Overview

Brief Summary

Biology

This agile sheep lives in small groups of between three and six individuals (4), comprising a single adult male, several adult females, and their offspring (2). Occasionally, such as in the dry season, several of these groups may congregate, forming parties of up to 20 individuals (4). Adult males must earn their position as head of a group of females through intimidation displays, with males showing their magnificent mane of hair on their foreparts (2), and savage fights in which two males stand up to 15 metres apart, and then walk rapidly toward each other, breaking into a run and lowering their heads before colliding (5). Remarkably, it has been observed that a male will not attack if his opponent is unprepared or off-balance (5). Mating is thought to peak in October and November, with births taking place around 150 to 165 days later (4). One or two young are born at a time, and lie in a secluded site with the mother for the first few days of life, before joining the rest of the group. Female Barbary sheep reach sexual maturity around the age of 18 months, and Barbary sheep in captivity have been known to live for 24 years (2). The Barbary sheep feeds primarily at dusk, dawn and during the night, on a diet of grass, herbs, and foliage from shrubs and trees. By feeding at night, when plants accumulate moisture from the atmosphere or become covered in dew, the Barbary sheep gains much needed water, enabling this sheep to survive without drinking water during dry periods in its arid habitat (2). Another adaptation to this dry and unproductive terrain can be seen in the Barbary sheep's reaction to threats; with an almost total lack of sufficient vegetation to hide behind, the Barbary sheep will instead remain motionless when threatened, their sandy-brown coat enabling them to blend into their surroundings (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Males considerably larger than females. An unmis­takable, large, stocky, wild sheep with prominent mane along under­side of neck and smooth, curved horns. Upper parts orange-brown to reddish, browner on legs. No flank stripe, underparts paler. Lower legs and feet pale, hooves dark. Profuse mane (more apparent in male than female) of long hair running from throat down underside of neck to the forelegs. Mane paler than upper parts. No beard as present in male Ibex. Head elongated, lacking distinctive pattern. Ears small and pointed, whitish inside. Horns large and heavy, often meeting at base on forehead. Curve out and back and then down and inward, almost forming a circle. Ringed, but lack the distinct knobs of the Ibex. Larger in the male, where they can reach 88cm along the curve, than in the female, where they rarely reach 40cm. Tail rather long-haired, even bushy. Naked on underside at base. Voice a series of grunts between female and calves and from rutting male.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Barbary sheep has the distinction of being the only wild sheep species in Africa (4), and the only species in the genus Ammotragus (5). In appearance, it is somewhat of an intermediate between a sheep and a goat. It is a stocky, heavily built animal, with short legs and a rather long face (2). The coat, which is generally a sandy-brown colour (4), is woolly during the winter, but moults to a finer, sleek coat for the hot summer months (2). Both sexes have horns that sweep backwards and outwards in an arch; those of the male are much thicker, longer and more heavily ridged than the more slender horns of the female (2). Males also differ from females by their significantly heavier weight, (up to twice that of females) (2), and the notably longer curtain of hair that hangs from the throat, chest and upper part of the forelegs (2) (5). On males, this mane of long, soft hairs almost touches the ground (2) (5). The short tail, which is hairless on the underside, has scent glands (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Auodad was formerly widespread in rugged and mountainous terrain from deserts and semi-deserts to open forests in North Africa, but has suffered a strong decline due to poaching and competition from domestic stock. The ranges of the six supposed subspecies can be summarized as follows (following Cassinello in press, and references therein):

Ammotragus lervia lervia (Atlas Aoudad) occurs in the mountains of Morocco, except the western half of the Rif, and in northern Algeria and northern Tunisia.

A. l. ornata (Egyptian Aoudad) was formerly quite widespread throughout the Eastern and Western Desert of Egypt and was actually thought extinct (see Amer 1997). However, Wacher et al. (2002) reported evidence of the presence of Aoudad in both the Elba Protected Area and the Western Desert between 1997 and 2000 (and see Manlius et al. 2003).

A. l. blainei (Kordofan Aoudad) were once relatively widespread from west Sudan to the Red Sea coast, but currently are probably restricted to the Red Sea hills of east Sudan (Nimir 1997). Contrary to Mekonlau and Daboulaye (1997), this is the subspecies that may occur in the Ennedi and Uweinat mountains in northeast Chad (Alados et al. 1988). It may also be present in southeastern Libya.

A. l. fassini (Libyan Aoudad) is found only in extreme southern Tunisia and in Libya.

A. l. angusi (Aïr Aoudad) inhabit the Aïr Massif (Niger) and Termit Massif (Niger).

A. l. sahariensis (Saharan Aoudad) has the largest range of the subspecies, including southern Morocco and Western Sahara, southern Algeria, south-west Libya, Sudan, the mountains of the Adrar de Iforas in Mali, Niger, Mauritania, and the Tibesti Massif. There were no reliable reports of the species in the Western Sahara since the surveys of Valverde (1957), but the possibility of their survival in the Oued El Dahab was noted by Aulagnier and Thévenot (1997), and the species was recently rediscovered in this country (Cuzin 2003; Cuzin et al. in press).

Auodad have been introduced into the United States, northern Mexico, Spain (mainland and the Canary Islands (La Palma)) (Gray and Simpson 1980; Grubb 2005). These introduced populations are not mapped.

The species occurs from 200 to 4,100 m asl (Cuzin 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Barbary sheep, also called auodads, originated in the hills of the Sahara and have inhabited all the major mountains of North Africa. In the late 1800s, Barbary sheep were introduced into Europe, including Germany and Italy. Around 1900, the first Barbary sheep were transferred to the United States to be placed in zoos. Surplus zoo stock was sold to private parties who eventually released some to the wild in New Mexico in 1950 and in Texas in 1957. This has allowed a wild population to develop in the southwestern United States (Gray & Simpson, 1980).

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

70 records. Latest 2000 (Gebel Elba, Gebel Uweinat).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Formerly Widespread, now Narrow (south). AOO=218.4 km². EOO=712333.8 km². 11 locations. Big decline in occupancy over 20th century.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Formerly much of North Africa in mountainous areas from Mauritania to Morocco east through Algeria, Libya, and Egypt and south to Chad, Niger, and Sudan. Range now fragmented but still recorded in reasonable numbers in some regions. In Egypt, formerly over much of the Eastern Desert and the central and south­ern Western Desert including near Kharga, Farafra, and Gebel Uweinat. Now decimated by hunting and possibly extinct in the Western Desert (last record 1972). Anecdotal reports of the species from northeast of Wadi Allaqi in the south of the Eastern Desert where two were reportedly shot illegally by hunters in 1993. Protected by Egyptian Law, but this is poorly enforced.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to North Africa (western Sahara to western Egypt; Mali to Sudan). Introduced in Spain, northern Mexico, and the U.S. (Grubb, in Wilson and Reeder 1993). In the U.S., the largest populations are in west Texas (e.g., Palo Duro Canyon), New Mexico (e.g., Canadian River gorge and Largo Canyon), and west-central California (Hearst Ranch).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The Barbary sheep is found in northern Africa, where it is distributed from Morocco and Western Sahara, east to Egypt and Sudan (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ammotragus lervia is a relatively large sheep. The main pelage of the Barbary sheep is brown; however, the chin, throat, chest, and insides of the front limbs are covered with long, white hair. This white hair is called the ventral mane and appears as if the sheep had a beard. Sexual dimorphism is evident. Males can be up to 145 kg, while females are much smaller, the largest are up to 65 kg. Both males and females have horns that curve outward, backward, and point inward toward the neck. Females' horns are smaller, but have the same shape (Gray & Simpson, 1980; The Mammals of Texas - Online Edition, 1994).

Range mass: 65 to 145 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • 1994. "The Mammals of Texas - Online Edition" (On-line). Accessed November 21, 1999 at http://www.nsrl.ttu.edu/tmot1/ammolerv.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length (male) 175-190cm, (female) 145-160cm; Tail (male) 20-25cm, (female) 15-20cm; Shoulder (male) 90-100cm, (female) 75-90cm; Weight (male) 100-140kg, (female) 40-55kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 170 cm

Weight: 145000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Taxonomy

Type of the ssp from near Cairo.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Aoudads tend to inhabit rocky and often precipitous areas, from near sea level up to snow-free areas at about 4,100 m (such as the Moroccan Atlas). They also require rocks or sparse tree cover for shade, and might wander far from water sources for long periods of time. This species is a generalist herbivore combining grazing with browsing, and can survive without drinking water for long periods (even years), eating succulent forbs. They probably make small migratory movements in relation to food availability (Cassinello in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Ammotragus lervia is endemic to the mountains of Northern Africa. It has also survived in the mountains and canyons of the dry southwestern United States. Barbary sheep live in the desert mountains from sea level up to the edge of the snows.

Barbary sheep are also well adapted to a dry climate. They are able to survive long periods of time without fresh water intake by using metabolic water (Gray & Simpson, 1980; The Mammals of Texas - Online Edition, 1994; Schaller, 1977).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Mountainous desert areas, cliffs, etc. Extremely adept climber. Descends to wadis to feed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Arid and semiarid habitat to at least 945 m in North Africa. In the southwestern U.S., inhabits canyonlands with gorges 305 m deep at elevations up to 1829 m. Typically in areas with precipitous topography.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Barbary sheep are found in arid hill and mountain habitats (6). Within this rocky, rugged terrain, the Barbary sheep selects areas where there is some shade, either caves, rocky overhangs or trees, to which it can retreat during the hottest hours of the day (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Barbary sheep are herbivorous, feeding on a variety of vegetation such as grass, forbs, and shrubs. Seasonal variation plays a role in determining their diet. In the winter, grass makes up the majority of food intake, while shrubs are the more common food the rest of the year (The Mammals of Texas - Online Edition, 1994).

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet changes seasonally. In New Mexico, woody browse and grasses were major food source in spring, summer and fall; grasses were principal winter food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Minimum home range size of one radio-collared male in Texas 0.98 sq km in winter, 19.26 sq km in summer. Population density 0.4-2.4 per sq km in different areas of U.S. (Gray and Simpson 1983). Competes with native ungulates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Little known in Egypt. As with most desert herbivores, active mainly in early morning and late afternoon/evening. By day seeks shade. Lives in small groups of 3-6. Herbivo­rous, feeding mainly on Tamarix, Capparis, Acacia and Citrullus, also on seeds, leaves, buds and tubers. Probably less tied to water than Ibex and may be able to obtain enough moisture from food. Will drink if water is available. Predators largely exterminated but Leopard and Caracal Felis caracal may still be present in southern Eastern Desert. Mates Sept-Nov when male guards female; pregnancy 150-165 days; 1-3 young per litter, suckled for up to 8 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
20.9 years.

Average lifespan

Status: wild:
10.0 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During estrus, females lick the sides of the prospective mate. The animals may touch muzzles. The male mounts the female and achieves copulation. Males defend groups of females from other males.

Mating System: polygynous

Breeding usually occurs from September through November, but the timing can vary. Gestation lasts about 160 days, so most lambs are born between March and May. However, births have been seen as late as November. Most births produce a single offspring, but twins are born one out of every six or seven births.

The timing of sexual maturity varies among males. Sperm were found in one male at eleven months; however, this is probably not the norm. Females are considered sexually mature at 19 months; however, females as young as 8 months of age have produced offspring.

Breeding interval: Breeding occurs once yearly.

Breeding season: Breeding occurs from September to November.

Range number of offspring: 1 to 2.

Average number of offspring: 1.01.

Range gestation period: 5.17 to 5.5 months.

Average gestation period: 5.33 months.

Range weaning age: 4 (low) months.

Average weaning age: 4 months.

Average age at sexual or reproductive maturity (female): 19 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 4500 g.

Average number of offspring: 1.2.

Average age at sexual or reproductive maturity (female)

Sex: female:
335 days.

Parental Investment: extended period of juvenile learning

  • 1994. "The Mammals of Texas - Online Edition" (On-line). Accessed November 21, 1999 at http://www.nsrl.ttu.edu/tmot1/ammolerv.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most matings occur during autumn rut, September-November, but some occur throughout the year. Gestation lasts 22-23 weeks. Up to 84% of births occur March-May. Females produce 1, sometimes 2, more rarely 3, young.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ammotragus lervia

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA838-07|NC_009510|Ammotragus lervia| AACCGCTGATTATTTTCAACTAATCATAAAGACATCGGCACCCTCTACCTCCTATTTGGCGCCTGAGCCGGCATGGTAGGAACCGCCTTA---AGCTTATTAATTCGCGCCGAACTAGGCCAACCTGGAACCCTACTTGGAGAT---GATCAAATCTACAACGTAGTTGTAACTGCACACGCGTTCGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGCAACTGACTAGTTCCTCTAATG---ATTGGAGCCCCTGACATAGCATTCCCTCGGATAAATAATATAAGCTTTTGACTCCTCCCCCCTTCCTTCCTATTACTCCTAGCATCCTCCATAGTTGAGGCCGGAGCAGGAACAGGTTGAACTGTGTACCCGCCTCTAGCAGGCAACCTAGCCCATGCAGGAGCTTCAGTAGACCTA---ACCATCTTTTCCCTACACCTAGCAGGTGTCTCCTCAATTCTAGGAGCTATCAATTTTATCACAACCATCATTAATATAAAACCCCCTGCAATATCACAATATCAAACTCCCCTGTTCGTGTGATCTGTACTAATTACTGCCGTCCTACTCCTCCTCTCACTTCCTGTATTAGCAGCT---GGCATCACAATATTACTTACAGACCGAAACCTAAATACAACCTTTTTTGACCCAGCAGGAGGAGGGGACCCTGTTTTATATCAACACCTATTCTGATTCTTTGGGCACCCTGAAGTATATATTCTTATTTTACCCGGATTCGGAATGATCTCCCACATTGTGACCTACTATTCAGGGAAAAAA---GAACCATTTGGGTATATGGGAATGGTATGAGCCATAATATCAATTGGGTTCCTAGGGTTTATTGTATGAGCCCATCATATGTTCACAGTTGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ammotragus lervia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
Cassinello, J., Cuzin, F., Jdeidi, T., Masseti, M., Nader, I. & de Smet, K.

Reviewer/s
Festa-Bianchet, M. & Harris, R. (Caprinae Red List Authority)

Contributor/s

Justification
Listed as Vulnerable as the total population size is in the order of 5,000-10,000 individuals, and it is estimated that a decline in excess of 10% will occur over the coming 15 years (three generations) mainly as a result of hunting and habitat loss.

History
  • 1996
    Vulnerable
  • 1994
    Indeterminate
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Commercially grown and wild populations of Barbary sheep are legally hunted in New Mexico and Texas (Gray & Simpson, 1980).

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Critically Endangered (A2, B2 a,b i,ii); declared Extinct by IUCN in the 1990s, but new records show it is still extant.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Rare.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1) and listed on Appendix II of CITES (3). Subspecies: Ammotragus lervia ornata (Egyptian Barbary Sheep) is classified as Extinct in the Wild (EW) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no total estimates of population size, but overall indications are that the population is in the order of 5,000-10,000 individuals.

The total population in Morocco is estimated to be between 800 and 2,000 animals (Cuzin et al. in press), and there are several thousand animals in Algeria. Low numbers survive in Chad, Mauritania and Adrar des Iforas in Mali; there are no estimates in Libya, Western Sahara, or Tunisia. In Niger, estimates are available for the Air and Tenere National Nature Reserve (3,500 animals) and outside the reserve (700). These populations in the Air mountains appear to be increasing, but for the country as a whole the population trend is overall downward. There are no population estimates available for Sudan, but the species is generally regarded as very rare and almost certainly declining (Shackleton 1997; and references therein). Once regarded as extinct, Aoudads seem to be locally numerous in the Eastern and Western Deserts of Egypt (M.A. Saleh, in Cassinello in press).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The major threats across the range include poaching and habitat destruction, mainly from livestock grazing, fuelwood collection, and from drought and desertification. In the Western Sahara, hunting by soldiers has been a serious threat, and here the species might already be extinct (Valverde 1968). The decline of Egyptian Barbary Sheep has no doubt been accelerated by competition with livestock and feral camels. The availability and distribution of waterholes would likely be a major factor in the condition of populations, and both may fluctuate from year to year.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The sole wild sheep of Africa has been heavily impacted by both extensive hunting and competition with livestock (2) (4), resulting in an alarming decline in numbers and the disappearance of this species entirely from some areas (4) (5). The Barbary sheep is an important source of meat and hides for many of the native people of the Sahara (5), and expanding human populations have not only led to an increase in hunting, but has reduced suitable habitat for the sheep as logging, agriculture and grazing expands into the mountainous areas (6). The Egyptian subspecies (Ammotragus lervia ornata) was, like all Barbary sheep, reduced significantly in number by hunting and competition with livestock and feral camels (6), to the point where no more were believed to exist in the wild (1). However, there is some evidence, collected between 1997 and 2000, that the Egyptian Barbary sheep persists in the southwest and southeast of Egypt, meaning that the IUCN classification of Extinct in the Wild may no longer be valid (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Algeria

Aoudad occur in four protected areas in Algeria: Belezma, Tassili n’Ajjer, and Ahaggar National Parks, and in Djebel Aissa State Forest (De Smet 1997).

Priority conservation measures proposed include: 1) Establishing more reserves in the north if the species is to survive in the Saharan Atlas range; 2) Reintroducing Aoudad into Djelfa Hunting Reserve (20,000 ha; est. 1974) located in the Haut Plateau (34°40’N, 3°15'E), and into Tlemcen Hunting Reserve (400 ha) in north-west Algeria between Oran and Oujda (34°52'N, l°15'E).

Chad

In Chad, Aoudad are present in the Fada-Archei Faunal Reserve (La Reserve de Faune de Fada Archei) in north-eastern Chad. This was established to preserve Aoudad and other desert species in 1967. Unfortunately, conditions have been difficult in this region since 1972, as a result of political instability and the conflict with Libya. Poaching in the reserve probably takes place and there are military personnel stationed at the nearby town of Fada (Mekonlaou and Daboulaye 1997).

Priority conservation measures proposed include: 1) carrying out surveys in the Tibesti and Ennedi mountains, and elsewhere to determine current numbers and actual distributions; 2) consider establishing a protected area, preferably a national park or at least a faunal reserve, in the Tibesti mountains; and 3) improve the levels of protection, especially anti-poaching efforts, staffing and support for Fada-Archei Fauna1 Reserve, as with other protected areas in the country.

Egypt

Aoudad have recently been confirmed as occurring in Gebel Elba Conservation Area (48,000 ha; est. 1986). Assiut University Protected Area was originally set aside in the 1930s to protect Aoudad, but there are no recent reports of the species’ presence (Amer 1997).

Conservation measures proposed include: 1) survey areas previously known to be inhabited by the species; and 2) evaluate the habitat along with the potential for re-introductions.

Libya

It is not known whether Aoudad are protected by law. The species was introduced into Tripoli Nature Reserve (870 ha; est. 1978). It may also occur in Jabel Nefhusa Nature Reserve (20,000 ha; est. 1978) in northern Libya in the Jebel Tarabulus range of the Jebel Nefhusa mountains (Tripolitania Region 32°N, 12°50'E), although this reserve does not appear to fall within the suspected distribution of the species (Shackleton and De Smet 1997). There are captive populations in Sabratha, Surman and the Zoological Garden of Tripoli (T. Jdeidi pers. comm.). The latter definitely belongs to the subspecies A. l. fassini.

A population survey is needed to determine the current distribution and status of Aoudad in Libya.

Mali

Aoudad receive no protection nor occur in any protected areas in Mali (Lamarche 1997).

Proposed conservation measures include: 1) conduct censuses and surveys to determine population numbers and distribution within the Adrar des Iforas; and 2) consider the feasibility of establishing a protected area for Aoudad in this region.

Mauritania

Aoudad occur in one protected area in Adrar Mouflon Partial Faunal Reserve (Lamarche 1997).

Conservation measures proposed include censuses to determine current numbers and distribution.

Morocco

Since 1958, the annual ministerial order regulating hunting has severely restricted taking Aoudad. For example, in 1961 the species could be hunted for only three days, and only one day in 1966. Since 1966, the species is fully and permanently protected. Aoudad occur in four protected areas in Morocco, including Eastern High Atlas National Park, Toubkal National Park, and the adjacent Takherkhort Hunting Reserve (1,230 ha). The latter, situated in the western High Atlas mountains, was established in 1967 to preserve the species. Although around 350 to 475 animals occupy the hunting reserve (Mokhtari 2006), grazing by livestock is a serious threat. Animals from the reserve have been used for re-introductions to other areas, including Sochatour’s Tiradine Hunting Reserve. The native vegetation is evergreen oak forest, and the Aoudad is reported to be reproducing, and numbered around 70 animals in 1990. Aoudad also inhabit a number of other hunting reserves, most of which are so small that they are occupied only seasonally and have little significance for conservation of the species (Aulagnier and Thevenot 1997).

The most important conservation measures proposed include: 1) Surveys to determine the status and distribution of Aoudad in Morocco; 2) Increasing the number of protected areas. Among the most valuable and interesting natural places where Aoudad need protection, three or four national parks or permanent reserves can be proposed: Jbel Grouz and Jbel Maiz (arid hills near Figuig), Jbel Bou Iblane or Jbel Bou Nasser (eastern Middle Atlas), and some areas of rocky argan bush in the Anti-Atlas (between Igherm and Tata); and 3) Hunting and grazing should be strictly forbidden in protected areas.

Niger

All hunting has been banned since 1964 and though this law is enforced by the Nigerien Forest Service, the vast range occupied by the Aoudad, together with manpower limitations and political unrest, limit the effectiveness of anti-poaching efforts. Aoudad only occur in one protected area in Niger, in the vast Reserve Naturelle Nationale de L’Air et du Tenere, in north-central Niger. Created in January 1988, the reserve covers 7,737,000 ha of Saharan desert and Sahara-montane habitat. The reserve may harbor as much as 70% of the total population of Aoudad in Niger (Magin and Newby 1997)

Sudan

Aoudad fall under Schedule II as a protected species, though up to two can be shot by anyone with a class A or D license. None occur in any protected area in the Sudan (Nimir 1997).

Conservation measures proposed include: 1) move Aoudad to Schedule I so that it is completely protected; and 2) re-introduction of Aoudad to remaining areas and habitats which are suitable.

Tunisia

In Tunisia, Aoudad has been protected by law since 1966. A re-introduction of Aoudad into the Djebel Chambi National Park began in 1987, when ten animals, originally from Kasserine, were released into a one ha enclosure for later release into the rest of the park. Some of these animals escaped in 1988, and the wild population now numbers 100 animals (DGF 2005). A few animals are held in captivity in the Djebel Bou Hedma National Park, in the Bou Hedma ranges of the Atlas Saharien. Animals are also believed to occur in the proposed Dghoumes National Park (De Smet 1997), and the species was also released in the Oued Dekouk Nature Reserve, south of Tataouine.

Priority conservation measures proposed include: 1) ensuring the establishment of the new desert national park 50 km east of Tozeur at Dghoumes (this area and the rest of the mountain chain north of the Chott El Fedjadj and Chott El Djerid, are considered good Aoudad habitat); and 2) reconsider the suggestion to release Aoudad into Sidi Toui National Park because the topography is probably too flat to be suitable for them.

Western Sahara

The most important conservation measures proposed include: 1) Surveys to determine whether or not this species surivives in Western Sahara, and if so, to ascertain its status and distribution; 2) Establishing a protected area for the species if there is a surviving population (for example, in Oued Ed Dahab Province); and 3) Strict control of hunting and of grazing where this species survives.

Listed in CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

While the Barbary sheep is protected by law throughout most of its range, the lack of enforcement of these laws is a serious problem for the conservation of this species (6). This relates to the unfortunate fact that most countries in which the Barbary sheep occurs have little funds available to conserve these animals (6). For the Egyptian subspecies, confirming whether it does still exist in the wild is clearly a priority, followed by the effective protection of any populations that do remain (7). Giza Zoo in Egypt holds a population of Barbary sheep, which may be used in the future in reintroduction programmes. The Egyptian Wildlife Service, in co-operation with the zoo, has already identified some areas for possible reintroductions (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

It is currently unknown as to whether the Barbary sheep will become a pest like many other introduced species. It has been suggested that Barbary sheep would compete directly with mule deer for food. They might also affect the attempt at reintroduction of bighorn sheep. These two species may not survive in the same environment because of direct competition for food and other resources. Barbary sheep have been found feeding on winter wheat crops in Texas (Mammals of Texas - Online Edition, 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the United States, Barbary sheep are commercially bred to be used for sport hunting. Nomads of the Sahara depend on Barbary sheep for meat, hide, hair, sinews, and horns (Gray & Simpson, 1980).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Barbary sheep

The Barbary Sheep (Ammotragus lervia) is a species of caprid (goat-antelope) native to rocky mountains in North Africa. Six subspecies have been described. Although it is rare in its native North Africa, it has been introduced to North America, southern Europe and elsewhere. It is also known as aoudad, waddan, arui, and arruis.

Contents

Description

Barbary Sheep stand 80 to 100 cm (2.6 to 3.3 ft) tall at the shoulder and weigh 40 to 140 kg (88 to 310 lb). They are a sandy-brown color, darkening with age, with a slightly lighter underbelly and a darker line along the back. Upper parts and the outer parts of the legs are a uniform reddish-brown or grayish-brown. There is some shaggy hair on the throat (extending down to the chest in males) and a sparse mane. Their horns have a triangular cross section. The horns curve outwards, backwards then inwards, and reach up to 50 cm (20 in). The horns are fairly smooth, with slight wrinkles evident at the base as the animal matures (see photo).

Range

Natural range

Barbary Sheep are found naturally in northern Africa in Algeria, Tunisia, northern Chad, Egypt, Libya, northern Mali, Mauritania, Morocco, Niger and Sudan (west of the Nile and east of the Nile in the Red Sea Hills).[4]

Introduced populations

old picture In the London Zoo

Barbary Sheep have been introduced to southeastern Spain and southwestern United States Chinanti Mountains (on La Escalera Ranch, Guadalupe Mountains National Park, and other parts of Texas, New Mexico, and California) and Mexico and to some parts of Africa.

Barbary sheep have become common in a limited region of the south-east of Spain, since its introduction in 1970 to Sierra Espuña [Regional park] as a game species. Its adaptability enabled it to colonise nearby areas quickly, and private game estates provided other centers of dispersion. The species is currently expanding, according to recent field surveys, now being found in the provinces of Alicante, Almería, Granada and Murcia.[5] This species is a potential competitor to native ungulates inhabiting the Iberian Peninsula. The species has also been introduced to La Palma (Canary Islands), and has spread throughout the northern and central parts of the island, where it is a serious threat to endemic vegetation.

Taxonomy

juvenile

A. lervia is the only species in the genus Ammotragus. However, some authors include this genus in the goat genus Capra, together with the sheep genus Ovis.[3]

The subspecies are found allopatrically in various parts of North Africa:[4]

Habitats

Barbary Sheep

Barbary Sheep are found in arid mountainous areas where they graze and browse grass, bushes and lichens. They are able to obtain all their moisture from food, but if liquid water is available they drink it and wallow in it. Barbary Sheep are crepuscular: active in the early morning and late afternoon and resting in the heat of the day. They are very agile and can achieve a standing jump of over 2 metres (7 ft). Barbary Sheep are very gregarious, and freeze in the presence of danger, probably in order to remain unnoticed to predators. Their main predators in North Africa were the Barbary leopard, the Barbary lion and caracal, but nowadays only humans threaten their populations.

Names

The binomial name Ammotragus lervia derives from the Greek ammos ("sand", referring to the sand-coloured coat) and tragos ("goat"). Lervia derives from the wild sheep of northern Africa described as "lerwee" by Rev. T. Shaw in his "Travels and Observations" about parts of Barbary and Levant.

The Spanish named this sheep the arruis, and the Spanish Legion even used it as a mascot for a time.

Aoudad ([ˈɑː.uːdæd]) is the name for this sheep used by the Berbers, a North African people, and it is also called arui and waddan (in Libya).

Gallery

References

  1. ^ Cassinello, J., Cuzin, F., Jdeidi, T., Masseti, M., Nader, I. & de Smet, K. (2008). Ammotragus lervia. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 11 November 2008. Database entry includes a brief justification of why this species is of Vulnerable C1.
  2. ^ Grubb, Peter (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press], 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200753. 
  3. ^ a b Grubb, Peter (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press], 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200767. 
  4. ^ a b Grubb, Peter (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press], 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200754. 
  5. ^ Cassinello, J.; Serrano, E.; Calabuig, G. & Pérez, J.M. (2004). Range expansion of an exotic ungulate (Ammotragus lervia) in southern Spain: ecological and conservation concerns. Biodiversity and Conservation 13: 851-866

Bibliography

  • Cassinello, J. (1998). Ammotragus lervia: a review on systematics, biology, ecology and distribution. Annales Zoologici Fennici 35: 149-162
  • Wacher, T., Baha El Din, S., Mikhail, G. & Baha El Din, M. (2002). New observations of the "extinct" Aoudad Ammotragus lervia ornata in Egypt. Oryx 36: 301–304.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data. Some authors have included the genus Ammotragus in the genus Capra, but most authors have retained these as separate genera (e.g., Jones et al. 1992; Grubb, in Wilson and Reeder 1993, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!