Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Description

Pronghorn are endemic to North America, and are the only living members of the family Antilocapridae. In the Pleistocene, about a dozen species roamed the continent. Two things distinguish their horns from those of all other mammals: they fork, and the black, outer, forked sheath is shed annually from the unforked, bony core. The horns of females are shorter and do not develop a pronounced prong-like shape. Pronghorns stay in the open, relying on their excellent eyesight and speed for protection - they have been clocked at 72 km per hour. They communicate with each other visually, by raising the mane on the back of the neck into a stiff brush and erecting the white hairs on the rump. When a Pronghorn activates this visual beacon, it is coupled with an olfactory signal: the rump glands emit a strong smell.

Adaptation: Pronghorn have large eyes projecting away from the skull. A prominent ring-like eye socket supports the eyes, giving them a very wide field of view.

Links:
Mammal Species of the World
  • Original description: Ord, 1815. in Guthrie, William, A new system of modern geography: or, a geographical, historical, and commercial grammar, and present state of the several nations of the world, 2nd Edition, Johnson and Warner, Philadelphia and Richmond, p. 292.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Pronghorn occur from southern Alberta and Saskatchewan south to northern
Sonora and Chihuahua, Mexico; west to eastern Oregon and notheastern
California; and east to mid-state regions of North Dakota, South Dakota,
and Texas. There are small, contiguous populations in extreme western
Oklahoma and Nebraska [67] and small, isolated populations in Kansas
and Baja California [76].

Distribution by subspecies is [44,76]:

American pronghorn - western mountain, Great Basin, and prairie
states; most abundant subspecies
Oregon pronghorn - contiguous in sagebrush steppe of eastern
Oregon, southwestern Idaho, northeastern
California, and northern Nevada; isolated
populations in eastern Washington
Mexican pronghorn - southern Arizona, New Mexico, Texas, and
central Mexico
peninsula pronghorn - isolated populations in Baja California;
original range included southern California
Sonoran pronghorn - extreme southern Arizona and west-central Mexico

Historically, pronghorn range extended further north in Alberta and
Saskatchewan; west through most of California and all of Baja
California; east to western Minnesota and Iowa; and south through
east-central Texas to San Luis Potosi in Mexico [76]. Warm desert
populations have declined greatly from historic size and range.
Pronghorn from the United States have been introduced in all Mexican
Chihuahuan Desert states from the international boarder south to San
Luis Potosi. The largest pronghorn populations are first, in Wyoming,
and secondly, Montana [57,76].
  • 44. Lee, Thomas E., Jr.; Bickham, John W.; Scott, M. Douglas. 1994. Mitochondrial DNA and allozyme analysis of North American pronghorn populations. Journal of Wildlife Management. 58(2): 307-318. [25383]
  • 57. Ramirez, Bernardo Villa. 1974. Major game mammals and their habitats in the Chihuahuan Desert region. In: Wauer, Roland H.; Riskind, David H., eds. Transactions of the symposium on the biological resources of the Chihuahuan Desert region, United States and Mexico; 1974 October 17-18; Alpine, TX. Transactions and Proceedings Series No. 3. Washington, DC: U.S. Department of the Interior, National Park Service: 155-161. [16059]
  • 67. Sundstrom, Charles; Hepworth, William G.; Diem, Kenneth L. 1973. Abundance, distribution and food habits of the pronghorn: A partial characterization of the optimum pronghorn habitat. Bulletin No. 12. Boise, ID: U.S. Bureau of Sport Fisheries and Wildlife, Division of River Basin Studies. 59 p. [5906]
  • 76. Yoakum, Jim. 1980. Habitat management guides for the American pronghorn antelope. Tech. Note 347. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 77 p. [23170]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America


AZ CA CO ID KS MT NE NV
ND OK SD TX UT WA WY
AB SK MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Pronghorn occurs in western North America, from the southern Prairie Provinces of Canada (southern Alberta, southern Saskatchewan) south through the western U.S. to northern Mexico (Baja California, Sonora, Hidalgo).

It was introduced on Lanai Island (Hawaii) in 1959, where it reached a population of about 250 in the mid-1960s; however, there were less than 12 in 1983 and it seems headed for extinction (Tomich 1986).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Antilocapra americana is endemic to North America and distributed throughout the treeless plains, basins, and deserts of western North America, from the southern prairie provinces of Canada, southward into the western United States and to northern Mexico. Distribution of populations within this range is discontinuous. In 1959, a population was introduced to Hawaii. However, by 1983 the population was roughly 12 individuals and headed for extinction.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Western North America, from southern Prairie Provinces of Canada (southern Alberta, southern Saskatchewan) south through the western U.S. to northern Mexico (Baja California, Sonora, Hidalgo). Introduced on Lanai (Hawaii) in 1959; reached population of about 250 in the mid-1960s; less than 12 in 1983 and headed for extinction (Tomich 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pronghorns are small ungulates with barrel-shaped bodies. Females stand 860 mm at the shoulder and males 875 mm at the should. Females are approximately 1406 mm in body length and males are approximately 1415 mm. The tail is up to 105 mm long and ears are up to 143 mm long. Their body weight is from 35 to 70 kg, depending on sex and age. Their hair is dense and very coarse and is air-filled, providing excellent insulation. Guard hairs are hollow and underlain by finer, shorter underfur. Guard hairs are erectile for heat regulation. As more air becomes trapped in fur, the more they are insulated from external temperatures. Their dorsal fur is a rufous brown and they have creamy underbellies, rumps, and neck patches. Males have short black manes on the neck, from 70 to 100 mm in length, as well as a neck patch and a black stripe that runs across the forehead from horn to horn. Females lack these black facial patches, but have a small mass of black hair around their nose. Their ears are small and point slightly inward at the tip. Pronghorns have a patch of white, erectile fur on their rumps that is visible at great distances. The mucous membranes and eyelashes are coal black. Southern populations are paler in overall color than northern populations. The horns are erect, with a posterior hook and a short anterior prong. The prong gives rise to the common name “pronghorn”. This pronged pattern is unique to this species. The horn is a keratinized sheath, black in color, and is deciduous. Horn sheaths grow over a bony extension of the frontal bone, which is now called the cancellous bone in ungulates. A new sheath forms under the old, which splits and is dropped just after the rut each year. Both sexes have horns, although the horns of females are generally small or absent, and never exceed ear length. Female horns average about 120 mm and the prongs are not prominent. The horn begins to grow at the age of six months and will be shed by 18 months. The maximum horn height for males will occur within 2 to 3 years of age and will average 250 mm, exceeding the length of the ear.

Pronghorn limbs are specialized for cursoriality, giving them enhanced speed and endurance. They are the fastest known New World mammal, traveling at speeds of 98 km/h when sprinting, and can hold a sustained speed of 59 to 65 km/h. The advantages to having speed and endurance include the ability to forage over large areas, to seek new food sources when familiar sources fail, and the ability to escape predators. Pronghorns have unguligrade foot posture, which lengthens the legs by allowing them to stand on the tips of their digits. The length of the radius bone is as long, or longer, than the femur. The ulna is reduced and partially fused to the radius. The clavicle in ungulates has been lost and the scapula has been reoriented to lie flat against the side of their chest where it is free to rotate roughly 20° to 25° in the same plane in which the leg swings. The ulna and radius have been reduced to eliminate the twisting and rotating of the elbow. The reduction of bone and associated muscles in the distal limbs decreases limb weight, giving them more speed. Pronghorns have modified their joints to act as hinges allowing only motion in the line of travel. This has been done by introducing interlocking spines and grooves in their joints. All these adaptations have made pronghorns excel in cursorial locomotion, but they can no longer jump because they have lost the suspension mechanism that cervids have. This explains their apparent fear of fences.

The dental formula of Antilocapra americana is 0/3-0/1-3/3-3/3, where incisors and canines only occur on the lower jaw. Pronghorns have hypsodont crown height; discernable roots do not occur, allowing the cheek teeth to be ever growing. An approximate age when the molars erupt varies slightly; the first comes in at 2 months and the second and third come in around 15 months of age. Replacement of incisors varies as the first is replaced at 15 months, the second at 27, and the third at 39 months. Canines are replaced between 39 and 41 months. Premolars are all replaced at 27 months of age. The sequence of tooth eruption, replacement, and wear is used to estimate the age of pronghorns. Cementum annuli analysis of the first permanent incisor is used for older age classes.

Maximal rate of oxygen intake in pronghorns determines the peak at which the animal can synthesize ATP by aerobic catabolism. This then determines how intensely the animal can exercise. Pronghorns are an extreme example of evolutionary specialization for high oxygen consumption. When comparing body weight to weight-specific consumption of oxygen, pronghorns have values three times higher than the that expected for their body size. This high oxygen consumption makes pronghorns Earth’s fastest sustained runner. Unlike cheetahs, also one of the fastest animals on Earth, pronghorns produce ATP required to run fast aerobically. They have exceptionally large lungs for their body size and exceptional abilities to maintain high rates of blood circulation.

Range mass: 47 to 70 kg.

Average mass: 50-57 kg.

Range length: 1.75 (high) m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful; ornamentation

Average basal metabolic rate: 50.973 W.

  • Hildebrand, M., G. Goslow. 2001. Analysis of Vertebrate Structure Fifth Edition. New York, NY: John Wiley & Sons, Inc..
  • Hill, R., G. Wyse, M. Anderson. 2004. Animal Physiology. Sunderland, MA: Sinauer Associates, Inc..
  • Hays, W. 1868. The Prong-Horn Antelope. The American Naturalist, Vol. 2, No. 3: 131-133.
  • O'Gara, B. 1978. Antilocapra americana. Mammalian Species, 90: 1-7.
  • Schroeder, M., L. Robb. 2005. Criteria for Gender and Age. Pp. 303-338 in C Braun, ed. Techniques for Wildlife Investigations and Management. Bethesda, Maryland: The Wildlife Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 145 cm

Weight: 63000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 1.3-1.5 m males; 1.3-1.5m females

Weight:
Range: 42-59 kg males; 41-50 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Shape of the horns and annual shedding of horn sheaths are unique among North American ungulates. Differs from the bighorn sheep in having white bands on the neck and slightly curved horns rather than strongly curved horns. Differs from deer in having white lower sides rather than lower sides the same basic color as the upper sides; also, deer lack conspicuous white bands on the neck.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cover Requirements

More info for the terms: cover, forbs, shrub, shrubs

Reaching top speeds of 50 mph (80 km/hr), pronghorn are North America's
fastest mammal. Pronghorn rely on keen eyesight, vigilant watch, and
rapid flight to avoid predation [35]. Pronghorn therefore require open
cover, either grassland or grassland interspersed with low shrubs, that
provides long-range visibility. Prenslow and others [56] never observed
pronghorn in areas where views were restricted by terrain or vegetation
for more than a few minutes at a time. Pronghorn typically occupy areas
where vegetation is at a mean height of 15 inches (37.5 cm), even if
more suitable forage is available on sites with taller vegetation [15].

Adult pronghorn may use low shrubs for bedding cover [1].

Does seek areas with greater than average shrub cover and height for
fawning [5]. Fawns under 3 weeks old tend to stay in their birthing
area [1,31], using the tallest vegetation in the area for cover [6,56].
On the shortgrass prairie of Colorado, habitat diversity provided by
silver sagebrush (Artemisia cana), small depressions, and stands of
grasses and forbs 9.8 inches (25 cm) or more in height contributed to
above-average fawn survival. Eighty-eight percent of fawns captured
were located in washouts, tall grass, or near large rocks [56].
  • 1. Alldredge, A. William; Deblinger, Robert D.; Peterson, Jan. 1991. Birth and fawn bed site selection by pronghorns in a sagebrush-steppe community. Journal of Wildlife Management. 55(2): 222-227. [15468]
  • 5. Autenrieth, Robert. 1976. A study of birth sites selected by pronghorn does and the bed sites of fawns. In: Autenrieth, Robert, compiler. Proceedings, 7th pronghorn antelope workshop; 1976 February 24-26; Twin Falls, ID. Boise, ID: Idaho Department of Fish and Game: 127-134. [25418]
  • 6. Autenrieth, Robert. 1978. Antelope fawning and bedding site vegetation analysis. In: Greenley, Joseph C., compiler. Antelope ecology. Boise, ID: Idaho Department of Fish and Game: 32-37. [25419]
  • 15. Boyd, Raymond J.; Cooperrider, Allen Y.; Lent, Peter C.; Bailey, James A. 1986. Ungulates. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 519-564. [10856]
  • 31. Fichter, Edson. 1972. On the bedding behavior of pronghorn. In: Compton, H. O.; Pyrah, Duane, compilers. Proceedings, 5th antelope states workshop; 1972 June 19-22; Billings, MT. [Place of publication unknown]
  • 35. Hailey, Tommy L.; DeArment, Richard. 1972. Droughts and fences restrict pronghorns. In: Compton, H. O.; Pyrah, Duane, compilers. Proceedings, 5th antelope states workshop; 1972 June 19-22; Billings, MT. [Place of publication unknown]
  • 56. Prenzlow, E. J.; Gilbert, D. L.; Glover, F. A. 1968. Some behavior patterns of the pronghorn. Special Report No. 17. GFP-R-S 17. Denver, CO: Colorado Department of Game, Fish and Parks. 16 p. [25691]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, forb, forbs, shrub

Pronghorn typically inhabit low, rolling, expansive lands with less than
30 percent slope. Kindschy and others [41] reported that less than 5
percent slope was ideal for pronghorn. Temperature is not limiting:
Pronghorn occur in cold continental climates and in warm deserts. They
reach highest densities on ranges with annual precipitation rates of 10
to 15 inches (254-381 mm); populations in areas with greater or lesser
amounts of precipitation have lower survival rates. Pronghorn are found
from sea level in Mexico to alpine meadows reaching 11,000 feet (3,353
m) elevation in Oregon and Wyoming. Greatest densities in the Great
Basin occur between 4,000 to 6,000 feet (1,220-1,830 m) elevation [7].
The following characterisitics were common to preferred pronghorn ranges
in the Great Basin [41]:

* ground cover averaging 50 percent live vegetation;
* range composition of 40 to 60 percent grasses, 10 to 30 percent
forbs, and 5 to 20 percent browse;
* a variety of plant species including 5 to 10 grass species, 20
to 40 forb species, and 5 to 10 shrub species;
* succulent plants, available in spring and wet summers;
* low vegetation structure averaging 15 to 24 inches (38-61 cm)
in height

Most of these preferred habitat characteristics would probably also
apply to pronghorn habitat east of the Continental Divide [15].

Pronghorn require readily accessible water. Sundstrom [66] reported
that 95 percent of observed pronghorn in Wyoming's Red Desert were
within 3 miles (6 km) of water. Otherwise suitable pronghorn habitat in
Oregon has remained unoccupied year-round due to lack of water in summer
[4]. Pronghorn prefer water in pH range from 6.5 to 8.5 [41]. They
cannot tolerate strongly alkaline water. In the Red Desert of Wyoming,
pronghorn did not drink water above pH 9.25 [56].

Pronghorn habitat requirements are described in detail in Allen and
others [2], Autenrieth [6], Kindschy and others [41], and Yoakum [76].
Allen and others [2] provide a pronghorn habitat index suitablility
model applicable to the Great Basin and the Great Plains.
  • 2. Allen, Arthur W.; Cook, John G.; Armbruster, Michael J. 1984. Habitat suitability index models: Pronghorn. FWS/OBS-82/10.65. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 22 p. [11709]
  • 4. Anon. 1961. Pronghorn antelope. Wild. Ser. Leaf. 2. Portland, OR: Oregon State Game Commission. 28 p. [25481]
  • 6. Autenrieth, Robert. 1978. Antelope fawning and bedding site vegetation analysis. In: Greenley, Joseph C., compiler. Antelope ecology. Boise, ID: Idaho Department of Fish and Game: 32-37. [25419]
  • 7. Autenrieth, Robert, ed. 1983. Guidelines for the management of pronghorn antelope. Austin, TX: Texas Parks and Wildlife Department. 51 p. [25416]
  • 15. Boyd, Raymond J.; Cooperrider, Allen Y.; Lent, Peter C.; Bailey, James A. 1986. Ungulates. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 519-564. [10856]
  • 41. Kindschy, Robert; Sundstrom, Charles; Yoakum, James. 1978. Range/wildlife interrelationships--pronghorn antelope. In: Proceedings, 8th biennial pronghorn antelope workshop; 1978 May 2-4; Jasper, AB. Edmonton, AB: Albertal Recreation, Parks, and Wildlife, Fish and Wildlife Division: 216-262. [3316]
  • 56. Prenzlow, E. J.; Gilbert, D. L.; Glover, F. A. 1968. Some behavior patterns of the pronghorn. Special Report No. 17. GFP-R-S 17. Denver, CO: Colorado Department of Game, Fish and Parks. 16 p. [25691]
  • 66. Sundstrom, Charles. 1968. Water consumption by pronghorn antelope and distribution related to water in Wyoming's Red Desert. In: Proceedings of the biennial antelope states workshop; 1968 February 5-6; Casper, WY. [Place of publication unknown]
  • 76. Yoakum, Jim. 1980. Habitat management guides for the American pronghorn antelope. Tech. Note 347. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 77 p. [23170]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

Pronghorn primarily occur in grasslands and open shrub-grasslands. In
1964, 62 percent of pronghorn were associated with grasslands*; 37
percent with shrub-grasslands**; and 1 percent with deserts [78]. Pronghorn
occasionally use quaking aspen (Populus tremuloides) parklands [13] and
large montane meadows [17].

*41% of the grasslands was shortgrass prairie and 21% was mixed-grass
prairie
**33% of the shrub-grassland was sagebrush [Artemisia spp.]-grassland;
3% was woodland-galleta [Hilaria spp.] grassland; and 1% was mesquite-grama
[Prosopis-Bouteloua spp.] grassland
  • 13. Bird, Ralph D. 1930. Biotic communities of the aspen parkland of central Canada. Ecology. 11(2): 356-442. [15277]
  • 17. Brown, David E. 1982. Montane meadow grassland. In: Brown, David E., ed. Biotic communities of the American Southwest--United States and Mexico. Desert Plants. 4(1-4): 113-114. [8895]
  • 78. Yoakum, Jim. 1972. Antelope--vegetative relationships. In: Proceedings of the antelope states workshop; [Location unknown]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: shrub, vine

101 Bluebunch wheatgrass
102 Idaho fescue
103 Green fescue
104 Antelope bitterbrush-bluebunch wheatgrass
105 Antelope bitterbrush-Idaho fescue
106 Bluegrass scabland
107 Western juniper/big sagebrush/bluebunch wheatgrass
210 Bitterbrush
211 Creosotebush scrub
212 Blackbush
301 Bluebunch wheatgrass-blue grama
302 Bluebunch wheatgrass-Sandberg bluegrass
303 Bluebunch wheatgrass-western wheatgrass
304 Idaho fescue-bluebunch wheatgrass
305 Idaho fescue-Richardson needlegrass
306 Idaho fescue-slender wheatgrass
307 Idaho fescue-threadleaf sedge
309 Idaho fescue-western wheatgrass
310 Needle-and-thread-blue grama
311 Rough fescue-bluebunch wheatgrass
312 Rough fescue-Idaho fescue
314 Big sagebrush-bluebunch wheatgrass
315 Big sagebrush-Idaho fescue
316 Big sagebrush-rough fescue
317 Bitterbrush-bluebunch wheatgrass
318 Bitterbrush-Idaho fescue
319 Bitterbrush-rough fescue
320 Black sagebrush-bluebunch wheatgrass
321 Black sagebrush-Idaho fescue
323 Shrubby cinquefoil-rough fescue
401 Basin big sagebrush
402 Mountain big sagebrush
405 Black sagebrush
406 Low sagebrush
407 Stiff sagebrush
408 Other sagebrush types
412 Juniper-pinyon woodland
414 Salt desert shrub
501 Saltbush-greasewood
502 Grama-galleta
504 Juniper-pinyon pine woodland
505 Grama-tobosa shrub
506 Creosotebush-bursage
507 Palo verde-cactus
508 Creosotebush-tarbush
602 Bluestem-prairie sandreed
603 Prairie sandreed-needlegrass
605 Sandsage prairie
606 Wheatgrass-bluestem-needlegrass
607 Wheatgrass-needlegrass
608 Wheatgrass-grama-needlegrass
609 Wheatgrass-grama
610 Wheatgrass
611 Blue grama-buffalograss
612 Sagebrush-grass
613 Fescue grassland
614 Crested wheatgrass
615 Wheatgrass-saltgrass-grama
701 Alkali sacaton-tobosagrass
702 Black grama-alkali sacaton
703 Black grama-sideoats grama
704 Blue grama-western wheatgrass
705 Blue grama-galleta
706 Blue grama-sideoats grama
707 Blue grama-sideoats grama-black grama
708 Bluestem-dropseed
709 Bluestem-grama
712 Galleta-alkali sacaton
713 Grama-muhly-threeawn
714 Grama-bluestem
715 Grama-buffalograss
716 Grama-feathergrass
717 Little bluestem-Indiangrass-Texas wintergrass
718 Mesquite-grama
719 Mesquite-liveoak-seacoast bluestem
721 Sand bluestem-little bluestem (plains)
722 Sand sagebrush-mixed prairie
724 Sideoats grama-New Mexico feathergrass-winterfat
725 Vine mesquite-alkali sacaton
727 Mesquite-buffalograss
728 Mesquite-granjeno-acacia
729 Mesquite
730 Sand shinnery oak

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: shrub

K023 Juniper-pinyon woodland
K024 Juniper steppe woodland
K027 Mesquite bosque
K031 Oak-juniper woodlands
K038 Great Basin sagebrush
K039 Blackbrush
K040 Saltbush-greasewood
K041 Creosotebush
K042 Creosotebush-bursage
K043 Paloverde-cactus shrub
K044 Creosotebush-tarbush
K045 Ceniza shrub
K050 Fescue-wheatgrass
K051 Wheatgrass-bluegrass
K053 Grama-galleta steppe
K054 Grama-tobosa prairie
K055 Sagebrush steppe
K056 Wheatgrass-needlegrass shrubsteppe
K057 Galleta-three-awn shrubsteppe
K058 Grama-tobosa shrubsteppe
K059 Trans-Pecos shrub savanna
K060 Mesquite savanna
K061 Mesquite-acacia savanna
K062 Mesquite-live oak savanna
K063 Foothills prairie
K064 Grama-needlegrass-wheatgrass
K065 Grama-buffalograss
K066 Wheatgrass-needlegrass
K067 Wheatgrass-bluestem-needlegrass
K068 Wheatgrass-grama-buffalograss
K069 Bluestem-grama prairie
K071 Shinnery
K075 Nebraska Sandhills prairie
K085 Mesquite-buffalograss
K086 Juniper-oak savanna
K087 Mesquite-oak savanna

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

66 Ashe juniper-redberry (Pinchot) juniper
67 Mohrs (shin) oak
68 Mesquite
220 Rocky Mountain juniper
238 Western juniper
239 Pinyon-juniper
240 Arizona cypress
241 Western live oak
242 Mesquite

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
An inhabitant of grasslands, sagebrush plains, deserts, and foothills. They range from near sea-level to 3,350 m (O'Gara 1999). Their need for free water varies with the succulence of the vegetation in their diet. Some populations undertake seasonal movements, sometimes moving as much as 160 km from their summering area (O'Gara 1978). They usually occur in small bands, but large winter herds disperse in spring. Forms separate bachelor and female-kid groups in spring and summer. Males associate with females in late summer and early fall. Breeding takes place mid-September to early October in the north, and from late July to early October in south.

In winter, northern populations depend heavily on browse, especially sagebrush; forbs are most important in summer. Southern populations use more forbs and less browse. They also take grasses, and, in some areas, cacti.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pronghorns are primarily found in grassland, sage scrub or chapparal, and desert. The southern portion of their range consists mainly of arid grasslands and open prairies. Throughout the rest of their range they are common in sage scrub and chaparral as well, areas of dense shrubs with tough leaves. Pronghorns are particularly dependent on sage brush for forage in these areas. Pronghorn feed primarily on sage, forbs, and grasses. They have also been known to consume cacti in some areas.  There is an overlap in forage preferences with domestic sheep and cattle, so some competition for food occurs. Overgrazing by sheep has been implicated in pronghorn die offs, especially in winter.  Pronghorn habitat ranges from sea-level to about 3500 m. Their need for free standing, fresh water varies with the moisture content of the vegetation they consume. They may have to travel a great distance to find a water source. In winter, northern populations depend heavily on sage brush. Pronghorn are commonly found along wind-blown ridges where vegetation has been cleared of snow, although they will dig through snow with their hooves to get to vegetation.

Range elevation: 0 to 3,350 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral

Other Habitat Features: suburban ; agricultural

  • Feldhamer, G., L. Drickamer, S. Vessey, J. Merritt. 2004. Mammology: Adaptation, Diversity, and Ecology Second Edition. New York, NY: McGraw Hill Companies.
  • Anderson, S. 2002. Managing Our Wildlife Resources Fourth Edition. Upper Saddle River, New Jersey: Prentice Hall.
  • Bleich, V., J. Kie, E. Loft, T. Stephenson, M. Oehler, Sr., A. Medina. 2005. Managing Rangeland for Wildlife. Pp. 873=897 in C Braun, ed. Techniques for Wildlife Investigations and Management. Bethesda, Maryland: The Wildlife Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Grasslands, sagebrush plains, deserts, and foothills. Need for free water varies with succulence of vegetation in the diet. Birth and fawn bedding sites in a sagebrush-steppe community in south-central Wyoming were in dense shrub cover, but the tallest, most dense cover was avoided (Alldredge et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonal movements occur in some populations. Sometimes moves as much as 160 km from summering area (O'Gara 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

More info for the terms: cacti, forb, forbs, lichens, shrubs

Foods utilized by pronghorn vary seasonally depending upon
availability, palatability, and succulence of vegetation [39]. Over a
year's time, pronghorn consume nearly all available plant species, with
a preference for succulent forage [79]. Forbs are preferentially
selected when available. Pronghorn select the most succulent,
high-protein browse or grasses available when forbs are scarce [11].

Pronghorn food habits vary throughout their range. The average
pronghorn diet on the shortgrass prairie of Colorado was 43 percent
forbs, 40 percent browse, 11 percent cacti, and 6 percent grasses [39].
Cole and Wilkins [23] found similar dietary patterns on
grama-needlegrass-wheatgrass (Boutelous spp.-Stipa spp.-Agropyron spp.
(as described by Kuchler [43])) types in central Montana. In central
Wyoming, however, pronghorn annual diet averaged 5 percent forbs, 3
percent graminoids, and over 90 percent browse [61].

In winter, shrubs are high in protein relative to other forage, and
shrubs comprise the majority of the pronghorn diet [10]. Browse was the
most heavily utilized pronghorn winter food in Alberta even though its
availability was extremely limited [51]. In Utah browse comprised over
90 percent of the pronghorn diet, with black sagebrush (Artemisia nova)
selected most often. Other important browse species were winterfat
(Krascheninnikovia lanata), Brickellia spp., and green rabbitbrush
(Chrysothamnus viscidiflorus) [9]. Sagebrush (Artemisia spp.),
rabbitbrush (Chrysothamnus spp.), and bitterbrush (Purshia tridentata)
are important pronghorn browse throughout the Great Basin [77]. Big
sagebrush (A. tridentata), bitterbrush, and saltbush (Atriplex spp.) are
important in Montana [9]. When vegetation is mostly covered with snow,
pronghorn seek windswept areas and graze lichens [62,69].

Pronghorn consume primarily forbs in spring, summer, and fall [14].
Forbs consistently selected throughout pronghorn's range include yellow
sweet clover (Melilotus officinalis) and alfalfa (Medicago sativa).
Scarlet globemallow (Sphaeralcea coccinea) is highly preferred on the
Great Plains, and Louisiana sagewort (Artemisia ludoviciana) is
consistently selected in the Intermountain region [20,45]. Lists of
other forbs often used by pronghorn in the Great Basin [76], the
Intermountain region [14], and shortgrass prairies of Saskatchewan [27]
and Wind Cave National Park, South Dakota [45], are available.

In summer pronghorn supplement their forb diet with browse and green
grasses. Spring is the only time of year when grasses are heavily
grazed [11,39], but grasses are also utilized during other periods of
green-up [9]. The high protein content of early spring grasses may be
particularly beneficial at a time when other forage is of low quality
[74]. Pronghorn in Utah were not observed to use dry, mature grasses at
any time [11]. In fall pronghorn consume forbs and browse [11,39].

Except for alfalfa and wheat (Triticum aestivum), pronghorn do not
usually consume agricultural crops [27,41]. Hepworth [35] reported use
of winter wheat in Nebraska only when browse was unavailable. Alfalfa,
however, may be grazed year-round [7].
  • 7. Autenrieth, Robert, ed. 1983. Guidelines for the management of pronghorn antelope. Austin, TX: Texas Parks and Wildlife Department. 51 p. [25416]
  • 9. Bayless, Stephen R. 1969. Winter food habits, range use, and home range of antelope in Montana. Journal of Wildlife Management. 33(3): 538-550. [16590]
  • 10. Bayless, Steve. 1971. Relationships between big game and sagebrush. Paper presented at: Annual meeting of the Northwest Section of the Wildlife Society; 1971 March 25-26; Bozeman, MT. 14 p. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17098]
  • 11. Beale, Donald M.; Smith, Arthur D. 1970. Forage use, water consumption, and productivity of pronghorn antelope in western Utah. Journal of Wildlife Management. 34(3): 570-582. [6911]
  • 14. Blaisdell, James P.; Murray, Robert B.; McArthur, E. Durant. 1982. Managing Intermountain rangelands--sagebrush-grass ranges. Gen. Tech. Rep. INT-134. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 41 p. [467]
  • 20. Campbell, R. B. 1972. Pronghorn, sheep and cattle range relationships in southeastern Montana. In: Compton, H. O.; Pyrah, Duane, compilers. Proceedings, 5th antelope states workshop; 1972 June 19-22; Billings, MT. [Place of publication unknown]
  • 23. Cole, G. F.; Wilkins, B. T. 1958. The pronghorn antelope, its range use and food habits in central Montana with special reference to wheat. Tech. Bull. 2. Helena, MT: Montana Fish and Game Dept. 39 p. [25482]
  • 27. Dirschl, Herman J. 1963. Food habits of the pronghorn in Saskatchewan. Journal of Wildlife Management. 27(1): 81-93. [5939]
  • 35. Hailey, Tommy L.; DeArment, Richard. 1972. Droughts and fences restrict pronghorns. In: Compton, H. O.; Pyrah, Duane, compilers. Proceedings, 5th antelope states workshop; 1972 June 19-22; Billings, MT. [Place of publication unknown]
  • 39. Hoover, Robert L. 1966. Antelope food habits and range relationships in Colorado. In: Proceedings, 2nd annual antelope states workshop; 1966 February 16-17; Denver, CO. Fort Collins, CO: Colorado Game, Fish, and Parks Department, Antelope States Workshop: 75-85. [25693]
  • 41. Kindschy, Robert; Sundstrom, Charles; Yoakum, James. 1978. Range/wildlife interrelationships--pronghorn antelope. In: Proceedings, 8th biennial pronghorn antelope workshop; 1978 May 2-4; Jasper, AB. Edmonton, AB: Albertal Recreation, Parks, and Wildlife, Fish and Wildlife Division: 216-262. [3316]
  • 43. Kuchler, A. W. 1964. Manual to accompany the map of potential vegetation of the conterminous United States. Special Publication No. 36. New York: American Geographical Society. 77 p. [1384]
  • 45. Lovaas, Allan L. 1972. Preliminary studies of pronghorn antelope - blacktail prairie dog relations in Wind Cave National Park. In: Compton, H. O.; Pyrah, Duane, compilers. Proceedings, 5th antelope states workshop; 1972 June 19-22; Billings, MT. [Place of publication unknown]
  • 51. Hoover, R. L.; Till, C. E.; Ogilvie, S. 1959. The antelope of Colorado. Tech. Bull. No. 4. Denver, CO: Colorado Department of Fish and Game. 110 p. [25475]
  • 61. Severson, K.; May, M.; Hepworth, W. 1968. Food preferences, carrying capacities and forage competition between pronghorn and domestic sheep in Wyoming's Red Desert. Sci. Mono. 10. Laramie, WY: Agricultural Experimental Station, Laramie. 51 p. [25477]
  • 62. Sharnoff, Stephen. 1993. Use of lichens by wildlife in North America: A preliminary compilation. [Publisher unkown]
  • 69. Thomas, Allan E.; Rosentreter, Roger. 1993. Utilization of lichens by pronghorn antelope in three valleys in east-central Idaho. Tech. Bulletin No. 92-3. Boise, ID: U.S. Department of the Interior, Bureau of Land Management, Idaho State Office. 13 p. [23682]
  • 74. Wallmo, O. C.; Carpenter, L. H.; Regelin, W. L.; [and others]
  • 76. Yoakum, Jim. 1980. Habitat management guides for the American pronghorn antelope. Tech. Note 347. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 77 p. [23170]
  • 77. Yoakum, Jim. 1982. Managing vegetation and waters for pronghorn. In: Western proceedings: 62nd annual conference of the Western Association of Fish and Wildlife Agencies; 1982 July 19-22; Las Vegas, NV. [Place of publication unknown]
  • 79. Yoakum, James D. 1978. Managing rangelands for the American pronghorn antelope. In: Proceedings, 8th biennial pronghorn antelope workshop; 1978 May 2-4; Jasper, AB. Edmonton, AB: Alberta Recreation, Parks, and Wildlife, Fish and Wildlife Division: 321-336. [3299]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Pronghorns are herbivores, eating stems, leaves, grasses and shrubs. Pronghorns have been described as "dainty" feeders, feeding on small amounts of a wide variety of plants. Particularly important in their is browse, especially sagebrush in winter. Pronghorns on grasslands have been observed starving in winter, whereas nearby populations in sagebrush survive well. Forbs with high water content are preferred in the summer diet and grasses are generally eaten only when there is new growth. Cacti are also eaten to some extent, especially in southern populations. Pronghorns use foregut fermentation with rumination to break down cellulose. Their stomach is enlarged and compartmentalized into four chambers, as in other ruminants. Water consumption varies with the water content of the vegetation available locally. When tender leaves are available, with moisture content of 75% or more, pronghorns do not seem to need to drink free-standing water. In dry seasons or areas, pronghorns are typically found within 5 to 6 km of water and may drink up to 3 liters per day.

Pronghorns must compete with introduced cattle (Bos taurus) and sheep (Ovis aries) throughout most of their range. In some areas, pronghorn are excluded from areas used by sheep, because the sheep eliminate much of their preferred vegetation. In other areas pronghorn and sheep seem to be able to coexist well. However, pronghorns can do well on areas overgrazed by cattle because they prefer forbs and browse. It is estimated that 1 cow can eat as much as 38 pronghorns. Fences constructed to enclose cattle and sheep can prevent pronghorn movement across rangeland, resulting in starvation and dehydration. Pronghorns can be considered a valuable part of rangeland management because they eat noxious weeds.

Plant Foods: leaves; roots and tubers; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In winter, northern populations depend heavily on browse, especially sagebrush. Forbs most important in summer. Southern populations use more forbs and less browse. Also eats grasses; in some areas, cactus (including burned Opuntia).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

More info for the term: shrubs

Coyote (Canis latrans), domestic dog (C. familiaris), bobcat (Felis
rufus), mountain lion (F. concolor), and golden eagle (Aquila
shrysaetos) are important pronghorn predators [52,58,76]. Humans also
hunt and poach pronghorn [52]. Coyote, bobcat, and golden eagle prey
mostly on fawns, especially newborns [34,76].

The importance of predation as a limiting factor for pronghorn
population increases varies with habitat quality. Studies of predation
on pronghorn showed that fawns on the shortgrass prairie of Alberta had
high survival rates [8], while survivorship of fawns on desert
shrublands of Nevada had was low. Populations in habitat of marginal
quality (i.e., where dense and/or tall shrubs predominate) are likely to
experience high fawn mortality from predation [50].
  • 8. Barrett, Morley W. 1978. Pronghorn fawn morality in Alberta. In: Proceedings, 8th biennial pronghorn antelope workshop; 1978 May 2-4; Jasper, AB. [Calgary, AB]
  • 34. Goodwin, Gregory A. 1976. Golden eagle predation on pronghorn antelope. Auk. 94(4): 789-790. [19315]
  • 50. McNay, M. E. 1980. Causes of low pronghorn fawn:doe ratios on the Sheldon Nationall Wildlif Wildlife Refuge, Nevada. Missoula, MT: Univ. of MT, Missoula. 128 p. Thesis. [25480]
  • 52. Ockenfels, Richard A. 1994. Mountain lion predation on pronghorn in central Arizona. Southwestern Naturalist. 39(3): 305-306. [24572]
  • 58. Reichel, James D. 1991. Relationships among coyote food habits, prey populations, and habitat use. Northwest Science. 65(3): 133-137. [17112]
  • 76. Yoakum, Jim. 1980. Habitat management guides for the American pronghorn antelope. Tech. Note 347. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 77 p. [23170]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Throughout their range pronghorns co-occur with cattle, bison, sheep, and horses. Pronghorns can improve rangeland quality for these other speces by eating noxious weeds or invasive plants. Introduced livestock may overgraze areas they share with pronghorn, thus reducing cover and quantity of food. The reduction of cover may increase young mortality through predation.

Although there are few epizootic diseases that strongly affect pronghorn populations there are 33 species of roundworms, 21 genera of bacteria, 14 viral diseases, 8 species of protozoa, 5 species of tapeworms, 4 species of ticks, one fluke, and a louse fly that are known to infect them. "Bluetongue" disease has resulted in extensive mortality in some cases. It is an insect-borne viral disease (Bluetongue virus, BTV) that is transmitted by midges (Culicoides imicola). Worm infections have also resulted in extensive fawn mortality in some areas. Pronghorns that co-occur with sheep tend to have higher parasite loads than those in areas without sheep. Pronghorns are the definitive host of a nematode worm that also infects sheep and mule deer: Pseudostertagia bullosa (Nematoda: Trichostrongyloidea). They can also be parasitized by meningeal worms (Parelaphostrongylus tenuis) that are common parasites of white-tailed deer.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Fawns or weaker pronghorns are preyed on by coyotes, bobcats, wolves, mountain lions, golden eagles, and other predators within their range.  Pronghorns can use their horns to help defend themselves, but they primarily use their speed to escape predators. They are capable of sprints up to 86 km per hour and sustained speeds of 59 to 65 km/hr, making them one of the fastest land mammals. Pronghorns also use their feet in fighting off predators. They have keen eyesight and can spot an object from approximately two miles away. Pronghorns are curious animals and will move towards an intruder until they can detect what it is. If they determine that it is a threat, they will flee. When disturbed, pronghorns erect the white fur on their rumps, which acts to warn others of a disturbance.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Antilocapra americana (antelope) preys on:
Machaeranthera canescens canescens
three-cleft greenthread forb/shrub
Cryptantha
Bromus tectorum
Lappula occidentalis cupulata
Taraxacum officinale
Plantago patagonica
Lepidium densiflorum
Senecio multicapitatus
Artemisia frigida
Bouteloua gracilis
Kochia
Sphaeralcea coccinea

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, forb, forbs, series, shrubs, wildfire

Kindschy and others [41], McCarty [48], and Yoakum [77] have recommended
prescribed burning to improve pronghorn habitat. As a primarily
forb-eating species with strong requirements for open cover, pronghorn
are favorably influenced by the increase in herbaceous species and
reduction of shrubs after fire [37]. Higher protein and mineral levels
and reduced levels of indigestible materials have been reported in
resprouts of grasses and shrubs [25,41]. Nutritional benefits of fire
on forage may last up to 4 postfire years with an increase in primary
productivity for a longer period, depending upon plant species [72].

Examples: In 1954, a lightning-ignited wildfire burned 6,000 acres
(2,400 ha) of the Hart Mountain National Antelope Refuge in Lake County,
Oregon. Prior to the fire, sagebrush (Artemisia spp.) cover was over 50
percent, with shrubs averaging 30 inches (76.2 cm) or more in height.
The fire converted the range from sagebrush steppe to a grassland-forb
community with small stands of shrubs. Deming [26] reported that
pronghorn did not use tha area prior to the fire but began to use it
within the first postfire year. Pronghorn used the burn for at least 11
years after fire.

Wildfires in another sagebrush steppe area reclaimed historic pronghorn
range adandoned by pronghorn for decades. In the Long Valley of
California and Nevada, a series of wildfires in July 1973 burned 38,000
acres (15,200 ha). Prior to the wildfires, big sagebrush comprised 60
percent cover and averaged 23 inches (58.4 cm) in height; grass cover
was 37 percent; and forb cover was 3 percent. Pronghorn had not been
sighted in Long Valley for 60 years but moved into Long Valley from
adjacent ranges within a few years of the wildfires. In 1980, postfire
plant composition was 60 percent grasses, 20 percent forbs, and 20
percent shrubs with a mean height of 17 inches (43.2 cm). Pronghorn
still inhabited Long Valley at postfire year 7 (1980) [76].
  • 25. Daubenmire, R. 1968. Ecology of fire in grasslands. In: Cragg, J. B., ed. Advances in ecological research: Vol. 5. New York: Academic Press: 209-266. [739]
  • 26. Deming, O. V. 1963. Antelope and sagebrush. In: Yoakum, Jim, compiler. Transactions, Interstate antelope conference; 1963 December 4-5; Alturas, CA. Reno, NV: Interstate Antelope Conference: 55-60. [25687]
  • 37. Higgins, Kenneth F.; Kruse, Arnold D.; Piehl, James L. 1989. Effects of fire in the Northern Great Plains. Ext. Circ. EC-761. Brookings, SD: South Dakota State University, Cooperative Extension Service, South Dakota Cooperative Fish and Wildlife Research Unit. 47 p. [14749]
  • 41. Kindschy, Robert; Sundstrom, Charles; Yoakum, James. 1978. Range/wildlife interrelationships--pronghorn antelope. In: Proceedings, 8th biennial pronghorn antelope workshop; 1978 May 2-4; Jasper, AB. Edmonton, AB: Albertal Recreation, Parks, and Wildlife, Fish and Wildlife Division: 216-262. [3316]
  • 48. McCarty, Robert S., Jr. 1982. Little Lost/Birch Creek antelope habitat management plan. In: Proceedings, 10th pronghorn antelope workshop; 1982 April 5-7; Dickinson, ND. [Place of publication unknown]
  • 72. U.S. Department of the Interior, National Park Service, Wind Cave National Park. 1966. Conservation plan: Wind Cave National Park, Custer County Conservation District. Wind Cave National Park, SD: U.S. Department of the Interior, National Park Service, Wind Cave National Park. 46 p. [2760]
  • 76. Yoakum, Jim. 1980. Habitat management guides for the American pronghorn antelope. Tech. Note 347. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 77 p. [23170]
  • 77. Yoakum, Jim. 1982. Managing vegetation and waters for pronghorn. In: Western proceedings: 62nd annual conference of the Western Association of Fish and Wildlife Agencies; 1982 July 19-22; Las Vegas, NV. [Place of publication unknown]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

Minimum breeding age: Males breed at 16 months of age [76]. Females
generally breed as 2-year-olds [28], although breeding of 1-year-old
females has been reported [18,75]. Once sexual maturity is reached,
pronghorn apparently breed for the rest of their lives [53].

Breeding season: Pronghorn breed from late summer [76] to fall [3,42];
rutting season lasts for 2 to 3 weeks [67]. Mating systems are
described in Maher [47] and Byers and Kitchen [19].

Gestation period: averages 252 days [76]

Fawning period: May to June [3,76]; does deliver a single fawn at first
birth and twins thereafter [76]

Fawn development: Fawns walk within hours of birth but are generally
inactive for the first few days of life; they run by their fifth day
[76]. Fawns under 3 weeks of age spend up to 90 percent of their time
lying in seclusion; newborns are generally active only for a brief
period when their mothers return to the fawning grounds to nurse them
[31]. Fawns graze by 3 weeks of age and are completely weaned by fall
[3].

Fawn survivorship: Survivorship probably varies greatly by habitat; in
the Trans-Pecos region of Texas, mortality was 90 percent (18 of 20
radio-collared fawns), with all deaths attributed to predation [21].
Fawn survivorship of 50 percent has been reported in favorable habitat
in Arizona [46].

Life span: Pronghorn seldom live more than 9 years in the wild [36],
but a few wild does have been aged at 16 years [70].

Movement/migration: Pronghorn movement is usually in response to
changing environmental conditions such as drought, blizzards, or new
food sources. Some cold-climate populations migrate from one
seasonal-use area to another, using the same routes each year. Migrating
populations may travel up to 200 miles (320 km) or more to leave areas
of deep snow [59]. Southern herds show localized movement but seldom
migrate [7].
  • 3. Amstrup, Steven C. 1978. Activities and habitat use patterns of pronghorns on Montana-Wyoming coal lands. In: Proceedings, 8th biennial pronghorn antelope workshop; 1978 May 2-4; Jasper, AB. Edmonton, AB: Alberta Recreation, Parks, and Wildlife, Fish and Wildlife Division: 270-304. [3300]
  • 7. Autenrieth, Robert, ed. 1983. Guidelines for the management of pronghorn antelope. Austin, TX: Texas Parks and Wildlife Department. 51 p. [25416]
  • 18. Buechner, Helmut K. 1950. Life history, ecology, and range use of the pronghorn antelope in Trans-Pecos Texas. American Midland Naturalist. 43(2): 257-354. [4084]
  • 19. Byers, John A.; Kitchen, David W. 1988. Mating system shift in a pronghorn population. Behavioral Ecology and Sociobiology. 22: 355-360. [25385]
  • 21. Canon, S. Kemble; Bryant, Fred C. 1990. Fawn survival and bed site characteristics of Trans Pecos pronghorn. In: Webster, David B.; Schramm, Harold L., Jr., eds. Research highlights: Noxious brush and weed control; range and wildlife management. Vol. 21. Lubbock, TX: Texas Tech University, College of Agricultural Sciences: 21-22. [14915]
  • 28. Einarsen, A. S. 1948. The pronghorn antelope and its management. Wash., DC: Wild. Manage. Inst. 238 p. [25479]
  • 31. Fichter, Edson. 1972. On the bedding behavior of pronghorn. In: Compton, H. O.; Pyrah, Duane, compilers. Proceedings, 5th antelope states workshop; 1972 June 19-22; Billings, MT. [Place of publication unknown]
  • 36. Barrett, Morley W. 1978. Pronghorn fawn morality in Alberta. In: Proceedings, 8th biennial pronghorn antelope workshop; 1978 May 2-4; Jasper, AB. [Calgary, AB]
  • 42. Kricher, John C. 1993. A field guide to the ecology of western forests. The Peterson Field Guide Series No. 45. Boston, MA: Houghton Mifflin Company. 554 p. [21729]
  • 46. MacPhee, Douglas T. 1991. Prescribed burning and managed grazing restores tobosa grassland, antelope populations. Restoration & Management Notes. 9(1): 35-36. [16571]
  • 47. Maher, Christine R. 1991. Activity budgets and mating system of male pronghorn antelope at Sheldon National Wildlife Refuge, Nevada. Journal of Mammalogy. 72(4): 739-744. [25382]
  • 53. O'Gara, B. W. 1978. Antilocapra americana. Mammalian Species. No. 90: 1-7. [25415]
  • 59. Riddle, Phil. 1990. Wyoming antelope status report -- 1990. In: Proceedings, 14th biennial pronghorn antelope workshop; 1990 May 22-24; Silver Creek, CO. [Place of publication unknown]
  • 67. Sundstrom, Charles; Hepworth, William G.; Diem, Kenneth L. 1973. Abundance, distribution and food habits of the pronghorn: A partial characterization of the optimum pronghorn habitat. Bulletin No. 12. Boise, ID: U.S. Bureau of Sport Fisheries and Wildlife, Division of River Basin Studies. 59 p. [5906]
  • 70. Trainer, Charles E.; Willis, Mitchell J.; Keister, George P., Jr.; Sheehy, Dennis P. 1983. Fawn mortality and habitat use among pronghorn during spring and summer in southeastern Oregon, 1981-1982. Wildlife Research Report No. 12. Portland, OR: Oregon Department of Fish and Wildlife, Wildlife Research and Development Division. 117 p. [25692]
  • 75. Wright, Philip L.; Dow, Sumner A., Jr. 1962. Minimum breeding age in pronghorn antelope. Journal of Wildlife Management. 26(1): 100-101. [25690]
  • 76. Yoakum, Jim. 1980. Habitat management guides for the American pronghorn antelope. Tech. Note 347. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 77 p. [23170]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Usually in small bands. Large winter herds disperse in spring. Forms separate bachelor and female-kid groups in spring and summer. Males associate with females in late summer and early fall. High mortality in young is common (mostly predation).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Doe-fawn recognition seems to be through a combination of visual, vocal, and olfactory cues. Scent glands are widely used in male-male and male-female behavioral interactions. Scent glands are used to mark territories, attract potential mates, identify a mate, alert danger, or deter other males intruding in their territory. Both sexes have rump glands and interdigital glands; males also have a gland below each ear and on the back.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Daily activity pattern varies seasonally. Alternating periods of feeding and rest occur throughout the day, with fairly continuous feeding in the early morning and late afternoon, and longer rest periods at night (Davis 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Female pronghorn have been aged at 16 years in the wild, though they seldom live past 9 years. The most common causes of death are predators, hard winters with deep snow, lack of water, and hunting or car collisions. Pronghorns have been recorded living 11 years in captivity.

Average lifespan

Status: wild:
16 years.

Range lifespan

Status: captivity:
11 (high) years.

Average lifespan

Status: wild:
16 years.

Average lifespan

Status: captivity:
11.8 years.

Average lifespan

Status: wild:
10.0 years.

Average lifespan

Status: wild:
10.0 years.

Average lifespan

Status: captivity:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.5 years (captivity) Observations: In the wild, these animals tend to live less than 10 years (Bernhard Grzimek 1990), though there are anecdotal reports of wild animals living as much as 15 years. One captive specimen lived 15.5 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Pronghorns are polygynous. Males defend territories from March through the end of the rut in early October. They defend a small harem of females in their territories during that time. Males with territories that contain a water source and have topographic features that help them corner does, do better than males without those features in their territories. Depending on a female's body condition, she will search among territorial males for potential mates. This behavior may last for two to three weeks. Pronghorns have scent glands that emit pheromones to attract or identify mates. These pheromones are important to interactions between sexes. Scent glands are located on either side of the jaw, between the hooves, on the rump, and above the tail. The glands on the neck are larger in males and are thought to be associated with sexual interaction as they are more active during the rutting season. Before mating, a male will approach a female from behind and shake his head to emit pheromones to attract the female. Males also use scent gland secretions to mark tall grasses on territorial boundaries. Males also mark territories with scrapes where they urinate and defecate, using a stereotypes "sniff, paw, urinate, defecate" sequence that may be repeated. Male interactions can include some or all of the following: 1) staring, 2) vocalization by the territory holder (a decrescendo snort-wheeze), 3) approaching an intruder, which can be accompanied by head thrashing, sneezes, and teeth grinding, 4) interacting with an intruder, and 5) chasing, which can be for only a few meters or up to 5 km. Male use of the snort-wheeze vocalization is often accompanied by erection of the mane, rump patches, and the cheek patches. If an intruder does not run away, then the two males walk in parallel to each other in a slow, deliberate manner with their heads held low. If a fight occurs, the males thrust their horns at each other in an attempt to do injury. Males end up in horn-horn or head-head pushing battles in which they try to knock the other off balance. Fights average only about 2 minutes long, but often result in serious injury.

Mating System: polygynous

Breeding occurs from mid-September to October in northern parts of the pronghorn range and from July to October in southern parts of their range. Females ovulate from 4 to 7 ova at the time of mating. These ova quickly travel to the uterus and form blastocysts, where they absorb nutrition for almost a month before implantation. Blastocysts develop long, thread-like walls that begin to twist together and form knots. One quarter to one third of blastocysts die of malnutrition when this knotting reduces the membrane surface area. As many as 7 embryos may still survive this knotted blastocyst stage. However, as the embryos develop, distal embryos are forced into the oviduct, where they perish from lack of nutrition and are reabsorbed. The gestation period is about 252 days and births are synchronous, with all females giving birth within a few days of each other. Females give birth to one or two fawns in the spring, typically they have a single young in their first year of breeding and twins in subsequent years. Females often labor on their sides, but stand as the front legs of the fawn begin to emerge from the vulva. Females and their young form bands in the summer that roam over the territories of one to several males. Pronghorns have 4 inguinal mammary glands. Young are partially weaned by 3 weeks old, at which point they begin to eat vegetation as well. Most female pronghorns breed in their second year, at about 16 months old, although some females can breed as early as 5 months old. Males can breed in their first year, but rarely do because older, dominant males monopolize breeding opportunities. Males typically begin to breed in their third year.

Breeding interval: Pronghorns breed once yearly.

Breeding season: onghorn range and from July to October in southern parts of their range.

Range number of offspring: 1 to 2.

Average gestation period: 252 days.

Range birth mass: 1 to 5.8 kg.

Average birth mass: 3.5 kg.

Average weaning age: 3 weeks.

Range time to independence: 1 to 1.5 years.

Range age at sexual or reproductive maturity (female): 5 (low) months.

Average age at sexual or reproductive maturity (female): 16 months.

Range age at sexual or reproductive maturity (male): 1 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average gestation period: 235 days.

Average number of offspring: 2.

Female pronghorns care for their young from 1 to 1.5 years after birth, after which the young will become independent. At the time of birth, the mother will consume the afterbirth to prevent detection by predators. She also consumes any excrement of the young for the first few weeks of their life to prevent detection by predators. For several days after birth young are weak and unable to keep the pace with adults, so mothers and young rest near a source of water until they gain their strength. Females leave their young in a hidden location in vegetation while they forage, but remain within two miles of them. Within minutes after birth, young pronghorns can stand on their own and they nurse within 2 hours. Within days of birth, young pronghorns can outrun a human and begin to travel and forage with their mother and other females and young in summer bands. Siblings are generally on their own until they begin to travel with their mother. Fawns play extensively in the summer herds, developing strength and dexterity. Male pronghorns do not help in raising offspring.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female)

  • Feldhamer, G., L. Drickamer, S. Vessey, J. Merritt. 2004. Mammology: Adaptation, Diversity, and Ecology Second Edition. New York, NY: McGraw Hill Companies.
  • Feldhamer, G., D. Drickamer, S. Vessey, J. Merritt, C. Krajewski. 2007. Mammology: Adaptation, Diversity, and Ecology Third Edition. Baltimore, MD: Johns Hopkins University Press.
  • Anderson, S. 2002. Managing Our Wildlife Resources Fourth Edition. Upper Saddle River, New Jersey: Prentice Hall.
  • Hildebrand, M., G. Goslow. 2001. Analysis of Vertebrate Structure Fifth Edition. New York, NY: John Wiley & Sons, Inc..
  • Williston, S. 1877. The American Antelope. The American Naturalist, Vol. 11 No. 10: 599-603.
  • Buechner, H. 1950. Life History, Ecology, and Range Use of the Pronghorn Antelope in Trans-Pecos Texas. American Midland Naturalist, Vol. 43, No. 2: 257-354.
  • O'Gara, B. 1978. Antilocapra americana. Mammalian Species, 90: 1-7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds mid-September to early October in north, late July to early October in south. Gestation lasts 240-250 days in north, shorter in south (e.g., 210-225 days in Texas). Births occur earlier in south than in north; April-May in Texas, mainly first half of June in Colorado (Fairbanks, 1993, J. Mamm. 74:129-135). Females give birth usually to twins (single fawns mainly from young females). Young are weaned by four months, but continue to follow mother during first winter. Some begin breeding at 1 year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antilocapra americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTCTCAACCAACCACAAAGACATTGGTACCTTATATCTACTATTTGGTGCCTGAGCTGGCATAGTAGGCACAGCCCTGAGCCTGCTAATTCGCGCCGAATTAGGTCAACCCGGGACCTTACTCGGAGACGATCAAATCTACAACGTGGTCGTCACTGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGGGGATTTGGCAACTGATTAGTTCCCCTAATAATTGGTGCCCCAGATATAGCATTCCCCCGAATGAACAATATAAGTTTTTGACTTCTCCCTCCATCATTCCTACTACTTTTAGCATCATCTATAGTTGAAGCCGGAGCCGGAACAGGCTGAACAGTTTACCCACCATTAGCTGGAAATATAGCCCATGCAGGAGCCTCGGTAGATCTCACTATTTTCTCACTACACCTAGCAGGTGTTTCCTCAATTTTAGGAGCCATTAATTTCATTACAACTATTATTAACATGAAACCCCCTGCAATATCACAATACCAAACACCCCTGTTCGTATGATCTGTACTAATTACCGCCGTATTACTACTACTTTCACTTCCCGTACTAGCTGCCGGAATTACAATACTACTCACCGACCGAAATCTTAATACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCTTATATCAACACCTGTTCTGATTTTTTGGACACCCAGAAGTATATATTCTTATTTTACCAGGATTCGGAATAATCTCCCACATCGTAACCTATTATTCAGGAAAAAAAGAACCATTCGGATATATGGGAATGGTTTGAGCCATAATGTCAATCGGATTCCTAGGATTTATCGTATGAGCCCATCACATATTCACAGTAGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCCACCATAATTATTGCCATCCCTACCGGGGTAAAAGTTTTCAGCTGACTAGCAACCCTCCACGGAGGAAACATTAAATGATCTCCCGCTATAATGTGAGCCCTAGGCTTTATTTTCCTCTTTACAGTGGGAGGCCTAACAGGAATTGTTCTAGCCAACTCCTCCCTTGACATTGTCCTACACGACACATACTACGTAGTCGCACACTTCCATTATGTATTATCAATAGGAGCCGTGTTTGCTATTATAGGAGGATTCGTACACTGATTCCCACTATTCTCAGGCTACACTCTTAACGACACATGAGCCAAAATTCACTTCGTAATTATATTTGTAGGCGTAAACATAACTTTCTTCCCACAACATTTCTTAGGACTGTCAGGTATACCACGACGATACTCCGACTACCCAGACGCATACACAACATGAAACACCATCTCATCCATAGGCTCATTCATTTCCCTAACAGCAGTAATACTAATAATCTTCATTATTTGAGAAGCGTTCTCATCTAAACGAGAGGTTTTATCCGTAGACCTTACTACAACAAACCTAGAGTGACTGAATGGATGTCCTCCACCTTATCATACATTTGAAGAGCCCACATATGTCAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Antilocapra americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

More information on protection status of animals in the United States
and Canada is available at NatureServe, although recent changes in
status may not be included.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

U.S. Federal Legal Status

The peninsula and Sonoran pronghorn are listed as endangered [71].
  • 71. U.S. Fish and Wildlife Service. 2013. Listed animals. In: Environmental Conservation Online System, [Online]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hoffmann, M., Byers, J. & Beckmann, J.

Reviewer/s
Mallon, D.P. (Antelope Specialist Group) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species remains widespread and relatively common within its range, with a population estimated at between a half to one million animals. No major population declines are reported, with a number of populations occurring in large and well-managed protected areas.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

It is estimated that up to 35 million pronghorns lived in North America before colonization by western Europeans. By 1924 this number had decreased to less than 20,000. Pronghorn populations have increased since that time and are now considered the second most numerous game species in North America.

The IUCN Red List lists Antilocapra americana as lower risk/least concern. Populations are stable, widespread, and relatively common throughout most of their range, with an estimated population size of 0.5 to 1 million. The U.S. Endangered Species Act recognizes two populations as endangered: Sonora pronghorns (A. a. sonoriensis) and peninsular pronghorns (A. a. peninsularis). Populations of Sonoran pronghorn in Mexico have been protected since 1967 and have undergone several recovery plans, the most recent in 1998. This population of pronghorn is listed under the Convention of International Trade of Endangered Flora and Fauna (CITES) Appendix I.

US Federal List: endangered

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in western North America, common in several regions; generally well managed as a game species with sustainable populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

#The Sonoran pronghorn (A. americana sonoriensis) is Endangered; the Baja California pronghorn (A. americana peninsularis) is Critically Endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the early 1800s, there were probably in the order of more than 35 million Pronghorn. By 1924, they were believed to be near extinction with only about 20,000 animals remaining. From 1924 to 1964 the population increased ten-fold (O'Gara 1978). Today, numbers are estimated at about 700,000. They are generally declining in Mexico, although more stable in the remainder of the range; however, numbers do fluctuate depending on the severity of droughts and winters (O'Gara 1999).

It is estimated that there are fewer than 300 individuals of the Sonoran Pronghorn in the United States and 200-500 individuals in Sonora, Mexico (U.S. Fish and Wildlife Service 1998).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The original decline in numbers of Pronghorn was most likely due to hunting, combined with a drastic reduction of available habitat due to habitat loss from agricultural, urban, and mining expansion onto historic lands; fencing across routes of seasonal movements; removal of native vegetation by rangeland rehabilitation projects; and heavy livestock grazing (U.S. Fish and Wildlife Service 1998). However, effective law enforcement, and habitat and wildlife management techniques during the mid-1900s helped Pronghorn stage a remarkable recovery (Yoakum 1968).

Today, there are no major range-wide threats, although localized declines are taking place, particularly to the Sonoran Pronghorn, mainly as a result of, among others, livestock grazing, the construction of roads, fences and other barriers that pose barriers to historical habitat, illegal hunting (mainly in Mexico), insufficient forage and water, and lack of recruitment (see U.S. Fish and Wildlife Service 1998 for review). Pronghorn usually inhabit large expanses of contiguous habitat and once such regions become fragmented beyond some threshold, use by Pronghorn generally decreases.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the terms: cacti, cover, forb, litter, shrub, shrubs

Because pronghorn require a mosaic of very open areas, areas with low,
sparse shrubs, and areas with taller, more dense shurbs for fawning,
field experts do not recommend large-scale prescribed burning for
pronghorn [38]. To maintain or create mosaics for pronghorn, Yoakum
[80] has recommended that prescribed fires burn less than 1,000 acres
(405 ha) and maintain shrub coverage of 5 to 10 percent.

Examples: Following summer (July and August) prescribed burning in
Alberta, pronghorn used burned areas of needle-and-thread
grass-thickspike wheatgrass-western wheatgrass (Stipa comata-Elymus
lanceolatus-Pascopyrum smithii) prairie significantly more than unburned
prairie during fall, in winter after snowmelt, and in early spring.
Grasses on the burned areas began spring growth 3 weeks earlier than
grasses on unburned sites. Burns containing plains prickypear (Opuntia
polyacantha) were especially heavily used: Pronghorn grazed burns with
cacti significantly more than expected from August through February
(except in November), probably because the fires removed the spines from
the cacti, which are succulent and nutritious but usually inedible [24].
Shoop and others [64] found plains pricklypear digestibility to be as
good or better than high-quality alfalfa hay. The fire-singed cacti
provided pronghorn with a high-quality food in fall and winter, when
nutritious forage is scarce in Alberta [24].

Prescribed grazing and burning has been successful in promoting
pronghorn populations in desert grassland. In 1981 and 1982, 1,500
acres (600 ha) of tobosa (Hilaria mutica) prairie used as cattle range
was burned on the Prescott National Forest, Arizona. Fire was used to
restore the prairie and enhance habitat for pronghorn: The prairie was
invaded by woody species such as broom snakeweed (Gutierrezia spp.) and
honey mesquite (Prosopis glandulosa), and coyote predation on pronghorn
was heavy. Managers hoped to reduce woody vegetation and reduce
predation on pronghorn. The prescribed fires killed broom snakeweed and
reduced cover of sprouting shrubs. From 1983 to 1989, an additional
60,000 acres (24,000 ha) were prescribed burned. These fires were
initially successful, but tobosa thatch became thick within "a few"
postfire years. At that point, pronghorn were allowed free range access
but cattle were put on a short-duration, high-intensity grazing system
to mimic presettlement grazing patterns of elk and pronghorn. Used in
combination, prescribed grazing and burning reduced tobosa litter,
opened the canopy, and encouraged forb growth. Following grazing and
fire treatments, the pronghorn population increased for 7 years, from
about 150 animals in 1982 to a peak of 366 animals in 1989. Population
size declined to 320 in 1990 following a drought. Fawn survival rates
in the burned area averaged nearly 50 percent compared to an overall
rate in Arizona of approximately 20 percent. Using prescribed grazing
and burning treatments together, managers estimated that fire will be
needed about every 7 to 10 years [46].
  • 24. Courtney, Rick F. 1989. Pronghorn use of recently burned mixed prairie in Alberta. Journal of Wildlife Management. 53(2): 302-305. [6701]
  • 38. Holechek, Jerry L. 1981. Brush control impacts on rangeland wildlife. Journal of Soil and Water Conservation. 36(5): 265-269. [1182]
  • 46. MacPhee, Douglas T. 1991. Prescribed burning and managed grazing restores tobosa grassland, antelope populations. Restoration & Management Notes. 9(1): 35-36. [16571]
  • 64. Shoop, M. C.; Alford, E. J.; Mayland, H. F. 1977. Plains pricklypear is a good forage for cattle. Journal of Range Management. 30(1): 12-17. [25528]
  • 80. Yoakum, James D. 1979. Managing rangelands for pronghorns. Rangelands. 1(4): 146-148. [25689]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the terms: association, forbs

Range: It has been suggested that pronghorn thrive on vegetation in a
subclimax condition with a mixture of forbs, grasses, and browse [7,41].
Subclimax conditions were historically created by fires and seasonal
grazing patterns of pronghorn in association with bison (Bison bison),
elk (Cervus elaphus), and/or deer (Odocoileus spp.). Pronghorn and
bison in particular may have been symbiotic: Bison grazed grasses
heavily which in turn stimulated growth of forbs and browse used by
pronghorn [41].

Management practices promoting pronghorn including grazing systems,
range rehabilitation methods such as site prepartion and seeding
rates/ratios, and specifications for building water storage facilities
are discussed in detail in Authenrieth [7], Kindschy and others [41],
O'Gara and Yoakum [54], and Yoakum [76,77].

Pronghorn and bison, cattle, or horses have little dietary overlap on a
yearlong basis except on overgrazed ranges [29,49,60,73]. Pronghorn can
benefit livestock ranges by eating forbs such as paperflower
(Psilostrophe spp.) and groundsel (Senecio spp.) that are poisonous to
livestock [55]. In the Great Basin, diets of mule deer (O. hemionus)
and pronghorn overlapped moderately in winter and only slightly in other
seasons [73]. Diets of domestic sheep and pronghorn, however, have
considerable overlap, and domestic sheep often outcompete pronghorn for
forage. Moderate domestic sheep use of winter range in the Great Basin
of Utah significantly lowered pronghorn use of the range [22].

Heavy cattle stocking can be detrimental to pronghorn by converting
shrub-grassland to shrubland, which renders the area unusable to
pronhorn. Due to cattle grazing, historic pronghorn range in portions
of California, Nevada, and Oregon no longer meet pronghorn needs. Heavy
cattle grazing in Texas forced pronghorn to a diet heavy in poisonous
plants, resulting in direct pronghorn mortality and reproductive losses
[81].

Cattle use of traditional or potential pronghorn fawning grounds
during fawning season has been shown to displace does to less suitable
birthing areas. This usually results in higher fawn mortality due to
predation [81].

Livestock fences, especially those designed to retain domestic sheep,
can severely restrict pronghorn movement and lower pronghorn numbers.
Pronghorn herds are especially vulnerable when movement from depleted
ranges or to water is restricted [55]. Specifications for building
fences (including sheep fences) that allow pronghorn passage are
available [7,14,76].

Reintroduction: Pronghorn have successfully been reintroduced in
sagebrush steppe of Mono County, California [33], and in desert
grassland of Arizona [16].

A reintroduction strategy of releasing small groups of pronghorn over
several years may be more successful than one large release of animals
[33]. Britt [16] reported that in Arizona, pronghorn establishment was
successful only after three releases of 126 pronghorn over 10 years.
Pronghorn from the original translocation may have served as a nucleus
of experienced animals that provided social stimuli and established
behaviors for new animals that followed.

Genetic considerations for pronghorn reintroduction programs are
provided in Lee and others [44].
  • 7. Autenrieth, Robert, ed. 1983. Guidelines for the management of pronghorn antelope. Austin, TX: Texas Parks and Wildlife Department. 51 p. [25416]
  • 14. Blaisdell, James P.; Murray, Robert B.; McArthur, E. Durant. 1982. Managing Intermountain rangelands--sagebrush-grass ranges. Gen. Tech. Rep. INT-134. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 41 p. [467]
  • 16. Britt, Thomas L. 1980. Reestablishment of pronghorn antelope on the Arizona Strip. In: Proceedings, 9th pronghorn antelope workshop; 1980 April 8-10; Rio Rico, AZ. [Place of publication unknown]
  • 22. Clary, Warren P.; Beale, Donald M. 1983. Pronghorn reactions to winter sheep grazing, plant communities, and topography in the Great Basin. Journal of Range Management. 36(6): 749-752. [641]
  • 29. Evans, Keith E.; Probasco, George E. 1977. Wildlife of the prairies and plains. Gen. Tech. Rep. NC-29. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 18 p. [14118]
  • 33. Goldsmith, Audrey E. 1988. History and research on reintroduction of pronghorn in California. In: Neilson, L.; Brown, R. D., eds. Translocation of wild animals. [Place of publication unknown]
  • 41. Kindschy, Robert; Sundstrom, Charles; Yoakum, James. 1978. Range/wildlife interrelationships--pronghorn antelope. In: Proceedings, 8th biennial pronghorn antelope workshop; 1978 May 2-4; Jasper, AB. Edmonton, AB: Albertal Recreation, Parks, and Wildlife, Fish and Wildlife Division: 216-262. [3316]
  • 44. Lee, Thomas E., Jr.; Bickham, John W.; Scott, M. Douglas. 1994. Mitochondrial DNA and allozyme analysis of North American pronghorn populations. Journal of Wildlife Management. 58(2): 307-318. [25383]
  • 49. McInnis, Michael L.; Vavra, Martin. 1987. Dietary relationships among feral horses, cattle, and pronghorn in southeastern Oregon. Journal of Range Management. 40(1): 60-66. [1605]
  • 54. O'Gara, Bart W.; Yoakum, Jim D., eds. 1992. Pronghorn management guides. Proceedings, 15th biennial pronghorn antelope workshop; [Date unknown]
  • 55. Passey, Howard B.; Hicks, Vernon M. 1970. Grassland restoration and its effect on wildlife. Part VI. Temple, TX: U.S. Department of Agriculture, Soil Conservation Service. 29 p. [1835]
  • 60. Schwartz, Charles C.; Nagy, Julius G. 1976. Pronghorn diets relative to forage availability in northeastern Colorado. Journal of Wildlife Management. 40(3): 469-478. [4937]
  • 73. Vavra, Martin; Sneva, Forrest. 1978. Seasonal diets of five ungulates grazing the cold desert biome. In: Hyder, Donald N., ed. Proceedings of the 1st International Rangeland Congress; 1978 August 14-18; Denver, CO. Denver, CO: Society for Range Management; 1978: 435-437. [2429]
  • 76. Yoakum, Jim. 1980. Habitat management guides for the American pronghorn antelope. Tech. Note 347. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 77 p. [23170]
  • 77. Yoakum, Jim. 1982. Managing vegetation and waters for pronghorn. In: Western proceedings: 62nd annual conference of the Western Association of Fish and Wildlife Agencies; 1982 July 19-22; Las Vegas, NV. [Place of publication unknown]
  • 81. Yoakum, Jim D.; O'Gara, Bart W. 1990. Pronghorn/livestock relationships. Transactions, 55th North American Wildlife and Natural Resources Conference. 55: 475-487. [25384]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Populations of the Sonoran Pronghorn in Arizona and Mexico are protected under the US Endangered Species Act (since 1967), and a recovery plan for this subspecies has been prepared by USFWS (U.S. Fish and Wildlife Service 1998). Mexican animals are listed on CITES Appendix I. Pronghorns have game-animal status in all of the western states of the United States, and permits are required to trap or shoot pronghorns.

This species occurs in a number of large and well-managed protected areas, including Yellowstone National Park.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: In southeastern Alberta, Courtney (1989) concluded that prescribed burning could improve range quality in fall and early spring and would improve pronghorn prewinter condition and winter survival.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Pronghorns are grazers that will take advantage of wheat or alfalfa fields during the winter if there is deep snow. This may negatively impact crop yield. However, most pronghorn populations occur in areas with little agricultural development.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Pronghorns are an important big games species in the western United States. Their use of open habitat means often hunters have success rates of up to 90 percent.

Positive Impacts: food ; body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pronghorn

The Pronghorn (Antilocapra americana) is a species of artiodactyl mammal endemic to interior western and central North America. Though not an antelope, it is often known colloquially in North America as the Prong Buck, Pronghorn Antelope, or simply Antelope,[3] as it closely resembles the true antelopes of the Old World and fills a similar ecological niche due to convergent evolution.[4] It is the only surviving member of the family Antilocapridae.[5] During the Pleistocene period, 12 antilocaprid species existed in North America. About 5 existed when humans entered North America 13,000 years ago; all but A. americana are now extinct.[5]

Contents

Morphology

Adult males are 1.3–1.5 m (4 1/4–5 ft) long from nose to tail and stand 81–104 cm (2 5/8–3 3/8 ft) high at the shoulder, and weigh 36–70 kg. The females are the same heights as males but weigh 41–50 kg. The feet have just two hooves, with no dewclaws. The body temperature is 38.0°C.[5][6][7][8]

Closeup of pronghorn head

Each "horn" of the Pronghorn is composed of a slender, laterally flattened blade of bone that grows from the frontal bones of the skull, forming a permanent core. As in the Giraffidae, skin covers the bony cores, but in the Pronghorn it develops into a keratinous sheath which is shed and regrown on an annual basis. Unlike the horns of the family Bovidae, the horn sheaths of the Pronghorn are branched, each sheath possessing a forward-pointing tine (hence the name Pronghorn). The horns of males are well developed.

The orbits (eye sockets) are prominent and sit high on the skull; there is never an antorbital pit. The teeth are hypsodont, and the dental formula is:

Dentition
0.0.3.3
3.1.3.3
PronghornDetail.jpg

Males have a prominent pair of horns on the top of the head, which are made up of an outer sheath of hairlike substance that grows around a bony core; the outer sheath is shed annually. Males have a horn sheath about 12.5–43 cm (mean 25 cm) long with a prong. Females have smaller horns, ranging from 2.5–15 cm (average 12 cm), and sometimes barely visible; they are straight and very rarely pronged.[7] Males are further differentiated from females in that males will have a small patch of black hair at the angle of the mandible. Pronghorns have a distinct, musky odor. Males mark territory with a scent gland located on the sides of the head.[5] They also have very large eyes, with a 320 degree field of vision. Unlike deer, Pronghorns possess a gallbladder.[9]

It can run exceptionally fast, being built for maximum predator evasion through running, and is generally accepted to be the fastest land mammal in the New World. The top speed is very hard to measure accurately and varies between individuals; it is variously cited as up to 70 km/h,[6] 72 km/h,[5] or 86 km/h.[7] It is often cited as the second-fastest land animal, second only to the cheetah.[10] It can, however, sustain high speeds longer than cheetahs. University of Idaho zoologist John Byers has suggested that the Pronghorn evolved its running ability to escape from extinct predators such as the American cheetah, since its speed greatly exceeds that of extant North American predators.[11] It has a very large heart and lungs, and hollow hair. Although built for speed, it is a very poor jumper. Their ranges are often affected by sheep ranchers' fences. However, they can be seen going under fences, sometimes at high speed. For this reason the Arizona Antelope Foundation and others are in the process of removing the bottom barbed wire from the fences, and/or installing a barbless bottom wire.[citation needed]

Gaits used by the Pronghorn include the highly distinctive pronk, a leaping gait.[citation needed]

Range and ecology

Pronghorns in Fort Rock, Oregon, United States.

Pronghorns were brought to scientific notice by the Lewis and Clark Expedition, which found them in what is now South Dakota, USA. The range extends from southern Saskatchewan and Alberta in Canada south through the United States (southwestern Minnesota and central Texas west to coastal southern California[12][13] and northern Baja California Sur, to Sonora and San Luis Potosí in northern Mexico.[5][14]

The subspecies known as the Sonoran Pronghorn (Antilocapra americana sonoriensis) occurs in Arizona and Mexico.[7] Other subspecies include the Mexican Pronghorn (A. a. mexicana), the Oregon pronghorn (A. a. oregona), and the critically endangered Baja California Pronghorn (A. a. peninsularis).

Pronghorns live primarily in grasslands but also in brushland and deserts. They eat a wide variety of plant foods, often including plants that are unpalatable or toxic to domestic livestock (sheep and cattle) though they also compete with these for food.[6] In one study forbs comprised 62% of the diet, shrubs 23%, and grasses 15%,[6] while in another, cacti comprised 40%, grass 22%, forbs 20%, and shrubs 18%.[7] An ongoing study by the Lava Lake Institute for Science and Conservation and the Wildlife Conservation Society, shows an overland migration route that covers more than 160 miles.[15] The migrating pronghorn start travel from the foothills of the Pioneer Mountains through Craters of the Moon National Monument to the Continental Divide. Dr. Scott Bergen of Wildlife Conservation Society says, ""This study shows that pronghorn are the true marathoners of the American West. "With these new findings, we can confirm that Idaho supports a major overland mammal migration--something that is becoming increasingly rare in the U.S. and worldwide."[16]

Cougars, wolves, coyotes,chetah's, and bobcats are the major predators. Golden Eagles have been reported to prey on fawns.

Social behavior and reproduction

Herd of pronghorns

Pronghorns form mixed-sex herds in the winter. In early spring the herds break up with young males forming bachelor groups, females forming their groups and adult males live a solitary life.[17] There are female bands which share the same summer range and bachelor male bands form between spring and fall. Females form dominance hierarchies with few circular relationships.[18] Dominant females will aggressively displace other females from feeding sights.

Pronghorns in Montana, United States.

Adult male pronghorns employ two different mating strategies during the breeding season. A pronghorn male will defend a fixed territory that females may enter or it might defend a harem of females. A pronghorn may change mating strategies depending on environmental or demographic conditions.[17] In areas that have high precipitation, adult male pronghorn tend to be territorial and maintain their territories with scent marking, vocalizing and challenging intruders.[19] In these systems, territorial males have access to better resources than bachelor males. [19] Female also employ different mating strategies. "Sampling" females visit several males, remain with each male a short time, and switch between males at an increased rate as estrus approaches.[20] "Inciting" females behave as samplers until estrus; then they move away from the male, inciting fights and other aggressive competitition.[20] Inciting females watch the competition, and they always mate immediately with the winning male.[20] "Quiet" females move to an isolated, peripheral location occupied by a single male, and remain with that male throughout estrus.[20]

When courting an estrous female, a male pronghorn will appoach her while softly vocalizing[17] and waving his head side to side, displaying his cheek patches.[21] A resceptive female still motionless and stiff his scent gland and then allow the males to mount her.[17] Pronghorns have a gestation period of 235 days, longer than is typical for North American ungulates. They breed in mid-September, and the doe carries her fawn until late May. This is around six weeks longer than the white-tailed deer. Newborn Pronghorns weigh 2--4 kg, most commonly 3 kg. In their first 21-26 days, a fawns spends time hiding in vegatation.[19] Fawns interact with their mothers for only 20-25 minutes a day and this continues even when the fawn joins a nursery.[19] The females nurse, grooming, distract predators and lead their young to food and water.[19] Males are weaned 2-3 weeks either than females.[19] Sexual maturity is reached at 15 to 16 months, though males rarely breed until 3 years old. The longevity is typically up to 10 years, rarely 15 years.[6][7][8]

Population and conservation

Pronghorn in Yellowstone National Park

By 1908, hunting pressure had reduced the Pronghorn population to about 100,000. Protection of habitat and hunting restrictions have allowed their numbers to recover to an estimated population of between 500,000 and 1,000,000.[22] There has been some recent decline in a few localized populations,[6] due to blue tongue disease which is spread from sheep; however the overall trend has been positive since conservation measures were put in place.

Pronghorn migration corridors are threatened by habitat fragmentation and the blocking of traditional migration routes. In a migration study conducted by Lava Lake Institute for Science and Conservation and the Wildlife Conservation Society, at one point the migration corridor bottlenecks to an area only 200 yards wide.[23]

Pronghorns are now quite numerous and outnumbered people in Wyoming and parts of northern Colorado until just recently. It is widely hunted in western states[citation needed] for purposes of population control and food, as the meat is rich and lean. There are no major range-wide threats, although localized declines are taking place, particularly to the Sonoran Pronghorn, mainly as a result of, among others, livestock grazing, the construction of roads, fences and other barriers that pose barriers to historical habitat, illegal hunting, insufficient forage and water, and lack of recruitment.[1]

Three subspecies are considered endangered in all (A. a. sonoriensis, A. a. peninsularis), or part of their ranges (A. a. mexicana). Populations of the Sonoran Pronghorn in Arizona and Mexico are protected under the US Endangered Species Act (since 1967), and a recovery plan for this subspecies has been prepared by USFWS (U.S. Fish and Wildlife Service 1998).[1] Mexican animals are listed on CITES Appendix I. Pronghorns have game-animal status in all of the western states of the United States, and permits are required to trap or shoot pronghorns.[1]

See also

References

  1. ^ a b c d Hoffmann, M., Byers, J. & Beckmann, J. (2008). Antilocapra americana. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 10 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Wilson, Don E.; Reeder, DeeAnn M., eds (2005). Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200468. 
  3. ^ Caton, J. D. (1876). The American Antelope, or Prong Buck The American Naturalist 10 (4): 193-205.
  4. ^ Farb, Peter (1970). Ecology. Time Life Books. pp. 126, 136
  5. ^ a b c d e f Smithsonian Institution. North American Mammals: Pronghorn Antilocapra americana
  6. ^ a b c d e f Mammals of Texas: Pronghorn
  7. ^ a b c d e f Animal Diversity Web: Antilocapra americana
  8. ^ a b AnAge: Antilocapra americana
  9. ^ Verts, BJ. Land Mammals of Oregon 1998:University of California Press. p485.
  10. ^ Klessius, M. (2007). Losing Ground. National Geographic 211 (1): 22. ISSN 0027-9358
  11. ^ Byers, John (1998). American Pronghorn: Social Adaptations and the Ghosts of Predators Past. Chicago University Press. p. 318. ISBN 978-0226086996. http://books.google.com/books?id=iFQgW0Mf5VoC&source=gbs_navlinks_s. 
  12. ^ Frank Stephens (1906). California Mammals. San Diego, California: The West Coast Publishing Company. p. 56. http://books.google.com/books?id=oRqdMVhdtOYC&printsec=frontcover&dq=%22california+mammals%22+stephens&source=bl&ots=-XAsCxd08F&sig=laNNeyABHJTUe8I9Yj9YtYjVfCQ&hl=en&ei=H7hFTefRMpPQsAPa16G6Cg&sa=X&oi=book_result&ct=result&resnum=1&ved=0CBMQ6AEwAA#v=onepage&q=antelope&f=false. Retrieved 2011-01-30. 
  13. ^ Pedro Font. Expanded Diary of Pedro Font. http://anza.uoregon.edu/Action.lasso?-database=fontex&-layout=standard&-op=eq&pg2=148&-response=format/fontexpg2fmt.html&-maxRecords=1000&-noresultserror=/sorry.html&-search. Retrieved 2011-01-30. 
  14. ^ J. Cancino, R. Rodríguez-Estrella, A. Ortega (1995). "First Aerial Survey of Historical Range for Peninsular Pronghorn of Baja California, Mexico". Journal of the Arizona-Nevada Academy of Science: 46-50. http://www.jstor.org/stable/40024301. Retrieved 2011-01-30. 
  15. ^ "Pronghorn Antelope Migration Route: 160 Miles Plus : Discovery News". News.discovery.com. http://news.discovery.com/animals/pronghorn-antelope-migration-route-160-miles-plus.html. Retrieved 2010-07-21. 
  16. ^ "Pronghorn migration circuit found in Idaho - NatGeo News Watch". Blogs.nationalgeographic.com. 2009-11-02. http://blogs.nationalgeographic.com/blogs/news/chiefeditor/2009/11/pronghorn-migration-found-in-idaho.html. Retrieved 2010-07-21. 
  17. ^ a b c d Byers, J.A. 1997. American Pronghorn: Social Adaptations and the Ghosts of Predators Past. University of Chicago Press.
  18. ^ Fairbanks, W.S. 1994. "Dominance, age and aggression among female pronghorn, Antilocapra americana (Family: Antilocapridae)". Ethology. 97:278-293.
  19. ^ a b c d e f See "Pronghorn" entry for The Encyclopedia of Mammals (edited by David MacDonald, Oxford University Press) on pgs. 528-529.
  20. ^ a b c d Byers, J.A., J.D. Moodie, and N. Hall. 1994. "Pronghorn females choose vigorous mates". Animal Behavior. 47:33-43.
  21. ^ Min, S.E. 1997. "The effect of variation in male sexually dimorphic traits on female behavior in pronghorn (Antilocapra americana)". Ethology. 103:732-743.
  22. ^ Antilocapra americana, International Union for Conservation of Nature and Natural Resources
  23. ^ New Long Distance Migration Route for Pronghorn Found in Idaho by WCS and Lava Lake Institute, November 2, 2009

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Thought to belong to the family Bovidae by some authors, but retained in the Antilocapridae by recent authors (e.g., Janis and Scott 1987; Jones et al. 1992; Grubb, in Wilson and Reeder 1993, 2005). See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data; relationship of Antilocapridae and Bovidae remains unresolved.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!