-Saharan Africa, in North Africa leopards are on the verge of extinction.

There are no reliable continent-wide estimates of population size in Africa, and the most commonly cited estimate of over 700,000 leopards in Africa (Martin and de Meulenaar 1988) is flawed. In India, based on pugmark censuses (a methodology which has been criticized as inaccurate), 9,844 leopards were estimated in 2001. Many populations are believed to be increasing (Singh 2005), and there are high levels of human-leopard conflict (Singh et al. 2008).

Several Asian subspecies are included on the Red List, with population information as follows:

Amur leopard P.p. orientalis CR C2a(ii),D: 14-20 (Anon. 2007)
Arabian leopard P.p. nimr CR C2a(I): <200 (Breitenmoser 2006, Spalton and Al Hikmani 2006)
Javan leopard P.p. melas CR C2a(i): 323-525, with <250 mature breeding adults (A. Ario pers. comm. 2007)
Sri Lankan leopard P.p. kotiya EN C2a(i): 700-950 (Kittle and Watson 2007)
Persian leopard P.p. saxicolor EN C2a(i): 871-1290 (Khorozyan et al., 2005; Lukarevsky et al. 2007)

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Throughout Africa, the major threats to Leopard are habitat conversion and intense persecution, especially in retribution for real and perceived livestock loss (Ray et al. 2005). In intact rainforest, the chief threat to Leopards is probably competition with human hunters for prey; the tremendous volume of wild meat harvests denudes forests of prey and may drive localized extinctions. Nonetheless, Leopard are somewhat tolerant of habitat conversion, and may persist close to large human populations provided they have suitable cover and prey (Hunter et al. in press).

Leopard come into conflict with people across their range. A rapidly increasing threat to Leopards is the poisoning of carcasses targeting carnivores, either as a means of predator control or incidentally.

The impact of trophy hunting on populations is unclear, but may have impacts at the demographic and population level, especially when females are shot. In Tanzania, which allows only males to be hunted, females comprised 28.6% of 77 trophies shot between 1995 and 1998 (Spong et al. 2000).

Skins and canines are still widely traded domestically in some central and West African countries where parts are used in traditional rituals and sold openly in villages and cities (Hunter et al. in press). Djibouti is an important conduit for Leopard skins from East Africa that are bought mainly by French military personnel and carried illegally to Europe.

In West Asia, small leopard subpopulations are threatened primarily by habitat fragmentation, killing in defence of livestock, and poaching for trade (Habibi 2004, Breitenmoser et al. 2006, Breitenmoser et al. 2007).

In Indo-Malaya, leopards are threatened primarily by habitat loss (deforestation) as well as poaching for illegal trade (Nowell and Jackson 1996). In India, leopards are feared for their attacks on people (Singh 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leopards are highly adaptable but they still face many threats. Growing human populations are increasingly encroaching on leopard habitat and killing these cats in fear or for trophies. Illegal hunting of leopards became so common in the 1960s that as many as 50,000 skins were taken annually.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Included on CITES Appendix I. Legal international traffic is limited largely to exports of skins and hunting trophies under a CITES Appendix I quota system by 13 African countries (2005 CITES quota is 2,590). Leopards are protected under national legislation throughout most of their range (Nowell and Jackson 1996). In Africa, although Leopards occur in numerous protected areas across their range, the majority of the population occurs outside of protected areas, necessitating a need for improved conflict mitigation measures (including livestock management, conflict resolution) (Hunter et al. in press). In West Asia, leopards are essentially restricted to protected areas, many of which are too small to support viable populations, and need expansion through buffer zones and connectivity through corridors (Breitenmoser et al. 2006, 2007). In Indo-Malaya and China, leopards need better protection from illegal trade in skins and bones (Nowell 2007). Leopards are protected in Afghanistan having recently been placed on the country?s Protected Species List (2009), prohibiting all hunting and trading of the species within Afghanistan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

When natural prey abundances are low, leopards have been known to kill livestock. Injured or sickly leopards have been known to hunt humans as easy prey.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Leopards can be seen in National Parks throughout Asia and Africa. They help control baboon populations and disperse seeds that stick to their fur. Chiefs and warriors from tribal cultures throughout the leopard's geographic range wear their fur as a symbol of honor and courage. Tribal medicine men and women suggest leopard skins as a remedy for bad omens. Leopards are often captured for pet trade and are targeted by trophy hunters as well.

Positive Impacts: pet trade ; body parts are source of valuable material; ecotourism

  • Arhin, C. 2003. "Biodiversity Reporting" (On-line). The Wisdom of the Leopard. Accessed April 01, 2009 at http://www.biodiversityreporting.org/article.sub?docId=751&c=Ghana&cRef=Ghana&year=2003&date=May%202003.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Leopard

The leopard (play /ˈlɛpərd/), Panthera pardus, is a member of the Felidae family and the smallest of the four "big cats" in the genus Panthera, the other three being the tiger, lion, and jaguar. The leopard was once distributed across eastern and southern Asia and Africa, from Siberia to South Africa, but its range of distribution has decreased radically because of hunting and loss of habitat. It is now chiefly found in sub-Saharan Africa; there are also fragmented populations in the Indian subcontinent, Sri Lanka, Indochina, Malaysia, Indonesia, and China. Because of its declining range and population, it is listed as a "Near Threatened" species on the IUCN Red List.[1]

Compared to other members of the Felidae family, the leopard has relatively short legs and a long body with a large skull. It is similar in appearance to the jaguar, but is smaller and more slightly built. Its fur is marked with rosettes similar to those of the jaguar, but the leopard's rosettes are smaller and more densely packed, and do not usually have central spots as the jaguars do. Both leopards and jaguars that are melanistic are known as black panthers.

The species' success in the wild is in part due to its opportunistic hunting behavior, its adaptability to habitats, its ability to run at speeds approaching 58 kilometres per hour (36 mph), its unequaled ability to climb trees even when carrying a heavy carcass,[2] and its notorious ability for stealth. The leopard consumes virtually any animal that it can hunt down and catch. Its habitat ranges from rainforest to desert terrains.

Contents

Characteristics

Leopards are agile and stealthy predators. Although smaller than other members of the Panthera genus, they are able to take large prey due to their massive skulls that facilitate powerful jaw muscles. Head and body length is between 95 and 165 cm (37 and 65 in), and the tail reaches 60 to 110 cm (24 to 43 in).[3] Shoulder height is 45 to 80 cm (18 to 31 in). The muscles attached to the scapula are exceptionally strong, which enhance their ability to climb trees. They are very diverse in size. Males are about 30% larger than females, weighing 30 to 91 kg (66 to 200 lb) compared to 23 to 60 kg (51 to 130 lb) for females. Large males of up to 91 kg (200 lb) have been documented in Kruger National Park in South Africa; however, males in South Africa's coastal mountains average 31 kg (68 lb) and the females from the desert-edge in Somalia average 23 to 27 kg (51 to 60 lb). This wide variation in size is thought to result from the quality and availability of prey found in each habitat. The most diminutive leopard subspecies overall is the Arabian leopard (P. p. nimr), from deserts of the Middle East, with adult females of this race weighing as little as 20 kg (44 lb).[4]

Other large subspecies, in which males weigh up to 91 kg (200 lb), are the Sri Lankan leopard (P. p. kotiya) and the Anatolian leopard (P. p. tulliana).[5] The largest verified leopards weighed 96.5 kg (213 lb). Larger sizes reported are considered unreliable.[6] The leopard's body is comparatively long, and its legs are short.[7]

Leopards show a great diversity in coat color and rosette patterns. Their rosettes are circular in East Africa but tend to be squarer in southern Africa and larger in Asian populations. Their yellow coat tends to be more pale and cream colored in desert populations, more gray in colder climates, and of a darker golden hue in rainforest habitats. Overall, the fur under the belly tends to be lighter coloured and of a softer, downy type. Solid black spots in place of open rosettes are generally seen along the face, limbs and underbelly.[4]

Leopards may sometimes be confused with two other large spotted cats, the cheetah, with which it may co-exist in Africa, and the jaguar, a neotropical species that it does not naturally co-exist with. However, the patterns of spots in each are different: the cheetah has simple black spots, evenly spread; the jaguar has small spots inside the polygonal rosettes; while the leopard normally has rounder, smaller rosettes than those of the jaguar. The cheetah has longer legs and a thinner build that makes it look more streamlined and taller but less powerfully built than the leopard. The jaguar is more similar in build to the leopard but is generally larger in size and has a more muscular, bulky appearance.[8]

Variant coloration

Persian leopard with atypical coat pattern

Melanistic leopards are commonly called black panthers, a term that also applies to melanistic jaguars. Pseudomelanism (abundism) also occurs in leopards.[9] Melanism in leopards is inherited as a Mendelian, monogenic recessive trait relative to the spotted form. Pairings of black animals inter se have a significantly smaller litter size than other possible pairings.[10] The black color is caused by recessive gene loci.[11]

The black panther is common in the equatorial rainforest of Malaya and the tropical rainforest on the slopes of some African mountains such as Mount Kenya.[12] Between January 1996 and March 2009, Indochinese leopards were photographed at 16 sites in the Malay Peninsula in a sampling effort of more than 1000 trap nights. Of 445 photographs of melanistic leopards taken, 410 came from study sites south of the Isthmus of Kra, where the non-melanistic morph was never photographed. These data suggest the near fixation of the dark allele in the region. The expected time to fixation of this recessive allele due to genetic drift alone ranged from about 1,100 years to about 100,000 years.[13][14]

Melanism in leopards has been hypothesized to be causally associated with a selective advantage for ambush.[15]

Etymology

In antiquity, a leopard was believed to be a hybrid of a lion and a panther, as is reflected in its name, which is a Greek compound of λέων leōn (lion) and πάρδος pardos (male panther). The Greek word is related to Sanskrit पृदाकु pṛdāku (snake, tiger, panther), and probably derives from a Mediterranean language, such as Egyptian.[16][17]

A panther can be any of several species of large felids: the term can refer to cougars and jaguars in the American continents; and everywhere else to leopards.[18]

The generic component of its modern scientific designation, Panthera pardus, derives from Latin via Greek πάνθηρ (pánthēr).[19] Folk etymology saw the name as a compound of παν (pan, all) and θηρ (beast).[20] However, it is believed instead to be derived from an Indo-Iranian word meaning "white-yellow, pale"; in Sanskrit, this word's reflex was पाण्डर pāṇḍara, which was derived from पुण्डरीक puṇḍárīka (tiger, among other things), then borrowed into Greek.[17][19]

Taxonomy and evolution

Like all of the feline family, the Panthera genus has been subject to much alteration and debate, and the exact relations between the four species as well as the clouded leopard and snow leopard have not been effectively resolved.

The leopard was among the first animals named under the modern system of biological classification, since it was described by Carl Linnaeus in 1758 in the 10th edition of Systema Naturae. Linnaeus placed the leopard under the genus Felis as the binominal Felis pardus.[21] In the 18th and 19th centuries, most naturalists and taxonomists followed his example. In 1816, Lorenz Oken proposed a definition of the genus Panthera, with a subgenus Panthera using Linnaeus' Felis pardus as a type species. But most disagreed with his definition, and until the beginning of the 20th century continued using Felis or Leopardus when describing leopard subspecies.[22] In 1916, Reginald Innes Pocock accorded Panthera generic rank defining Panthera pardus as species.[23]

It is believed that the basal divergence amongst the Felidae family occurred about 11 million years ago. The last common ancestor of the lion, tiger, leopard, jaguar, snow leopard, and clouded leopard is believed to have occurred about 6.37 million years ago. Panthera is believed to have emerged in Asia, with ancestors of the leopard and other cats subsequently migrating into Africa. The researchers suggest that the snow leopard is most closely aligned with the tiger, whereas the leopard possibly has diverged from the Panthera lineage subsequent to these two species, but before the lion and jaguar.[24]

Results of phylogenetic analyses of chemical secretions amongst cats has suggested that the leopard is closely related to the lion.[25] Results of a mitochondrial DNA study carried out later suggest that the leopard is closely related to the snow leopard, which is placed as a fifth Panthera species, Panthera uncia.[26]

Fossil records

Fossil leopard bones and teeth dating from the Pliocene were found in Perrier in France, northeast of London, and in Valdarno in Italy. At 40 sites in Europe fossil bones and dental remains of leopards dating from the Pleistocene were excavated mostly in loess and caves. The sites of these fossil records range from near Lisbon, near Gibraltar, and Santander Province in northern Spain to several sites in France, Switzerland, Italy, Austria, Germany, in the north up to Derby in England, in the east to Přerov in the Czech Republic and the Baranya in southern Hungary.[27]

Fossils of early leopard ancestors have been found in East Africa and South Asia from the Pleistocene of 2 to 3.5 Ma. The modern leopard is suggested to have evolved in Africa 470,000–825,000 years ago and radiated across Asia 170,000–300,000 years ago.[28]

Distribution and habitat

Leopards have the largest distribution of any wild cat, occurring widely in eastern and central Africa, although populations have shown a declining trend and are fragmented outside of sub-Saharan Africa. Within sub-Saharan Africa, the species is still numerous and even thriving in marginal habitats where other large cats have disappeared. But populations in North Africa may be extinct.[4]

Data on their distribution in Asia are not consistent—populations in southwest and central Asia are small and fragmented; in the northeast, they are critically endangered; but in the Indian subcontinent, Southeast Asia, and China, leopards are still relatively abundant. Of the species as a whole, its numbers are greater than those of other Panthera species, all of which face more acute conservation concerns.[1]

Leopards live mainly in grasslands, woodlands, and riverine forests. They are usually associated with savanna and rainforest, but leopards are exceptionally adaptable: in the Russian Far East, they inhabit temperate forests where winter temperatures reach a low of −25 °C (−13 °F).[28]

Distribution of subspecies

Since Carl Linnaeus published his description of leopards in the Systema Naturae in 1758, as many as 27 leopard subspecies were subsequently described by naturalists from 1794 to 1956. In 1996, according to DNA analysis carried out in the 1990s, only eight subspecies are considered valid.[29] Later analysis revealed a ninth valid subspecies, the Arabian leopard (P. p. nimr). Because of limited sampling of African leopards, this number might be an underestimation.[28]

The nine subspecies recognised by IUCN are:[1][28][30]

A morphological analysis of characters of leopard skulls implies the validity of two more subspecies:[30]

Ecology and behavior

Leopard resting on a tree
Leopard in a tree

Leopards are elusive, solitary and largely nocturnal.[31] They have primarily been studied in open savanna habitats, which may have biased common descriptions. Activity level varies depending on the habitat and the type of prey that they hunt. Radio-tracking and scat analysis in West Africa showed that rainforest leopards are more likely to be diurnal and crepuscular. Forest leopards are also more specialized in prey selection and exhibit seasonal differences in activity patterns.[32]

Leopards are known for their ability in climbing, and have been observed resting on tree branches during the day, dragging their kills up trees and hanging them there, and descending from trees headfirst.[33] They are powerful swimmers, although not as strong as some other big cats, such as the tiger. They are very agile, and can run at over 58 kilometres per hour (36 mph), leap over 6 metres (20 ft) horizontally, and jump up to 3 metres (9.8 ft) vertically.[34] They produce a number of vocalizations, including grunts, roars, growls, meows, and "sawing" sounds.[35]

Social structure and home range

Female leopard in the Sabi Sands area of South Africa. Note the white spot on its tail, used for communicating with cubs while hunting or in long grass.[2]

Home ranges of male leopards vary between 30 km2 (12 sq mi) and 78 km2 (30 sq mi), and of females between 15 to 16 km2 (5.8 to 6.2 sq mi).[4] Virtually all sources suggest that males do have larger home ranges. There seems to be little or no overlap in territory among males, although overlap exists between the sexes; one radio-collar analysis in the Ivory Coast found a female home range completely enclosed within a male's.[36]

Research in a conservation area in Kenya showed similar territory sizes and sex differential: 32.8 km2 (12.7 sq mi) average ranges for males, and 14 km2 (5.4 sq mi) for females.[37]

In Nepal, somewhat larger male ranges have been found at about 48 km2 (19 sq mi), while female ranges at 17 km2 (6.6 sq mi); female home ranges decreased to 5 to 7 km2 (1.9 to 2.7 sq mi) when young cubs were present, while the sexual difference in range size seemed to be in positive proportion to overall increase.[38]

Studies of leopard home range size have tended to focus on protected areas, which may have led to skewed data; as of the mid-1980s, only 13% of the leopard range actually fell within a protected area. However, significant variations in the size of home ranges have been suggested across the leopard's range. Research in Namibia that focused on spatial ecology in farmlands outside of protected areas revealed ranges that were consistently above 100 km2 (39 sq mi) with some more than 300 km2 (120 sq mi). Admitting that their data were at odds with others, the researchers found little or no sexual variation in the size of territories.[39]

Aggressive encounters have been observed. Two of five males studied over a period of a year at a game reserve in South Africa died, both violently. One was initially wounded in a male–male territorial battle over a carcass; taken in by researchers, it was released after a successful convalescence only to be killed by a different male a few months later. A second was killed by another predator, possibly a spotted hyena. A third of the five was badly wounded in intraspecific fighting, but recovered.[31]

Hunting and diet

Leopard with kill in tree in South Africa
Charging young leopard

Leopards are versatile, opportunistic hunters, and have a very broad diet. They feed on a greater diversity of prey than other members of the Panthera species, and will eat anything from dung beetles to 900 kg (2,000 lb) male giant elands.[4] Their diet consists mostly of ungulates and monkeys, but they also eat rodents, reptiles, amphibians, insects, birds (like the Vulturine Guineafowl), fish and sometimes smaller predators (such as bat-eared foxes, martens, and jackals). In at least one instance, a leopard has predated a sub-adult Nile crocodile that was crossing over land.[40] They stalk their prey silently, pounce on it at the last minute, and strangle its throat with a quick bite. In Africa, mid-sized antelopes provide a majority of their prey, especially impala and Thomson's gazelles.[41]

In the open savanna of Tsavo National Park, they kill more prey when hunting between sunset and sunrise.[42] In Kruger National Park, males and females with cubs are more active at night. At least 92 prey species have been documented in their diet. They focus their hunting activity on locally abundant medium-sized ungulate species in the 20 to 80 kg (44 to 180 lb) range, while opportunistically taking other prey. Analysis of leopard scats found that 67% contained ungulate remains, of which 60% were impala, the most abundant antelope, with adult weights of 40 to 60 kg (88 to 130 lb). Small mammal remains were found most often in scats of sub-adult leopards, especially females. Average daily consumption rates was estimated at 3.5 kg (7.7 lb) for adult males and 2.8 kg (6.2 lb) for females.[43]

In Asia, the leopard preys on deer such as chitals and muntjacs, as well as various Asian antelopes and ibex. Prey preference estimates in southern India showed that the most favored prey of the leopard were chitals.[44] A study at the Wolong Reserve in China revealed how adaptable their hunting behaviour is. Over the course of seven years, the vegetative cover receded, and the animals opportunistically shifted from primarily consuming tufted deer to pursuing bamboo rats and other smaller prey.[45]

They select their prey focusing on small herds, dense habitat, and low risk of injury, preferring prey weights of 10 to 40 kg (22 to 88 lb) such as impala, chital, bushbuck and common duiker with an average body weight of 25 kg (55 lb).[46]

In search of safety, leopards often stash their young or recent kills high up in a tree, which can be a great feat of strength considering that they may be carrying prey heavier than themselves in their the mouth while they climb vertically.[41] One leopard was seen to haul a young giraffe, estimated to weigh up to 125 kg (280 lb), about 2–3 times the weight of the leopard, up 5.7 m (19 ft) into a tree.[42]

Interspecific predatory relationships

Leopard.ogv
Video of a leopard in the wild

Leopards must compete for food and shelter with other large predators such as lions, tigers, spotted hyenas, and both African and Asiatic wild dogs. These animals may steal the leopard's kill, devour its young or even kill adult leopards, although lions are most likely to kill and not eat young leopards if they are discovered. In some areas of Africa, troops of large baboon species (potentially leopard prey themselves) will kill and sometimes eat leopard young if they discover them.[47] Occasionally, Nile crocodiles may predate on leopards.[48] Leopards co-exist alongside these other predators by hunting for different types of prey and by avoiding areas frequented by them.[4] Lions are occasionally successful in climbing trees and fetching leopard kills.[41] In the Kalahari desert, leopards frequently lose kills to the brown hyena, if the leopard is unable to move the kill into a tree. Single brown hyenas have been observed charging at and displacing male leopards from kills.[49][50]

Resource partitioning occurs where leopards share their range with lions or tigers. Leopards tend to take smaller prey, usually less than 75 kg (170 lb), where the larger cats are present.[4] In the Chitwan National Park in Nepal, leopards killed prey ranging from less than 25 kg (55 lb) to 100 kg (220 lb) in weight with most kills in the 25–50 kg (55–110 lb) range; tigers killed more prey in the 50–100 kg (110–220 lb) range.[51] In the tropical forests of India’s Nagarhole National Park, tigers selected prey weighing more than 176 kg (390 lb), whereas leopards selected prey in the 30–175 kg (66–390 lb) range. The average weights of leopard prey was 37.6 kg (83 lb), and of tiger prey was 91.5 kg (202 lb) with a bias towards adult males of chital, sambar and wild pig, and young gaur.[52] In tropical forest they do not always avoid the larger cats by hunting at different times. With relatively abundant prey, tigers and leopards seem to successfully coexist without competitive exclusion or inter-species dominance hierarchies that may be more common to the leopard's co-existence with the lion in savanna habitats.[53] In areas with high tiger populations, such as in the central parts of India’s Kanha National Park, leopards are not permanent residents, but transients. They were common near villages at the periphery of the park and outside the park.[51]

Reproduction and life cycle

Depending on the region, leopards may mate all year round. In Manchuria and Siberia, they mate during January and February. The estrous cycle lasts about 46 days and the female usually is in heat for 6–7 days.[54] Gestation lasts for 90 to 105 days.[55] Cubs are usually born in a litter of 2–4 cubs.[56] But mortality of cubs is estimated at 41–50% during the first year.[43]

Females give birth in a cave, crevice among boulders, hollow tree, or thicket to make a den. Cubs are born with closed eyes, which open four to nine days after birth.[57] The fur of the young tends to be longer and thicker than that of adults. Their pelage is also more gray in color with less defined spots. Around three months of age, the young begin to follow the mother on hunts. At one year of age, leopard young can probably fend for themselves, but remain with the mother for 18–24 months.[33]

Leopards have been reported to reach 21 years of age in captivity.[58]

Hybrids

Pumapard, 1904

Crossbreeding between leopards and other members of the genus Panthera has been documented, resulting in hybrids. A cross between a lioness and a male leopard is known as a leopon (or a lipard if the sex of the parents is reversed). Leopons have been bred in captivity; a well-documented case occurred at the Koshien Hanshin Park in Nishinomiya, Japan in the late 1950s.[59] Although lions and leopards may come in to contact in sub-Saharan Africa, they are not widely believed to interbreed naturally. However, there have been anecdotal reports of small lions with exceptionally pronounced spotting, known as "marozis" and various other names, in several African countries, for which there has been cryptozoological speculation that they may be naturally occurring lion-leopard hybrids.[60]

Crossbreeding between jaguars and leopards in captivity has also been documented.[61][62] A cross between a female leopard and a male jaguar is referred to as a jagupard, the reverse is known a leguar; however, a crosses between either have also been called lepjags. Such crosses can only occur in captivity because leopards do not exist in the wild on the American continents where jaguars live.[citation needed] There have also been a few claims of crosses between tigers and leopards.[63]

A pumapard is a hybrid animal resulting from a mating between a leopard and a puma (a member of the Puma genus, not the Panthera genus). Three sets of these hybrids were bred in the late 1890s and early 1900s by Carl Hagenbeck at his animal park in Hamburg, Germany. While most of these animals did not reach adulthood, one of these was purchased in 1898 by the Berlin Zoo. A similar hybrid in the Berlin Zoo purchased from Hagenbeck was a cross between a male leopard and a female puma. A specimen in the Hamburg Zoo (in the photo at right) was the reverse pairing, fathered by a puma bred to an Indian leopardess.[64]

Whether born to a female puma mated to a male leopard, or to a male puma mated to a female leopard, pumapards inherit a form of dwarfism. Those reported grew to only half the size of the parents. They have a puma-like long body (proportional to the limbs, but nevertheless shorter than either parent), but short legs. The coat is variously described as sandy, tawny or greyish with brown, chestnut or faded rosettes.[64]

Leopards and humans

Leopards have been known to humans throughout history, and have featured in the art, mythology, and folklore of many countries where they have historically occurred, such as ancient Greece, Persia, and Rome, as well as some where they have not existed for several millennia, such as England. The modern use of the leopard as an emblem for sport or a coat of arms is much more restricted to Africa, though numerous products worldwide have used the name.

Leopard domestication has also been recorded—several leopards were kept in a menagerie established by King John at the Tower of London in the 13th century; around 1235, three of these animals were given to Henry III by Holy Roman Emperor Frederick II.[65]

Heraldry

The lion passant guardant or leopard is a frequently used charge in heraldry, most commonly appearing in groups of three.[66] The heraldric leopard lacks spots and sports a mane, making it visually almost identical to the heraldric lion, and the two are often used interchangeably. These traditional lions passant guardant appear in the coat of arms of England and many of its former colonies; more modern naturalistic (leopard-like) depictions appear on the coat of arms of several African nations including Benin, Malawi, Somalia, the Democratic Republic of the Congo and Gabon, which uses a black panther.[67]

Tourism

Park reserves in several countries operate wildlife touring programs that allow visitors to observe leopards in their natural habitat. The Sabi Sands Private Game Reserve in South Africa is one such establishment that offers safari ventures. Sri Lanka offers two leopard habitats, Yala National Park and Wilpattu National Park, where wildlife tours are available. In India, leopards can be seen in the Madhya Pradesh and Uttarakhand national parks.

While luxury establishments may boast the fact that wild animals can be seen at close range on a daily basis, the leopard's camouflage and propensity to hide and stalk prey make leopard sightings rare.[68] For example, in Sri Lanka's Yala National Park, leopards have been ranked by visitors to be among the least visible of all animals in the park despite their high concentration in the reserve.[69]

Man-eating

Most leopards avoid people, but humans may occasionally be targeted as prey. Most healthy leopards prefer wild prey to humans, but injured, sickly, or struggling cats with a shortage of regular prey may resort to hunting humans and become habituated to it. Two extreme cases occurred in India: the first leopard, "the Leopard of Rudraprayag", may have killed more than 125 people; the second, the "Panar Leopard", was believed to have killed more than 400, after injury by a poacher made it unable to hunt normal prey.[70][71] Both were killed by hunter Jim Corbett.[72] Man-eating leopards are considered bold by feline standards and may enter human settlements for prey, more so than lions and tigers.[73] Author and big game hunter Kenneth Anderson had first-hand experience with many man-eating leopards, and described them as far more threatening than tigers:

Although examples of such animals are comparatively rare, when they do occur they depict the panther [leopard] as an engine of destruction quite equal to his far larger cousin, the tiger. Because of his smaller size he can conceal himself in places impossible to a tiger, his need for water is far less, and in veritable demoniac cunning and daring, coupled with the uncanny sense of self preservation and stealthy disappearance when danger threatens, he has no equal.
—Kenneth Anderson, Nine Man-Eaters and One Rogue, Chapter II "The Spotted Devil of Gummalapur""

See also

References

  1. ^ a b c d Henschel, P., Hunter, L., Breitenmoser, U., Purchase, N., Packer, C., Khorozyan, I., Bauer, H., Marker, L., Sogbohossou, E., Breitenmoser-Würsten, C. (2008). "Panthera pardus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/15954. 
  2. ^ a b c "Animal bytes: Leopard". Zoological Society of San Diego. http://www.sandiegozoo.org/animalbytes/t-leopard.html. Retrieved 13 February 2010. 
  3. ^ Boitani, L. (1984). Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books. ISBN 978-0-671-42805-1. 
  4. ^ a b c d e f g Nowell, K.; Jackson, P. (1996). "Leopard Panthera pardus (Linnaeus, 1758)". Wild Cats: status survey and conservation action plan. Gland, Switzerland: IUCN/SSC Cat Specialist Group. http://lynx.uio.no/lynx/catsgportal/cat-website/catfolk/ssaprd01.htm. 
  5. ^ Brakefield, T. (1993). Big Cats: Kingdom of Might. ISBN 0-89658-329-5. 
  6. ^ Brain, C. K. (1983). The Hunter or the Hunted: An Introduction to African Cave Taphonomy. University of Chicago Press. ISBN 978-0-226-07090-2. 
  7. ^ "Leopard". African Wildlife Foundation. http://www.awf.org/content/wildlife/detail/leopard. Retrieved 21 September 2007. 
  8. ^ "Jaguar (Panthera onca)". Our animals. Akron Zoo. http://www.akronzoo.org/learn/jaguar.asp. Retrieved 27 March 2010. 
  9. ^ Gamble, C.; Griffiths, R. (2004). Leopards: Natural History and Conservation. Voyageur Press. ISBN 0-89658-656-1. 
  10. ^ Robinson, R. (1970). "Inheritance of black form of the leopard Panthera pardus". Genetica 41: 190–197. 
  11. ^ Eizirik, E.; Yuhki, N.; Johnson, W. E.; Menotti-Raymond, M.; Hannah, S. S., O’Brien, S. J. (2003). "Molecular Genetics and Evolution of Melanism in the Cat Family". Current Biology 13 (5): 448–53. doi:10.1016/S0960-9822(03)00128-3. PMID 12620197. http://www.pucrs.br/fabio/genomaenglish/index_arquivos/artigos_eduardo/Copy%20of%20Melanism_CB_reprint.pdf. 
  12. ^ Searle, A. G. (1968). Comparative Genetics of Coat Colour in Mammals. London: Logos Press. 
  13. ^ Kawanishi, K.; Sunquist, M. E.; Eizirik, E.; Lynam, A. J.; Ngoprasert, D.; Wan Shahruddin, W. N.; Rayan, D. M.; Sharma, D. S. K.; Steinmetz, R. (2010). "Near fixation of melanism in leopards of the Malay Peninsula". Journal of Zoology 282 (3): 201–206. doi:10.1111/j.1469-7998.2010.00731.x. 
  14. ^ Sunquist, F. (2007). "Malaysian Mystery Leopards". National Wildlife Magazine 45 (1). http://www.nwf.org/nationalwildlife/printerFriendly.cfm?issueID=112&articleID=1413. 
  15. ^ Majerus, M. E. N. (1998). Melanism: evolution in action. New York: Oxford University Press. 
  16. ^ Partridge, 1983, p. 349
  17. ^ a b Monier-Williams, M. (2005). A Sanskrit-English dictionary: etymologically and philologically arranged. Motilall Baransidass Publishers. ISBN 81-208-3105-5. http://books.google.com/?id=zUezTfym7CAC&pg=PA1. 
  18. ^ "panther". Merriam-Webster Online Dictionary. http://www.merriam-webster.com/dictionary/panther. Retrieved 3 April 2010. 
  19. ^ a b Partridge, 1983, p. 467
  20. ^ "Panther". Online Etymology Dictionary. Douglas Harper. http://www.etymonline.com/index.php?term=panther. Retrieved 3 April 2010. 
  21. ^ Linnaeus, C. (1760). Caroli Linnæi Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. I. Halae Magdeburgicae. p. 41. http://www.archive.org/stream/carolilinnaeisys11linn#page/n96/mode/1up. 
  22. ^ Ellerman, J. R.; Morrison-Scott, T. C. S. (1966). Checklist of Palaearctic and Indian mammals 1758 to 1946 (Second ed.). London: British Museum of Natural History. pp. 315–317. http://www.archive.org/stream/checklistofindia00elle#page/314/mode/2up. 
  23. ^ Pocock, R.I. (1939). "Panthera pardus". The Fauna of British India, Including Ceylon and Burma. Mammalia: Volume 1. London: Taylor and Francis. pp. 222–239. http://www.archive.org/stream/PocockMammalia1/pocock1#page/n273/mode/2up. 
  24. ^ Johnson, W. E.; Eizirik, E.; Pecon-Slattery, J.; Murphy, W. J.; Antunes, A.; Teeling, E.; O'Brien, S. J. (2006). "The Late Miocene radiation of modern Felidae: A genetic assessment". Science 311 (5757): 73–7. doi:10.1126/science.1122277. PMID 16400146. 
  25. ^ Bininda-Emonds, O. R. P.; Decker-Flum, D. M. (2001). "The utility of chemical signals as phylogenetic characters: an example from the Felidae". Biological Journal of the Linnean Society 72: 1–15. doi:10.1111/j.1095-8312.2001.tb01297.x. http://www.personal.uni-jena.de/~b6biol2/Publications/FatCats.pdf. Retrieved 2008-06-07. 
  26. ^ Yu, L.; Zhang, Y. P. (2005). "Phylogenetic studies of pantherine cats (Felidae) based on multiple genes, with novel application of nuclear beta-fibrinogen intron 7 to carnivores" (PDF). Molecular Phylogenetics and Evolution 35 (2): 483–95. doi:10.1016/j.ympev.2005.01.017. PMID 15804417. Archived from the original on 2 January 2012. http://www.webcitation.org/64OWLaPAD. 
  27. ^ Schmid, E. (1940). "Variationstatistische Untersuchungen am Gebiss pleistozäner und rezenter Leoparden und anderer Feliden" (in German). Zeitschrift für Säugetierekunde 15: 1–179. 
  28. ^ a b c d Uphyrkina, O.; Johnson, E.W.; Quigley, H.; Miquelle, D.; Marker, L.; Bush, M.; O'Brien, S. J. (2001). "Phylogenetics, genome diversity and origin of modern leopard, Panthera pardus" (PDF). Molecular Ecology 10 (11): 2617–2633. doi:10.1046/j.0962-1083.2001.01350.x. PMID 11883877. http://www.biosoil.ru/files/00001386.pdf. 
  29. ^ Miththapala, Sriyanie; Seidensticker, John; O'Brien, S. J. (August 1996). "Phylogeographic Subspecies Recognition in Leopards (P. pardus): Molecular Genetic Variation". Conservation Biology 10 (4): 1115–1132. doi:10.1046/j.1523-1739.1996.10041115.x. http://www.blackwell-synergy.com/links/doi/10.1046/j.1523-1739.1996.10041115.x. Retrieved 6 June 2008. 
  30. ^ a b c Khorozyan, I. G.; Gennady, F.; Baryshnikov, G. F.; Abramov, A. V. (2006). "Taxonomic status of the leopard, Panthera pardus (Carnivora, Felidae) in the Caucasus and adjacent areas" (PDF). Russian Journal of Theriology 5 (1): 41–52. http://wild-cat.org/pardus/infos/Khorozyan2006Leopard-taxonomy.pdf. 
  31. ^ a b Hunter, L.; Balme, G.; Walker, C.; Pretorius, K.; Rosenberg, K. (2003). "The landscape ecology of leopards (Panthera pardus) in northern KwaZulu-Natal, South Africa: A preliminary project report". Ecological Journal 5: 24–30. http://www.biolsci.monash.edu.au/research/leopards/docs/ecojournal-2003.pdf. 
  32. ^ Jenny, D., Zuberbühler, K. (September 2005). "Hunting behaviour in West African forest leopards". African Journal of Ecology 43 (3): 197–200. doi:10.1111/j.1365-2028.2005.00565.x. http://www.blackwell-synergy.com/doi/abs/10.1111/j.1365-2028.2005.00565.x. 
  33. ^ a b "Leopard (Panthera pardus); Physical characteristics and distribution". Comparative Mammalian Brain Collections. http://brainmuseum.org/Specimens/carnivora/leopard/index.html. 
  34. ^ "Animal bytes – Panthera pardus". Sea World. http://www.seaworld.org/animal-info/Animal-bytes/animalia/eumetazoa/coelomates/deuterostomes/chordata/craniata/mammalia/carnivora/leopard.htm. Retrieved 6 June 2008. 
  35. ^ Estes, R. (1991). The Behavior Guide to African Mammals, Including Hoofed Mammals, Carnivores, Primates. Los Angeles: The University of California Press. 
  36. ^ Jenny, D. (1996). "Spatial organization of leopards Panthera pardus in Tai National Park, Ivory Coast: Is rainforest habitat a "tropical haven"?". Journal of Zoology 240 (3): 427–440. doi:10.1111/j.1469-7998.1996.tb05296.x. http://md1.csa.com/partners/viewrecord.php?requester=gs&collection=ENV&recid=4026878&q=Panthera+pardus+habitat&uid=1040057&setcookie=yes. 
  37. ^ Mizutani, F.; Jewell, P. A. (1998). "Home-range and movements of leopards (Panthera pardus) on a livestock ranch in Kenya". Journal of Zoology 244 (2): 269–286. doi:10.1017/S0952836998002118. http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=40975. 
  38. ^ Odden, M., Wegge, P. (2005). "Spacing and activity patterns of leopards Panthera pardus in the Royal Bardia National Park, Nepal". Wildlife Biology 11 (2): 145–152. doi:10.2981/0909-6396(2005)11[145:SAAPOL]2.0.CO;2. ISSN 0909-6396. http://wild-cat.org/pardus/infos/Odden+Wegge2005-Leopards-spacing+activity-BardiaNP.pdf. 
  39. ^ Marker, L. L.; Dickman, A. J. (2005). "Factors affecting leopard (Panthera pardus) spatial ecology, with particular reference to Namibian farmlands". South African Journal of Wildlife Research 35 (2): 105–115. http://www.cheetah.org/ama/orig/leopard.pdf. 
  40. ^ "Leopard savaging a crocodile caught on camera". The Telegraph. 18 July 2011. http://www.telegraph.co.uk/earth/earthnews/3347532/Leopard-savaging-a-crocodile-caught-on-camera.html. 
  41. ^ a b c Schaller, G. (1972). Serengeti: a kingdom of predators. New York: Knopf. ISBN 0-394-47242-X. 
  42. ^ a b Hamilton, P. H. (1976). The movements of leopards in Tsavo National Park, Kenya, as determined by radio-tracking (M.Sc. thesis). Nairobi: University of Nairobi. 
  43. ^ a b Bailey, T. N. (1993). 'The African leopard: a study of the ecology and behavior of a solitary felid. New York: Columbia University Press. 
  44. ^ Arivazhagan C., Arumugam R., Thiyagesan K. (2005) Food habits of Leopard (Panthera pardus fusca), Dhole (Cuon alpinus) and striped Hyena (Hyaena hyaena) in a tropical dry thorn forest of Southern India. Journal of the Bombay National Historical Society Vol 104 (2):
  45. ^ Johnson K. G.; Wei W.; Reid D. G.; Jinchu H. (August 1993). "Food Habits of Asiatic Leopards (Panthera pardus fusca) in Wolong Reserve, Sichuan, China". Journal of Mammalogy 74 (3): 646–650. doi:10.2307/1382285. JSTOR 1382285. 
  46. ^ Hayward, M. W.; Henschel, P.; O'Brien, J.; Hofmeyr, M.; Balme, G.; Kerley, G. I. H. (2006). "Prey preferences of the leopard (Panthera pardus)". Journal of Zoology 270 (2): 298–313. doi:10.1111/j.1469-7998.2006.00139.x. http://www.zbs.bialowieza.pl/publ/pdf/1596.pdf. 
  47. ^ [1] (2011).
  48. ^ [2] (2011).
  49. ^ Owens, M., Owens, D. (1984) Cry of the Kalahari. Houghton Mifflin, Boston. ISBN 0-395-32214-6, ISBN 978-0-395-32214-7
  50. ^ Owens, D.; Owens, M. (February 1980). "Hyenas of the Kalahari". Natural History 89 (2): 50. 
  51. ^ a b Seidensticker, J. (1976) On the ecological separation between tigers and leopards. Biotropica 8: 225–234
  52. ^ Karanth, K. U., Sunquist, M. E. (1995) Prey selection by tiger, leopard and dhole in tropical forests. Journal of Animal Ecology, 1995, 64: 439–450
  53. ^ Karanth, U. K.; Sunquist, M. E. (2000). "Behavioural correlates of predation by tiger (Panthera tigris), leopard (Panthera pardus) and dhole (Cuon alpinus) in Nagarahole, India". Journal of Zoology 250 (2): 255–265. doi:10.1111/j.1469-7998.2000.tb01076.x. 
  54. ^ Sadleir, R. (1966). "Notes on the Reproduction of the larger Felidae". International Zoo Yearbook: Vol 6. Zoological Society of London. pp. 184–87. 
  55. ^ Hemmer, H. (1976). "Gestation period and postnatal development in felids. Pp 143–165 in R.L. Eaton, ed.". The world’s cats. Vol 3. Carnivore Research Institute, Univ. Washington, Seattle. 
  56. ^ Eaton, R.L. (1977). "Reproductive biology of the leopard". Zoologischer Garten 47 (5): 329–351. 
  57. ^ Sunquist, M.; Sunquist, F. (2002). Wild Cats of the world. University of Chicago Press. 
  58. ^ Crandall, L. (1964). The management of wild animals in captivity. Chicago: University of Chicago Press. 
  59. ^ McCarthy, Eugene M. Leopon: Lioness x Leopard Macroevolution.net. Accessed 18 March 2010.
  60. ^ Shuker, Karl (1989). Mystery Cats of the World. Robert Hale (London).
  61. ^ Jaguar Panthera onca. Zoological Society of San Diego Zoo. Accessed 28 March 2010.
  62. ^ Hartwell, S. Hybrids involving leopards and jaguars. Messybeast.com. Britain. Accessed 28 March 2010.
  63. ^ Shuker, Karl [3]. ShukerNature. Accessed 7 November 2011.
  64. ^ a b Jen Stevenson. "Le Pumapard". The Strand. http://media.www.thestrand.ca/media/storage/paper404/news/2005/03/17/Features/Le.Pumapard-891758.shtml. Retrieved 16 June 2008. 
  65. ^ Owen, James (November 3, 2005). "Medieval Lion Skulls Reveal Secrets of Tower of London 'Zoo'". National Geographic Magazine. National Geographic. http://news.nationalgeographic.com/news/2005/11/1103_051103_tower_lions.html. Retrieved 2007-09-05. 
  66. ^ Strickland, Debra Higgs; Debra Hassig (1999). The Mark of the Beast: The Medieval Bestiary in Art, Life, and Literature. Taylor & Francis. ISBN 0-8153-2952-0. 
  67. ^ Pedersen, Christian Fagd (1971). The International Flag Book in Color. Morrow. 
  68. ^ Wines, Michael (24 October 2004). "In South Africa, It’s All in the Game". The New York Times. http://travel.nytimes.com/2004/10/24/travel/24timbavati.html. Retrieved 20 March 2010. 
  69. ^ U.M.I.R.K. Weerasinghe, Dayananda Kariyawasm and Mangala De Zoysa “Ruhuna (Yala) National Park in Sri Lanka: Visitors, Visitation, and Eco-Tourism”. University of Ruhuna
  70. ^ Hart, Donna; Robert W. Sussman (2005). Man the Hunted: Primates, Predators, and Human Evolution. Westview Press. ISBN 0-8133-3936-7. 
  71. ^ Tougias, p.147
  72. ^ Capstick, Peter Hathaway (1978). Death in the Long Grass. St. Martin's Press. ISBN 0-312-18613-4. 
  73. ^ Anderson, Kenneth (1954). Nine Man-Eaters and one Rogue. Allen & Unwin. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!