Articles on this page are available in 1 other language: Spanish (4) (learn more)

Overview

Brief Summary

Description

Caribou, or Reindeer, is the only deer species in which both males and females have candelabra-like antlers. They live in large, migratory herds along the tree line of northern forests, eating mostly grass-like plants and shrubs in summer, and lichen, which carpets the snow-covered forests, in the winter. Getting at winter feed by digging through the snow can lead to intense competition, which may explain why females also carry antlers. During the breeding season, males compete with one another for access to females, using their antlers in jousting matches. They become completely devoted to the rituals of mating, failing even to eat, and losing their built up energy reserves in the process. Females give birth at traditional calving grounds on the open tundra during the spring, after a gestation of seven months. Then they pour all of their energy reserves into nursing their calves for a month. There are more than 2,000,000 Caribou in North America, but they are less successful in the southern parts of their range where they must cope with humans and other predators.

Links:
Mammal Species of the World
Visit ARKive for more images of the Peary caribou  More images, video and sound of the Peary caribou, a subspecies
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:67, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

The reindeer has a circumpolar distribution in the tundra and taiga zones of northern Europe, Siberia, and North America (Corbet 1978, Hall 1981, Koubek and Zima 1999, Wilson and Ruff 1999). In North America, the range formerly extended as far south as central Idaho, the Great Lakes area, and northern New England - however, wild populations currently remain only in Alaska, Canada, Washington, and northern Idaho. In Europe, wild populations have a fragmented distribution in Norway (including the island of Svalbard, where there is a separate subspecies R. t. platyrhynchus), Finland, and Russia (including the island of Novaya Zemlya, which also has an endemic subspecies R. t. pearsoni) (Herre 1986, Koubek and Zima 1999). In Finland, wild reindeer occur in two isolated subpopulations, one in the west and one in the east. Semi-domesticated reindeer are widespread in Lappland, and a feral population has historically become established on Iceland (Koubek and Zima 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Caribou have a nearly circumpolar distribution. The woodland subspecies of caribou (Rangifer tarandus caribou) can be found as far south as 46o north latitude, while other subspecies (Peary caribou [R. t. pearyi] and Svalbard reindeer [R. t. platyrhynchus]) can be found as far north as 80o north latitude. Once found as far south as Germany, Great Britain, Poland, and Maine (USA), over-hunting and habitat destruction have diminished the historic range of caribou.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Circumboreal in tundra and taiga. The range formerly extended as far south as central Idaho, the Great Lakes area, and northern New England in North America and into central Germany in Europe. North America: wild populations currently extant in Alaska, Canada, Washington, and northern Idaho. Reintroduced from Newfoundland to Maine in 1986. Introduced and feral in Iceland, Kerguelen Islands, South Georgia Island, Pribilof Islands, St. Matthew Island; extirpated in Sweden (Grubb, in Wilson and Reeder 1993, 2005). See Bernard and Horn (1989) for summary of introductions in eastern North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The various subspecies of caribou display a wide range of size. Generally speaking, the subspecies inhabiting the more southerly latitudes are larger than their northern cousins. Caribou can have shoulder heights of up to 120 cm and total length ranges from 150 to 230 cm. They have short tails. There is marked sexual dimorphism, with males of some subspecies being twice as large as females. The coat of the caribou is an excellent, lightweight insulation against the extreme cold temperatures they face. The hairs are hollow and taper sharply which helps trap heat close to the body and also makes them more buoyant. Color varies by subspecies, region, sex, and season from the very dark browns of woodland caribou bulls in summer to nearly white in Greenland (R. t. groenlandicus) and high Arctic caribou. White areas are often present on the belly, neck, and above the hooves. The hooves are large and concave, which support them in snow and soft tundra, conditions that they often face. The broad hooves are also useful when swimming. Caribou make an audible clicking noise while walking, which is produced from tendons rubbing across a bone in the foot. Rangifer tarandus is the only species of deer in which both sexes have antlers. Mature bulls can carry enormous and complex antlers, whereas cows and young animals generally have smaller and simpler ones. Mature bulls usually shed their antlers shortly after the rut whereas cows can keep theirs until spring.

Range mass: 55 to 318 kg.

Range length: 150 to 230 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 119.66 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 210 cm

Weight: 270000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 1.8 m males; 1.7 m females
Range: 1.6-2.1 m males; 1.4-1.9 m females

Weight:
Average: 110 kg males; 81 kg females
Range: 81-153 kg males; 63-94 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits arctic (including tussock tundra and sedge meadow) and subarctic tundra, open montane habitats, and open woodland, often on high mountain slopes and in alpine zones at elevations of 2,300-3,000 meters, where it feeds on lichens, mosses herbs, ferns, grasses, and shoots and leaves of deciduous shrubs and trees (especially willow--Salix spp.--and birch--Betula spp.).

A social deer, this species forms large regional herds of 50,000-500,000 animals which band together during the spring, although this herd is composed of generally single-sex subgroups with 10-1,000 individuals. Rutting takes place about October. Young are born in May and June after a gestation of about 228 days. One or two young are born; they wean at about 6 months; reach maturity at 2.5-3.5 years; and live up to 20 years. Thick fur and short tail are adaptations to extreme cold winters. Its ability to smell and find lichens and other food under snow is a special adaptation. The major predators are bears and wolves.

A highly nomadic species, caribou may travel 5,000 km/3,000 miles in a year, the longest documented movements of any terrestrial mammal. In addition, most populations undertake extensive migrations in the spring and fall, travelling. During these migrations, herds move at a rate of 19-55 kilometers/11-33 miles per day. The caribou's maximum running speed is 60-80 kmph/36-48 mph. Caribou are excellent swimmers, and will readily cross large rivers or lakes. When swimming, adults can maintain a speed of 6.5 kpmh / 4 mph, and when pressed can swim at 10 kmph / 6 mph. Population densities are very sparse - generally 0.5 animals per square kilometre of suitable habitat. However, during the migration period, concentrations may exceed 19,000 animals per square kilometre. In North America it is a migratory species, making seasonal movements from the coast in summer to the interior in winter, but in Europe reindeer are more sedentary (Herre 1986; Vevers and Pinner, 1948). The species migrates seasonally in Mongolia, but not over long distances (Litvinov and Bazardorj, 1992).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Caribou inhabit arctic tundra and subarctic (boreal) forest regions.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Artic tundra (including tussock tundra and sedge meadow), subartic taiga, mature coniferous forest, semi-open and open bogs, rocky ridges with jack pine, and riparian zone. Migratory herds in Alaska, Yukon, and Northwest Territories winter in boreal forest, summer in tundra.

In northern British Columbia, seeks high south slopes in mountains as calving site (Bergerud et al. 1984). Porcupine Herd of northeastern Alaska and northwestern Yukon: females give birth on patches of bare ground within snowfields (Eastland et al. 1989); cows select areas north of the foothills (snow conditions permitting), thereby reducing exposure of calves to predators.

In winter in northeastern Alberta, woodland caribou selected forested fen peatland complexes; feeding activity was concentrated in forested raised bog islands, which may have been related to increased lichen biomass in these habitats (Bradshaw et al. 1995). "Mountain" caribou of southeastern British Columbia depend upon the arboreal lichens of older coniferous forests with high canopy closure, especially in late winter (Apps et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In areas where still ranges freely, may form herds and migrate seasonally. Tundra populations may migrate 800 miles between summer and winter ranges; other popualtions make seasonal elevational migrations. In northern Alaska, winters in northern foothills of Brooks Range, females reach calving areas along coastal plain by mid-May; population highly aggregated near arctic coast and river deltas in July (Carruthers et al. 1987); begin return migration to winter range in September-October; cows annually may travel over 5000 km (Fancy et al. 1989). Heard and Williams (1992) described the migration in the Northwest Territories, Yukon, and Alaska as follows: cows begin migration to tundra in March-April, reach calving grounds in time for early June parturition; adult males migrate later but most reach tundra by June; return to tree line by early September, may not enter forest until October. Did not migrate in southeastern Manitoba (Darby and Pruitt 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Caribou are primarily grazing herbivores. Their diet is most variable during the summer, when they consume the leaves of willows and birches, mushrooms, cotton grass, sedges and numerous other ground dwelling species of vegetation. Lichens are an important component of the diet, especially in winter, but are not eaten exclusively.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; bryophytes; lichens

Other Foods: fungus

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats various plants: leaves, buds and bark of trees and shrubs; grasses; sedges; forbs; mushrooms; terrestrial and arboreal lichens. In summer moves to new areas to find new plant growth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Through their foraging activities, caribou have a dramatic impact on communities of vegetation throughout their range. They are also important prey species for large predators, such as bears and wolves, especially during the calving season.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Calves are highly vulnerable to predation by bears, wolves, and other predators during their first week of life. Healthy adult caribou are less susceptible to predation until old age and illness weakens them. By traveling in herds, caribou increase the number of individuals that can watch for predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Rangifer tarandus is prey of:
Haliaeetus albicilla
Ursus arctos
Ursus americanus
Canis lupus

Based on studies in:
Russia (Tundra)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Rangifer tarandus preys on:
phanerogams
lichens
Bryophyta
willows
sedges
grasses
tundra vegetation
fungi

Based on studies in:
Norway: Spitsbergen (Agricultural)
USA: Alaska (Tundra)
Russia (Tundra)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
adult of Lipoptena cervi ectoparasitises Rangifer tarandus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious; in tundra, usually in bands of 10-50 or loose herds of about 1,000. Sexes may segregate seasonally. May form herds after fawning (not in southeastern Manitoba). Tundra caribou may travel extensively in summer in attempt to avoid bothersome insects (Fancy et al. 1989).

Often incurs high calf loss, mostly due to predation (Bergerud et al. 1984). In south-central Alaska, Bergerud and Ballard (1988) concluded that wolf predation limited caribou recruitment, though winter starvation was proposed as the important population control by another researcher.

In northeastern Alaska and adjacent Canada, first-year survival of calves was 51%; mean annual survival rate was 84% for adult females and 83% for adult males; hunting mortality for the herd averaged 2-3% annually (Fancy et al. 1994).

In Quebec, home range size of adult females averaged 148 sq km and did not vary seasonally or annually (Ouellet et al. 1996).

White-tailed deer carry and disperse into the environment meningeal worms that usually are fatal to moose and caribou but are clinically benign in deer; hence, white-tailed deer, through worm-mediated impacts, commonly are believed to exclude moose and caribou from areas where deer occur (see Schmitz and Nudds 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Caribou communicate among themselves through vocal, visual, chemical, and tactile cues. They have a keen sense of smell, which allows them to find food buried deep under snow.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Primarily diurnal, feeding crepuscularly.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Females generally have longer life spans than males, some over 15 years. Bulls are highly susceptible to predation after the rut, which can leave them injured and/or exhausted. Bulls typically live less than 10 years in the wild. Average life expectancy is 4.5 years.

Average lifespan

Status: wild:
10 to 15 years.

Average lifespan

Status: wild:
4.5 years.

Average lifespan

Sex: male

Status: wild:
8.0 years.

Average lifespan

Sex: female

Status: wild:
10.0 years.

Average lifespan

Status: wild:
15.0 years.

Average lifespan

Status: captivity:
20.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.7 years (captivity) Observations: A gradual ageing process has been documented in this species (Weladji et al. 2002). One captive specimen lived 21.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males compete for access to females during the fall rut, which occurs in October and early November. During this time males may engage in battles that leave them injured and exhausted. Dominant males restrict access to small groups of 5 to 15 females. Males stop feeding during this time and lose much of their body reserves.

Mating System: polygynous

In late August and September, prime bulls shed the velvet that surrounds their antlers. Sparring begins shortly there after, with the rut typically occurring in October. Females can be sexually mature as early as 16 months of age but more commonly at 28 months. With good nutrition females give birth to calves each year, but may skip years in poor ranges. A single calf, weighing 3 to 12 kg, is born approximately 228 days after impregnation, in May or June. Twinning has been reported, but is very rare. The suckling period rarely last past the first week of July and grazing commences shortly after birth. Calves rely mainly on foraging for nutrition after 45 days old.

Breeding interval: Caribou breed once yearly.

Breeding season: Breeding typically occurs in October.

Range number of offspring: 2 (high) .

Average number of offspring: 1.

Average gestation period: 7.6 months.

Average weaning age: 1.5 months.

Range age at sexual or reproductive maturity (female): 16 (low) months.

Average age at sexual or reproductive maturity (female): 28 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 6500 g.

Average gestation period: 228 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
680 days.

Newborn calves are precocial, being able to suckle minutes after birth, follow their mother after an hour and are capable of outrunning a human at one day of age. Calves nurse exclusively for their first month, after which they begin to graze. They will continue to nurse occasionally through early fall, when they become independent.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds mostly in October. Gestation lasts about 227-230 days. Cows bear usually 1, sometimes 2, young in May and June (early June in northern British Columbia). Calves precocious. Adult females sometimes skip reproduction for a year, in response to nutritional stress (Cameron, 1994, J. Mamm. 75:10-13). In northeastern Alaska and adjacent Canada, 80% of adult females (age 3 years or older) gave birth each year (Fancy et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Panting cools blood: reindeer
 

The tongue of the reindeer or caribou cools blood heading to the brain under duress by being high vascularized.

     
  "The reindeer (Rangifer tarandus) is an Arctic animal that has adapted to annual changes of 80°C in ambient temperature by growing a fur of excellent insulation value in the autumn to be shed in the following spring. That together with a reduction of surface temperature caused by vascular changes (Johnsen et al., 1985b) and an efficient nasal heat exchange mechanism (Blix and Johnsen, 1983) result in a 30°C reduction in lower critical temperature from summer to winter (Nilssen et al., 1984a). The animal, so equipped to withstand cold, consequently has few avenues of heat loss in winter and runs the risk of hyperthermia during exercise when metabolic heat production rises rapidly with running speed (Nilssen et al., 1984b)...We have observed that moderately heat-stressed reindeer pant, first with the mouth closed, but, under severe heat stress, they resort to open-mouth panting (OMP) to dissipate heat from their big and richly vascularized tongue...We propose that reindeer regulate body and, particularly, brain temperature under heavy heat loads by a combination of panting, at first through the nose, but later, when the heat load and the minute volume requirements increase due to exercise, primarily through the mouth and that they eventually resort to selective brain cooling." (Blix et al. 2011:3850,3855)
  Learn more about this functional adaptation.
  • Blix AS; Walløe L; Folkow LP. 2011. Regulation of brain temperature in winter-acclimatized reindeer under heat stress. Journal of Experimental Biology. 214: 3850-3856.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Dense underfur insulates: reindeer
 

The coat of a reindeer insulates against polar cold via dense underfur.

   
  "Naturally, animals that live in polar regions have the warmest coats of all. The reindeer's coat combines long, water-repelling guard hairs with an extremely dense underfur, deep-piled like a shag carpet." (Foy and Oxford Scientific Films 1982:84)


"The winter fur of adult reindeer consisted of thick guard hairs with air-filled cavities and an underfur of thin and woolen hairs...The density of guard hairs varied considerably and averaged 2000/cm2 and 12 mm on the legs, 1000/cm2 and 30 mm on the abdomen, and 1700/cm2 and 30 mm on the back. The corresponding count on the back of calves was 3200/cm2 and 10 mm...All hairs were wool-like and hollow...The thick underfur is very important, since it effectively prevents air movement within it and thus reduces heat dissipation...[T]he results suggest that the prime mechanism by which adult reindeer thermoregulate in a cold environment is insulation." (Soppela et al. 1986:275, 277)

  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
  • Soppela P; Nieminen M; Timisjàrvi J. 1986. Thermoregulation in reindeer. Rangifer. 1: 273-278.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Guard hairs repel water: reindeer
 

The coat of reindeer repels water via long guard hairs.

   
  "Naturally, animals that live in polar regions have the warmest coats of all. The reindeer's coat combines long, water-repelling guard hairs with an extremely dense underfur, deep-piled like a shag carpet." (Foy and Oxford Scientific Films 1982:84)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physiology

Seasonally breeding mammals typically use the annual change in the photoperiod cycle (light-darkness ratio) to drive rhythmic daily melatonin signals from the pineal gland, providing a critical cue to time seasonal reproduction. The daily light cycle resets the animal's internal clock (circadian clock) roughly every 24 hours, keeping it synchronized with the environment. Production of melatonin and other hormones rises and falls with this daily cycle, regulated by the internal clock. At high latitudes, however, where there is continuous light or continuous darkness for months at a time, no photoperiod information is available for much of the year. Lu et al. (2010) studied two circadian clock genes in fibroblast cells of Arctic Reindeer and found they did not turn on and off on a daily cycle, as in most other animals that have been studied. However, melatonin production responded strongly to light and darkness (dropping in the light and rising in the dark), regardless of the activity of the circadian clock genes being monitored. Lu et al. suggest that in the Arctic environment, where a 24 hour cycle has little meaning, natural selection has reduced or eliminated the circadian clock in Reindeer (and perhaps other Arctic animals). Instead, they speculate, informative melatonin signals associated with the spring and fall equinoxes (when daily light cycles are available) may directly entrain a ‘‘circannual clock’’ [24, 29] that may not involve circadian mechanisms. (Lu et al. 2010) This phenomenon must be investigated in other Arctic animals, and using other genes in Reindeer, but these data suggest that, as might be expected, time-keeping in the far north may be quite different than at lower latitudes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rangifer tarandus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0660-06|NC_007703|Rangifer tarandus| AACCGCTGATTATTTTCAACTAATCACAAAGACATTGGCACCTTGTATTTACTATTTGGTGCTTGAGCAGGCATAGTAGGAACTGCCCTA---AGCTTACTAATCCGTGCTGAACTGGGCCAACCTGGGACCCTACTCGGAGAC---GATCAAATTTATAATGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGACTTGTCCCTCTAATA---ATTGGTGCCCCAGATATAGCATTCCCTCGGATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCTTTTCTACTTCTTCTAGCATCATCCATAATTGAAGCTGGAACAGGAACAGGTTGAACTGTTTACCCTCCTTTAGCTGGTAACCTAGCTCACGCAGGAGCTTCAGTAGACTTA---ACTATTTTCTCTTTACACTTAGCAGGTGTCTCCTCAATTTTAGGGGCAATTAACTTTATCACAACAATTATTAATATAAAACCTCCTGCTATATCACAGTATCAAACCCCTTTATTTGTATGATCTGTCTTAATCACTGCTGTATTATTACTTCTCTCACTTCCTGTACTAGCAGCC---GGAATTACAATACTACTAACAGACCGAAATTTAAATACAACTTTCTTCGACCCAGCAGGAGGCGGGGATCCCATCCTATATCAACATTTATTCTGATTCTTTGGACACCCTGAAGTTTATATTCTTATTTTACCTGGATTTGGTATAATCTCCCACATTGTAACCTACTACTCGGGAAAAAAA---GAACCATTTGGGTACATAGGAATAGTCTGAGCCATAATATCAATTGGATTTTTAGGATTTATTGTATGAGCCCACCATATATTTACAGTTGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rangifer tarandus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 133
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Henttonen, H. & Tikhonov, A.

Reviewer/s
Black, P., González, S. (Deer Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern due to a wide circumpolar distribution and presumed large populations.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although Alaska, with its more than 30 herds, has nearly double the number of caribou (1,000,000) than people, caribou in the contiguous US are considered endangered. Caribou in Alaska are of the barren-ground subspecies, whereas extant (WA, ID) and extinct (ME) herds are of the woodland subspecies. The Selkirk Herd, inhabiting WA, ID, and southern British Columbia numbers only around 30 members. They are listed as Endangered under the Endangered Species Act in these regions. Loss of habitat, overhunting, and other factors has contributed to the precarious position the woodland caribou now exists in the US. Worldwide, the caribou population is estimated to be around 5 million. The largest herds now occur in Alaska, Canada, and Russia. Humans have heavily hunted this species. They have been extinct in most parts of Europe since at least the 1600s. Exploration for oil and minerals in Canada may threaten woodland caribou habitat. High Arctic caribou populations are also thought to be vulnerable.

Despite their status in the wild, domestic herds of reindeer flourish in the Old World, in Canada, in Alaska, and in the lower 48 states including Michigan.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The Peary caribou or reindeer, Rangifer tarandus pearyi, is an Endangered subspecies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are large numbers of reindeer (locally known as caribou) in North America.

There are approximately 30,000 wild reindeer in southern Norway and 10,000 in Svalbard (Andersen and Hustad 2004). The population trend in Norway is believed to be stable, and hunting is controlled. In Finland, forest reindeer (subspecies R. t. fennicus) were driven extinct in the early 1900s, but are now starting to recover as a result of animals moving in from Karelia in Russia and from some captive bred stock that were released (Ruusila and Kojola in press). Forest Reindeer remain very rare in Finland (about 1,200 in the eastern subpopulation and 1,000 individuals in the western subpopulation).

The Finnish population trend is difficult to determine, as the population in eastern Finland has expanded rapidly from c. 40 reintroduced individuals in 1980 to c.1,200 today, whereas the western subpopulation has declined from c.1,800 to c.1,000 during 2001-2006 (although in the last few years prior to 2001 it had been increasing) (H. Henttonen pers. comm. 2006, Ruusila and Kojola in press). Overall, the current Finnish population trend is one of growth rather than decline. Numbers in European Russia are very low with presumed ongoing declines, and the reindeer is now absent from large tracts of tundra and taiga. It is not known whether the small Kola Peninsula population in Russia is derived from autochthonous wild reindeer or from semi domesticated animals (A. Tikhonov pers. comm. 2006). The Novaya Zemlya subspecies pearsoni has a small population (less than 1,000 mature individuals), which is undergoing continuing decline (A. Tikhonov pers. comm. 2006). The reindeer's status in Asia is poorly known, although it is significantly more abundant there than in Europe, with a population estimated at 400,000 in the 1950s (Koubek and Zima 1999). There are also large numbers of reindeer (locally known as caribou) in North America. The feral population in Iceland numbers c.1000, and there are approximately 0.5 million semi-domesticated reindeer in Lappland (H. Henttonen pers. comm. 2006).

Numbers in European Russia are very low with presumed ongoing declines, and the reindeer is now absent from large tracts of tundra and taiga. It is not known whether the small Kola Peninsula population in Russia is derived from autochthonous wild reindeer or from semi domesticated animals (A. Tikhonov pers. comm. 2006). The Novaya Zemlya subspecies pearsoni has a small population (less than 1,000 mature individuals), which is undergoing continuing decline (A. Tikhonov pers. comm. 2006).

The reindeer's status in Asia is poorly known, although it is significantly more abundant there than in Europe, with a population estimated at 400,000 in the 1950s (Koubek and Zima 1999). Two separate populations of this species are present in Mongolia (Litvinov and Bazardorj, 1992). No robust data on population trends or abundance are currently available, although the total Mongolian population is believed to consist of fewer than 1,000 individuals.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 50-70%

Comments: Vors and Boyce (2009) gathered population data for 58 major caribou and reindeer herds throughout the global range and found that 34 were reported as declining, eight were increasing, and 16 had no data. The authors gathered 40 time series of population estimates for smaller herds within the major herd ranges. The time series spanned an average of 21.6 years and population estimates were available for an average of 9.9 years. Of these herds, 11 were in decline for fewer than 10 years, eight were in decline for 10-19 years, and six were in decline for more than 20 years. Mean percentage decline from known population maxima for these herds was 57 percent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The Porcupine caribou herd in northeastern Alaska and adjacent northwestern Canada and the adjacent Central Arctic herd are potentially threatened by onshore petroleum exploration and development; industrial development on the coastal plain of the Arctic National Wildlife Refuge could increase calf mortality if calving were displaced south and east of potential development areas (Fancy and Whitten 1991). However, Pollard et al. (1996) documented high use of oil fields by caribou during periods of high mosquito and fly activity.

Poaching is a major threat in the Russian Federation (A. Tikhonov pers. comm. 2006). The causes of decline of the Novaya Zemlya subspecies pearsoni are not known (A. Tikhonov pers. comm. 2006). Loss of habitat in Finland (through logging) may pose problems, and there is increased disturbance to the species in some areas due to winter sporting activities. Hybridisation with semi domesticated reindeer is a potential problem for some subspecies and subpopulations (H. Henttonen pers. comm. 2006, Ruusila and Kojola in press).

White-tailed deer carry and disperse into the environment meningeal worms that usually are fatal to moose and caribou but are clinically benign in deer; hence, white-tailed deer, through worm-mediated impacts, commonly are believed to exclude moose and caribou from areas where deer occur (see Schmitz and Nudds 1994). Predation by an expanding coyote population threatened a remnant caribou herd in southeastern Quebec (Crete and Desrosiers 1995). Long-term steady decline in the taiga-dwelling population in Ontario has been associated with the expansion of forest harvesting (Schaefer 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Recent global declines in caribou and reindeer populations appear to be associated with changes in phenology, spatiotemporal changes in species overlap (e.g., other ungulate species, predators, disease organisms), and increased frequency of extreme weather events (Vors and Boyce 2009).

The Porcupine caribou herd in northeastern Alaska and adjacent northwestern Canada and the adjacent Central Arctic herd are potentially threatened by onshore petroleum exploration and development; industrial development on the coastal plain of the Arctic National Wildlife Refuge could increase calf mortality if calving were displaced south and east of potential development areas (Fancy and Whitten 1991). However, Pollard et al. (1996) documented high use of oil fields by caribou during periods of high mosquito and fly activity.

Peary caribou (subspecies PEARYI), low arctic islands population: high winter mortality, low reproduction, and minimal recruitment, with additional pressure from hunting and disturbances associated with industrial activities (see 1991 COSEWIC report by F. L. Miller; also 1979 COSEWIC report by Gunn et al.).

Failed reintroductions often result when white-tailed deer are common; caribou probably contract meningeal worm disease from white-tailed deer (Bernard and Horn 1989).

Predation by an expanding coyote population threatened a remnant caribou herd in southeastern Quebec (Crete and Desrosiers 1995).

Long-term steady decline in the taiga-dwelling population in Ontario has been associated with the expansion of forest harvesting (Schaefer 2003). See also files for subspecies CARIBOU (woodland caribou).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on Appendix III of the Bern Convention. Subspecies R. t. fennicus is strictly protected under Annex II of the EU Habitats and Species Directive. In eastern parts of Russia there are strict anti-hunting measures in place, but there is continued poaching (A. Tikhonov pers. comm. 2006). Hunting in Norway is also strictly controlled. In Finland, a large fence has been constructed between areas occupied by semi domesticated reindeer and forest reindeer, to prevent hybridisation (Koubek and Zima 1999, H. Henttonen pers. comm. 2006). Research is urgently required to determine the causes of population decline of R. t. pearsoni on Novaya Zemlya, and to identify appropriate conservation actions.

In China the species is rare; only a few hundred animals remain there. Most of its habitat was burned in great fires in 1986. It is listed on the China Red List as Not Applicable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Based on genetic differences, translocations of caribou from the southern tier of arctic islands in Canada to arctic islands farther north would not be biologically sound (Miller, 1991 COSEWIC report).

Murphy and Curatolo (1987) recommended that elevated pipelines and heavily traveled roads be separated to minimize impact on caribou in northern Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative impacts of caribou.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Caribou have been used extensively for their meat, fur and antlers. Reindeer, the domesticated subspecies of caribou, have been herded throughout their range for thousands of years.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Reindeer

The reindeer (Rangifer tarandus), also known as the caribou in North America, is a deer from the Arctic and Subarctic, including both resident and migratory populations. While overall widespread and numerous,[1] some of its subspecies are rare and one (or two, depending on taxonomy) has already gone extinct.[2][3]

Reindeer vary considerably in color and size. Both sexes grow antlers, though they are typically larger in males. There are a few populations where females lack antlers completely.

Wild reindeer hunting and herding of semi-domesticated reindeer (for meat, hides, antlers, milk and transportation) are important to several Arctic and Subarctic people.[4] Even far outside its range, the reindeer is well known due to the myth, probably originating in early 19th century America, in which Santa Claus's sleigh is pulled by flying reindeer, a popular element of Christmas.[5] In Lapland, reindeer pull pulks.[6]

Contents

Distribution and habitat

Large male reindeer

The reindeer is a widespread and numerous species in the northern Holarctic, being present in both tundra and taiga (boreal forest).[7] Originally, the reindeer was found in Scandinavia, eastern Europe, Russia, Mongolia, and northern China north of the 50th latitude. In North America, it was found in Canada, Alaska (USA), and the northern conterminous USA from Washington to Maine. In the 19th century, it was apparently still present in southern Idaho.[1] It also occurred naturally on Sakhalin, Greenland, and probably even in historical times in Ireland. During the late Pleistocene era, reindeer were found as far south as Nevada and Tennessee in North America and Spain in Europe.[7][8] Today, wild reindeer have disappeared from many areas within this large historical range, especially from the southern parts, where it vanished almost everywhere. Large populations of wild reindeer are still found in Norway, Finland, Siberia, Greenland, Alaska, and Canada.

The George River reindeer herd in the tundra of Quebec and Labrador in eastern Canada, once numbered world’s largest 8-900,000 animals, stands December 2011 at 74,000 – a drop of up to 92% because of Iron-ore mining, flooding for hydro-power and road-building.[9]

Southernmost reindeer: a South Georgian reindeer with velvet-covered antlers

Domesticated reindeer are mostly found in northern Fennoscandia and Russia, with a herd of approximately 150-170 reindeer living around the Cairngorms region in Scotland. The last remaining wild tundra reindeer in Europe are found in portions of southern Norway.[10]

A few reindeer from Norway were introduced to the South Atlantic island of South Georgia in the beginning of the 20th century. The South Georgian reindeer total some 2600 animals in two distinct herds separated by glaciers. Although the flag and the coat of arms of the territory contain an image of a reindeer, they are under threat of eradication because of the environmental damage they cause. Around 4000 reindeer have been introduced into the French sub-Antarctic archipelago of Kerguelen Islands. East Iceland has a small herd of about 2500–3000 animals.[11]

Caribou and reindeer numbers have fluctuated historically, but many herds are in decline across their range.[12] This global decline is linked to climate change for northern, migratory caribou and reindeer herds and industrial disturbance of caribou habitat for sedentary, non-migratory herds.[13]

Morphology

Size

The characteristically small and relatively short-legged reindeer from Svalbard

The females usually measure 162–205 cm (64–81 in) in length and weigh 80–120 kg (180–260 lb)[14] The males (or "bulls") are typically larger (although the extent to which varies in the different subspecies), measuring 180–214 cm (71–84 in) in length and usually weighing 159–182 kg (350–400 lb),[14] though exceptionally large males have weighed as much as 318 kg (700 lb).[14] Shoulder height typically measure from 85 to 150 cm (33 to 59 in), and the tail is 14 to 20 cm (5.5 to 7.9 in) long. The subspecies R. t. platyrhynchus from Svalbard island is very small compared to other subspecies (a phenomenon known as insular dwarfism), with females having a length of approximately 150 cm (59 in), and a weight around 53 kg (120 lb) in the spring and 70 kg (150 lb) in the autumn.[15] Males are approximately 160 cm (63 in) long, and weigh around 65 kg (140 lb) in the spring and 90 kg (200 lb) in the autumn.[15] The reindeer from Svalbard are also relatively short-legged and may have a shoulder height of as little as 80 cm (31 in),[15] thereby following Allen's rule.

Domesticated reindeer are shorter-legged and heavier than their wild counterparts.[citation needed]

Fur

The colour of the fur varies considerably, both individually, and depending on season and subspecies. Northern populations, which usually are relatively small, are whiter, while southern populations, which typically are relatively large, are darker. This can be seen well in North America, where the northernmost subspecies, the Peary caribou, is the whitest and smallest subspecies of the continent, while the southernmost subspecies, the Woodland Caribou, is the darkest and largest.[16] The coat has two layers of fur: a dense woolly undercoat and longer-haired overcoat consisting of hollow, air-filled hairs.

Antlers

Reindeer antlers grow again each year under a layer of fur called velvet. This reindeer is losing the velvet layer on one of its antlers.

In most populations both sexes grow antlers and it is the only cervid species in which females grow them as well as males.[17] In the Scandinavian populations, old males' antlers fall off in December, young males' fall off in the early spring, and females' fall off in the summer. The antlers typically have two separate groups of points, a lower and upper. There is considerable subspecific variation in the size of the antlers (e.g., rather small and spindly in the northernmost subspecies),[16] but, on average, the bull reindeer's antlers are the second largest of any extant deer, after the moose. In the largest races, the antlers of big males can range up to 100 cm (39 in) in width and 135 cm (53 in) in beam length. They have the largest antlers relative to body size among living deer species.[17]

Nose and hooves

Reindeer have specialized noses featuring nasal turbinate bones that dramatically increase the surface area within the nostrils. Incoming cold air is warmed by the animal's body heat before entering the lungs, and water is condensed from the expired air and captured before the deer's breath is exhaled, used to moisten dry incoming air and possibly absorbed into the blood through the mucous membranes.

Reindeer hooves adapt to the season: in the summer, when the tundra is soft and wet, the footpads become sponge-like and provide extra traction. In the winter, the pads shrink and tighten, exposing the rim of the hoof, which cuts into the ice and crusted snow to keep it from slipping. This also enables them to dig down (an activity known as "cratering")[18][19] through the snow to their favorite food, a lichen known as reindeer moss. The knees of many species of reindeer are adapted to produce a clicking sound as they walk.[20]

Vision

Reindeer are thought to be the only mammals that can see ultraviolet light. A study conducted by researchers from the University College London in 2011 revealed that reindeer can see light with wavelengths as low as 320 nm, considerably below the human threshold of 400 nm. It is thought that this ability helps them to survive in the Arctic, because many objects that blend into the landscape in normally visible light, such as urine and fur, produce sharp contrasts in ultraviolet.[21]

Ecology and behavior

Diet

Caribou licking salt from roadway in British Columbia
The size of the antlers play a significant role in establishing the hierarchy in the group[7]
A herd of barren-ground caribou at the Thelon River. This subspecies is a long-distance migrant.[16]

Reindeer are ruminants, having a four-chambered stomach. They mainly eat lichens in winter, especially reindeer moss. However, they also eat the leaves of willows and birches, as well as sedges and grasses. There is some evidence to suggest that on occasion, they will also feed on lemmings,[22] arctic char, and bird eggs.[23] Reindeer herded by the Chukchis have been known to devour mushrooms enthusiastically in late summer.[24]

Reproduction

Mating occurs from late September to early November. Males battle for access to females. Two males will lock each other's antlers together and try to push each other away. The most dominant males can collect as many as 15-20 females to mate with. A male will stop eating during this time and lose much of its body reserves.[citation needed]

Calves may be born the following May or June. After 45 days, the calves are able to graze and forage but continue suckling until the following autumn and become independent from their mothers.[citation needed]

Migration

Some populations of the North American caribou migrate the furthest of any terrestrial mammal, travelling up to 5,000 km (3,100 mi) a year, and covering 1,000,000 km2 (390,000 sq mi).[1][25] Other populations (e.g., in Europe) have a shorter migration, and some, for example the subspecies R. t. pearsoni and R. t. platyrhynchus (both restricted to islands), are residents that only make local movements.[citation needed]

Normally travelling about 19–55 km (12–34 mi) a day while migrating, the caribou can run at speeds of 60–80 km/h (37–50 mph).[1] During the spring migration smaller herds will group together to form larger herds of 50,000 to 500,000 animals but during autumn migrations, the groups become smaller, and the reindeer begin to mate. During the winter, reindeer travel to forested areas to forage under the snow. By spring, groups leave their winter grounds to go to the calving grounds. A reindeer can swim easily and quickly, normally at 6.5 km/h (4.0 mph) but if necessary at 10 km/h (6.2 mph), and migrating herds will not hesitate to swim across a large lake or broad river.[1]

Predators

Reindeer standing on snow to avoid blood-sucking insects.

A variety of predators prey heavily on reindeer. Golden Eagles prey on calves and are the most prolific hunter on calving grounds.[26] Wolverine will take newborn calves or birthing cows, as well as (less commonly) infirm adults. Brown bears and polar bears prey on reindeer of all ages, but like the wolverines they are most likely to attack weaker animals, such as calves and sick deer, since healthy adult reindeer can usually outpace a bear. The Gray Wolf is the most effective natural predator of adult reindeer and sometimes takes large numbers, especially during the winter. A single wolf pack can follow and live off of a particular reindeer herd for months.[citation needed]

As carrion, reindeer are fed on opportunistically by foxes, ravens and hawks. Blood-sucking insects, such as black flies and mosquitoes, are a plague to reindeer during the summer and can cause enough stress to inhibit feeding and calving behaviors.[27] In one case, the entire body of a reindeer was found in the stomach of a Greenland shark,[28] a species found in the far northern Atlantic, although this was quite possibly a case of scavenging considering the dissimilarity of habitats between the ungulate and the large, slow-moving fish. The population numbers of some of these predators is influenced by the migration of reindeer.[citation needed]

Subspecies

The Peary caribou is a relatively small and pale subspecies found in the tundra of far northern North America. Unsurprisingly, it is part of the group known as Tundra reindeer.

In 1961 the reindeer classification was divided into two major groups, the tundra reindeer (with six subspecies) and the woodland reindeer (with three subspecies).[citation needed] Some of the tundra's subspecies are small-bodied, high-Arctic island forms. These island subspecies are probably not closely related, since the Svalbard reindeer seems to have evolved from large European reindeer, whereas Peary caribou and the extinct Arctic reindeer are closely related and probably evolved in high-Arctic North America.[2]

The following is a partial list; four subspecies which are restricted to Russia and neighbouring regions have been left out. These are R. tarandus buskensis, R. tarandus pearsoni (Novaya Zemlya reindeer), R. tarandus phylarchus (Kamchatka/Okhotsk reindeer) and R. tarandus sibiricus (Siberian Tundra reindeer).[29]

Tundra reindeer

Approximate range of caribou subspecies in North America. Overlap is possible for contiguous range. Subspecies groenlandicus and pearyi mix on some arctic islands, and granti is probably a synonym of groenlandicus. Populations here included in caribou are sometimes divided into four separate subspecies (see text)

Woodland reindeer

Reindeer and humans

Hunting

Reindeer pulling a sled in Russia

Reindeer hunting by humans has a very long history, and caribou/wild reindeer "may well be the species of single greatest importance in the entire anthropological literature on hunting."[4]

Humans started hunting reindeer in the Mesolithic and Neolithic periods, and humans are today the main predator in many areas. Norway and Greenland have unbroken traditions of hunting wild reindeer from the ice age until the present day. In the non-forested mountains of central Norway, such as Jotunheimen, it is still possible to find remains of stone-built trapping pits, guiding fences, and bow rests, built especially for hunting reindeer. These can, with some certainty, be dated to the Migration Period, although it is not unlikely that they have been in use since the Stone Age.[citation needed]

Norway is now preparing to apply for nomination as a World Heritage Site for areas with traces and traditions of reindeer hunting in Dovrefjell-Sunndalsfjella National Park, Reinheimen National Park and Rondane National Park in Central Sør-Norge (Southern Norway). There is in these parts of Norway an unbroken tradition of reindeer hunting from post-glacial Stone Age until today.[citation needed]

Wild caribou are still hunted in North America and Greenland. In the traditional lifestyle of the Inuit people, Northern First Nations people, Alaska Natives, and the Kalaallit of Greenland, the caribou is an important source of food, clothing, shelter, and tools. Many Gwichʼin people, who depend on the Porcupine caribou, still follow traditional caribou management practices that include a prohibition against selling caribou meat and limits on the number of caribou to be taken per hunting trip.[32]

The blood of the caribou was supposedly mixed with alcohol as drink by hunters and loggers in colonial Quebec to counter the cold. This drink is now enjoyed without the blood as a wine and whiskey drink known as Caribou.[33][34]

Reindeer husbandry

A reindeer sled, Arkhangelsk, Russia. Late nineteenth-century photochrom.
Milking reindeer in the 19th century
Reindeer fur coat

Reindeer have been herded for centuries by several Arctic and Subarctic people including the Sami and the Nenets. They are raised for their meat, hides, and antlers and, to a lesser extent, for milk and transportation. Reindeer are not considered fully domesticated, as they generally roam free on pasture grounds. In traditional nomadic herding, reindeer herders migrate with their herds between coast and inland areas according to an annual migration route and herds are keenly tended. However, reindeer were not bred in captivity, though they were tamed for milking as well as for use as draught animals or beasts of burden.[citation needed]

The use of reindeer as semi-domesticated livestock in Alaska was introduced in the late 19th century by the U.S. Revenue Cutter Service, with assistance from Sheldon Jackson, as a means of providing a livelihood for Native peoples there.[35] Reindeer were imported first from Siberia, and later also from Norway. A regular mail run in Wales, Alaska, used a sleigh drawn by reindeer.[36] In Alaska, reindeer herders use satellite telemetry to track their herds, using online maps and databases to chart the herd's progress.[citation needed]

Economy

The reindeer has (or has had) an important economic role for all circumpolar peoples, including the Saami, Nenets, Khants, Evenks, Yukaghirs, Chukchi, and Koryaks in Eurasia. It is believed that domestication started between the Bronze and Iron Ages. Siberian deer owners also use the reindeer to ride on (Siberian reindeer are larger than their Scandinavian relatives). For breeders, a single owner may own hundreds or even thousands of animals. The numbers of Russian herders have been drastically reduced since the fall of the Soviet Union. The fur and meat is sold, which is an important source of income. Reindeer were introduced into Alaska near the end of the 19th century; they interbreed with native caribou subspecies there. Reindeer herders on the Seward Peninsula have experienced significant losses to their herds from animals (such as wolves) following the wild caribou during their migrations.[citation needed]

Reindeer meat is popular in the Scandinavian countries. Reindeer meatballs are sold canned. Sautéed reindeer is the best-known dish in Lapland. In Alaska and Finland, reindeer sausage is sold in supermarkets and grocery stores. Reindeer meat is very tender and lean. It can be prepared fresh, but also dried, salted, hot- and cold-smoked. In addition to meat, almost all internal organs of reindeer can be eaten, some being traditional dishes.[37] Furthermore, Lapin Poron liha, fresh reindeer meat completely produced and packed in Finnish Lapland, is protected in Europe with PDO classification.[38][39]

Reindeer antler is powdered and sold as an aphrodisiac, nutritional or medicinal supplement to Asian markets.

Caribou have been a major source of subsistence for Canadian Inuit.

In history

Both Aristotle and Theophrastus have short accounts – probably based on the same source – of an ox-sized deer species, named tarandos, living in the land of the Bodines in Scythia, which was able to change the colour of its fur to obtain camouflage. The latter is probably a misunderstanding of the seasonal change in reindeer fur colour. The descriptions have been interpreted as being of reindeer living in the southern Ural Mountains at c. 350 BC[40]

Tragelaphus or Deer-Goat

A deer-like animal described by Julius Caesar in his Commentarii de Bello Gallico (chapter 6.26) from the Hercynian Forest in the year 53 BC is most certainly to be interpreted as reindeer:[40][41]

There is an ox shaped like a stag. In the middle of its forehead a single horn grows between its ears, taller and straighter than the animal horns with which we are familiar. At the top this horn spreads out like the palm of a hand or the branches of a tree. The females are of the same form as the males, and their horns are the same shape and size.

According to Olaus Magnus's Historia de Gentibus Septentrionalibus – printed in Rome in 1555 – Gustav I of Sweden sent 10 reindeer to Albert I, Duke of Prussia, in the year 1533. It may be these animals that Conrad Gessner had seen or heard of.

Name etymology

The name rangifer, which Linnaeus chose as the name for the reindeer genus, was used by Albertus Magnus in his De animalibus, fol. Liber 22, Cap. 268: "Dicitur Rangyfer quasi ramifer". This word may go back to a Saami word raingo.[40] For the origin of the word tarandus, which Linnaeus chose as the species epithet, he made reference to Ulisse Aldrovandi's Quadrupedum omnium bisulcorum historia fol. 859–863, Cap. 30: De Tarando (1621). However, Aldrovandi – and before him Konrad Gesner[42] – thought that rangifer and tarandus were two separate animals.[43] In any case, the tarandos name goes back to Aristotle and Theophrastus – see above.

Local names

The name rein (-deer) is of Norse origin (Old Norse hreinn, which again goes back to Proto-Germanic *hrainaz and Proto-Indo-European *kroinos meaning "horned animal"). In the Uralic languages, Sami poatsu (in Northern Sami boazu, in Lule Sami boatsoj, in Pite Sami båtsoj, in Southern Sami bovtse), Mari pučə and Udmurt pudžej, all referring to domesticated reindeer, go back to *počaw, an Iranian loanword deriving from Proto-Indo-European *peḱu-, meaning "cattle". The Finnish name poro may also stem from the same.[44] The name caribou comes, through French, from Mi'kmaq qalipu, meaning "snow shoveler", referring to its habit of pawing through the snow for food.[45] In Inuktitut, the caribou is known by the name tuktu.[46][47] In Cree-Montagnais-Naskapi dialects the caribou is called atihkw.[citation needed]

Reindeer in Christmas

Two Scottish reindeer relax after pulling Santa's sleigh at the switching on of Christmas lights

Santa Claus's reindeer

In the Santa Claus tale, Santa Claus's sleigh is pulled by flying reindeer. These were first named in the 1823 poem "A Visit from St. Nicholas", where they are called Dasher, Dancer, Prancer, Vixen, Comet, Cupid, Dunder, and Blixem.[48] Dunder was later changed to Donder and—in other works—Donner (in German, "thunder"), and Blixem was later changed to Bliksem, then Blitzen (German for "lightning"). Some consider Rudolph as part of the group as well, though he was not part of the original named work referenced previously. Rudolph was added by Robert L. May in 1939 as "Rudolph the Red-Nosed Reindeer".[citation needed]

According to the British comedy panel game QI, Rudolph the Red-Nosed Reindeer and all of Santa's other reindeer must be either female or castrated, because male reindeer lose their antlers during winter.

Heraldry and symbols

Several Norwegian municipalities have one or more reindeer depicted in their coats-of-arms: Eidfjord, Porsanger, Rendalen, Tromsø, Vadsø, and Vågå. The historic province of Västerbotten in Sweden has a reindeer in its coat of arms. The present Västerbotten County has very different borders and uses the reindeer combined with other symbols in its coat-of-arms. The city of Piteå also has a reindeer. The logo for Umeå University features three reindeer.[citation needed]

The Canadian 25-cent coin, or "quarter" features a depiction of a caribou on one face. The caribou is the official provincial animal of Newfoundland and Labrador, Canada, and appears on the coat of arms of Nunavut. A caribou statue was erected at the center of the Beaumont-Hamel Newfoundland Memorial, marking the spot in France where hundreds of soldiers from Newfoundland were killed and wounded in the First World War and there is a replica in Bowring Park, in St. John's, Newfoundland's capital city.[citation needed]

Two municipalities in Finland have reindeer motifs in their coats-of-arms: Kuusamo[49] has a running reindeer and Inari[50] a fish with reindeer antlers.

See also

References

  1. ^ a b c d e f Henttonen, H. & Tikhonov, A. (2008). Rangifer tarandus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 April 2010.
  2. ^ a b Peter Gravlund, Morten Meldgaard, Svante Pääbo, and Peter Arctander (1998). "Polyphyletic Origin of the Small-Bodied, High-Arctic Subspecies of Tundra Reindeer (Rangifer tarandus)". Molecular Phylogenetics and Evolution 10 (2): 151–9. doi:10.1006/mpev.1998.0525. PMID 9878226. 
  3. ^ a b S. A. Byun, B. F. Koop, and T. E. Reimchen (2002). "Evolution of the Dawson caribou (Rangifer tarandus dawsoni)". Can. J. Zool. 80 (5): 956–960. doi:10.1139/z02-062. 
  4. ^ a b "In North America and Eurasia the species has long been an important resource—in many areas the most important resource—for peoples inhabiting the northern boreal forest and tundra regions. Known human dependence on caribou/wild reindeer has a long history, beginning in the Middle Pleistocene (Banfield 1961:170; Kurtén 1968:170) and continuing to the present....The caribou/wild reindeer is thus an animal that has been a major resource for humans throughout a tremendous geographic area and across a time span of tens of thousands of years." Ernest S. Burch, Jr. (1972). "The Caribou/Wild Reindeer as a Human Resource". American Antiquity 37 (3): 339–368. doi:10.2307/278435. JSTOR 278435. 
  5. ^ Flying Reindeer and Santa Claus: Fact, Fiction and Myth. Icr.arcticportal.org (2008-12-15). Retrieved on 2011-09-16.
  6. ^ The Sámi and their reindeer – University of Texas at Austin
  7. ^ a b c Novak, R. M. (editor) (1999). Walker's Mammals of the World. Vol. 2. 6th edition. Johns Hopkins University Press, Baltimore. pp. 1128–1130. ISBN 0-8018-5789-9
  8. ^ Sommer R. S. and Nadachowski A. (2006). "Glacial refugia of mammals in Europe: evidence from fossil records". Mammal Rev 36 (4): 251–265. doi:10.1111/j.1365-2907.2006.00093.x. 
  9. ^ Christmas reindeer mystery as world’s largest herd plummets Survival 21 December
  10. ^ Europe's last wild reindeer herds in peril. Newscientist. 19 December 2003. Retrieved on 2011-09-16.
  11. ^ Reindeer Hunting in Iceland. International Adventure. Accessed 12 November 2010.
  12. ^ BBC Earth News-Reindeer herds in global decline. BBC News (2009-06-11). Retrieved on 2011-09-16.
  13. ^ Vors, L. S and Boyce, M. S. (2009). "Global declines of caribou and reindeer". Global Change Biology 15 (11): 2626–2633. doi:10.1111/j.1365-2486.2009.01974.x. 
  14. ^ a b c Caribou at the Alaska Department of Fish & Game. Adfg.state.ak.us. Retrieved on 2011-09-16.
  15. ^ a b c Aanes, R. (2007). Svalbard reindeer. Norwegian Polar Institute.
  16. ^ a b c Reid, F. (2006). Mammals of North America. Peterson Field Guides. ISBN 978-0-395-93596-5
  17. ^ a b New World Deer (Capriolinae).[dead link] Answers.com
  18. ^ "In the winter, the fleshy pads on these toes grow longer and form a tough, hornlike rim. Caribou use these large, sharp-edged hooves to dig through the snow and uncover the lichens that sustain them in winter months. Biologists call this activity "cratering" because of the crater-like cavity the caribou’s hooves leave in the snow." All About Caribou – Project Caribou
  19. ^ Image of reindeer cratering in snow. Arcticphoto.co.uk. Retrieved on 2011-09-16.
  20. ^ Banfield AWF: The caribou. In The Unbelievable Land. Smith I.N. (ed.) Ottawa: Queen's Press; 1966: 25–28, cited in Jakob Bro-Jørgensen and Torben Dabelsteen (2008). "Knee-clicks and visual traits indicate fighting ability in eland antelopes: multiple messages and back-up signals". BMC Biology 6: 47. doi:10.1186/1741-7007-6-47. PMC 2596769. PMID 18986518. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2596769. 
  21. ^ Reindeer use UV light to survive in the wild. Ucl.ac.uk (2011-05-26). Retrieved on 2011-09-16.
  22. ^ Lemmings at Hinterland Who's Who
  23. ^ Terrestrial Mammals of Nunavut by Ingrid Anand-Wheeler. ISBN 1-55325-035-4.
  24. ^ ''The Sun, the Moon and Firmament in Chukchi Mythology and on the Relations of Celestial Bodies and Sacrifice'' by Ülo Siimets at 140. (PDF) . Retrieved on 2011-09-16.
  25. ^ Caribou Migration Monitoring by Satellite Telemetry. Mrnf.gouv.qc.ca. Retrieved on 2011-09-16.
  26. ^ Walker, Matt. (2009-10-20) Eagles filmed hunting reindeer. BBC News. Retrieved on 2011-09-16.
  27. ^ Caribou Foes: Natural Predators in the Wilderness. Learner.org. Retrieved on 2011-09-16.
  28. ^ Greenland Shark (Somniosus microcephalus). Postmodern.com. Retrieved on 2011-09-16.
  29. ^ a b c Grubb, Peter (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200328. 
  30. ^ a b Cronin, M. A., M. D. Macneil, and J. C. Patton (2005). Variation in Mitochondrial DNA and Microsatellite DNA in Caribou (Rangifer tarandus) in North America. Journal of Mammalogy 86(3): 495–505.
  31. ^ Geist, V. (2007). Defining subspecies, invalid taxonomic tools, and the fate of the woodland caribou. The Eleventh North American Caribou Workshop (2006). Rangifer, Special Issue 17: 25-28.
  32. ^ Gwichʼin Traditional Management Practices. Arcticcircle.uconn.edu. Retrieved on 2011-09-16.
  33. ^ Mieusset, Sébastien. "Le "Temps des sucres" au Québec". http://www.cuisine.tv/cid6799/le-temps-des-sucres-au-quebec.html 
  34. ^ Ovenell-Carter, Julie (06-02-2009). "Quebec's Carnaval is worth freezing your a** off for". theseboots.travel. http://theseboots.travel/2009/02/06/worth-repeating-quebecs-carnaval-is-worth-freezing-your-a-off-for/ 
  35. ^ King, Irving H.(1996). The Coast Guard Expands, p. 86–91. Naval Institute Press, Annapolis, Maryland. ISBN 1-55750-458-X.
  36. ^ United States. Bureau of Education; United States. Bureau of Education. Alaska Division (1905). Annual report on introduction of domestic reindeer into Alaska. 14. Govt. Print. Off.. pp. 18–. http://books.google.com/books?id=6RcWb-PNMiMC&pg=PA18. Retrieved 16 September 2011. 
  37. ^ Reindeer. Saunalahti.fi. Retrieved on 2011-09-16.
  38. ^ 'Lapland Reindeer meat protected in the EU' North Magazine (Accessed 19 July 2010)
  39. ^ European Commission PDO/PGI list (Accessed 19 July 2010)
  40. ^ a b c Sarauw, Georg (1914). "Das Rentier in Europa zu den Zeiten Alexanders und Cæsars [The reindeer in Europe to the times of Alexander the Great and Julius Caesar]". In Jungersen, H. F. E.; Warming, E. (in German). Mindeskrift i Anledning af Hundredeaaret for Japetus Steenstrups Fødsel. Copenhagen. pp. 1–33. 
  41. ^ "Est bos cervi figura, cuius a media fronte inter aures unum cornu* exsistit excelsius magisque directum his, quae nobis nota sunt, cornibus: ab eius summo sicut palmae ramique* late diffunduntur. Eadem est feminae marisque natura, eadem forma magnitudoque cornuum." Greenough, J. B.; D'Ooge, Benjamin L.; Daniell, M. Grant (1898). "book 6, chapter 26". Commentary on Caesar, Gallic War. Boston: Ginn and Company. http://old.perseus.tufts.edu/cgi-bin/ptext?doc=Perseus%3Atext%3A1999.04.0017&query=chapter%3D%23242. 
  42. ^ Gesner, K. (1617) Historia animalium. Liber 1, De quadrupedibus viviparis. Tiguri 1551. p. 156: De Tarando. 9. 950: De Rangifero.
  43. ^ Aldrovandi, U. (1621) Quadrupedum omnium bisulcorum historia. Bononiæ. Cap. 30: De Tarando – Cap. 31: De Rangifero.
  44. ^ Koivulehti, Jorma (2007): Saamen ja suomen 'poro'. Mémoires de la Société Finno-Ougrienne 253. http://www.sgr.fi/sust/sust253/sust253_koivulehto.pdf
  45. ^ Flexner, Stuart Berg and Leonore Crary Hauck, eds. (1987). The Random House Dictionary of the English Language, 2nd ed. (unabridged). New York: Random House, pp. 315–16)
  46. ^ Spalding, Alex, Inuktitut – A Multi-Dialectal Outline Dictionary (with an Aivilingmiutaq base). Nunavut Arctic College, Iqaluit, Nunavut, Canada, 1998.
  47. ^ Eskimoisches Wörterbuch, gesammelt von den Missionaren in Labrador, revidirt und herausgegeben von Friedrich Erdmann. Budissin [mod. Bautzen] 1864.
  48. ^ "The Legendary Role of Reindeer in Christmas, Jeff Westover, My Merry Christmas, accessed 27 December 2007
  49. ^ Coat of arms for Kuusamo.
  50. ^ Coat of arms for Inari.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Cronin (1992) found considerable variation in mtDNA among populations in Alberta, Labrador, Newfoundland, and Alaska; geographic differentiation was evident, but woodland and barren ground subspecies were not distinguishable by mtDNA genotypes. Populations of R. t. pearyi on the Queen Elizabeth Islands are genetically and possibly ecologically distinct from all other forms of Rangifer, including those on the southern tier of arctic islands (south of 74 degrees N latitude, excluding Baffin and Bylot islands) (Miller, 1991 COSEWIC report). See Grubb (in Wilson and Reeder 2005) for brief discussion of currently recognized subspecies and subspecies groups.

See Cronin (1991) for a phylogeny of the Cervidae based on mitochondrial-DNA data. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!