Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Description

Bighorn Sheep live only in remote, treeless mountain terrain. They use steep slopes and cliffs to escape from wolves, coyotes, and cougars. Many migrate seasonally, some moving a few hundred meters up or down a mountainside and others going 10-20 km from one mountain range to another. Some males make much longer migrations. Males and females live apart except during the mating season, when males vie for access to females. Larger size and age usually confer an advantage. The males rear up on their hind legs, kicking with their front legs and clashing their horns. Although Bighorn Sheep have heavily buttressed heads that absorb the shock of butting, these battles can result in death. Ewes usually give birth to one lamb, in May; twins are extremely rare. The lambs can follow their mothers within a day after birth, and nurse for 4-5 months. Bighorns eat seasonally available grasses and other vegetation, and cactus in the desert. They are attracted to natural salt licks, cattle licks, and piles of salt placed along highways for melting snow. In some places where bighorn populations went extinct, groups have been reintroduced, but many parts of their original range are no longer suitable. The species is declining in desert areas.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: "Shaw, G., 1804.  The Canadian Sheep.  Plate 610, the description, and the index, in Naturalist's Miscellany (by G. Shaw and E. Nodder), Vol 15 (unpaginated).  Nodder and Co., London."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Ovis canadensis is found in the Rocky Mountains from southern Canada to Colorado, and as a desert subspecies (O. c. nelsoni) from Nevada and California to west Texas and south into Mexico.

Biogeographic Regions: nearctic (Native )

  • Festa-Bianchet, M. 1999. Bighorn sheep. Pp. 348-350 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: The Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The bighorn sheep ranges widely in western Canada, western United States, and northern Mexico.

In Canada, the bighorn sheep (O. c. canadensis) is distributed throughout the Rocky Mountains in Alberta and British Columbia, south from the Peace River to the Canada-USA border. Two small populations also have been introduced to central British Columbia outside their normal distribution. Populations of a second subspecies, California bighorn sheep (O. c. californiana), are scattered through central British Columbia from north of Anahim lake, south along sections of the Chilcotin, Chilco and other western tributaries of the Fraser river south of William’s Lake and west to just north of Lillooet, and also south from around Kamloops along both sides of the Okanagan valley to the border with Washington State (USA) and as far west as Granby, British Columbia. Populations around Kamloops and Granby have been introduced, mostly into historically occupied habitat.

In the United States, the bighorn sheep is widely distributed from Montana and Idaho south through Wyoming and northern Utah, to Colorado and New Mexico. These bighorn herds comprise most of the traditional O. c. canadensis for which Thorne et al. (1985) estimated a population of greater than 19,000. To the south, desert bighorn (traditionally O. c. nelsoni, O. c. cremnobates, and O. c. mexicana) inhabit southern portions of California, Nevada, Utah and New Mexico, much of Arizona, and west Texas. Weaver (1985) estimated 16,000 desert bighorn in this area. However, there are few bighorn and few herds (mostly transplants to reintroduce bighorns in areas where they were extirpated) within the Chihuahuan desert of New Mexico and west Texas. To the west, bighorn occur in scattered populations in the Columbia plateau and Great Basin ranges of Washington, Oregon, southwest Idaho, and northern Nevada. These herds comprise most of the traditional O. c. californiana, for which Thorne et al. (1985) estimated greater than 2,800 animals. East of the Rocky Mountains, bighorn exist in scattered herds in badlands and river-breaks in eastern Montana, North and South Dakota, northeast Wyoming, Nebraska, and outside of historic range in southeast Colorado.

In Mexico, the bighorn sheep was originally distributed in the northern states of Nuevo Leon, Coahila, Chihuahua, Sonora, Baja California and Baja California Sur. Desert bighorn in Mexico is now restricted to three states: Mexican bighorn (O. c. mexicana) in northwestern Sonora and on Tiburon island in the Sea of Cortez; Peninsular bighorn (O. c. cremnobates) in the northern two thirds of Baja California; and Weems’ bighorn (O. c. weemsi) in the southern third of Baja California Sur.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range includes mountains and river breaks from southwestern Canada (southern British Columbia and southwestern Alberta) south through the Rocky Mountains, Sierra Nevada, and desert mountains of the southwestern United States to Baja California and the northwestern mainland of Mexico. Distribution is naturally fragmented in many areas due to discontinuity of habitat. Local extirpations and subsequent reintroductions from local or distant stocks have occurred in many parts of the range. For example, this species formerly ranged east to the badlands in western North Dakota and Black Hills of South Dakota; after extirpation there, individuals from non-native populations were introduced (Valdez and Krausman 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The former range of the bighorn sheep extended from the Northern Rocky
Mountains of Canada south to the mainland of Mexico and Baja California
[22]. It is now found in relatively isolated pockets in the Coast and
Cascade ranges and the Sierra Nevada, and in the Rocky Mountains south
of the Peace River to Mexico [6].
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 22. Reel, Susan; Schassberger, Lisa; Ruediger, William, compilers. 1989. Caring for our national community: Region 1 - threatened, endangered & sensitive species program. Missoula, MT: U.S. Department of Agriculture, Forest Service, Northern Region. 309 p. [19675]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AZ CA CO ID MT NM NV ND OR SD
TX UT WA WY AB BC MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Males 119-127kg; females 53-91 kg. Rams typically measure 160-180 cm from head to tail, while ewes are approximately 150 cm. Bighorn sheep have double-layered skulls shored with struts of bone for battle protection. They also have a broad, massive tendon linking skull and spine to help the head pivot and recoil from blows. Horns may way as much as 14 kg, which is the weight of all the bones in a ram's body. The horns of a female are much smaller and only slightly curved. The horns of a ram can tell much about him such as his age, health, and fighting history. The desert subspecies, Ovis canadensis nelsoni, is somewhat smaller and has flatter, wider-spreading horns. The pelage of Ovis canadensis is smooth and composed of an outer coat of brittle guard hairs and short, grey, crimped fleece underfur. The summer coat is a rich, glossy brown but it becomes quite faded by late winter.

Range mass: 53 to 127 kg.

Range length: 150 to 180 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 114.674 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 185 cm

Weight: 150000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 1.6-1.9 m males; 1.6-1.7 m females

Weight:
Range: 75-135 kg males; 48-85 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Montana Valley and Foothill Grasslands Habitat

This taxon can be found in the Montana valley and foothill grasslands ecoregions, along with some other North American ecoregions. This ecoregion occupies high valleys and foothill regions in the central Rocky Mountains of Montana in the USA and Alberta, Canada. The ecoregion the uppermost flatland reaches of the Missouri River drainage involving part of the Yellowstone River basin, and extends into the Clark Fork-Bitterroot drainage of the Columbia River system. The ecoregion, consisting of three chief disjunctive units, also extends marginally into a small portion of northern Wyoming. Having moderate vertebrate species richness, 321 different vertebrate taxa have been recorded here.

The dominant vegetation type of this ecoregion consists chiefly of wheatgrass (Agropyron spp.) and fescue (Festuca spp.). Certain valleys, notably the upper Madison, Ruby, and Red Rock drainages of southwestern Montana, are distinguished by extensive sagebrush (Artemisia spp.) communities as well. This is a reflection of semi-arid conditions caused by pronounced rain shadow effects and high elevation. Thus, near the Continental Divide in southwestern Montana, the ecoregion closely resembles the nearby Snake/Columbia shrub steppe.

A number of mammalian species are found in the ecoregion, including: American Pika (Ochotona princeps), a herbivore preferring talus habitat; Bighorn Sheep (Ovis canadensis), Black-tailed Prairie Dog (Cynomys ludovicianus), who live in underground towns that may occupy vast areas; Brown Bear (Ursos arctos); Hoary Marmot (Marmota caligata), a species who selects treeless meadows and talus as habitat; and the Northern River Otter (Lontra canadensis), a species that can tolerate fresh or brackish water and builds its den in the disused burrows of other animals.

There are six distinct anuran species that can be found in the Montana valleys and foothills grasslands, including: Canadian Toad (Anaxyrus hemiophrys); Western Toad (Anaxyrus boreas); Northern Leopard Frog (Lithobates pipiens); Plains Spadefoot Toad (Spea bombifrons); Columbia Spotted Frog (Rana luteiventris), an anuran that typically breeds in shallow quiet ponds; and the Boreal Chorus Frog (Pseudacris maculata).

Exactly two amphibian taxa occurr in the ecoregion: Long-toed Salamander (Ambystoma macrodactylum), a species who prefers lentic waters and spends most of its life hidden under bark or soil; Tiger Salamander (Ambystoma tigrinum).

Reptilian species within the ecoregion are: Milk Snake (Lampropeltis triangulum), an adaptable taxon that can be found on rocky slopes, prairie and near streambeds; Painted Turtle (Chrysemys picta); Western Plains Garter Snake (Thamnophis radix), a taxon that can hibernate in the burrows of rodents or crayfish or even hibernate underwater; Yellow-bellied Racer (Coluber constrictor); Spiny Softshell Turtle (Apalone spinifera); Western Terrestrial Garter Snake (Thamnophis elegans); Rubber Boa (Charina bottae); Western Skink (Plestiodon skiltonianus); and the Western Rattlesnake (Crotalis viridis).

The ecoregion supports endemic and relict fisheries: Westslope Cutthroat Trout (Oncorhynchus clarki lewisi), Yellowstone Cutthroat Trout (Oncorhynchus clarkii bouvieri), and fluvial Arctic Grayling (Thymallus arcticus), a relict species from past glaciation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Sierra Juarez and San Pedro Martir pine-oak forests Habitat

This taxon can be found in the Sierra Juarez and San Pedro Martir pine-oak forests. The ecoregion is located in two mountain ranges in the state of Baja California, Mexico: the Sierra de Juarez and the Sierra de San Pedro Martir. Both mountain ranges belong to the physiographical province of Baja California, and constitute the northernmost elevated peaks of the Baja Peninsula. The mountainous range that descends into a large portion of Baja California becomes more abrupt at Juarez and San Pedro Martir; the eastern slope is steeper than the western. Altitudes range between 1100-2800 meters. The granitic mountains of Juarez and San Pedro Martir have young rocky soils and are poorly developed, shallow, and low in organic matter.

Dominant trees in the ecoregion are: Pinus quadrifolia, P. jeffreyi, P. contorta, P. lambertiana, Abies concolor, and Libocedrus decurren. The herbaceous stratum is formed by Bromus sp. and Artemisia tridentata. Epiphytes and fungi are abundant throughout the forests.

Characteristic mammals of the ecoregion include: Ornate shrew (Sorex ornatus), Puma (Puma concolor), Fringed Myotis bat (Myotis thysanodes), California chipmunk (Tamias obscurus), Bobcat (Lynx rufus), Coyote (Canis latrans), San Joaquin kit fox (Vulpes macrotis) and Bighorn sheep (Ovis canadensis).

Numerous birds are present in the ecoregion, including the rare Bald eagle (Haliaeetus leucocephalus), California condor (Gymnogyps californianus), Pinyon jay (Gymnohinus cyanocephalus), and White-breasted nuthatch (Sitta carolinensis).

A number of different reptilian taxa are found in these oak-pine forests; representative reptiles here are: the Banded rock lizard (Petrosaurus mearnsi); Common checkered whiptail (Cnemidophorus tesselatus), who is found in sparsely vegetated areas; Coast horned lizard (Phrynosoma coronatum), often found in locales of sandy soil, where individuals may burrow to escape surface heat; Night desert lizard (Xantusia vigilis), who is often found among bases of yucca, agaves and cacti; and the Baja California spiny lizard (Sceloporus zosteromus).

The Pacific chorus frog (Pseudacris regilla) is an anuran found within the Sierra Juarez and San Pedro Martir pine-oak forests as one of its western North America ecoregions of occurrence. The only other amphibian in the ecoregion is the Western toad (Anaxyrus boreas).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Ovis canadensis canadensis inhabits alpine meadows, grassy mountain slopes and foothill country in proximity to rugged, rocky cliffs and bluffs. Bighorn sheep require drier slopes where the annual snowfall is less than about sixty inches a year, since they cannot paw through deep snow to feed. The winter range usually lies between 2,500-5,000 feet in elevation, while the summer range is between 6,000-8,500 feet.

Range elevation: 800 to 2500 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; chaparral ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
These animals are sexually segregated outside the rut. Group sizes usually range from 5 to 50 for males and from 5 to 100 for ‘nursery’ groups of females, lambs and young males.

They mostly eat grass, but they also consume forbs and browse – diet varies widely over the large geographical range of the species. Females gestate for 175 days, and give birth to a single offspring per pregnancy. Females can first conceive at 18 months of age and males are rarely successful at obtaining paternities before about 3 years of age. Very few females live more than 15 years and very few males survive past 12 years.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Terrestrial

Comments: Bighorn sheep occur in mesic to xeric, alpine to desert grasslands or shrub-steppe in mountains, foothills, or river canyons (Shackleton et al. 1999, Krausman et al. 1999). Many of these grasslands are fire-maintained (Geist 1971, Erickson 1972). Suitable escape terrain (cliffs, talus slopes, etc.) is an important feature of the habitat. In winter, Rocky Mountain Bighorns spend as much as 86% of their time within 100 meters of escape terrain (Oldemayer et al. 1971, Erickson 1972), and usually stay within 800 meters of escape terrain throughout the year (Pallister 1974). Mineral licks are more important in the range of Rocky Mountain Bighorn than in the range of "California" Bighorn, presumably because the soils in the range of the former are generally lower in mineral content (Van Dyke 1978). Distribution is correlated with low precipitation levels, especially in winter and spring. Elevation varies considerably, both geographically and seasonally, from as low as 450 meters to over 3,300 meters (Shackleton et al. 1999).

Winter ranges of northern populations are relatively snow-free because of light snow, steep south aspect, and/or high winds; bighorns generally avoid snow deeper than 30 centimeters (Stelfox 1975). The solar heat on south aspects also reduces cold stress on sheep (Shackleton et al. 1999).

In the north, bighorn sheep usually are not dependent on free-standing water, getting water instead from succulent vegetation in the summer and snow or ice in the winter (Van Dyke 1978). However, in some southwestern deserts they may be dependent on access to free water during summer (Turner 1979, Turner and Weaver 1980, Seegmiller and Ohmart 1981).

Bighorn Sheep - Peninsular Ranges

Habitat includes steep slopes and cliffs, rough and rocky topography, and sparse vegetation (Monson and Summner 1980), "with use of alluvial fans and washes, and valley floors depending on environmental conditions and dispersal requirements" (USFWS 2011; see also Monson and Sumner 1980 and USFWS 2000). Females about to give birth "seek secluded sites with shelter, unobstructed views, and steep terrain, ...while rams may be found in less steep or rugged terrain" (USFWS 2011). In the Peninsular Ranges, bighorn sheep generally stay elevationally below the pinyon pine-juniper and chararral vegetation zones (USFWS 2011). Vegetation of occupied habitat often includes Agave deserti (agave)-Fouquieria splendens (ocotillo), Opuntia spp. (cholla)-Cercidium floridum (palo verde), and Larrea tridentata (creosote)-Prosopis spp. (palo verde-mesquite). Bighorns use open areas and generally avoid areas where visibility is obstructed by thick vegetation.

Valley floors provide important linkages between adjacent mountainous regions and allow bighorn sheep access to resources (e.g., forage, water, lambing habitat) in neighboring areas; these lowlands also allow gene flow to occur between subpopulations (USFWS 2011). Bighorns may forage or access water on gentle terrain (e.g., alluvial fans and washes) but may travel quickly through valley floors to reach nearby mountains (Simmons, in Monson and Sumner 1980). Reproductive females may make heavy use of the food resources on alluvial fans and washes, and these areas can be important in summer and during droughts, when nutritious forage is scarce elsewhere (Andrew 1994).

North-facing slopes provide cooler refuges during the hottest weather, and south-facing slopes may be used on cold winter days (Andrew 1994).

In summer, bighorn sheep may congregate around water sources; most sheep stay wihtin 3-5 km of water (see USFWS 2011). They may abandon areas where no standing water exists. Above-average rainfall and cooler temperatures may allow bighorns to occupy habitats that may be abandoned during droughts (USFWS 2011).

Suitable habitat exists as a narrow north-south continuum from the San Jacinto Mountains all the way to the U.S.-Mexico border (Rubin et al. 2009).

Sierra Nevada Bighorn Sheep (Ovis canadensis sierrae)

Sierra Nevada bighorn sheep inhabit open areas where the land is rocky, sparsely vegetated, and characterized by steep slopes and canyons.. Habitats range from alpine to Great Basin sagebrush scrub. They prefer open ground and areas with good access to steep, rocky terrain (escape habitat) and so generally avoid forests, thick brush, and large expanses lacking precipitous escape terrain. In summer, most live at higher elevations (10,000-14,000 feet; 3,050-4,270 meters) in subalpine and alpine areas. Females occur largely in alpine environments, whereas males often are at somewhat lower elevations in subalpine habitats. In winter, they occupy high-elevation, windswept ridges if forage is available and tend to inhabit south-facing slopes where snow melts more readily, or they migrate to lower elevations in sagebrush-steppe areas to avoid deep snow and to find forage. Low-elevation winter ranges provide an important source of high quality forage early in the growing season. Reproductive female select steep, rugged slopes and canyons for lambing. Sources: McCullough and Schneegas (1966), Wehausen (1980), USFWS (2007, 2008).

USFWS (2008) determined that primary constituent elements (habitat features) for Sierra Nevada bighorn sheep include: (1) Non-forested habitats or forest openings within the Sierra Nevada from 4,000 feet (1,219 meters) to 14,500 feet (4,420 meters) in elevation with steep (greater than or equal to 60 percent slope), rocky slopes that provide for foraging, mating, lambing, predator avoidance, and bedding and that allow for seasonal elevational movements between these areas. (2) Presence of a variety of forage plants as indicated by the presence of grasses (e.g., Achnanthera spp.; Elymus spp.) and browse (e.g., Ribes spp.; Artemisia spp., Purshia spp.) in winter, and grasses, browse, sedges (e.g., Carex spp.) and forbs (e.g., Eriogonum spp.) in summer. (3) Presence of granite outcroppings containing minerals such as sodium, calcium, iron, and phosphorus that could be used as mineral licks in order to meet nutritional needs.

Johnson et al. (2007) used resource selection probability functions to identify important winter and summer habitat characteristics, and to generate predictive models of habitat use in unoccupied ranges. "Characteristics of topography and vegetation were significant in describing bighorn sheep winter habitat use, and only topographic characteristics were significant in describing summer habitat use. Habitat models were used to determine the amount of winter and summer range within each herd unit, the connectivity of seasonal ranges, areas at risk of contact with domestic sheep, and to simulate the effects of prescribed fire on bighorn sheep habitat."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, shrub, shrubs

Escape terrain is an important habitat requirement for bighorn sheep.
Cliffs, rock rims, rock outcroppings, and bluffs with sparse cover of
trees or shrubs typify escape habitat, which provides both thermal and
hiding cover. While bighorn sheep are not always found in precipitous
mountain areas, ewes and lambs rely on these areas for escape cover,
especially during the lambing period [6,26,27].

Visibility is another important habitat component for bighorn sheep. It
allows for predator detection, visual communication, and efficient
foraging [4]. Bighorn sheep tend to forage in open areas with low
vegetation such as grasslands, shrublands, or mixes of these. They
avoid foraging on mild slopes with shrub or canopy cover in excess of 25
percent and shrubs 2 feet (60 cm) or higher. On steep slopes they have
been noted to travel through or bed in dense brush [26].
  • 4. Boyd, Raymond J.; Cooperrider, Allen Y.; Lent, Peter C.; Bailey, James A. 1986. Ungulates. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 519-564. [10856]
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 26. Van Dyke, Walter A.; Sands, Alan; Yoakum, Jim; [and others]
  • 27. Woodard, Paul M.; Van Nest, Terry. 1990. Winter burning bighorn sheep range--a proposed strategy. Forestry Chronicle. October: 473-477. [14619]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: shrubs

Bighorn sheep occupy a variety of plant communities ranging from alpine
meadows, woodlands, mixed-grass prairie, shrub-bunchgrass, and dry
pinyon-juniper (Pinus-Juniperus spp.) [2,7,14,25,27]. They avoid dense
forests [6].

Summer ranges of bighorn sheep in southeastern Oregon vary from
subalpine meadows or grasslands to sagebrush (Artemisia spp.)/grasslands
or shrublands. Winter ranges are usually shrub/grasslands and
shrublands. Communities dominated by trees or tall shrubs such as aspen
(Populus spp.), cottonwood (Populus spp.), fir (Abies spp.), pine,
juniper, mountain-mahogany (Cercocarpus spp.), squaw apple (Peraphyllum
ramosissimum), and cherry (Prunus spp.) may occur throughout both summer
and winter ranges [26].

On two bighorn sheep winter ranges in the upper Yellowstone River
Valley, vegetation types in which bighorns were observed included
bluebunch wheatgrass (Pseudoroegneria spicata), needle-and-thread (Stipa
comata), and Idaho fescue (Festuca idahoensis) grasslands; sagebrush
(primarily A. tridentata) and black greasewood (Sarcobatus vermiculatus)
shrublands; open Douglas-fir (Pseudotsuga menziesii) woodland; and the
vegetation mosaics associated with cliffs and draws [14]. Bighorn sheep
range in Glacier National Park includes bunchgrass communities dominated
by bluebunch wheatgrass, Idaho fescue, rough fescue (F. scrabrella), and
Saskatoon serviceberry (Amelanchier alnifolia); and seral vegetation of
subalpine fir (Abies lasiocarpa) habitat types [24].

Other plant species common on bighorn sheep range include bitterbrush
(Purshia tridentata), mountain muhly (Muhlenbergia montana), russet
buffaloberry (Shepherdia canadensis), bearberry (Arctostaphylos
uva-ursi), blue grama (Bouteloua gracilis), rabbitbrush (Chrysothamnus
spp.), bluegrass (Poa spp.), buffalograss (Buchloe dactyloides), western
wheatgrass (Pascopyron smithii), and sedges (Carex spp.) [2,7,11,24,25].
  • 2. Bentz, Jerry A.; Woodard, Paul M. 1988. Vegetation characteristics and bighorn sheep use on burned and unburned areas in Alberta. Wildlife Society Bulletin. 16(2): 186-193. [15276]
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 7. Easterly, Thomas G.; Jenkins, Kurt J. 1991. Forage production and use on bighorn sheep winter range following spring burning in grassland and ponderosa pine habitats. Prairie Naturalist. 23(4): 193-200. [19277]
  • 11. Goodson, Nike J.; Stevens, David R.; Bailey, James A. 1991. Winter-spring foraging ecology and nutrition of bighorn sheep on montane ranges. Journal of Wildlife Management. 55(3): 422-433. [15425]
  • 14. Keating, Kimberly A.; Irby, Lynn R.; Kasworm, Wayne F. 1985. Mountain sheep winter food habits in the upper Yellowstone Valley. Journal of Wildlife Management. 49(1): 156-161. [15521]
  • 24. Stucker, Donald E.; Peek, James M. 1984. Response of bighorn sheep to the Ship Island Burn. Report submitted to the Northern Forest Fire Laboratory: Supplement No. INT-80-108CA. 33 p. On file at: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17070]
  • 25. Todd, J. W. 1975. Foods of Rocky Mountain bighorn sheep in southern Colorado. Journal of Wildlife Management. 39(1): 108-111. [6218]
  • 26. Van Dyke, Walter A.; Sands, Alan; Yoakum, Jim; [and others]
  • 27. Woodard, Paul M.; Van Nest, Terry. 1990. Winter burning bighorn sheep range--a proposed strategy. Forestry Chronicle. October: 473-477. [14619]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: shrub

K003 Silver fir - Douglas-fir forest
K004 Fir - hemlock forest
K005 Mixed conifer forest
K010 Ponderosa shrub forest
K011 Western pondersoa forest
K012 Douglas-fir forest
K015 Western spruce - fir forest
K016 Eastern ponderosa forest
K018 Pine - Douglas-fir forest
K019 Arizona pine forest
K020 Spruce - fir - Douglas-fir forest
K021 Southwestern spruce - fir forest
K022 Great Basin pine forest
K024 Juniper steppe woodland
K023 Juniper - pinyon woodland
K028 Mosaic of K002 and K026
K029 California mixed evergreen forest
K031 Oak - juniper woodlands
K032 Transition between K031 and K037
K035 Coastal sagebrush
K037 Mountain-mahogany - oak scrub
K038 Great Basin sagebrush
K039 Blackbrush
K040 Saltbush - greasewood
K041 Creosotebush
K042 Creosotebush - bursage
K047 Fescue - oatgrass
K050 Fescue - wheatgrass
K051 Wheatgrass - bluegrass
K053 Grama - galleta steppe
K054 Grama - tobosa prairie
K057 Galleta - three-awn shrubsteppe
K058 Grama - tobosa shrubsteppe
K059 Trans-Pecos shrub savanna
K052 Alpine meadows and barren
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K065 Grama - buffalograss
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K068 Wheatgrass - grama - buffalograss
K069 Bluestem - grama prairie
K070 Sandsage - bluestem prairie
K074 Bluestem prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES23 Fir-spruce
FRES26 Lodgepole pine
FRES29 Sagebrush
FRES30 Desert shrub
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

Bighorn sheep inhabit remote mountain and desert regions. They are
restricted to semiopen, precipitous terrain with rocky slopes, ridges,
and cliffs or rugged canyons [6,26]. Forage, water, and escape terrain
are the most important components of bighorn sheep habitat [26].

Winter range - Generally, bighorn sheep have two distinct, separate
summer and winter ranges [6]. Most of the year is spent on the winter
range, where the elevation is typically below 10,826 feet (3,300 m).
The aspect is usually south or southwest. Rams often venture onto the
more open slopes, although rugged terrain is always nearby. Desert
bighorn sheep rarely stray far from the base of a mountain and usually
are found on eastern aspects, where they use dry gullies. During
severe weather, if snow becomes unusually deep or crusted, bighorn sheep
move to slightly higher elevations where wind and sunshine have cleared
the more exposed slopes and ridges [6].

Spring range - The spring range is generally characterized by the same
parameters as the winter range. However, bighorn sheep begin to respond
to local greenups along streambanks and valleys. Bighorn sheep use
areas around saltlicks heavily in the spring. Preferred lambing range
is in the most precipitous, inaccessible cliffs near forage, and
generally has a dry, southern exposure [6].

Summer range - In the summer, bighorn sheep are mostly found grazing on
grassland meadows and plateaus above timber. In early summer south and
southwestern exposures are most frequently utilized; however, in the
case of the desert bighorn sheep the eastern aspect is preferred. By
late summer the more northerly exposures are preferred [6]. Snow
accumulation seems to be the principal factor that triggers bighorn
sheep to move from summer to winter ranges [26].

Water - Bighorn sheep obtain water from dew, streams, lakes, springs,
ponds, catchment tanks, troughs, guzzlers, and developed seeps or
springs [26]. Alkaline water is not suitable. Bighorn sheep spend most
of their time within 1 mile (1.6 km) of water but have been located as
far as 2 miles (3.2 km) from water. Water sources more than 0.3 mile
(0.5 km) from escape terrain or surrounded by tall dense vegetation are
avoided by bighorn sheep [26]. Desert bighorn sheep primarily utilize
ephemeral water sources. They may drink every day if water is nearby,
but may go without water for up to 14 days in the dry season. Since
water is one of the major limiting factors of desert bighorn sheep,
management agencies have installed cisterns and other water developments
in critical areas [6].
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 26. Van Dyke, Walter A.; Sands, Alan; Yoakum, Jim; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

204 Black spruce
205 Mountain hemlock
206 Engelmann spruce - subalpine fir
208 Whitebark pine
210 Interior Douglas-fir
218 Lodgepole pine
220 Rocky Mountain juniper
230 Douglas-fir - western hemlock
237 Interior ponderosa pine
238 Western juniper
239 Pinyon - juniper

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Populations other than those in low deserts typically migrate between an alpine or montane summer range and a lower elevation winter range (Shackleton et al. 1999). Some may occupy as many as five separate ranges during a year (Geist 1971). This vertical migration is probably a response to the increasing abundance of nutritious, new vegetative growth at higher elevations as spring and summer progress (Shackleton et al. 1999). The downward migration is motivated by snow accumulation in the high elevation summer ranges (Shackleton et al. 1999).

Bighorn Sheep - Peninsular Ranges

"This population...exhibits a metapopulation structure, and requires habitat necessary to accommodate movements of males (rams), and more rarely females (ewes), between ewe groups (subpopulations)" (USFWS 2011).

In the San Jacinto Mountains, fixed-kernel home range sizes averaged 25 square kilometers for males and 20 square kilometers for females (DeForge et al. 1997). Home range size depends on forage quantity and quality, season, sex, and age of the animal, and on the location of required resources such as water, forage, escape terrain, and lambing habitat (USFWS 2000). In many populations, home range size is smaller in summer thatn in winter, presumably because movement away from permanent water sources is more restricted in the hotter months (see sources cited in USFWS 2011).

"The gregarious and philopatric (faithful to natal home range) behaviors of ewes limit their dispersal and exploratory abilities relative to those of rams" (USFWS 2011). Young learn seasonal movement patterns from their mothers. Adult males are more vagile than females and young, and they often move among groups of females. Young maleseventually begin to follow older males and may adopt their traditional travel routes.

In the Peninsular Ranges, movement of radio-collared females between female groups is rare, although inter-group movement does occasionally occur (Rubin et al. 1998).

Sierra Nevada Bighorn Sheep (Ovis canadensis sierrae)

Seasonal migrations revolve primarily around avoidance of deep snow in winter.

Individuals tend to show a high level of philopatry to their seasonal home ranges, though long-distance dispersal to new areas sometimes occurs.

Maximum diameters of annual home ranges for females in the Mount Warren/Mount Gibbs, Wheeler, and Baxter herds ranged from 6.35 to 16.75 km); males from the Mount Warren/Mount Gibbs, Wheeler, and Sawmill herds ranged from 8.9 to 59.4 km (Sierra Nevada Bighorn Sheep Recovery Program 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Bighorn sheep are mainly diurnal, feeding intermittently throughout the day. Ovis canadensis canadensis is largely a grazer, consuming grasses, sedges, and forbs, but it will take some browse when preferred food is scarce (especially in winter). Desert bighorns (O. c. nelsoni) eat a variety of desert plants and get most of their moisture from the vegetation, although they still visit water holes every several days.

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet is diverse and variable. Bighorn sheep are primarily grazers of grass and forbs, but the diet can also include significant amounts of shrubs (Miller and Gaud 1989, Krausman et al. 1999, Shackleton et al. 1999). Diet changes seasonally. Access to mineral lick may be important for Rocky Mountain and desert bighorns, especially in spring (Shackleton et al. 1999, Krausman et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: forbs

Bighorn sheep primarily graze grasses and forbs, but eat other
vegetation depending on availability [6]. They prefer green forage and
move up- or downslope or to different aspects for more palatable forage.
Forage areas that provide a variety of aspects are preferable because
they provide green forage for longer periods [26].

Bighorn sheep eat sedges and a variety of grasses including bluegrasses
(Poa spp.), wheatgrasses, bromes, and fescues. Browse species include
sagebrush, willow (Salix spp.), rabbitbrush, curlleaf mountain-mahogany
(Cercocarpus ledifolius), winterfat (Kraschnennikovia lanata),
bitterbrush, and green ephedra (Ephedra spp.). Forbs include phlox
(Phlox spp.), cinquefoil (Potentilla spp.), twinflower (Linnaea
borealis), and clover (Trifolium spp.) [6,23].

Because of the dry climate, browse is the dominant food of the desert
bighorn sheep and includes desert holly (Atriplex hymenelytra),
honeysweet (Tidestromia oblongifolia), brittlebush or encelia (Encelia
spp.), hairy mountain-mahogany (C. breviforus), Wright silktassel
(Garrya wrightii), desert mallow (Sphaeralcea ambigua), Russian-thistle
(Salsola kali), false mesquite (Calliandra eriophylla), goatnut
(Simmondsia chinensis), white ratany (Krameria canescens), bursage
(Hyptis emoryi), mesquite (Prosopis glandulosa), catclaw (Acacia
greggii), ironwood (Olneya tesota), paloverde (Cercidium spp.),
pincushion (Mammillaria spp.), and saguaro (Carnegiea gigantea). Dry
grasses are eaten throughout the year and are an important food reserve,
especially near waterholes [6].
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 23. Stelfox, John G. 1976. Range ecology of Rocky Mountain bighorn sheep in Canadian national parks. Report Series Number 39. Ottawa, ON: Canadian Wildlife Service. 50 p. [13851]
  • 26. Van Dyke, Walter A.; Sands, Alan; Yoakum, Jim; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Bighorn sheep are important predators of grasses and shrubs in their native landscapes, they are also important sources of prey for large predators. Bighorn sheep are hosts for a number of parasites. Nematode lungworms, Protostrongylus stilesi and P. rushi, infect all bighorn sheep individuals and probably co-evolved with these sheep in North America. Most sheep do not experience any significant deleterious effects of lungworms.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The availability of escape territory in the form of rocky cliffs is important to bighorn sheep survival. If a sheep can reach a rocky outcrop or cliff, it is usually safe from the attack of wolves, coyotes, bears, Canada lynx, and mountain lions. Golden eagles (Aquila chrysaetos) may take some lambs.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Golden eagles (Aquila chrysaetos) occasionally threaten bighorn sheep
lambs, but are rarely successful in taking one. Bighorn sheep are an
incidental food item in the diet of grizzly or black bears (Ursus
arctos, U. americanus) and wolverines (Gulo gulo), and are generally
eaten only as carrion. Wolves (Canis lupus), coyotes (C. latrans),
mountain lions (Felis concolor), and bobcats (Lynx rufus) are other
predators of bighorn sheep [6,26]. The number of bighorn sheep taken by
predators is usually of little consequence to healthy populations.
Predators are most effective when locations of escape terrain or water
limit sheep movement and allow predators to concentrate hunting efforts
[26].

Bighorn sheep are hunted by humans. Hunting has traditionally been for
rams only and is further restricted by a 3/4 or full horn curl policy.
In the last few years most states and provinces have adopted more
stringent horn curl regulations. While the overall trend has been for
more restrictive hunting seasons, in some cases local situations have
dictated either sex or 1/2 curl ram seasons [6].
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 26. Van Dyke, Walter A.; Sands, Alan; Yoakum, Jim; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Ovis canadensis (bighorn sheep, wapiti, mule deer) is prey of:
Gulo gulo
Ursus arctos

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Ovis canadensis (bighorn sheep, wapiti, mule deer) preys on:
alpine vegetation

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Estimated in Demarchi et al. (1999a).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: In 1991, the total population was estimated to be 70,840: Rocky Mountain-37,969; California-9816; and Desert-23,055 (Valdez and Krausman 1999). In 1992, End. Sp. Tech Bull. (17(3-8):6) reported that desert populations in the U.S. declined to 1171 by 1979 and to fewer than 400 in the early 1990s, and that 1500-2500 still occur in Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Gregarious, but for most of the year adult males live apart from females/young (Shackleton et al. 1999, Krausman et al. 1999). Among mature males, older males (up to an age of not more than 10 years) generally dominate younger males during the breeding season; males older than 10 years decline rapidly in condition. In western Arizona, January-June home range of adult females was 19-27 sq km (Seegmiller and Ohmart 1981). Male annual home range up to 37 sq km in Nevada (Leslie and Douglas 1979).

Carrying capacity for bighorn can be reduced through grazing by other ungulates (cattle, burros, etc.). In the Santa Catalina Mountains of southern Arizona, not limited by forage quantity or quality (Mazaika et al. 1992).

Contact with a stray domestic sheep is believed to have resulted in the death (through bacterial pneumonia) of entire reintroduced herd of 65 in Warner Mountains, California (California Department of Fish and Game 1990). In some areas, lungworm infections may predispose bighorn to respiratory infection by opportunistic bacteria; lungworm life cycle involves gastropod intermediate host.

In desert, can survive 10 or more days in summer without drinking; may meet water needs in part by eating barrel cacti (Warrick and Krausman 1989).

PREDATION: Probably live in groups primarily to reduce predation (Shackleton et al. 1999). Coyotes may be a significant predator on young in some areas, killing up to 80% of the year's lambs (Hebert and Harrison 1988, Harper 1984, Hass 1989). Cougars can be important predators as well (Harrison and Hebert 1988, Krausman et al. 1999), and can have significant impacts on remnant or transplant herds (Krausman et al. 1999). Direct losses to predation are not generally as important as the fact that predation has forced females and young to use less productive habitats in and near escape terrain (Festa-Bianchet 1988, Demarchi et al. 1999a).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: fire exclusion, succession

Many bighorn sheep populations originally occurred in areas with
frequent fire intervals [19,24]. Bighorn sheep inhabiting the Salmon
River drainage of Idaho occupy a region where over 64 percent of their
habitat has burned since 1900 [24].

Fire exclusion for over 50 years has allowed plant succession to alter
many bighorn sheep habitats throughout North America [6,7]. Fire
exclusion, which has allowed conifers to establish on grasslands, has
decreased both the forage and security values on many bighorn sheep
ranges [7].

Fire is an important factor in creating habitats that are heavily used
by bighorn sheep [6,27]. Periodic burning keeps seral grasslands from
becoming dominated by coniferous trees [27]. In April 1987, a
prescribed fire was conducted on 235 acres (95 ha) of bighorn sheep
winter range in Custer State Park, South Dakota. Burning expanded
foraging habitat for bighorn sheep by curtailing encroachment of
pondersosa pine (Pinus ponderosa) onto mixed-grass prairie.

Burning may regenerate rangelands and enhance the production,
availability, and palatability of important bighorn sheep forage species
[27]. Bighorn sheep heavily utilized burned winter range the following
two winters after a September 1974 fire on the East Fork of the Salmon
River, Idaho [19]. Over 66 percent of the plants on this burned range
had been grazed by bighorn sheep. Utilization was consistently higher
on burned sites than on adjacent unburned sites for at least 4 years
after the fire [19].

Burning can increase visibility for bighorn sheep. Research has shown
that on burned sites bighorn sheep use areas more distant to escape
terrain than on adjacent unburned sites [27].

Fire can negatively affect bighorn sheep habitat when range condition is
poor and forage species cannot recover, when nonsprouting species that
provide important forage for bighorn sheep are eliminated, or when too
much area is burned and forage is inadequate until the next growing
season. Another potentially negative effect is when other species,
especially elk, are attracted to prescribed burns intended to benefit
bighorn sheep [19].
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 7. Easterly, Thomas G.; Jenkins, Kurt J. 1991. Forage production and use on bighorn sheep winter range following spring burning in grassland and ponderosa pine habitats. Prairie Naturalist. 23(4): 193-200. [19277]
  • 19. Peek, James, M.; Demarchi, Dennis A.; Demarchi, Raymond A.; [and others]
  • 24. Stucker, Donald E.; Peek, James M. 1984. Response of bighorn sheep to the Ship Island Burn. Report submitted to the Northern Forest Fire Laboratory: Supplement No. INT-80-108CA. 33 p. On file at: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17070]
  • 27. Woodard, Paul M.; Van Nest, Terry. 1990. Winter burning bighorn sheep range--a proposed strategy. Forestry Chronicle. October: 473-477. [14619]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: polygamous

Breeding season - Bighorn sheep are polygamous. Ewes are monesterous.
Rams of most subspecies rut in November and December. However, desert
bighorn sheep may rut for up to 9 months, with rutting reaching a peak
in August and September [6].

Age at sexual maturity - The age at which ewes attain sexual maturity is
quite variable and is dependent mainly on their physical condition [6].
Most bighorn sheep become mature at 2.5 years of age. Large-bodied rams
may reach sexual maturity within 18 months, but smaller rams may take as
long as 36 months. Very old ewes generally do not breed [6].

Gestation and lambing - The gestation period is 5.5 to 6 months. The
majority of ewes give birth to one lamb per year. Lambing of northern
bighorn sheep occurs between late April and late June, with most lambs
born before the end of May. Desert bighorn sheep ewes give birth
throughout the year; however, the peak is from January to April [6].

Development of lambs - Bighorn sheep lambs are precocious and within a
day or so climb almost as well as their mothers. Within 2 weeks lambs
can eat grass. They are weaned between 1 and 7 months. By their second
spring bighorn sheep are totally independent of their mother. Ewes
reach their adult weight by 4 to 5 years of age, while rams do not
achieve maximum weight until they are 6 or 7 years old [6].

Life span - Mortality is high for bighorn sheep 1 to 2 years of age,
drops to a relatively low rate for 2 to 8 years of age, then increases
to a maximum for those older than 8 to 9 years. Bighorn sheep that live
past 8 or 9 years may live to 15 to 17 years of age, but 10 to 12
years is more common [6].

Bighorn sheep are territorial. By 4 years of age, individuals have
established home ranges that are utilized throughout their life span [6].
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Bighorn sheep are very alert and have remarkable eyesight that allows them to judge distances accurately in jumping and locating footholds. They often watch other animals moving at distances of up to a mile away. Bighorn sheep probably also use chemical cues, as do most mammals, to distinguish reproductive states and may use visual cues to assess dominance among males. Bighorn sheep are less vocal than domestic sheep. The lambs bleat, and ewes respond with a gutteral "ba." At other times of the year, adults utter throaty rumbles or "blow" in fright. During the rut, the rams frequently snort loudly.

Communication Channels: visual ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: During the day, feeding alternates with rest-rumination periods. Daily activity may vary seasonally; often feeding peaks in early morning and at dusk. In winter, feeding periods are longer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Longevity depends on population status. In declining or stable populations, most sheep live over 10 years, with a maximum of 19 years. However in an expanding population with heavy reproduction, average life span is only 6 to 7 years. Females have been known to live up to 19 years and males to 14 but attaining these ages is rare. Even in areas where no hunting occurs, females rarely make it past 15 and males rarely live beyond 12. Juvenile mortality is variable and can be quite high, from 20 to 80%, averaging 5 to 30%. Between the ages of 2 and 6 there is relatively low mortality.

Range lifespan

Status: wild:
19 (high) years.

Typical lifespan

Status: wild:
6 to 15 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.6 years (captivity) Observations: Young females have an over 90% survival in the wild, though an increased mortality with age has been reported for both males and females after about 8 years of age (Loison et al. 1999). It has been reported that these animals live up to 24 years in captivity (David Macdonald 1985), which could be overestimated. Record longevity in captivity is 20.6 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bighorn sheep are perhaps best known for the head-to-head combat between males. Horn size is a symbol of rank, and the mass of the horns (as much as 14 kg) is used to a male's best advantage as he smashes into an opponent at speeds of 20 miles per hour. Combat has been observed to last for as long as 25.5 hours (with approximately 5 clashes an hour) until one of the males conceded. Males do not defend territories but rather engage in battles over mating access to a particular female. Male dominance status is determined by age as well as horn size, and homosexual activity often occurs in groups of males with the dominant animal behaving like a courting male and the subordinate playing the role of an estrous female. Ewes are seasonally polyoestrous and will accept several rams, often frequently, when in oestrus. Because of intense competition between males for females and the dominance hierarchy based on age and size (including the size of the horns), males do not usually mate until they are seven years old. Younger males will mate sooner if dominant rams in their group are killed.

Mating System: polygynous

Rutting season is in the autumn and early winter, and births take place in the spring. Mating for the desert bighorn, however, can last from July to December. Gestation lasts from 150-180 days, after which usually one, rarely two, young are born. Newborns are precocial and are able to follow their mothers at a good pace over the rocky terrain after the first week. Within a few weeks of birth, offspring form bands of their own, seeking out their mothers only to suckle occasionally. They are completely weaned by 4 to 6 months of age. Ovis canadensis females have been mated when 10 to 11 months old in captivity, but they generally do not breed until their second or third year in the wild.

Breeding interval: Bighorn sheep breed once yearly.

Breeding season: Mating occurs from July to December, with most activity concentrated in the fall rut.

Range number of offspring: 1 to 2.

Average number of offspring: 1.36.

Range gestation period: 5 to 6 months.

Range weaning age: 4 to 6 months.

Range time to independence: 4 to 6 months.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 2-3 years.

Range age at sexual or reproductive maturity (male): 7 (high) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 4400 g.

Average number of offspring: 1.

Female bighorn sheep seek out protected areas to give birth to their lambs. They nurse the young for 4 to 5 months, with the lambs increasing from about 4 kg at birth to 25 to 35 kg at weaning (males generally weighing more). Lambs are capable of walking and following their mothers on precipitous terrain soon after birth. Males do not participate in parental care.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female); post-independence association with parents; extended period of juvenile learning

  • Festa-Bianchet, M. 1999. Bighorn sheep. Pp. 348-350 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: The Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The timing of the mating season varies throughout the range. Bighorns in southwestern deserts have an extended season encompassing several months (Krausman et al. 1999), but the season is relatively later and shorter elsewhere, generally November in the northern part of the range (Shackleton et al. 1999), November-December in some southern California mountains (DeForge (1980). Gestation lasts about 175 days (Geist 1971, Shackleton et al. 1999). Lambing generally peaks in March in desert populations (Rubin et al. 2000), May (occasionally April or June) in the remainder of range (Krausman et al. 1999, Shackleton et al. 1999). Litter size is 1, rarely 2 (Geist 1971, Turner and Hansen 1980).Young are weaned in 4-6 months. Females first breed usually in second year in south, third year in north; occasionally in first year in some areas (Krausman et al. 1999, Shackleton et al. 1999); fecundity generally declines only slightly after eight years of age (Caughley 1977).

In the mating season, mature males battle over access to females through vigorous head butting contests, but during most of the rest of the year they live amiably in small bands apart from the females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ovis canadensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACTAACCACAAAGATATCGGCACCCTTTACCTTCTATTCGGTGCCTGAGCTGGCATAGTAGGAACCGCCTTAAGCCTACTAATTCGCGCTGAACTAGGCCAACCAGGAACTCTACTTGGAGATGACCAAATCTACAATGTAATCGTAACTGCACATGCATTCGTAATAATTTTCTTTATAGTAATGCCTATTATGATTGGTGGATTCGGCAACTGACTAGTTCCCCTAATAATTGGAGCCCCTGATATAGCATTTCCTCGGATAAACAACATAAGTTTTTGACTTCTTCCCCCATCTTTTCTGTTACTCCTAGCATCCTCTATGGTCGAGGCCGGAGCAGGAACAGGTTGAACCGTATACCCTCCTCTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTAGATCTAACTATCTTCTCCCTACACCTGGCAGGCGTCTCCTCAATTCTAGGAGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCTGCAATATCACAGTATCAAACCCCCTTGTTTGTATGATCTGTACTAATTACCGCCGTACTGCTCCTTCTCTCACTTCCTGTATTAGCAGCTGGCATCACAATATTACTAACGGACCGGAACCTAAATACAACCTTTTTTGACCCAGCAGGAGGAGGAGACCCTATCCTGTATCAACACCTATTCTGATTCTTTGGGCACCCTGAGGTATATATTCTTATTTTACCTGGATTTGGAATAATCTCTCATATCGTGACCTACTATTCAGGAAAAAAAGAACCATTTGGATATATAGGAATAGTATGAGCCATAATATCAATTGGGTTTCTAGGATTTATTGTATGAGCCCATCATATGTTCACAGTCGGAATAGATGTCGATACACGGGCTTACTTCACGTCAGCTACTATAATTATTGCTATCCCAACAGGAGTAAAAGTATTTAGTTGACTAGCAACACTTCATGGAGGTAATATCAAAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ovis canadensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Several populations may be threatened with eventual extinction, bighorn numbers are only one-tenth the population that existed when western settlers first began exploiting the Rockies. Their main threats are unregulated or illegal hunting, introduced diseases, competition from livestock, and continual human encroachment on their habitat. The subspecies O. c. auduboni of the Black Hills and adjacent areas has already become extinct. Bighorn sheep are incompatible with domestic sheep because they are susceptible to diseases of domestic livestock, including pneumonia, which is periodically responsible for large die-offs in bighorn sheep populations. Hunting has been prohibited or controlled since the early 1900's, but much illegal poaching still occurs. Hunting for trophies is particularly damaging to the cohesiveness of bighorn groups because it eliminates the dominant, breeding males. Recovery of numbers has been slow for these animals and their future is threatened unless further conservation measures are implemented. California bighorn sheep (O. c. californicus) are considered endangered under the U.S. Endangered Species Act.

US Federal List: endangered

CITES: appendix ii; no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Festa-Bianchet, M.

Reviewer/s
Festa-Bianchet, M. (Caprinae Red List Authority) & Stuart, S.N. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, large population, and because it is not declining at anything close to the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Still widespread in western North America from Canada to Mexico, although populations are much smaller than in the past. In some areas threatened by habitat changes resulting from fire suppression, interactions with feral and domestic livestock, and human encroachment; protected in some areas through adequate management.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent changes
in status may not be included.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

Nelson's Peninsular and Sierra Nevada bighorn sheep are listed as endangered [28].
  • 28. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

"#The Ovis canadensis weemsi, Weems' Bighorn Sheep, is Critically Endangered; Peninsula Bighorn Sheep, Ovis canadensis cremnobates, is an Endangered subspecies; the Mexican Bighorn Sheep, Ovis canadensis mexicana, is Vulnerable."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The total population of all bighorn sheep in Canada is estimated to be ca. 15,500 to 15,700 individuals. Of this total, ca. 11,500 to 11,700 are estimated to be Rocky Mountain bighorns [Alberta 10,300 (K. Smith, in litt., 1994), and British Columbia 1,500 to 1,700 (Hebert et al., 1985)], and ca. 4,000 California bighorn whose individual populations range in size from 15 to 2,400 animals. Most populations of both subspecies are either increasing or stable.

In 1990, there were estimated to be greater than 42,700 bighorn sheep in over 340 recognized herds, in 14 of the states in the United States. However, 64% of the herds recently had less than 100 animals (Thorne et al., 1985; U. S. Bureau of Land Management, n.d.), but most of these populations have since increased.

Only rough population estimates are available for Mexico. Previous estimates of 4,500 in all of Baja California, and perhaps 1,000 on ten separate ranges in Sonora (Sandoval, 1985) were inaccurate. A helicopter survey of the northern two thirds of Baja California in April 1992 by the Bighorn Institute, revealed there were probably greater than 2,500 wild sheep in the entire peninsula (J. Deforge pers. comm., 1992). Personnel from the Arizona Game and Fish Department and the Centro Ecologico de Sonora, conducted a helicopter survey of the principal mountain ranges of Sonora, Mexico in November 1992. Based on this survey, during which 528 sheep were classified by age and sex, R.M. Lee (pers. comm., 1992) estimated ca. 2,000 wild sheep for Sonora. The total estimate of all desert bighorn sheep in Mexico in 1992 was therefore ca. 4,500 animals.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Recent trends seem more or less stable; some increases are apparently offset by local dieoffs. Some sources conclude that numbers of Rocky Mountain bighorn sheep are increasing, whereas others cite declines due to habitat loss and disease (Risenhoover et al. 1988). Population on east slope of Sierra Nevada has increased in recent decades due to reintroduction program (California Department of Fish and Game 1990). (California and Baja California) has declined (California Department of Fish and Game 1990). A die-off occurred in Canyonlands National Park/Glen Canyon NRA and vicinity in the 1980s (Park Science, Summer 1993). Penisular range population declined between 1971 and 1991 in the United States, but is relatively stable in Mexico (USFWS 1998).

Global Long Term Trend: Decline of 50-70%

Comments: Long-term trend is a great decline: from approximately 150,000-200,000 before 1800 (Seton's 1929 estimate of 2 million or more is considered an order of magnitude too high, Demarchi 1976, Valdez and Krausman 1999) to very few thousand at the turn of the century. Numbers are not available for the total population at this time, but in 1915, there were only 1775-3400 Rocky Mountain Bighorns in Canada (Miller 1916). Protection from hunting and some habitat protection helped populations over the next few decades, but devastating dieoffs occurred as more and more domestic sheep (and their exotic diseases) were introduced onto western ranges in the early 1900s (Goodson 1982). The number of domestic sheep in 11 western states increased to approximately 28 million in 1920 and remained high until 1945 (Goodson 1982). After 1945, however, domestic sheep numbers declined and this allowed an energetic program of reintroductions and habitat enhancement to begin to turn the trend around. By 1960, populations in the contiguous United States had increased to 15,200-18,000 (Buechner 1960). Since 1960, populations of Rocky Mountain and California Bighorns have generally increased: 1975-30,667; 1983-37,035; 1993-48915 (Gilchrist (1998). In 1991, the total population (Rocky Mountain, California, and Desert Bighorns) was estimated to be 70,840 (Valdez and Krausman 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Epizootics have occurred periodically, especially in Rocky Mountain bighorn, and together with over-harvesting and competition from livestock at the end of the 19th century and beginning of the 20th, reduced numbers significantly. Most populations recovered with the aid of wildlife management and conservation efforts, but pneumonia and mange epizootics still occur today, particularly in populations that come into contact with domestic sheep and goats. Poaching of large trophy males is a problem in many areas, including within national parks.

In the US, small (< 100) numbers in many herds, and diseases from domestic sheep are major threats, while in Mexico the threats are poaching, competition from domestic livestock, and habitat degradation (Sandoval, 1985).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: High

Comments: Initial large declines were primarily the result of competition with domestic stock (e.g., cattle, sheep, burros), diseases and parasites introduced by domestic sheep, overhunting, and habitat loss (Cowan 1940; Buechner 1960; Sugden 1961; Stelfox 1971; Goodson 1982, Boyce et al. 1990, Valdez and Krausman 1999).

DOMESTIC STOCK: In Idaho, introduced bighorns avoided cattle and were more sensitive to cattle presence than were established populations, based on previous studies (Bissonette and Steinkamp 1996). Decline of desert populations has been attributed destruction of habitat and competition with domestic livestock and other native and domestic species (e.g., may be limited through resource competition with burros; Seegmiller and Ohmart 1981).

PARASITES AND DISEASE: Psoroptic scabies from domestic sheep devastated bighorn populations in the first half of the twentieth century (Boyce et al. 1990). The Peninsula ranges population (California and Baja California) has declined due to disease-caused low survival rate of juveniles (California Department of Fish and Game 1990). Many dieoffs (greater than 50% mortality over a few months) of herds have been reported over the last century; these are poorly understood, but seem to result from stress, which interacts with endemic lungworm infestations and lowers the animals' resistance to organisms such as PASTEURELLA bacteria. The animals subsequently die from acute bronchopneumonia (Ryder et al. 1992, Dunbar 1992, Schwantje 1988). See Bunch et al. (1999) for a general account of diseases and parasites affecting Bighorn Sheep.

HABITAT LOSS AND DEGRADATION: Loss and degredation of habitat, especially key winter forage sites, is a key threat (Valdez and Krausman 1999, Shackleton 1999, Krausman et al. 1999). Habitat degradation can occur through overgrazing by domestic stock, competition with exotic ungulates (e.g. Aoudad or Barbary, AMMOTRAGUS LERVIA), excessive off-road vehicle use, spread of rangeland weeds, and the usurpation of water sources (Simpson 1980, Valdez and Krausman 1999, Krausman et al. 1999). Fire suppression and resulting vegetation succession (encroachment of tall dense shrubland and forest) has been a major cause of habitat loss in Colorado and British Columbia (Davidson 1991, Cannings et al. 1999, Wakelyn 1987; see also Etchberger et al. [1989] for similar conclusion on the importance of fire in Santa Catalina Mountains, Arizona). Fragmentation of habitat reduces or eliminates genetic interchange among populations (Ramey 2000) and reduces the probability of recolonization following local extirpation; both these effects are especially of concern in small populations (fewer than 100 individuals), which are especially vulnerable to extirpation (Berger 1990).

OTHER: The social behavior and predator evasion strategy may have contributed to their decline (Miller and Gaud 1989). Feral honey bees may interfere with sheep attempting to drink at artificial water sources (guzzlers) in desert environments (Boyce et al. 2003).

Bighorn Sheep - Peninsular Ranges

Threatened in the United States by habitat loss, degradation, and fragmentation resulting from urban and commercial development (including proposed and approved renewable energy projects), invasive non-native plants (e.g., tamarisk), fire suppression (allows development of unsuitable thick vegetation), increased fire frequency (in some areas this facilitates invasion by non-native plants), and off-highway vehicle (OHV) activity; disease (in some instances contracted directly or indirectly from introduced domestic livestock); low recruitment (still a problem despite a recent increase in the bighorn sheep population); nonadaptive behavioral responses associated with residential and commercial development; high predation rates (by mountain lions and others) coinciding with low bighorn sheep population numbers in some areas; effects of non-native (e.g., ornamental) toxic plants; and climate change, particularly the ongoing and predicted trend toward warmer and drier conditions (USFWS 1998, 2011). Populations in Mexico are regarded as not very threatened (USFWS 1998).

Responses of bighorn sheep to human activity range from cautious curiosity to immediate flight or abandonment of habitat, as well as disruption of normal social patterns and resource use (USFWS 2011). Responses depend on the type of activity, an animal's previous experience with humans, size or composition of the bighorn sheep group, location of the sheep relative to elevation of the activity, distance to escape terrain, and distance to the activity (USFWS 2000).

The apparent extirpation of a subpopulation near the United States-Mexico border (Recovery Region 9) in the 1980s may have been caused construction of Interstate 8 in the mid-1960s, railroad activity, livestock grazing, poaching, and fire suppression (Rubin et al. 1998).

Sierra Nevada Bighorn Sheep (Ovis canadensis sierrae)

"Factors limiting Sierra Nevada bighorn sheep recovery include disease, predation, low population numbers and limited distribution, availability of open habitat, and potential further loss of genetic diversity due to small population sizes and inadequate migration between them. Since the vast majority of Sierra Nevada bighorn sheep habitat is publicly-owned land, loss of habitat has not been a limiting factor. However, management of bighorn sheep habitat (e.g., fire suppression) can result in habitat alterations and loss of key dispersal corridors connecting herds, which could be limiting factors." [Source: USFWS 2007]

Existing subpopulations are very small and are imminently threatened by mountain lion predation (USFWS 1999, 2000), which may need to be managed in some areas. As the numbers of Sierra Nevada bighorn sheep increase with recovery, the need for mountain lion control specifically for the benefit of Sierra Nevada bighorn sheep should be reduced and eventually eliminated (USFWS 2008). Continued suppression of fires in Sierra Nevada bighorn sheep range is a threat as habitat succession alters the abundance of suitable bighorn sheep habitat and increases bighorn sheep vulnerability to mountain lion predation (see USFWS 2008).

Although die-offs of bighorn sheep due to disease have occurred unrelated to domestic sheep (Miller et al. 1991: 534-540, cited by USFWS 2008)), a major contributing factor responsible for the decline of Sierra Nevada bighorn sheep populations over the years is thought to be the introduction of diseases by domestic livestock. Clifford et al. (2007:18, cited by USFWS 2008) indicated concern regarding the probability of a respiratory disease case occurring from disease transmission between domestic sheep and Sierra Nevada bighorn sheep, especially in the northern part of bighorn sheep range. Domestic grazing allotments within the vicinity of Sierra Nevada bighorn sheep habitat should be reviewed and activities should be modified as necessary to prevent competition and contact between the domestic livestock (sheep and goats) and bighorn sheep.

Domestic livestock (sheep, goats, cattle) grazing practices that result in overgrazing or allow for contact between domestic sheep, domestic goats, and Sierra Nevada bighorn sheep is a threat. Domestic livestock could compete with Sierra Nevada bighorn sheep for forage at some level in designated critical habitat units (USFWS 2008).

Some population units require special management considerations or protection to address impacts from development activities, including road construction and maintenance within Sierra Nevada bighorn sheep habitat (USFWS 2008).

Patented mining claims occur within habitat used by the Sierra Nevada bighorn sheep, but the area of the claims is small. Mining activities and associated facilities threaten bighorn sheep by causing the loss of vegetation structure required for foraging activities; the destruction of habitats used for escape, bedding, lambing, or connectivity between ranges; and the disturbance due to ongoing mining activities. Disturbance could modify bighorn sheep behavior or cause them to flee an area (USFWS 2008).

It remains unclear how significantly Sierra Nevada bighorn sheep may be affected by human disturbance. Increases in human uses of bighorn sheep habitat, including recreational activities such as rock and ice climbing, mountaineering, ski touring, hiking, camping, pack station establishment, snowmobiling, and off-road vehicle use may cause detrimental disturbance to Sierra Nevada bighorn sheep in some areas (USFWS 2008). Impacts to the habitat could occur through trampling and reduced vegetation structure due to grazing by pack animals (USFWS 2008).

Management actions to protect Sierra Nevada bighorn sheep habitat from catastrophic, naturally occurring events may be necessary. Events such as wildfires and avalanches could temporarily destroy large areas that provide summer or winter foraging habitat (USFWS 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Canada, more than 4,500 Rocky Mountain bighorns are fully protected within five National Parks (Banff, Jasper, Kootenay, Waterton, Yoho). An even larger number receive some level of protection in provincial parks and other protected areas in Alberta and British Columbia. Animals in protected areas are often especially vulnerable to poaching because they are habituated to humans and are also readily accessible. Outside national parks, both subspecies of bighorn sheep are covered by provincial or state wildlife acts, and many populations can be hunted under license. Harvesting both adult males and adult females may be permitted in some populations. Hunting quotas are determined each year, and in general regulations are strictly enforced. Management consists of regulating annual harvests, habitat improvement, annual censuses, translocation of animals, and promoting research. Between 200 to 250 male and 150 to 200 female Rocky Mountain bighorns are harvested annually in Alberta. In British Columbia, where only males are hunted: 60 to 65 Rocky Mountain and 40 to 45 California bighorns are shot each year, mainly by resident hunters (Hebert et al., 1985). In much of Canada, male harvest is limited only by the availability of adult males that have reached a minimum curl size, possibly leading to artificial selection against large-horned rams (Coltman et al., 2003).

In the US, Bighorn sheep occur in the following 30 National Parks, Monuments, Recreation Areas and Wildlife Refuges: Arizona: Grand Canyon NP; Cabeza Prieta, Havasu, and Kofa WRs; Glen Canyon, and Lake Mead NRAs; Organ Pipe Cactus NM; California: Sequoia- Kings Canyon NP; Death Valley, and Joshua Tree NMs; Colorado: Mesa Verde, and Rocky Mountain NPs; Colorado, and Dinosaur NMs; Montana: Glacier, and Yellowstone NPs; Bison Range, and C.M. Russell NWRs; Bighorn Canyon NRA; Nevada: Desert NWR; Death Valley NM; Lake Mead NRA; New Mexico: San Andres NWR; North Dakota: T. Roosevelt NP; Oregon: Hart Mountain NWR; South Dakota: Badlands NP; Utah: Arches, Canyonlands, Capitol Reef, and Zion NPs; Dinosaur NM; Flaming Gorge, and Glen Canyon NRAs; Wyoming: Grand Teton, and Yellowstone NPs; Bighorn Canyon NRA. It also occurs in the large Anza-Borrego State Park (California). Most of these protected areas are in the Mojave and Sonoran deserts, and on the Colorado plateau. Numerous other federal lands administered by the Forest Service and Bureau of Land Management also contain bighorn. Fourteen state wildlife agencies have transplanted sheep onto more than 200 historic ranges. This has accounted for much of the recovery of bighorn sheep from historic low numbers in the 1960s. However, numerous other transplants have failed (Bailey, 1990), presumably for lack of careful evaluation of habitat conditions at potential transplant sites or because of disease transmitted by livestock. Animals in about half the herds are hunted, and all states with bighorn sheep have at least one hunted population. Usually, only adult males are taken as hunting trophies. The number of sheep permitted to be taken each year is conservative and is regulated by each state. All states require that legally taken trophy heads be marked for permanent identification. This practice allows easy identification of illegally taken animals and thus discourages poaching.

Improvement of habitat for bighorn sheep has been frequent, especially on federal multiple-use lands. Projects have been funded with combinations of federal, state, and private moneys. Natural water sources have been improved and artificial water sources created, especially in the Mojave and Sonoran deserts of the Southwest. Further north, dense forest or shrub vegetation has been cleared, often by controlled burning, to provide open areas with forage for bighorn sheep. Some populations of bighorn are routinely baited and treated with drugs to control parasites including lungworm (Protostrongylus sp.). Such treatments concentrate sheep and may jeopardize wildness. Management and research biologists exchange information on bighorn sheep in annual meetings of the Desert Bighorn Council and biennial meetings of the Northern Wild Sheep and Goat Council. Proceedings of these meetings are published. Three private organizations, the Foundation for North American Wild Sheep, the Rocky Mountain Bighorn Society and the Society for the Conservation of Bighorn Sheep, raise funds for research and management. At least 10 states auction and/or raffle one or two special bighorn hunting licenses to raise funds for these purposes. Its status within the United States is Not Threatened (but see below).

The status of most traditional subspecies and major ecotypes of bighorn sheep is satisfactory because they exist on 30 biological reserves and on many other protected areas. However, their status is not fully secure because at least 64% of the herds contain about 100 animals. Berger (1990) reviewed the history of some small bighorn populations and concluded that those numbering less than 50 animals usually became extirpated, but Wehausen (1999) provides an alternative interpretation and viewpoint. Further, the ecotypes of bighorn in the Chihuahuan desert and in shortgrass-badlands and riverbreak environments are not secure because there are few reserves or other protected lands within these two regions, and very few of these lands contain wild sheep.

Conservation measures proposed for the United States: 1) Additional research on bighorn diseases, particularly in relation to domestic livestock, and on developing efficient methods for habitat management is desirable. 2) State and federal agencies should develop coordinated plans to enhance the long-term security of the numerous bighorn herds with less than 100 sheep. Strategies should include increasing herd size, expanding habitat and increasing herd mobility, and enhancing habitat quality and habitat protection in corridors between small herds (Bailey 1992). 3) Land management agencies, especially the U.S. Forest Service and Bureau of Land Management, should formally recognize bighorn ranges in their management plans, including corridors for movement within and between herds. 4) Until disease relations are clearer, bighorn should be protected from contact with domestic sheep and domestic goatswhenever possible. 5) Greater recognition of the values and importance of ecotypic variation in bighorn sheep is needed. Federal agencies and state wildlife departments should seek a consensus on classifying the major ecotypes. Each state should furthermore classify its bighorn according to state ecotypes. Conservation of major ecotypes should proceed under the federal Endangered Species Act. Each state should be responsible for conserving another level of ecotypic diversity of bighorn sheep within its boundaries. 6) Increase the number of bighorn sheep in federally protected habitats in the Chihuahuan Desert and in the shortgrass-badlands and river breaks ecosystems. In the Chihuahuan Desert, options include: a) expanding protection of habitat and sheep from the San Andres National Wildlife Refuge to a greater portion of the White Sands Missile Range; b) formally recognizing and enhancing protection of the Big Hatchet Game Range, now on Bureau of Land Management land; c) establishing viable bighorn populations in Guadalupe Mountains and Big Bend National Parks; and d) establishing bighorn in a new biological reserve, probably in west Texas. 7) In the shortgrass-badlands and river breaks ecosystems, management options include: a) expanding bighorn populations and distributions in the Charles M. Russell National Wildlife Refuge, the Bighorn National Recreation Area, and in Theodore Roosevelt and Badlands National Parks; and b) establishing bighorn populations in new biological reserves in eastern Wyoming or western Nebraska.

The species in Mexico is listed in Appendix II of CITES. Mexican bighorn occur in only two protected areas in Mexico, one of which (Isla Tiburon Wildlife Reserve (in the Sea of Cortez)) holds an introduced population. Peninsular bighorn is in only one protected area, Sierra de San Pedro Martir National Park, but Weem’s bighorn occurs in none. A small group (25 in 1992) of desert bighorn (O. c. nehoni) is held in captivity at Hermosillo. The high price ($30,000 to over $l00,000) that some hunters are willing to pay to hunt wild sheep has recently motivated private and communal landowners in Sonora and Baja California to begin desert sheep monitoring and management programs. In 1994, ranchers in Sonora started a captive breeding program by capturing 40 sheep and placing them in breeding enclosures. Six hunting permits were issued to private landowners for free-ranging bighorns in 1995, and each sold for $40,000. A private conservation organization has initiated a transplant of Weem’s bighorn from southern Baja California to Carmen Island. The excess sheep produced on this island, once the transplanted population increases to a viable size, will be used to re-establish extinct populations on the mainland. The participation of private landowners in wild sheep management programs in Mexico is a positive initiative. Private landowners have the funds to provide for monitoring wild sheep populations and to prevent further poaching.

Conservation measures proposed for Mexico: At least five areas must be addressed for conservation of desert bighorn in Mexico (Sandoval, 1985): a) Effective law enforcement is a major problem facing the conservation of bighorn in Mexico. In large part, this is due to the very low financial support generally given to wildlife programmes. b) There is a general lack of technical expertise among wildlife personnel. c) A public education program, especially targeted towards the rural population, is necessary if conservation programmes are to be successful. d) Habitat management has generally been ignored, despite the fact that agricultural practices and forest use have had, and continue to have, significant negative effects on the bighorn. e) The further spread of exotic ungulates, such as Barbary sheep, in or adjacent to current and historic bighorn range should be curtailed. Proposals to deal with these include: 1) Increase the number of protected areas in Baja California and in Sonora on the mainland. Present protected areas are inadequate to protect sheep populations. Mexico’s burgeoning human population requires intensive exploitation of agricultural and natural resources, while coastal tourist development projects in Sonora and Baja California will have further deleterious impacts on wild sheep habitats. 2) Raise enforcement of anti-poaching efforts to adequate levels. This will require a well-equipped law enforcement division. 3) Develop a public conservation education programme, especially targeted towards the rural population. This could play an important role for future conservation of wild sheep and all other wildlife and natural resources. 4) Educate and employ a cadre of professional wildlife biologists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preserve Selection and Design Considerations: In the southwestern U.S., Berger (1990) found that populations with fewer than 50 individuals are not viable; all such populations went extinct within 50 years.

Management Requirements: See Douglas and Leslie (1999) for a general discussion of Bighorn Sheep management; and see Smith and Krausman (1988) for a discussion of management of desert populations.

Management needs for the Rocky Mountain population: identification of seasonal ranges and migration corridors and identification of factors limiting range expansion; improvement of ranges by vegetation manipulation (burning, clearing); protection of ranges from human encroachment; avoiding contact between bighorn and domestic livestock Risenhoover et al. 1988). Smith et al. (1991) presented a habitat evaluation procedure for the Rocky Mountain population.

See California Department of Fish and Game (1990) for brief comments on management activities relating to Peninsular Range (California) population; recovery of this population with require compatible grazing programs by BLM, USFS, and private landowners.

Management Research Needs: Research into habitat requirements is important, and much work remains to be done in assessing habitat suitability and capability, and modeling habitat on a landscape scale. Continued studies of diseases are vital, as is research into population and metapopulation dynamics and population genetics (Douglas and Leslie 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Protected in many National Parks; many reserves have been established specifically for the species.

USFWS (2008) designated as critical habitat for subspecies sierrae approximately 417,577 acres (168,992 hectares) in Tuolumne, Mono, Fresno, Inyo, and Tulare counties, California.

Needs: Protect habitat from domestic livestock damage; protect populations from excessive hunting. Desert populations exhibit more movement between isolated patches of habitat than previously thought; consequently corridors between traditional habitats should be given conservation consideration (Bleich et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the terms: competition, shrub

Prescribed fire can be useful tool in managing bighorn sheep habitat
[19]. Prescribed burning has been widely used to increase the quantity
and nutritional quality of bighorn sheep forage throughout North America
[7].

Prescribed crown fires conducted in winter in mature conifer stands
adjacent to escape terrain may provide an inexpensive solution to
maintaining or establishing bighorn sheep winter range. In areas where
the available bighorn sheep range is large and provides alternative and
distant wintering sites, fires should be prescribed or located in areas
that would minimize the stress on sheep. Early spring fires,
particularly on south and southwest aspects, may provide more spring
forage than would otherwise be available for bighorn sheep [27].
Burning immature forests and scrublands adjacent to bighorn sheep winter
range could also provide migration corridors between winter and summer
ranges [24].

Prescribed burning has been used to establish and maintain subalpine
bighorn sheep range in British Columbia. According to Bentz and Woodard
[2], burning provides an economical method of converting subalpine
forests, which are of low value to bighorn sheep, to earlier seral plant
communities. On the British Columbia range, bighorn sheep used burned
sites more than adjacent unburned sites.

Since both positive and negative effects can occur from burning bighorn
sheep range, a well-thought-out plan must be developed before fire is
considered for use on their range. Plans must consider the following:

1) condition of plants
2) plant response to burning
3) adjacent conifers (The possibility of creating more open range exists
if conifer stands or tall shrub fields occur next to currently used ranges.)
4) limiting factors (factors that may limit bighorn sheep populations
should be identified, and an evaluation made as to how burning will
effect these limiting factors)
5) lungworm (lungworm infections can possibly be altered by reducing
bighorn sheep concentrations; however, if burns are small and
concentrate bighorn sheep, results could be negative. If burns disperse
populations, the effects could be positive)
6) competition from other ungulates attracted to burns [19]
  • 2. Bentz, Jerry A.; Woodard, Paul M. 1988. Vegetation characteristics and bighorn sheep use on burned and unburned areas in Alberta. Wildlife Society Bulletin. 16(2): 186-193. [15276]
  • 7. Easterly, Thomas G.; Jenkins, Kurt J. 1991. Forage production and use on bighorn sheep winter range following spring burning in grassland and ponderosa pine habitats. Prairie Naturalist. 23(4): 193-200. [19277]
  • 19. Peek, James, M.; Demarchi, Dennis A.; Demarchi, Raymond A.; [and others]
  • 24. Stucker, Donald E.; Peek, James M. 1984. Response of bighorn sheep to the Ship Island Burn. Report submitted to the Northern Forest Fire Laboratory: Supplement No. INT-80-108CA. 33 p. On file at: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17070]
  • 27. Woodard, Paul M.; Van Nest, Terry. 1990. Winter burning bighorn sheep range--a proposed strategy. Forestry Chronicle. October: 473-477. [14619]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: competition, density

Bighorn sheep are very susceptible to diseases. Incidence of lungworm
infestation approaches 100 percent in some herds, although the level of
individual infection varies depending upon sheep and domestic livestock
densities, range conditions, climate, season, and age. Desert bighorn
sheep appear to have lighter infestations, possibly due to climate or
low density. A significant correlation exists between the intensity of
the lungworm infestation and the amount of precipitation in the spring
of the previous year. In Washington state both wild and captive bighorn
sheep have been successfully treated with the experimental drug
albendazole. Further research is needed to determine the feasibility of
treating remote populations [6].

The future of bighorn sheep depends on the preservation and improvement
of critical native ranges. Bighorn sheep are poor competitors with
other wild and domestic ungulates, and their range is diminishing.
The effect of domestic livestock grazing on bighorn sheep is
controversial and depends on the proximity and population size of
competing species. Domestic livestock have been reported to have little
deleterious effect if they do not graze on critical bighorn sheep winter
ranges. Nevertheless, extensive competition by livestock, especially on
public lands, persists and is one of the reasons for the decline in
density of bighorn sheep populations [6]. Elk (Cervus elaphus) and deer
(Odocoileus virginianus and O. hemionus) can also be serious competitors
with bighorn sheep on marginal habitat [6,18].

Human activities on bighorn sheep range are the most widespread threat
to bighorn sheep [4]. These activies reduce the number of bighorn sheep
by decreasing habitat, causing bighorn sheep to reduce or terminate
their use of prime habitat, stop migration, or split from large herds
into smaller herds [4,26]. Human activities responsible for declines in
sheep use of an area include hiking and backpacking, snow skiing, water
skiing, fishing, motorbiking, four-wheel-drive vehicle use, construction
and use of roads, urban development, and recreational development. When
bighorn sheep are pushed from prime to marginal habitat, mortality
usually increases and productivity decreases. Some herds have adapted
to human activity [26].
  • 4. Boyd, Raymond J.; Cooperrider, Allen Y.; Lent, Peter C.; Bailey, James A. 1986. Ungulates. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 519-564. [10856]
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 18. Peek, James. 1985. Bighorn sheep responses to fire. The Habitat Express. No. 85-4. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Region. 3 p. [5224]
  • 26. Van Dyke, Walter A.; Sands, Alan; Yoakum, Jim; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative effects of bighorn sheep on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Native Americans and early settlers prized bighorn meat as the most palatable of American big-game species. Native Americans also used the horns to fashion large ceremonial spoons and handles for utensils. The horns have also been popular for many centuries as trophies. Bighorn sheep may serve as an attraction for ecotourism ventures in parts of western North America.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bighorn sheep

For other uses, see Big Horn (disambiguation).

The bighorn sheep (Ovis canadensis)[3] is a species of sheep in North America[4] named for its large horns. These horns can weigh up to 30 lb (14 kg), while the sheep themselves weigh up to 300 lb (140 kg).[5] Recent genetic testing indicates three distinct subspecies of Ovis canadensis, one of which is endangered: O. c. sierrae. Sheep originally crossed to North America over the Bering land bridge from Siberia: the population in North America peaked in the millions, and the bighorn sheep entered into the mythology of Native Americans. By 1900, the population had crashed to several thousand, due to diseases introduced through European livestock and overhunting.[6] Conservation efforts (in part by the Boy Scouts) have restored the population.

Taxonomy and genetics[edit]

Ovis canadensis is one of three species of mountain sheep in North America and Siberia; the other two species being Ovis dalli, which includes Dall sheep and Stone's sheep, and the Siberian snow sheep Ovis nivicola. Wild sheep crossed the Bering land bridge from Siberia during the Pleistocene (about 750,000 years ago) and subsequently spread through western North America as far south as Baja California and northwestern mainland Mexico.[7] Divergence from their closest Asian ancestor (snow sheep) occurred about 600,000 years ago.[8] In North America, wild sheep have diverged into two extant species—Dall sheep, which occupy Alaska and northwestern Canada, and bighorn sheep, which range from southern Canada to Mexico.[9] However, the status of these species is questionable given that hybridization has occurred between them in their recent evolutionary history.[10]

Subspecies[edit]

In 1940, Ian McTaggart-Cowan split the species into seven subspecies:[7]

  • Rocky Mountain bighorn sheep, O. c. canadensis, are found from British Columbia to Arizona.
  • California bighorn sheep, O. c. californiana, are found from British Columbia south to California and east to North Dakota. The definition of this subspecies has been updated (see below).
  • Nelson's bighorn sheep, O. c. nelsoni, the most common desert bighorn sheep, ranges from California through Arizona.
  • Mexican bighorn sheep, O. c. mexicana, range from Arizona and New Mexico south to Sonora and Chihuahua.
  • Peninsular bighorn sheep O. c. cremnobates, occur in the Peninsular Ranges of California and Baja California.
  • Weems' bighorn sheep, O. c. weemsi, also are found in Baja California.
  • Audubon's bighorn sheep, O. c. auduboni, occurred in North Dakota, South Dakota, Montana, Wyoming, and Nebraska. This subspecies has been extinct since 1925.

However, starting in 1993, Ramey and colleagues,[8][11] using DNA testing, have shown this division into seven subspecies is largely illusory. The taxonomy of Ovis canadensis continues to be refined as new genetic and morphologic data become available, but most scientists currently recognize these subspecies of bighorn:[12][13]

  • Rocky Mountain bighorn sheep (O. c. canadensis), occupying the U.S. and Canadian Rocky Mountains and the northwestern U.S.
  • Sierra Nevada bighorn sheep (O. c. sierrae), formerly California bighorn sheep,[13] a genetically distinct subspecies that only occurs in the Sierra Nevada
  • Desert bighorn sheep (O. c. nelsoni), occurring throughout the southwestern desert regions of U.S. and Mexico.

In addition, two populations are currently considered endangered by the United States government:[14]

  • Sierra Nevada bighorn sheep (O. c. sierrae),
  • Peninsular bighorn sheep, a distinct population segment of desert bighorn sheep (O. c. nelsoni).

Description[edit]

A juvenile

Bighorn sheep are named for the large, curved horns borne by the rams (males). Ewes (females) also have horns, but they are shorter with less curvature.[15] They range in color from light brown to grayish or dark, chocolate brown, with a white rump and lining on the backs of all four legs. Males typically weigh 127–316 lb (58–143 kg), are 36–41 in (91–104 cm) tall at the shoulder, and 69–79 in (180–200 cm) long from the nose to the tail. Females are typically 75–188 lb (34–85 kg), 30–36 in (76–91 cm) tall and 54–67 in (140–170 cm) long.[16] Male bighorn sheep have large horn cores, enlarged cornual and frontal sinuses, and internal bony septa. These adaptations serve to protect the brain by absorbing the impact of clashes.[17] Bighorn sheep have preorbital glands on the anterior corner of each eye, inguinal glands in the groin, and pedal glands on each foot. Secretions from these glands may support dominance behaviors.[17]

Bighorns from the Rocky Mountains are relatively large, with males that occasionally exceed 500 lb (230 kg) and females that exceed 200 lb (90 kg). In contrast, Sierra Nevada bighorn males weigh up to only 200 lb (90 kg) and females to 140 lb (60 kg). Males' horns can weigh up to 30 lb (14 kg), as much as the rest of the bones in the male's body.[18]

Natural history[edit]

Ecology[edit]

In front of Mount Wilbur in Glacier National Park, Montana

The Rocky Mountains and Sierra Nevada bighorn sheep occupy the cooler mountainous regions of Canada and the United States. In contrast, the desert bighorn sheep subspecies are indigenous to the hot desert ecosystems of the Southwestern United States. Bighorn sheep generally inhabit alpine meadows, grassy mountain slopes, and foothill country near rugged, rocky cliffs and bluffs.[18] Since bighorn sheep cannot move though deep snow, they prefer drier slopes, where the annual snowfall is less than about 60 inches a year.[18] A bighorn's winter range usually lies at lower elevations than its summer range.[19] Bighorn sheep are highly susceptible to certain diseases carried by domestic sheep, such as scabies and pneumonia; additional mortality occurs as a result of accidents involving rock falls or falling off cliffs (a hazard of living in steep, rugged terrain). Bighorns are well adapted to climbing steep terrain where they seek cover from predators. Predation primarily occurs with lambs, which are hunted by coyotes, bobcats, lynxes and golden eagles. Bighorn sheep of all ages are threatened by bears, wolves and especially cougars, which are perhaps best equipped with the agility to prey on them in uneven, rocky habitats.[15][20][21] They are considered good indicators of land health because the species is sensitive to many human-induced environmental problems. In addition to their aesthetic value, bighorn sheep are considered desirable game animals by hunters.

Bighorn sheep graze on grasses and browse shrubs, particularly in fall and winter, and seek minerals at natural salt licks.[20] Females tend to forage and walk, possibly to avoid predators and protect lambs,[22] while males tend to eat and then rest and ruminate, which lends to more effective digestion and greater increase in body size.[22]

Social structure and reproduction[edit]

A bighorn ram following a juvenile ewe

Bighorn sheep live in large flocks, and do not typically follow a single leader ram, unlike the mouflon, the ancestor of the domestic sheep, which has a strict dominance hierarchy. Prior to the mating season or "rut", the rams attempt to establish a dominance hierarchy to determine access to ewes for mating. During the prerut period, most of the characteristic horn clashing occurs between rams, although this behavior may occur to a limited extent throughout the year.[23] Rams' horns can frequently exhibit damage from repeated clashes.[20] Females exhibit a stable, nonlinear hierarchy that correlates with age.[24] Females may fight for high social status when they are integrated into the hierarchy at one to two years of age.[24]

Rocky Mountain bighorn rams employ at least three different courting strategies.[25] The most common and successful is the tending strategy, in which a ram follows and defends an estrous ewe.[25] Tending takes considerable strength and dominance, so ewes are more receptive to tending males, feeling they are the most fit. Another tactic is coursing, which is when rams fight for an already tended ewe.[25] Ewes typically avoid coursing males so the strategy is not effective. Rams will also employ a blocking strategy. They will prevent a ewe from accessing tending areas before she even goes into estrus.[25]

Bighorn ewes have a six-month gestation. In temperate climates, the peak of the rut occurs in November with one, or rarely two, lambs being born in May. Most births occur in the first two weeks of the lambing period. Pregnant ewes of the Rocky Mountains migrate to alpine areas in spring, presumably to give birth in areas safer from predation,[26] but are away from areas with good quality forage.[26] Lambs born earlier in the season are more likely to survive than lambs born later.[27] Lambs born late may not have access to sufficient milk, as their mothers are lactating at a time when food quality is lower.[27] Newborn lambs weigh from 8 to 10 lb (3.6 to 4.5 kg) and can walk within hours. The lambs are then weaned when they reach four to six months old. The lifespan of rams is typically 9–12 years, and 10–14 years for ewes.[15]

Infectious disease[edit]

Many bighorn sheep populations in the United States experience regular outbreaks of infectious pneumonia,[28][29][30][31] which likely result from the introduction of bacterial pathogens (in particular, Mycoplasma ovipneumoniae,[32][33] and some strains of Mannheimia haemolytica)[34] carried asymptomatically in domestic sheep.[35] Once introduced, pathogens can transmit rapidly through a bighorn population, resulting in all-age die-offs that sometimes kill up to 90% of the population. In the years following pathogen introduction, bighorn populations frequently experience multiple years of lamb pneumonia outbreaks. These outbreaks can severely limit recruitment and likely play a powerful role in slowing population growth.[31]

Relationship with humans[edit]

A petroglyph of a caravan of bighorn sheep near Moab, Utah, USA; a common theme in glyphs from the desert southwest

Two hundred years ago, bighorn sheep were widespread throughout the western US, Canada, and northern Mexico. Some estimates placed their population at over 2 million. By around 1900, hunting, competition from ranching, and diseases had decreased the population to several thousand. A program of reintroductions, natural parks, and reduced hunting, together with a decrease in domesticated sheep near the end of World War II, allowed the bighorn sheep to make a comeback. In 2009, the California Department of Fish and Game issued 21 permits for the hunting of bighorn sheep, and 19 permits for the 2010–11 hunting season.[36]

A female bighorn sheep at the Grand Canyon

Boy Scouts[edit]

In 1936, the Arizona Boy Scouts mounted a state-wide campaign to save the bighorn sheep. The Scouts first became interested in the sheep through the efforts of Major Frederick Russell Burnham, the noted conservationist who has been called the "Father of Scouting".[37] Burnham observed that fewer than 150 of these sheep still lived in the Arizona mountains. He called George F. Miller, then scout executive of the boy scout council headquartered in Phoenix, with a plan to save the sheep. Burnham put it this way, "I want you to save this majestic animal, not only because it is in danger of extinction, but of more importance, some day it might provide domestic sheep with a strain to save them from disaster at the hands of a yet unknown virus."[38]

Several other prominent Arizonans joined the movement, and a "save the bighorns" poster contest was started in schools throughout the state. Burnham provided prizes and appeared in store windows across Arizona. The contest-winning bighorn emblem was made into neckerchief slides for the 10,000 boy scouts, and talks and dramatizations were given at school assemblies and on radio. The National Wildlife Federation, the Izaak Walton League, and the National Audubon Society also joined the effort.[38]

These efforts led to the establishment of two bighorn game ranges in Arizona: Kofa National Wildlife Refuge and Cabeza Prieta National Wildlife Refuge. On January 18, 1939, over 1,500,000 acres (6,100 km2) were set aside and a civilian conservation corps side camp was set up to develop high mountain waterholes for the sheep. The desert bighorn sheep is now the official mascot for the Arizona Boy Scouts.[38]

In culture[edit]

Bighorn sheep in Silver Canyon near the town of Bishop, California

Bighorn sheep were among the most admired animals of the Apsaalooka (Crow) people, and what is today called the Bighorn Mountain Range was central to the Apsaalooka tribal lands. In the Bighorn Canyon National Recreation Area book, storyteller Old Coyote describes a legend related to the bighorn sheep. A man possessed by evil spirits attempts to kill his heir by pushing the young man over a cliff, but the victim is saved by getting caught in trees. Rescued by bighorn sheep, the man takes the name of their leader, Big Metal. The other sheep grant him power, wisdom, sharp eyes, sure-footedness, keen ears, great strength, and a strong heart. Big Metal returns to his people with the message that the Apsaalooka people will survive only so long as the river winding out of the mountains is known as the Bighorn River.[39]

Bighorn sheep are hunted for their meat and horns, which are used in ceremonies, as food, and as hunting trophies. They also serve as a source of ecotourism, as tourists come to see the bighorn sheep in their native habitat.[citation needed]

The Rocky Mountain bighorn sheep is the provincial mammal of Alberta and the state animal of Colorado and as such is incorporated into the symbol for the Colorado Division of Parks and Wildlife.[40]

Bighorn sheep were once known by the scientific identification "argali" or "argalia" due to assumption that they were the same animal as the Asiatic argali (Ovis ammon).[41] Lewis and Clark recorded numerous sightings of Ovis canadensis in the journals of their exploration—sometimes using the name argalia. In addition, they recorded the use of bighorn sheep by the Shoshone in making bows.[42] William Clark's Track Map produced after the expedition in 1814 indicated a tributary of the Yellowstone River named Argalia Creek and a tributary of the Missouri River named Argalia River, both in what is today Montana. Neither of these tributaries retained these names, however. The Bighorn River, another tributary of the Yellowstone, and its tributary stream, the Little Bighorn River were both indicated on Clark's map and did retain their names, the latter being the namesake of the Battle of the Little Bighorn.[43]

References[edit]

  1. ^ Festa-Bianchet, M. (2008). Ovis canadensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2009-02-05.
  2. ^ Allen, JA (1912). "Historical and nomenclatorial notes on North American sheep". Bulletin of the AMNH 31. article 1. 
  3. ^ "Ovis canadensis". Integrated Taxonomic Information System. Retrieved 18 March 2006. 
  4. ^ Grubb, P. (16 November 2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  5. ^ "Bighorn Sheep". Ultimate Ungulate page. 
  6. ^ Yoshida, Kate (January 6, 2014). "A Symbol of the Range Returns Home". New York Times. 
  7. ^ a b Cowan, I. McT (1940). "Distribution and variation in the native sheep of North America". American Midland Naturalist 24 (3): 505–580. doi:10.2307/2420858. JSTOR 2420858. 
  8. ^ a b Ramey, R. R. II (1993). "Evolutionary genetics and systematics of North American mountain sheep" (Ph.D. Thesis). Cornell University, Ithaca, NY. 
  9. ^  This article incorporates public domain material from the United States Fish and Wildlife Service document "Draft recovery plan for the Sierra Nevada Bighorn Sheep".
  10. ^ Loehr, J.; Worley, K.; Grapputo, A.; Carey, J.; Veitch, A.; Coltman, D.W. (2006). "Evidence for cryptic glacial refugia from North American mountain sheep mitochondrial DNA". Journal of Evolutionary Biology 19 (2): 419–430. doi:10.1111/j.1420-9101.2005.01027.x. PMID 16599918. 
  11. ^ Wehausen, J. D.; R. R. Ramey II (1993). "A morphometric reevaluation of the Peninsular bighorn subspecies". Trans. Desert Bighorn Council 37: 1–10. 
  12. ^ Wehausen, J.D.; R.R. Ramey II (2000). "Cranial morphometric and evolutionary relationships in the northern range of Ovis canadensis". Journal of Mammalogy 81: 145–161. doi:10.1644/1545-1542(2000)081<0145:CMAERI>2.0.CO;2. ISSN 1545-1542. 
  13. ^ a b Wehausen, J. D.; V. C. Bleich; R. R. Ramey II (2005). "Correct nomenclature for Sierra Nevada bighorn sheep". California Fish and Game 91: 216–218. 
  14. ^ Caprinae Specialist Group (1996). Ovis canadensis. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 9 May 2006.
  15. ^ a b c "Facts about bighorn sheep". Bighorn Institute. Retrieved 2010-10-12. 
  16. ^ "Bighorn Sheep". eNature Nature Guides. 
  17. ^ a b Geist, V. (1971). Mountain sheep: a study in behavior and evolution. Chicago, IL: Univ. Chicago Press. 
  18. ^ a b c "Ovis canadensis". Animal Diversity Web. University of Michigan Museum of Zoology. 
  19. ^ Festa-Bianchet, M. (1999). "Bighorn sheep". In Wilson, D.E.; Ruff, S. The Smithsonian Book of North American Mammals. Washington, D.C.: The Smithsonian Institution Press. pp. 348–350. 
  20. ^ a b c  This article incorporates public domain material from the National Park Service document "Description of Bighorn Sheep at Yellowstone Park".
  21. ^ "Bighorn Sheep". Eduscapes.com. 2011. Archived from the original on 24 July 2011. Retrieved 2011-07-21. 
  22. ^ a b Ruckstuhl, K. E. (1998). "Foraging behaviour and sexual segregation in bighorn sheep". Animal Behaviour 56: 96–106. doi:10.1006/anbe.1998.0745. 
  23. ^ Valdez, R.; P. R. Krausman (1999). Mountain Sheep of North America. The University of Arizona Press, Tucson. ISBN 0-8165-1839-4. 
  24. ^ a b Hass, C. C. (1991). "Social status in female bighorn sheep (Ovis canadensis): expression, development, and reproductive correlates". Journal of Zoology (London) 225 (3): 509–523. doi:10.1111/j.1469-7998.1991.tb03832.x. 
  25. ^ a b c d Hogg, J. T. (1984). "Mating in Bighorn Sheep: Multiple Creative Male Strategies". Science 225 (4661): 526–529. doi:10.1126/science.6539948. PMID 6539948. 
  26. ^ a b Ruckstuhl, K. E.; Festa-Bianchet, M. (1998). "Do reproductive status and lamb gender affect the foraging behavior of bighorn ewes?". Ethology 104 (11): 941–954. doi:10.1111/j.1439-0310.1998.tb00043.x. 
  27. ^ a b Festa-Bianchet, Marco (1988). "Birthdate and survival in bighorn lambs (Ovis canadensis)". Journal of Zoology 214 (4): 653–661. doi:10.1111/j.1469-7998.1988.tb03764.x. 
  28. ^ Gross, J.E.; Singer, F.J.; Moses, M.E. (2000). "Effects of disease, dispersal, and area on bighorn sheep restoration". Restoration Ecology 8 (4S): 25–37. doi:10.1046/j.1526-100x.2000.80063.x. 
  29. ^ Cassirer, E.F.; Sinclair, A.R.E. (2007). "Dynamics of pneumonia in a bighorn sheep metapopulation". The Journal of Wildlife Management 71 (4): 1080–1088. doi:10.2193/22006-002. 
  30. ^ Boyce, W.M.; et al. (2011). "Wildlife translocation: the conservation implications of pathogen exposure and genetic heterzygosity". BMC Ecology 11 (5). doi:10.1186/1472-6785-11-5. 
  31. ^ a b Cassirer, E.F.; et. al. (2013). "Spatio-temporal dynamics of pneumonia in bighorn sheep". Journal of Animal Ecology 82: 518–528. doi:10.1111/1365-2656.12031. 
  32. ^ Besser, T.E.; et. al. (2008). "Association of Mycoplasma ovipneumoniae infection with population-limiting respiratory disease in free-ranging Rocky Mountain bighorn sheep (Ovis canadensis canadensis)". Journal of Clinical Microbiology 46: 423–430. doi:10.1128/JCM.01931-07. 
  33. ^ Dassanayake, R.P.; et. al. (2010). "Mycoplasma ovipneumoniae can predispose bighorn sheep to fatal Mannheimia haemolytical pneumonia". Veterinary Microbiology 145: 354–359. doi:10.1016/j.vetmic.2010.04.011. 
  34. ^ Shanthalingam, S.; et. al. (2014). "PCR assay detects Mannheimia haemolytica in culture-negative pneumonic lung tissues of bighorn sheep (Ovis canadensis) from outbreaks in the western USA, 2009-2010". Journal of Wildlife Diseases 50 (1): 1–10. doi:10.7589/2012-09-225. 
  35. ^ Besser, T.E.; et. al. (2012). "Causes of pneumonia epizootics among bighorn sheep, western United States, 2008-2010". Emerging Infectious Diseases 18. doi:10.3201/eid1803.111554. 
  36. ^ California DFG 2010 – 2011 Bighorn Sheep Tag Quotas and Season Dates. Dfg.ca.gov. Retrieved on 2011-09-16.
  37. ^ van Wyk, Peter (2000). Burnham: King of Scouts. Trafford Publishing. ISBN 1-4122-0028-8. Retrieved 2007-03-30. 
  38. ^ a b c Edward H. Saxton (March 1978). "Saving the Desert Bighorns". Desert Magazine 41 (3). Retrieved 2008-04-27. 
  39. ^ Graetz, Rick; Susie Graetz. "About the Crow: Introduction". Little Big Horn College Library. Retrieved 2010-03-21. 
  40. ^ "Colorado State Symbols". Archived from the original on 8 July 2007. Retrieved 2007-07-25. 
  41. ^ Stewart, George R., Jr. (December 1935). "Popular Names of the Mountain Sheep". American Speech (Duke University Press) 10 (4): 283–288. doi:10.2307/451603. JSTOR 451603. 
  42. ^ Tubbs, Stephenie Ambrose; Jenkinson, Clay Straus (2003). The Lewis and Clark Companion: An Encyclopedia Guide to the Voyage of Discovery. Henry Holt and Company. pp. 12–13. ISBN 0-8050-6726-4. 
  43. ^ Lewis, Samuel; William Clark (1814). "A Map of Lewis and Clark's track across the western portion of North America, from the Mississippi to the Pacific Ocean". Longman, Hurst, Reese, Orme and Brown. Retrieved 2007-03-11. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Wehausen and Ramey (2000) examined variation in skull and horn characters in populations from the Great Basin north to British Columbia and Alberta and concluded that: (1) O. c. auduboni does not warrant recognition separate from O. c. canadensis; (2) populations of O. c. "californiana" in British Columbia and Washington are best treated as O. c. canadensis; (3) extirpated native populations of O. c. "californiana" in northeastern California, Oregon, northern Nevada, and southwestern Idaho should be included in O. c. nelsoni (recognizing that some transition to O. c. canadensis probably occurred along that northern boundary); and (4) O. c. californiana is restricted to the central and southern Sierra Nevada in California. However, the type locality of O. c. californiana is Yakima Co., Washington, a locality now assigned to O. c. canadensis; thus, the Sierra Nevada population is not part of O. c. californiana, but is either O. c. canadensis or a distinct subspecies with a different name. The evidence of Wehausen and Ramey (2000) that this population is fixed for a unique mtDNA haplotype would indicate the latter. Wehausen et al. (20050 and USFWS (2008) reviewed available taxonomic information and concluded that the Sierra Nevada population should be recognized as a distinct subspecies (Ovis canadensis sierrae).

MtDNA data for O. c. canadensis suggest that "gene flow has occurred on a regional scale at some time in the past and that populations have not been subdivided by long-term biogeographic barriers. Nonetheless, significant differentiation in mtDNA-haplotype frequencies among herds suggests that little gene flow currently exists among populations" (Luikart and Allendorf 1996).

Ramey (1995) examined mtDNA variation in O. canadensis populations in the southwestern United States and adjacent northern Baja California and found a lack of concordance between mtDNA haplotype distributions and current subspecies designations. Additionally, Ramey (1993) and Wehausen and Ramey (1994) found no morphological support for the separation of desert sheep into four subspecies. Ramey (1995) suggested that populations formerly considered to be O. c. nelsoni, O. c. mexicana, O. c. cremnobates, and O. c. weemsi probably should be recognized as a single polytypic subspecies on the basis of morphological and mtDNA data. As such, the subspecies would be O. c. nelsoni Merriam, 1897. A study of nuclear DNA markers is needed to test this conclusion (Ramey 1995).

As of 2011, Integrated Taxonomic Information System (www.itis.gov; accessed 23 August 2011) did not recognize any subspecies of Ovis canadensis.

The genus Ovis has been included in the genus Capra by some authors. See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Old World O. nivicola occasionally has been included in O. canadensis, but most authorities have regarded them as separate species (see Grubb, in Wilson and Reeder 1993, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

bighorn sheep
mountain sheep

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for the bighorn sheep is Ovis
canadensis Shaw [6,13]. Subspecies are listed below [13].

Ovis canadensis subsp. canadensis (Rocky mountain bighorn sheep)
Ovis canadensis subsp. auduboni Merriam (Audubon's bighorn sheep)
Ovis canadensis subsp. californiana Douglas (California bighorn sheep)
Ovis canadensis subsp. cremnobates Elliot (Peninsular desert bighorn sheep)
Ovis canadensis subsp. mexicana Merriam (Mexican desert bighorn sheep)
Ovis canadensis subsp. nelsoni Merriam (Nelson's Peninsular bighorn sheep)
Ovis canadensis subsp. sierrae (Sierra Nevada bighorn sheep)
Ovis canadensis subsp. weemsi Goldman (Weem's desert bighorn sheep)
  • 6. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 13. Hall, E. Raymond; Kelson, Keith R. 1959. The mammals of North America, Volume II. New York: The Ronald Press Company. 79 p. [21460]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!