Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Muskoxen are well adapted to their cold Arctic habitat, with short, stocky bodies and a thick coat of ground-length hair, enhanced in the winter by woolly underhairs for added insulation. They feed on sedges, grasses, and willows. Like other mammals in the family Bovidae, they are ruminants: they gulp down a large quantify of food, then regurgitate and re-chew it at leisure. This behavior - chewing their cud - lets them break down the vegetation and digest it better. It also lets them forage quickly, which may be a protection from predators. Females and young Muskoxen live in mixed-sex groups year-round. Some bulls live alone in the summer, but are likely to join all-male or mixed-sex groups in winter. Bulls breed with several females. Competition involves clashing with horns and their heavily shielded heads. Muskoxen also use their horns in a group defense strategy against their principle predators, wolves and brown bears: they back into a circle or cluster, with head and horns facing outward. Individual animals dart out to charge at the intruder.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Zimmermann, E.A.W., 1780.  Geographische Geschichte des Menschen, und der allgemein verbreiteten vierfüssigen Thiere. Zweiter Band. Enthält ein vollständiges Verzeichniss aller bekannten Quadrupeden.  Weygandschen Buchhandlung, Leipzig, (2nd volume) pp. 86-88.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Ovibos moschatus is a circumpolar species native to Canada, Greenland, and up until the late 1800's, Alaska. The species was reintroduced to Alaska from animals captured in Greenland in the 1930's. Muskox have also been introduced into Russia, Svalbard, Norway, and Siberia. Some herds have also found their own way from Norway into Sweden.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Historically (1800s), muskoxen occurred from Point Barrow, Alaska (USA) east across Canada to northeast Greenland, south to northeast Manitoba (Canada), with the current range reduced (Grubb, 2005). In the Canadian Arctic, muskoxen inhabit most large islands (except Baffin Island) and the mainland tundra of the Northwest Territories and Nunavut from the coast of Hudson Bay west to almost the Mackenzie River and south to the tree line in the Northwest Territories and western Nunavut. Muskoxen occur naturally over the entire Northeast and North Greenland west to Nyeboe Land. As well, there are several introduced populations, which are now well established in West Greenland and Qaannaaq. The species was re-introduced to Alaska (USA), and four locations in West Greenland (Denmark). Muskoxen were also introduced to Norway and Svalbard (Norway), although on Svalbard, they have since died out (Grubb, 2005). The species occurred in Russia until around 2,000 years ago, and has been introduced to the Taimyr Peninsula and Wrangel Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Northern Alaska (extirpated then reintroduced from Greenland), northern Canada mainland, most arctic islands, and Greenland. Introduced populations occur in Scandinavia and Taimyr Peninsula. Distribution may fluctuate somewhat in response to longterm climatic variation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Many of the physical characteristics of O. moschatus can be attributed to arctic adaptations. Musk oxen have barrel-shaped bodies with short legs, and their entire bodies are covered with fur except for the small area between the nostrils and lips. Both sexes have cream-colored horns with black tips that grow together at the center of the head, drop down along side of head, then curve up to form sharp hooks. These horns grow with age. The tail is short (5 to 10 cm) and is entirely covered and hidden under the fur. Fur can be divided into two types: guard hair and qiviut (pronouced kiv-ee-Ute). Guard hairs are the continuously growing dark hairs that create the characteristic long, shaggy coat. This portion of the pelage can grow long enough to brush the ground on older muskoxen. This long hair is sometimes refered to as a skirt. The guard hairs act as protection against wind and precipitation, as well as insects. Qiviut is the insulating winter coat of muskoxen. It begins growing in the fall and is shed out through the guard hair in the spring. The back is marked by a lighter colored patch of brown or cream where the guard hairs are shorter. This is refered to as the saddle. Legs of these animals are white. Older adult muskoxen sometimes develop a large mane of fur that sits on the shoulders.

Subspecies include barren ground muskoxen, Ovibos moschatus moschatus, which are native to Canada and were native to Alaska until extirpation in the late 1800's. White-faced muskoxen, Ovibos moschatus wardi, are native to Greenland and have been introduced to many locations. Ovibos moschatus wardi tends to be slightly smaller than O. moschatus moschatus, but distinction between the two is based mostly on location of the animal. The two subspecies can interbreed.

Calves are born in the early spring with very short guard hair and nubs where the horns will begin growing soon after. They are also born with a layer of baby qiviut and over the harsh winter are dependent on the cows for both additional body warmth and protection from the elements by standing in the skirt.

Female weight ranges from 180 to 275 kg, with an average of 250 kg. Head and body length can vary from 135 to 200 cm. Muskoxen typically stand 120 cm at the shoulders. Females grow horns, but lack the extra thickness of a horn boss at the base of the horns. Hook size typically matches that of males. Ovibos moschatus has an udder with four teats, also covered in fur.

Males typically weigh an average of 320 kg, with a range of 300 to 400 kg. The combined head and body length varies from 200 to 250 cm. Males have a large horn boss, which is an extra thickness of the base of their horns at the top of the skull, that is between 15 and 20 cm thick. This feature protects them during mating behaviors that include headbutting.

Range mass: 180 to 400 kg.

Average mass: 285 kg.

Range length: 150 to 260 cm.

Average length: 210 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Rowell, J. 1990. The Muskox. Pp. 2-22 in B Holst, ed. International Studbook for Muskox: Ovibos moschatus .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 246 cm

Weight: 405000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 2.1-2.6 m males; 1.9-2.4 m females

Weight:
Range: 186-410 kg males; 160-191 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Ovibos moschatus lives north of the tree line on the arctic tundra. Summers have a very short growing seasons of three to four months with lush and abundant vegetation. Winters are long and very cold with little precipitation and harsh winds. There is little vegetation in winter and shallow snow.

Habitat Regions: polar ; terrestrial

Terrestrial Biomes: tundra

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Muskoxen are large-bodied herbivores in an environment characterized by a short and variable plant growing season (when diet quality is high) and a long winter when the availability of low quality forage is highly variable through the snow cover. Typically, muskoxen live in mixed sex and age herds or small male bachelor herds which have home ranges within which muskoxen move between seasonal ranges. Although primarily grazers adapted to a diet of sedges and grasses, muskoxen also browse shrubs and forage selectively for forbs. They calve well before snow melt so lactation is supported by the cow’s fat reserves which the cow has to replenish during the brief summer. Muskoxen have a high threshold of fat reserves before conceiving which reflects their conservative breeding strategies. Winter ranges typically have shallow snow to reduce the energetic costs of digging through snow to reach forage. Muskoxen may also be susceptible to internal parasites but their role in muskox foraging ecology and population dynamics is unknown. The implications of the low genetic variability of muskoxen are likewise unknown.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In High Arctic usually on well-vegetated sedge slopes on low-elevation coastal sites and valleys of watercourses. On mainland, vegetation mostly willow and birch thickets associated with sedges, grasses, and forbs. Feeds in wet meadows in summer, in lowland meadows or on windswept ridges in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Relatively sedentary; seasonal movements between winter and summer ranges do not exceed 80 km and are probably often less than 50 km (Gunn 1982, Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Muskoxen are generalized grazers. As calves, they are dependent upon the milk of their mothers for up to 1 year. Within weeks of birth, they begin incorporating the adult foods into their diet. In the summer months, the diet inculdes grasses, leafy plants, sedges, mosses, shrubs, herbs, and generally any vegetation available. The fecal matter of the animals at this time is very moist and still has high levels of nutrients available. In the winter months, the diet of muskoxen changes to willow, dwarf birch stems, roots, mosses, lichen, and any vegetation they can locate under or above the snow. The fecal matter during these months is very dry and has very few nutrients left after the animals have digested the food.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers; bryophytes; lichens

Other Foods: fungus

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly sedges, grasses, and willows in summer, primarily sedges or woody plants in winter. See A88LEN01NA for details. Often grazes on cliff-edge habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ovibos moschatus is herbivorous, and consumes plant life. It also provides a food source for arctic scavengers, wolves, polar bears, and brown bears. Muskoxen may help to disperse seeds as they graze.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The known predators of O. moschatus are polar bears, brown bears, and wolves. When faced with a predator coming head on, muskoxen line up with their heads down and horns facing the attacker. The calves are generally located behind the adults. When attacked by multiple predators, the herd creates a circle with horns pointed out and calves in the center of the herd. Larger adults may charge out to attack a predator. When a predator approaches the herd, the muskoxen attempt to headbutt or hook that predator with their horns. Muskoxen have been known to throw and trample wolves. As O. moschatus is adapted to arctic life, these animals can overheat easily and cannot run faster than wolves or bears long enough to escape from them. They therefore tend to stay in the circle formation as long as possible.

Known Predators:

  • Wolves
  • Grizzley or brown bear
  • Polar bear

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Not territorial. Forms herds of up to about 100 (generally 5-45); group sizes are larger in winter than in summer; density generally less than 1/sq km (Heard 1992). Breeding age bulls are solitary or in single-sex groups except when they join herd during summer rutting season. Basic social unit: females and young. Productivity and mortality are greatly influenced by weather. Major predator is the gray wolf; sometimes preyed on by brown bears and polar bears in summer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Ovibos moschatus has very interesting vocal abilities. Calves, when communicating with cows or each other, bleat. The pitch of the bleat lowers with maturity. Adults have deeper voices that sound closer to roars and rumbles that can be heard long distances. Adults also grunt and snort at each other, at calves, and at other animals. Pushing and shoving, as well as chasing and stomping, are used to communicate dominance.

Much of the non-vocal communication among muskoxen occurs during the breeding season when males compete for dominance and breeding rights. Males have very strong-smelling urine and urinate on their front legs and dribble urine during displays as warnings to competitors. They will also use a gland near each eye to mark objects by rubbing their faces against the item to be marked. Bulls also swing their heads, walk sideways, and horn the ground to gather chunks of earth to make themselves look larger.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Ovibos moschatus lives in very harsh climates and harsh winters may cause death for young calves as well as older adults. Females typically live 15 to 18 years though some older than 20 years have been recorded in the wild and in captivity. Males typically only live 10 to 12 years, as the breeding season is very strenuous. Adult muskoxen typically die through the inability to properly digest food because of excessive wear on molar teeth, or as a result of predation.

Range lifespan

Status: wild:
>20 (high) years.

Average lifespan

Status: wild:
14 years.

Range lifespan

Status: captivity:
>20 (high) years.

Average lifespan

Status: captivity:
14 years.

Typical lifespan

Status: wild:
<1 to 18 years.

Average lifespan

Status: wild:
14 years.

Typical lifespan

Status: captivity:
10 to 18 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.4 years (captivity) Observations: In the wild it has been reported that these animals may live up to 24 years (Bernhard Grzimek 1990). One wild born specimen was about 27.4 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Ovibos moschatus is considered a harem breeder in which one dominant male attempts to mate with all of the estrus females of the herd. Beginning in late summer and into fall, males compete for dominance using very ritualized behaviors. Males attempt to intimidate each other through posturing, roaring, head swinging, urinating on forefeet with strong scent markers, displaying broadsides to show size, and headbutting. During headbutting, males face each other up to 45 meters apart, then charge up to 20 or 25 miles per hour and crash together on the horn bosses. They can repeat this procedure up to 10 or 12 times or until one of the males cannot continue or runs away. This behavior is rarely fatal. Males that compete for dominance are typically between the ages of 6 and 8 years old. Older bulls are usually not strong enough, and younger males are typically not large enough, to compete. Competition between bulls sometimes results in solitary males. Once dominance is determined, a bull attempts to keep the females close together to defend them from other males. Dominant males may breed multiple times with each female during one season. Young muskoxen and non-dominant bulls typically keep their distance from the breeding harem.

Mating System: polygynous

Ovibos moschatus breeds from late August into September and gives birth between mid-April and mid-May. Muskoxen usually have single offspring after a gestation of about 8 months. Twins are very rare and do not usually survive. Generally within 45 minutes of birth, calves are standing and nursing. Calves typically weigh 9 to 11 kg at birth and can gain up to 0.5 kg a day. Though calves are born with a layer of baby qiviut and brown fat, they are dependent upon their mothers for warmth and food for the first winter of their lives, sometimes longer. Calves start eating adult food within weeks of birth, although they continue to nurse for 10 months to 1 year, sometimes longer depending on food availability, birth of a new calf, or temperament of the cow. Muskox calves follow their mothers and hide underneath the mother's skirt of guard hair.

Females typically reach sexual maturity between 1 to 4 years of age, depending on body condition, and will calve alternate years. Calving every year is possible if food sources are available. Males typically reach sexual maturity between 3 and 4 years.

Breeding interval: Female muskoxen breed once a year or once every two years, depending upon the availability of food.

Breeding season: Breeding occurs during late August and into September.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 7.5 to 8.5 months.

Range weaning age: 8 to 24 months.

Average weaning age: 10-14 months.

Range time to independence: 8 to 24 months.

Average time to independence: 10-14 months.

Range age at sexual or reproductive maturity (female): 1.5 to 4 years.

Average age at sexual or reproductive maturity (female): 2-3 years.

Range age at sexual or reproductive maturity (male): 2 to 4 years.

Average age at sexual or reproductive maturity (male): 3-4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Average birth mass: 11460 g.

Average number of offspring: 1.

Although they are fully furred and able to stand from birth, calves are dependent upon their mothers for milk, warmth from their bodies and fur, and protection. Though calves can generally eat adult food within weeks of birth, to gain sufficient body weight to survive through the winter they require milk from their mothers. For warmth, calves often lie with their mother, or stand underneath her skirt next to her belly. During attack from predators, the calves are often pushed behind the rumps of the adults, or into the middle of a circle formation. Mothers also teach calves the social hierarchy behaviors by playing "games" such as king of the mountain, and mock headbutting.

Males are not reported to directly care for the young. However, since these animals are social, it is likely that the adult male in a herd helps to protect the young in the herd.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

  • Groves, P. 1997. Muskox. Alaska Geographic, 23/4: 56-86.
  • Gray, D. 1990. Muskox Biology. Pp. 23-48 in B Holst, ed. International Studbook for Muskox: Ovibos moschatus .
  • Rowell, J. 1990. The Muskox. Pp. 2-22 in B Holst, ed. International Studbook for Muskox: Ovibos moschatus .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds August-September. Litter size usually is 1. Young are born mainly April-early May in some areas (e.g., Banks Island), mainly May (first 3 weeks) in northern Alaska. Calf nurses until after first winter. Female first breeds usually at 3 years, may not breed every year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Coat insulates against extreme cold: muskox
 

The coat of a muskox provides insulation via bilayer structure: a shaggy outercoat of guard hairs, and a thick silky undercoat.

   
  "The musk ox has shaggy outer hair and a thick silky undercoat in which it can withstand any blast or blizzard…" (Foy and Oxford Scientific Films 1982:84)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ovibos moschatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTTCTATTTGGTGCCTGAGCTGGCATAGTAGGAACTGCCCTAAGCCTGTTAATTCGCGCTGAACTAGGCCAACCTGGAACCCTACTTGGAGACGATCAAATCTACAATGTAGTCGTAACCGCACACGCATTCGTGATAATTTTCTTCATAGTAATGCCCATTATAATTGGAGGCTTCGGCAACTGACTAGTGCCTCTGATAATTGGAGCCCCTGACATAGCATTCCCTCGGATAAACAACATAAGTTTTTGACTCCTCCCCCCTTCCTTCCTATTACTCCTAGCATCCTCTATGGTTGAAGCCGGAGCAGGAACAGGCTGAACCGTATATCCCCCTCTAGCAGGTAACCTAGCCCATGCAGGACCCTCAGTAGACCTGACCATTTTCTCTCTGCACCTAGCAGGTGTCTCCTCAATTCTAGGGGCCATCAATTTTATTACAACCATCATTAATATAAAACCCCCTGCAATATCACAGTATCAAACTCCCCTATTCGTGTGGTCTGTACTGATTACTGCCGTATTACTCCTCCTCTCACTCCCTGTGTTGGCAGCTGGTATTACAATGCTACTAACAGACCGAAACCTAAACACAACTTTCTTTGACCCAGCAGGAGGAGGGGATCCTATTTTATATCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ovibos moschatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Though herds of O. moschatus native to Alaska and parts of Europe were driven to extinction through hunting pressures and climate fluctuations in the late 1800's, the species has been successfully reintroduced from suviving populations in Canada and Greenland and is doing well, currently numbering greater than 60,000 world wide. Ovibos moschatus is currently not listed as a threatened species.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gunn, A. & Forchhammer, M.

Reviewer/s
Festa-Bianchet, M. (Caprinae Red List Authority) & Stuart, S.N. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is not declining at anything close to the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Canada, estimated muskox numbers in the Northwest Territories total 75,400 (1991-2005) of which 93% occur on the large arctic islands of Banks and western Victoria. Nunavut has an estimated 45,300 animals, of which 35,000 occur on the Arctic islands (unpublished data). A few muskoxen from the transplanted population on the Alaskan North Slope have strayed into Yukon. In northern Quebec (outside their natural range), Le Henaff and Crete (1989) counted 290 muskoxen in 1986.

In Alaska, 3,714 animals were estimated from aerial and ground counts between 2001 and 2005: Nunivak Island 609; Nelson Island 318; Seward Peninsula 2050; northwest Alaska 369; northeast Alaska 268. The re-established herds either fluctuate or are increasing in size and range, and in some areas, local people are concerned that they will compete with caribou and reindeer.

The population size in Greenland in 1991 was estimated to number 9,500-12,500. Of this total, (Boertmann et al., 1990) recorded the following population estimates:1,000 to 1,500 in North Greenland between Newman bight (82°N, 55’W) and Nioghalvfjerdfjorden (79°N); around 35 animals in the northern East Greenland region between 79°N and Jokelbugten (78°N); 450 to 550 between 78°N and Ardencable fjord (75°N); 2,900 to 4,600 in the areas between 75°N and Kong Oscar Fjord (72°N), and 4,600 to 5,000 the southernmost part of the species’ natural range in East Greenland, between 72°N and Scoresby Sund (70°N) (although recent unpublished surveys suggest that the population here has been reduced to approximately 4,000 animals (P. Aastrup pers. comm. to M. Forchhammer.).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Historically this species declined because of over-hunting, but population recovery has taken place following enforcement of hunting regulations. Management in the late 1900s was mostly conservative hunting quotas to foster recovery and recolonization from the historic declines. Currently, there is increasing realization that periodically on some arctic islands, die-offs of up to 40% of the island’s muskoxen occur when warmer fall weather leads to icing and deeper snow which restrict forage availability. On the North American mainland, typically muskoxen have expanded their range recolonizing historic ranges but behind the colonizing edge, abundance declines at least partially due to predation by wolves and grizzly bears. A persistent concern of people is that muskoxen through their presence (smell) and foraging are detrimental to caribou (Rangifer tarandus). The environmental consequences of climate warming is likely to have an impact on this species.

In Greenland, there are no major threats, although the fact that populations are often small in size and scattered, make them vulnerable to local or regional fluctuations in climate. Most populations are within the National Park, where they are protected from hunting. The portion of the population which is south of the National Park sustains a regulated quota harvest. Climate change in Northeast Greenland is expected to bring increased precipitation and milder winters, which might negatively affect the muskox population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Unregulated commercial harvesting caused the disappearance of muskoxen from large areas of their Canadian continental ranges in the late 1880s and at the same time, ice storms probably reduced muskox numbers on Banks and western Victoria islands. After protection from hunting in 1917, muskoxen began to recover, and under the Northwest Territories and Nunavut Wildlife Act, are subject to aboriginal hunting limited by area-specific quotas and seasons. After 1980, the rights to hunt muskox could be transferred to non-aboriginal hunters for guided non-resident hunters and for commercial meat harvesting. In northern Canada, wildlife management is largely shifting from centralized government agencies to co-management boards and shared responsibility with aboriginal peoples. The wildlife management boards are developing management plans, and continue to regulate muskox hunting on the basis of sustainable yields. In the late 1990s, the annual quota for the NWT and Nunavut was 12,000 animals which includes 10,000 tags for Banks Island. The domestic harvest is relatively stable and while the commercial harvest for meat and hides (source of qiviut the fine underwool) annually varies, it averages about 1,000-2,000 muskoxen from Banks and Victoria islands. Management activities are mostly systematic aerial strip-transect surveys to track trends in population size, and as a basis for quota adjustments. No reserves are specifically set aside for muskoxen, but part of the rationale for establishing the Thelon Game Sanctuary was to protect a remnant muskox population from hunting. The species also occurs in three national parks: Quttinirpaaq (Ellesmere Island ), Aulavik (northern Banks Island) and Tuktu Nogait (Bluenose Lake, western Arctic mainland). In national parks, land use activities are controlled, but aboriginal hunting is permitted subject to conservation provisions. Conservation measures proposed for Canada: 1) Maintain sufficiently frequent population monitoring to track trends in abundance and distribution. 2) Utilize environmental screening of individual developments to protect muskox ranges outside any formally protected areas. 3) Public education is essentially as muskox have recolonized large areas and many people are unfamiliar with muskox ecology and behavior. People are often concerned about effects of muskoxen on caribou especially in areas muskoxen have recolonized.

In the United States, all five extant populations are the result of re-introductions of the muskox within and outside its historic range. The re-introductions began in 1935 with the translocation of animals, originally from northeast Greenland, to Nunivak Island. From 1967 to the most recent transplants in 1970, the Nunivak island population has been the source for all other Alaskan translocations (Klein 1988). Fully protected by law, muskox occurs in five protected areas and hunting is allowed under permit, with limited quotas on three of the five populations. Local subsistence hunting is given preference. Its status within the country is Not Threatened.

In Greenland, muskoxen occur in four protected areas, with indigenous populations in the vast Northeast Greenland National Park, and three introduced populations in Arnangarnup Qoorua Nature Reserve, and Kangerlussuag and Maniitsoq Caribou Reserves. Within these protected areas, muskox receives full protection. Most natural populations are within Northeast Greenland National Park. Outside protected areas, controlled hunting is allowed on Jameson Land in East Greenland, and near Kangerlussuaq in West Greenland. In both, quotas are determined annually and hunting is permitted only by full-time subsistence hunters. Between 1963 and 1991, muskoxen were translocated to three areas in the southwest previously uninhabited by muskox (near Kangerlussuaq, central West Greenland; Nunavik Peninsula, West Greenland; and Ivittuut, south Greenland), and a fourth population was reintroduced into former muskox range in Avanersuaq (Thule) in north-western North Greenland. Conservation measures proposed for Greenland: A proposal for development of a long-term management plan for existing muskox populations in West Greenland, is presently being considered by the Home Rule administration. A new system of game wardens in the West Greenland region, between Disko Bay (68°30’N) and Paamiut icecap (62°30’N), is being established to strengthen the enforcement of renewable resource legislation, and to control the performance of hunters in general.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: Capable of high productivity after reintroduction (Latour 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pleistocene Re-wilding

 

This species is one of a number which have been included in various “Pleistocene rewilding” plans. Pleistocene rewilding is the proposed practice of restoring ecosystems to their state in the Pleistocene, roughly 10,000 years ago. This contrasts the standard conservation benchmark, particularly in North America, of restoring ecosystems to their pre-Columbian or pre-industrial state. In both Eurasia and North America, the Pleistocene was characterized by much greater diversity and numbers of large herbivores and predators, including proboscidians, equids, camelids, and felidae (Donlan et al 2006; Zimov 2005). The process of restoration would involve the reintroduction of extant species in their historic range, as well as the introduction of ‘proxy organisms’ to replace the ecological functionality of extinct organisms (Donlan et al 2006). 

There are three central theoretical goals to Pleistocene rewilding. In Siberia, a team led by Sergey Zimov is investigating the role of large herbivores as ecosystem engineers. It is thought that herbivory pressure could play a central role in maintaining a grass-dominated plant community, as opposed to either tree- or moss-dominated. Grasslands are known to be more stable carbon sinks than either mossy or forested tundra, due to the rapidity of their biogeochemical cycling (Zimov 2005). In principle, then, reintroducing Pleistocene fauna could have positive climate change mitigation effects. Proposals in North America have focused instead on the preservation of ecological dynamics. Proponents of Pleistocene rewilding argue that due to the strong ecological interactions of megafauna, it is likely that their extinction at the end of the Pleistocene would have caused cascading ecological disruptions lasting until the present time (Donlan et al 2006). Additionally, introduction programs could provide a new lease on life for extant, endangered megafauna species, such as cheetahs and Asian elephants (Rubenstein 2006). 

Pleistocene rewilding, while headline-grabbing, is by no means the standard of modern conservation biology. There are a number of objections to the proposals of Pleistocene rewilders, summarized by Rubenstein et al (2006). The introduction of species which have been locally extinct for thousands of years, and more particularly the introduction of modern relatives of extinct species, carries many risks: the potential for invasive species, catastrophic disruption of existing ecosystems, inadvertent introduction of disease organisms, and unpredictable behavior of introduced species. Additionally, while paleoecology is a growing field, there is still a fair amount of uncertainty about the actual ecosystem functions of the Pleistocene.

Species which Zimov and his colleagues in Siberia are experimenting with bison, musk oxen, Przewalski’s horse, and Siberian tigers (Zimov 2005). Small-scale introductions have already begun in Yakutia. Donlan et al propose introducing Przewalski’s horse, Bolson tortoises, Bactrian camels, cheetahs, lions, and elephants into the Western United States (Donlan et al 2005). While some individuals of these species are present on privately owned land, there are no free-living populations in North America at this time. 

  • Donlan, CJ. 2005. Re-Wilding North America. Nature 436:913-914.
  • Donlan CJ, Berger J, Bock CE, Bock JH, Burney DA, Estes JA, Foreman D, Martin PS, Roemer GW, Smith FA, Soule ME, Greene HW. 2005. Pleistocene Rewilding: An Optimistic Agenda for Twenty-First Century Conservation. The American Naturalist 168:660-681.
  • Rubenstein DR, Rubenstein DI, Sherman PW, Gavin TA. 2006. Pleistocene Park: Does Rewilding North America Represent Sound Conservation for the 21st Century? Biological Conservation 132:232-238.
  • Zimov, SA. 2005. Pleistocene Park: Return of the Mammoth’s Ecosystem. Science 308:796-798.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 2 people

Average rating: 2.14286 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse affects of O. moschatus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

One of the arctic adaptations of muskoxen is the winter coat of underwool, called qiviut (pronounced "kiv-ee-Ute"). Qiviut is an Alaskan native word that has adapted many spellings. The wool is finer than cashmere and eight times warmer than wool. When collected from the few domestic muskox herds, it can be bought by companies or individuals to make garments, and can be sold raw. The rarity of the fiber and the garments makes it very valuable. Managers of 'domesticated' herds supply qiviut to companies and co-operations for use in making garments. A main producer of these garments is the Musk Ox Producer's Co-Operative.

Research is also performed at the Large Animal Research Station at the University of Alaska Fairbanks on nutrition and arctic adaptations which can be applied to wildlife conservation, biology, and many other aspects. LARS has a captive herd of approximately 40 muskoxen.

In some areas, including Alaska, current laws allow hunting if the hunter is selected through a periodic lottery system, though laws vary across locations and countries. There are domestic herds of muskoxen that can be used for meat, though the qiviut of the animal is much more valuable and continually produced.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Muskox

The muskox (Ovibos moschatus, also spelled musk ox and musk-ox) is an Arctic mammal of the family Bovidae, noted for its thick coat and for the strong odor emitted during the seasonal rut by males, from which its name derives. This musky odor is used to attract females during mating season. Muskoxen primarily live in the Canadian Arctic and Greenland,[2] with small introduced populations in Sweden, Siberia, Norway, and Alaska.

Evolution[edit]

Modern relatives[edit]

As members of the subfamily Caprinae of the family Bovidae, muskoxen are more closely related to sheep and goats than to oxen; however, they are placed in their own genus, Ovibos (Latin: "sheep-ox"). The muskox is one of the two largest extant members of Caprinae; along with the similarly sized takin.[3] While takin and muskox were once considered possibly related, the takin lacks common ovibonine features, such as the muskox's specialized horn morphology, and genetic analysis shows that their lineages actually separated early in caprine evolution. Instead, the muskox's closest living relatives appear to be the gorals of the genus Naemorhedus, nowadays common in many countries of central and east Asia. The vague similarity between takin and muskox must therefore be considered an example of convergent evolution.[4]

Fossil history and relatives[edit]

Euceratherium skeleton.

The modern muskox is the last member of a line of ovibovines that first evolved in temperate regions of Asia and adapted to a cold tundra environment late in its evolutionary history. Muskoxen ancestors with sheep-like high-positioned horns (horn cores being mostly over the plane of the frontal bones, rather than below them as in modern muskoxen) first left the temperate forests for the developing grasslands of Central Asia during the Pliocene, expanding into Siberia and the rest of northern Eurasia. Later migration waves of Asian ungulates that included high-horned muskoxen reached Europe and North America during the first half of the Pleistocene. The first well known muskox, the "shrub-ox" Euceratherium, crossed to North America over an early version of the Bering Land Bridge two million years ago and prospered in the American southwest and Mexico. Euceratherium was larger yet more lightly built than modern muskoxen, looking like a giant sheep with massive horns, and preferred hilly grasslands.

A genus with intermediate horns, Soergelia, inhabited Eurasia in the early Pleistocene, from Spain to Siberia, and crossed to North America during the Irvingtonian (1.8 million years to 240,000 years ago), soon after Euceratherium. Unlike Euceratherium, which survived in America down to the Pleistocene-Holocene extinction event, Soergelia was a lowland dweller that disappeared fairly early, displaced by more advanced ungulates, such as the "giant muskox" Praeovibos (literally "before Ovibos"). The low-horned Praeovibos was present in Europe and the Mediterranean 1.5 million years ago, colonized Alaska and the Yukon one million years ago and disappeared half a million years ago. Praeovibos was a highly adaptable animal that appears associated with cold tundra (reindeer) and temperate woodland (red deer) faunas alike. During the Mindel glaciation 500,000 years ago, Praeovibos was present in the Kolyma river area in eastern Siberia in association with many Ice Age megafauna that would later coexist with Ovibos, in the Kolyma itself and elsewhere, including wild horses, reindeer, woolly mammoth and stag-moose. It is debated, however, if Praeovibos was directly ancestral to Ovibos, or both genera descended from a common ancestor, since the two occurred together during the middle Pleistocene. Defenders of ancestry from Praeovibos have proposed that Praeovibos evolved into Ovibos in one region during a period of isolation and expanded later, replacing the remaining populations of Praeovibos.[4]

Bootherium skull.

Two more Praeovibos-like genera were named in America in the 19th century, Bootherium and Symbos, which are now identified as the male and female forms of a single, sexually dimorphic species, the "woodland muskox", Bootherium bombifrons. Bootherium inhabited open woodland areas of North America during the late Pleistocene, from Alaska to Texas and maybe even Mexico, but was most common in the Southern United States, while Ovibos replaced it in the tundra-steppe to the north, immediately south of the Laurentian ice sheet.[4][5]

Modern Ovibos appeared in Germany almost one million years ago and was common in the region through the Pleistocene. By the Mindel, muskoxen had also reached the British Isles. Both Germany and Britain were just south of the Barents-Kara Ice Sheet and covered in tundra during cold periods, but Pleistocene muskoxen are also rarely recorded in more benign and wooded areas to the south like France and Green Spain, where they coexisted with temperate ungulates like red deer and aurochs. Likewise, the muskox is known to have survived in Britain during warm interglacial periods.[4]

Today's muskoxen are descended from others believed to have migrated from Siberia to North America between 200,000[6] and 90,000 years ago,[7] having previously occupied Alaska (at the time united to Siberia and isolated periodically from the rest of North America by the union of the Laurentide and Cordilleran Ice Sheets during colder periods) between 250,000 and 150,000 years ago. After migrating south during one of the warmer periods of the Illinoian glaciation, non-Alaskan American muskoxen would be isolated from the rest in the colder periods. The muskox was already present in its current stronghold of Banks Island 34,000 years ago, but the existence of other ice-free areas in the Canadian Arctic Archipelago at the time is disputed.[4]

Along with the bison and the pronghorn,[8] the muskox was one of a few species of Pleistocene megafauna in North America to survive the Pleistocene/Holocene extinction event and live to the present day.[9] The muskox is thought to have been able to survive the Last glacial period by finding ice-free areas (refugia) away from prehistoric peoples.[7]

Fossil DNA evidence suggests that muskoxen were not only more geographically widespread during the Pleistocene, but also more genetically diverse.[10] During that time, other populations of muskoxen lived across the Arctic, from the Ural Mountains to Greenland. By contrast, the current genetic makeup of the species is more homogenous. Climate fluctuation may have affected this shift in genetic diversity: research indicates colder periods in Earth's history are correlated with more diversity, and warmer periods with more homogeneity.[9]

Physical characteristics[edit]

This skull, in the collection of The Children's Museum of Indianapolis, displays the muskox's large horns.

Both male and female muskoxen have long, curved horns. Muskoxen stand 1.1 to 1.5 m (4 to 5 ft) high at the shoulder, with females measuring 135 to 200 cm (4.4 to 6.6 ft) in length, and the larger males 200 to 250 cm (6.6 to 8.2 ft). The small tail, often concealed under a layer of fur, measures only 10 cm (3.9 in) long. Adults, on average, weigh 285 kg (630 lb) and range from 180 to 410 kg (400 to 900 lb).[3][11] The thick coat and large head suggests a larger animal than the muskox truly is; the bison, to which the muskox is often compared, can weigh up to twice as much.[12] However, heavy zoo-kept specimens have weighed up to 650 kg (1,400 lb).[13] Their coat, a mix of black, gray, and brown, includes long guard hairs that almost reach the ground. Rare "white muskoxen" have been spotted in the Queen Maud Gulf Bird Sanctuary.[14] Muskoxen are occasionally domesticated for wool, meat, and milk.[15][16] The wool, qiviut, is highly prized for its softness, length, and insulation value. Prices for yarn range between $40 and $80 per ounce (28 g).[17][18][19]

A muskox can reach speeds of up to 60 km/h (37 mph).[20] Their life expectancy is 12–20 years.

Range[edit]

Prehistory[edit]

During the Pleistocene period, muskoxen were much more widespread. Fossil evidence shows that they lived across the Siberian and North American Arctic, from the Urals to Greenland.[9] The ancestors of today's muskoxen came across the Bering Land Bridge to North America between 200,000[6] and 90,000 years ago.[7] During the Wisconsinan, modern muskox thrived in the tundra south of the Laurentide ice sheet, in what is now the Midwest, the Appalachians and Virginia, while distant relatives Bootherium and Euceratherium lived in the forests of the Southern United States and the western shrubland, respectively.[5] Though they were always less common than other Ice Age megafauna, muskox abundance peaked during the Würm II glaciation 20,000 years ago and declined afterwards, especially during the Pleistocene/Holocene extinction event, where its range was greatly reduced and only the populations in North America survived. The last known muskox population in Europe died out in Sweden 9,000 years ago,[4] and the last one in Asia, which lived on Siberia's Taymyr Peninsula, about 2,000 years ago.[10]

After the disappearance of the Laurentide ice sheet, the muskox gradually moved north across the Canadian Arctic Archipelago, arriving in Greenland from Ellesmere Island at about 350 AD, during the late Holocene. Their arrival in northwestern Greenland probably occurred within a few hundred years of the arrival of the Dorset and Thule cultures in the present-day Qaanaaq area. Human predation around Qaanaaq may have restricted muskoxen from moving down the west coast, and instead kept them confined to the northeastern fringes of the island.[21]

Recent native range in North America[edit]

Muskox family in east Greenland

In modern times, muskoxen were restricted to the Arctic areas of Canada, Greenland, and the United States. The Alaskan population was wiped out in the late 19th or early 20th century. Their depletion has been attributed to excessive hunting, but an adverse change in climate may have contributed.[15][22] However, muskoxen have since been reintroduced to Alaska. The United States Fish and Wildlife Service introduced muskox onto Nunivak Island in 1935 as a means for subsistence living.[23]

Introductions in Eurasia[edit]

The species has also been introduced from Banks Island to the Scandinavian Peninsula, in parts of Sweden, and the Dovre mountain range of Norway between 1947 and 1953. An introduction attempt in Svalbard, however, was unsuccessful.[24] They were also introduced in Iceland around 1930 but did not survive.[25]

In Russia, animals from Banks and Nunivak alike were imported and released in the Taymyr Peninsula between 1974 and 1975, and from Nunivak to Wrangel Island in 1975. Both locations are north of the Arctic Circle. Once established, these populations have been, in turn, used as sources for further introductions in Siberia between 1996 and 2010.[26] One of the last of such actions was the release of six animals within the "Pleistocene Park" project area in the Kolyma River in 2010, where a team of Russian scientists lead by Sergey Zimov aims to prove that muskoxen, along with other Pleistocene megafauna that survived into the early Holocene in northern Siberia,[27] did not disappear from the region due to climate change, but because of human hunting.[28]

Introductions in eastern Canada[edit]

Ancient muskox remains have never been found in eastern Canada, despite the ecological conditions in the northern Labrador Peninsula being suitable for them. In 1967, 14 animals were captured near Eureka, Ellesmere Island, and placed in a wool farm in Kuujjuaq, northern Quebec. Although the animals acclimatized and reproduced with no problem, the farm failed to make a profit. Subsequently, 54 animals from the farm were released in three locations of northern Quebec between 1973 and 1983, while the remaining were ceded to local zoos. Between 1983 and 1986, the released animals increased from 148 to 290, at a rate of 1.25 per year, and by 2003, an estimated 1400 muskoxen were in Quebec. Additionally, 112 adults and 25 calves were counted in the nearby Diana Island in 2005, having arrived there by their own means from the continent. Vagrant adults are sometimes spotted in the continental part of Newfoundland and Labrador, though no herds have been observed in the region.[29]

Ecology[edit]

During the summer, muskoxen live in wet areas, such as river valleys, moving to higher elevations in the winter to avoid deep snow. Muskoxen will eat grasses, arctic willows, woody plants, lichens, and mosses. When food is abundant, they prefer succulent and nutritious grasses in an area. Willows are the most commonly eaten plants in the winter. Muskoxen require a high threshold of fat reserves in order to conceive, which reflects their conservative breeding strategy. Winter ranges typically have shallow snow to reduce the energy costs of digging through snow to reach forage.[1] The primary predators of muskoxen are Arctic wolves, which may account for up to half of all mortality for the species. Other occasional predators, likely mainly predators of calves or infirm adults, can include grizzly bears and polar bears.[13]

Social behavior and reproduction[edit]

Nunivak Island, Alaskan muskoxen in the 1930s, shown here in defensive formation

Muskoxen live in herds of 12–24 in the winter and 8–20 in the summer.[30] They do not hold territories, but they do mark their trails with preorbital glands.[31] Male and female muskoxen both have separate age-based hierarchies, with mature oxen being dominant over juveniles.[30] Dominant oxen tend to get access to the best resources[13] and will displace subordinates from patches of grass during the winter.[30] Muskoxen bulls assert their dominance in many different ways. One is a "rush and butt", in which a dominant bull rushes a subordinate from the side with its horns, and will warn the subordinate so it can have a chance to get away.[32] Bulls will also roar, swing their heads, and paw the ground.[13] Dominant bulls sometimes treat subordinate bulls like cows. A dominant bull will casually kick a subordinate with its foreleg, something they do to cows during mating.[33] Dominant bulls will also mock copulate subordinates and sniff their genitals.[33] A subordinate bull can change his status by charging a dominant bull.[34]

Muskox in Dovrefjell National Park, Norway

The mating (or "rutting") season of the muskoxen begins in late June or early July. During this time, dominant bulls will fight others out of the herds and establish harems of usually six or seven cows and their offspring. Fighting bulls will first rub their preorbital glands against their legs while bellowing loudly, and then display their horns.[34] The bulls then back up 20 meters, lower their heads, and charge into each other, and will keep doing so until one bull gives up.[32] Subordinate and elderly bulls will leave the herds to form bachelor groups or become solitary.[13] However, when danger is present, the outside bulls can return to the herd for protection.[35] Dominant bulls will prevent cows from leaving their harems.[13] During mating, a bull will casually kick an estrous cow with his foreleg to calm her down and make her more receptive to his advances.[33] The herds reassemble when summer ends.[35]

While the bulls are more aggressive during the rutting season and make the decisions in the groups, the females take charge during gestation.[13] Pregnant females are aggressive and decide what distance the herd travels in a day and where they will bed for the night.[36] The herds move more frequently when cows are lactating, to allow them to get enough food to nurse their offspring.[36] Cows have an eight- to nine-month gestation period, with calving occurring from April to June. Cows do not calve every year. When winters are severe, cows will not go into estrus and thus not calve the next year. When calving, cows stay in the herd for protection. Calves are able to keep up with the herd within just a few hours after birth. The calves are welcomed into the herd and nursed for the first two months.[13] After that, a calf then begins eating vegetation and nurses only occasionally. Cows communicate with their calves through braying. The calf’s bond with its mother weakens after two years.

Muskoxen have a distinctive defensive behavior: when the herd is threatened, the bulls and cows will face outward to form a stationary ring or semicircle around the calves.[37] The bulls are usually the front line for defense against predators with the cows and juveniles gathering close to them.[13] Bulls determine the defensive formation during rutting, while the cows decide the rest of the year.[35]

Conservation status[edit]

Historically, this species declined because of overhunting, but population recovery has taken place following enforcement of hunting regulations.[1] Management in the late 1900s was mostly conservative hunting quotas to foster recovery and recolonization from the historic declines.[1] The current world population of muskoxen is estimated at between 80,000[38] and 125,000,[23] with an estimated 68,788 living on Banks Island.[39]

In Greenland there are no major threats, although populations are often small in size and scattered, which makes them vulnerable to local fluctuations in climate. Most populations are within national parks, where they are protected from hunting.[1] Muskoxen occur in four of Greenland's protected areas, with indigenous populations in Northeast Greenland National Park, and three introduced populations in Arnangarnup Qoorua Nature Reserve, and Kangerlussuaq and Maniitsoq Caribou Reserves. Within these areas, muskoxen receive full protection.[1]

References[edit]

  1. ^ a b c d e f Gunn, A. & Forchhammer, M. (2008). Ovibos moschatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 31 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Animal Life in Greenland – an introduction by the tourist board. Greenland-guide.gl. Retrieved on 2011-09-15.
  3. ^ a b Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  4. ^ a b c d e f Peter C. Lent (1999). Muskoxen and Their Hunters: A History. University of Oklahoma Press. ISBN 978-0-8061-3170-2. Retrieved 2013-08-25. 
  5. ^ a b Wisconsinan Mammalian Faunas
  6. ^ a b Wildlife Management Advisory Council (North Slope) fact sheet. taiga.net.
  7. ^ a b c Hinterland Who's Who ISBN 0-660-13637-6
  8. ^ Smithsonian Institution. North American Mammals: Pronghorn Antilocapra americana
  9. ^ a b c Switek, Brian. "Prehistoric DNA Reveals the Story of a Pleistocene Survivor, the Muskox." Laelaps blog on Science Blogs, posted 10 Mar. 2010. Accessed 18 Jan. 2013.
  10. ^ a b "Muskox Suffered Loss Of Genetic Diversity At Pleistocene/Holocene Transition". Science Daily. 2005-10-06. Retrieved 2011-03-03. 
  11. ^ "Ellis, E. ''Ovibos moschatus''". Animaldiversity.ummz.umich.edu. Retrieved 2011-03-03. 
  12. ^ Muskox videos, photos and facts – Ovibos moschatus. ARKive. Retrieved on 2012-08-23.
  13. ^ a b c d e f g h i Lent, Peter C (1988). "Ovibos moschatus". Mammalian Species 302 (1–9). 
  14. ^ "Search for the Legendary White Musk-ox". Thelon.com. 2010-08-06. Retrieved 2011-03-03. 
  15. ^ a b Muskox. Alaska Department of Fish and Game
  16. ^ Paul F. Wilkinson (1974). The history of musk-ox domestication. Polar Record, 17, pp 13-22. doi:10.1017/S0032247400031302.
  17. ^ "The Qiviut Fiber and Yarn". Qiviut.com. Retrieved 2011-03-03. 
  18. ^ Large Animal Research Station.uaf.edu. Retrieved on 2012-08-23.
  19. ^ Muskox Wool – Qiviut (Kiv-ee-oot). alaskabeadstore.com. Retrieved on 2012-08-23.
  20. ^ http://www.moskussafari.no/en/musk_ox.htm
  21. ^ Bennike, Ole; Andreasen, Claus (2005). "New dates of musk-ox (Ovibos moschatus) remains from northwest Greenland". Polar Record 41 (2): 125. doi:10.1017/S0032247404004127. 
  22. ^ "The Incredible Journey". Nps.gov. 2010-12-28. Retrieved 2011-03-03. 
  23. ^ a b "Muskox, (Ovibos moschatus) US Fish & Wildlife Service". Fws.gov. Retrieved 2011-03-03. 
  24. ^ Aulagnier, S. et al. (2008) Guide des mammifères d'Europe, d'Afrique du Nord et de Moyen-Orient. Delachaux et Niestlé, Paris
  25. ^ Zabrodin, V.A., and G.D. Yakushkin. "Chapter 10: Musk-Oxen." From Animal Genetic Resources of the USSR, edited by N.G Dmitriev and L.K Ernst. Rome: FAO, 1989.
  26. ^ http://www.lhnet.org/reintroduction-of-musk-ox-in-the-northern-russia/
  27. ^ http://www.rhinoresourcecenter.com/pdf_files/131/1312936307.pdf
  28. ^ http://news.nationalgeographic.com/news/2005/05/0517_050517_pleistocene.html
  29. ^ http://www.canadianfieldnaturalist.ca/index.php/cfn/article/view/398/398
  30. ^ a b c Tener, J. S. (1965). Muskoxen in Canada a biological and taxonomic review. Ottawa: Queen's Printer.
  31. ^ Owen-Smith, N. (1977). "On Territoriality in Ungulates and an Evolutionary Model". The Quarterly Review of Biology 52 (1): 1–38. doi:10.1086/409720. 
  32. ^ a b Wilkinson, P. F., Shank, C. C. (1976). "Rutting-fight Mortality among Musk Oxen on Banks Island, Northwest Territories, Canada". Animal Behavior 24 (4): 756–758. doi:10.1016/S0003-3472(76)80004-8. 
  33. ^ a b c Reinhardt, V. (2005). "Courtship behavior among musk-ox males kept in confinement". Zoo Biology 4 (3): 295–300. doi:10.1002/zoo.1430040311. 
  34. ^ a b Gray, D. R. (1986). "Standing his ground: How the muskox survives the rigours of an Arctic winter". Nature Canada 15: 19–26. 
  35. ^ a b c Freeman, M. (1971). "Population Characteristics of Musk-Oxen in the Jones Sound Region of the Northwest Territories". Journal of Wildlife Management 35 (1): 103–108. doi:10.2307/3799877. 
  36. ^ a b Jingfors, K. (1982). "Seasonal Activity Budgets and Movements of a Reintroduced Alaskan Muskox Herd". Journal of Wildlife Management 46 (1): 344–359. doi:10.2307/3808645. 
  37. ^ Miller, F. G., Anne. (1980). "Behavioral Reesponses of Musk Ox to Simulation of Cargo Slinging by Helicopter, Northwest Territories". The Canadian field naturalist 94 (1). 
  38. ^ "Robert G. White Large Animal Research Station, University of Alaska". Alaska.edu. 1963-10-12. Retrieved 2011-03-03. 
  39. ^ "Annual Report of Research and Monitoring in National Parks of the Western Arctic 2003, Parks Canada". Pc.gc.ca. 2009-04-15. Retrieved 2011-03-03. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Groves (1997) examined mtDNA variation and found low levels of variability and no support for the recognition of the two nominal subspecies.

See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species. See A91KRA03NA for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!