Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Spanish (4) (learn more)

Overview

Brief Summary

Description

Caribou, or Reindeer, is the only deer species in which both males and females have candelabra-like antlers. They live in large, migratory herds along the tree line of northern forests, eating mostly grass-like plants and shrubs in summer, and lichen, which carpets the snow-covered forests, in the winter. Getting at winter feed by digging through the snow can lead to intense competition, which may explain why females also carry antlers. During the breeding season, males compete with one another for access to females, using their antlers in jousting matches. They become completely devoted to the rituals of mating, failing even to eat, and losing their built up energy reserves in the process. Females give birth at traditional calving grounds on the open tundra during the spring, after a gestation of seven months. Then they pour all of their energy reserves into nursing their calves for a month. There are more than 2,000,000 Caribou in North America, but they are less successful in the southern parts of their range where they must cope with humans and other predators.

Links:
Mammal Species of the World
Visit ARKive for more images of the Peary caribou  More images, video and sound of the Peary caribou, a subspecies
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:67, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Geographic Range

Caribou are found in North America and Eurasia in a large circle around the north pole, this kind of distribution is called "circumpolar". The woodland subspecies of caribou can be found as far south as 46o north latitude, while other subspecies can be found as far north as 80o north latitude. Caribou were once found as far south as Germany, Great Britain, Poland, and Maine (USA), but over-hunting and habitat destruction have reduced their populations to only a portion of their historic range.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The reindeer has a circumpolar distribution in the tundra and taiga zones of northern Europe, Siberia, and North America (Corbet 1978, Hall 1981, Koubek and Zima 1999, Wilson and Ruff 1999). In North America, the range formerly extended as far south as central Idaho, the Great Lakes area, and northern New England - however, wild populations currently remain only in Alaska, Canada, Washington, and northern Idaho. In Europe, wild populations have a fragmented distribution in Norway (including the island of Svalbard, where there is a separate subspecies R. t. platyrhynchus), Finland, and Russia (including the island of Novaya Zemlya, which also has an endemic subspecies R. t. pearsoni) (Herre 1986, Koubek and Zima 1999). In Finland, wild reindeer occur in two isolated subpopulations, one in the west and one in the east. Semi-domesticated reindeer are widespread in Lappland, and a feral population has historically become established on Iceland (Koubek and Zima 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Caribou have a nearly circumpolar distribution. The woodland subspecies of caribou (Rangifer tarandus caribou) can be found as far south as 46o north latitude, while other subspecies (Peary caribou [R. t. pearyi] and Svalbard reindeer [R. t. platyrhynchus]) can be found as far north as 80o north latitude. Once found as far south as Germany, Great Britain, Poland, and Maine (USA), over-hunting and habitat destruction have diminished the historic range of caribou.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Circumboreal in tundra and taiga. The range formerly extended as far south as central Idaho, the Great Lakes area, and northern New England in North America and into central Germany in Europe. North America: wild populations currently extant in Alaska, Canada, Washington, and northern Idaho. Reintroduced from Newfoundland to Maine in 1986. Introduced and feral in Iceland, Kerguelen Islands, South Georgia Island, Pribilof Islands, St. Matthew Island; extirpated in Sweden (Grubb, in Wilson and Reeder 1993, 2005). See Bernard and Horn (1989) for summary of introductions in eastern North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The various populations of caribou display a wide range of size. Generally, populations that occur farther south are larger than their northern cousins. Caribou can have shoulder heights of up to 120 cm and total length ranges from 150 to 230 cm. They have short tails. Males are larger than females, sometimes twice as large.  The coat of caribou is an excellent, lightweight insulation against the extreme cold temperatures they face. The hairs are hollow and taper sharply which helps trap heat close to the body and also makes them more buoyant. Color varies by subspecies, region, sex, and season from the very dark browns of woodland caribou bulls in summer to nearly white in Greenland (R._t._groenlandicus) and high Arctic caribou. White areas are often present on the belly, neck, and above the hooves. The hooves are large and concave, which support them in snow and soft tundra, conditions that they often face. The broad hooves are also useful when swimming. Caribou make an audible clicking noise while walking, which is produced from tendons rubbing across a bone in the foot. Caribou are the only species of deer in which both sexes have antlers. Mature bulls can carry enormous and complex antlers, whereas cows and young animals generally have smaller and simpler ones. Mature bulls usually shed their antlers shortly after the rut whereas cows can keep theirs until spring.

Range mass: 55 to 318 kg.

Range length: 150 to 230 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 119.66 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The various subspecies of caribou display a wide range of size. Generally speaking, the subspecies inhabiting the more southerly latitudes are larger than their northern cousins. Caribou can have shoulder heights of up to 120 cm and total length ranges from 150 to 230 cm. They have short tails. There is marked sexual dimorphism, with males of some subspecies being twice as large as females. The coat of the caribou is an excellent, lightweight insulation against the extreme cold temperatures they face. The hairs are hollow and taper sharply which helps trap heat close to the body and also makes them more buoyant. Color varies by subspecies, region, sex, and season from the very dark browns of woodland caribou bulls in summer to nearly white in Greenland (R. t. groenlandicus) and high Arctic caribou. White areas are often present on the belly, neck, and above the hooves. The hooves are large and concave, which support them in snow and soft tundra, conditions that they often face. The broad hooves are also useful when swimming. Caribou make an audible clicking noise while walking, which is produced from tendons rubbing across a bone in the foot. Rangifer tarandus is the only species of deer in which both sexes have antlers. Mature bulls can carry enormous and complex antlers, whereas cows and young animals generally have smaller and simpler ones. Mature bulls usually shed their antlers shortly after the rut whereas cows can keep theirs until spring.

Range mass: 55 to 318 kg.

Range length: 150 to 230 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 119.66 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 210 cm

Weight: 270000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 1.8 m males; 1.7 m females
Range: 1.6-2.1 m males; 1.4-1.9 m females

Weight:
Average: 110 kg males; 81 kg females
Range: 81-153 kg males; 63-94 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Preferred Habitat

More info for the terms: basal area, bog, cover, density, forbs, lichen, lichens, mesic, series, shrubs, tree, tundra

Caribou outside the Columbia Mountains: Caribou primarily occupy boreal and subboreal forests in North America [24,74,99]. Herds in northern Canada and northern Alaska summer in arctic tundra and winter in boreal forest [99]. Major tree species within caribou habitat include black spruce, white spruce, jack pine, balsam fir, Engelmann spruce, subalpine fir, lodgepole pine, tamarack, and white birch [6,24,74,101]. In Saskatchewan and Manitoba, caribou foraged exclusively in and around spruce stands in mid- to late winter [78]. In Manitoba, barren ground caribou use upland semiopen to open black spruce stands most heavily for midwinter foraging. During northward migration in Saskatchewan in mid-February, barren ground caribou feed primarily on uplands in semiopen to dense black spruce and in isolated white birch stands [80]. Mature (≥70 years) balsam fir forests are used extensively by woodland caribou in Quebec [82].

Caribou distributions within these habitats are influenced by site characteristics and associated vegetation. Caribou frequent peatlands, bogs, muskegs, lake shores, and other wetland and riparian areas [37,61,80,97]. A mosaic of habitats, such as old-growth forest uplands and mature lowland forest adjacent to wetland and riparian areas, are important for feeding and other activities during mid- and late winter in Manitoba and Saskatchewan [80,97]. Habitat heterogeneity is primarily caused by fire [80]. Caribou spend most of their time on level or gently sloping land [81,103]. High-elevation hilltops and ridges are frequently used by caribou throughout the year [81,82,103]. High-elevation habitats include grasslands [103], alpine habitats characterized by ericaceous shrubs, lichens, mosses, and graminoids, and open subalpine white spruce-balsam fir forest. Woodland caribou in Quebec favored barren habitats with a large component of bare ground in alpine and subalpine zones >2,300 feet (700 m) [82].

Favored calving grounds for herds near the ocean include gently rising plains and hills >1,200 feet (370 m) in elevation [58]. A calving area in Alaska was characterized by subarctic, mesic, and wet-sedge meadows dominated by Bering Sea sedge (Carex nesophila), purple marshlocks (Potentilla palustris), and field horsetail (Equisetum arvense). Calving habitat in Greenland was characterized by warm, dry, south-facing slopes populated by Bellardi bog sedge (Kobresia myosuroides), weak arctic sedge (C. supina), grayleaf willow, and dwarf birch (B. nana) [88]. Caribou in Newfoundland calved in mature forest and then moved to barrens 2 to 4 days after calving. Extensive scrub habitats interspersed with bogs and barrens were used for calving as well in Newfoundland [74]. Uncharacteristically, females from a nonmigratory herd in Saskatchewan did not use a specific calving location from year to year, but the females did utilize the same general calving area [90]. A herd in Alaska was displaced from its traditional calving area and used a recent burn for calving instead. The traditional area was completely snow covered during the calving period, while the burned area was snow free. Nearby treeless, snow-free unburned areas were generally avoided [34].

Snow depth and hardness may influence caribou movements and foraging habits more than stand age [78,101]. To find food in winter, caribou favor habitats with reduced snow cover, including western and southern aspects and windy mountaintops [12,106]. Caribou selectively travel and feed in areas with shallow snow, which may explain why stands at least 40 years old are utilized more than younger stands [78]. Caribou dig feeding craters at sites with soft, shallow snow in both burned and unburned sites in Alaska [96]. In early winter, barren ground caribou movements are not yet restricted by snow depth or hardness [80]. Mountain pine beetle (Dendroctonus ponderosae) attacks can affect caribou movements by killing trees and increasing windthrow. Snow depths may increase in areas with reduced canopy cover due to windthrow caused by mountain pine beetle kills. As a result, caribou may abandon once-preferred habitats and utilize areas where predation risks may be higher [21]. Increases in snowfall over several seasons can lead to population declines within caribou herds [1].

Home range: Caribou home range size is highly variable because some herds are migratory while others are not [69,80,90,103]. Average home range sizes of male and female caribou in Newfoundland were 84.0 km² and 89.8 km², respectively [74]. The range of a woodland caribou herd in Labrador was estimated at 25,000 km² [17]. The general home range of a woodland caribou herd in Ontario was roughly 160,000 km² [39]. The primary home range of an Alaskan herd covered roughly 45,000 km² [103].

Endangered woodland caribou in the Columbia Mountains: Caribou in the Columbia Mountains primarily inhabit Engelmann spruce-subalpine fir and western red cedar-western hemlock forests >4,000 feet (1,200 m) in elevation [111]. The following Table describes the characteristics of habitats utilized by woodland caribou in the Columbia Mountain ecosystem in northern Idaho, northeastern Washington, and southeastern British Columbia.

Characteristics of woodland caribou habitat in the Columbia Mountains
Season Major habitat characteristics Tree size Basal area Canopy cover Lichen density Understory cover Road density Other characteristics
Early winter mature to old-growth western redcedar-western hemlock and Engelmann spruce-subalpine fir forests >20 cm DBH ≥50 m²/ha >50% high ...* ... 1,346-1,677 m elevation; 16%-30% slopes; southern aspects, highly productive stands; average windthrown tree density 7.4/ha [6,55,91,102,107,111]
Late winter old-growth Engelmann spruce-subalpine fir and western hemlock forests; ridgetops or upper slopes; also subalpine zones ... 2.3-17.2 m²/ha 26%-50% high ... ... >1,526 m elevation; moderate slopes; northern aspects; low tree density; stem densities 741 to 1235/ha [6,102,107]
Spring mature western redcedar-western hemlock-Engelmann spruce forests; forest openings and cutovers adjacent to mature stands; closed canopy forests of various ages <10 cm, 21-25 cm DBH <2.3 m²/ha, <45.9 m²/ha variable low ... ... low to midelevation; highly productive stands [6,38,102,111]
Calving mature to old-growth western redcedar-western hemlock and Engelmann spruce-subalpine fir forests; old noncommercial forests; calving females usually secluded ... ≤34.4 m²/ha low high ... lower than other times of the year 1,346 m elevation; low tree density; often snow covered [55,102,111]
Summer western redcedar-western hemlock and Engelmann spruce-subalpine fir forests; partial cuts, pole stands, and old-growth; high meadows adjacent to subalpine forest ... 17.3-34.4 m²/ha variable high >60% ... average elevation 1,400-1,700 m; northern and eastern aspects, relatively flat terrain at a fine scale; highly productive stands [6,38,102]
Fall mature to old-growth western hemlock; high meadows adjacent to subalpine forest >20 cm DBH >45.9 m²/ha variable high high ... shift to lower elevations following frost [38,102]
Rut ... >25 cm DBH >45.9 m²/ha >70% ... ... 1.3 km/km² high concentration of snags (>247/ha) [102]
*No data.

Johnson and others [55] identify preferred woodland caribou habitats in the Selkirk Mountains of Idaho, Washington, and British Columbia, and describe potential management conflicts due to human activity and development in the woodland caribou habitats. Prime habitat in the region includes lightly stocked stands with seral and mature Engelmann spruce-subalpine fir and western redcedar-western hemlock stands with <40% crown cover, especially in areas where lakes, bogs, and fens are present. These habitat types provide lichen forage during winter months as well as shrubs and forbs during other times of the year. Within these types, lightly stocked stands on steep southern aspects are vulnerable to fire. Any logging or fire activity within these stands would likely be detrimental to the caribou population [55].

Engelmann spruce-subalpine fir forest >5,000 feet (1,524 m) with >40% crown cover is another highly preferred habitat in the Selkirk Mountains. Western redcedar-western hemlock stands over 4,500 feet (1,346 m) within the spruce-fir type are used in early winter for feeding, movement corridors, and calving sites. These stands provide cover in late fall, while fallen trees within this habitat provide lichen forage. According to Johnson and others [55], irregularly shaped clearcuts <40 acres (16 ha) in size and <33% of the original forest size may be removed in a single drainage without serious harm to caribou populations in this habitat [55].

In the Selkirk Mountains, caribou frequently use sites adjacent to lakes, bogs, and fens for foraging in late summer and fall. Disturbances such as logging, camping, and road traffic near these water sources may be detrimental to caribou using those sites. Limiting the number of roads and utility corridors through preferred habitats would be highly beneficial to caribou in the Selkirk Mountains [55].

Woodland caribou in British Columbia frequent alpine-rock, lodgepole pine/reindeer lichen-cup lichen, and midelevation mixed spruce-fir-pine (Picea-Abies-Pinus spp.) habitats [54]. Western hemlock habitats are most important for woodland caribou in Idaho and British Columbia during autumn and early winter. However, habitats with western hemlock are largely avoided at other times of the year. Open canopy (10%-25%) is also favored during all seasons in stands without a western hemlock component [102]. Periodically in winter, caribou climb to the high ridges they more typically use in summer. These vertical movements are likely influenced by snow accumulation. Deep snow accumulation at high elevations forces caribou down to mature lowland forests. Caribou return to upper elevations if the snow pack hardens sufficiently. When snow softens in spring, caribou are again forced to lower-elevation forests. They move from low-elevation forests into snow-free alpine habitats in May and June and remain for most of the summer. Woodland caribou in this area inhabit dense, lowland forests that are roughly 4,000 feet (1,200 m) below their summer range during part of each winter. In lowland areas, woodland caribou favor flat, poorly drained areas interspersed with open bogs, meadows and ponds, and mature forests near the open ice of lakes [38].

Caribou in the Selkirk Mountains return to the same early winter habitats year after year [111]. Early winter habitat in the Selkirk Mountains is characterized by closed-canopy Engelmann spruce-subalpine fir and western hemlock-western redcedar on moderate slopes, with high densities of windthrow and arboreal lichens, at 4,000 to 6,200 feet (1,200-1,900 m) elevation [102,111]. Early winter is considered the most critical time for woodland caribou in the Selkirk Mountains because availability of suitable habitat is limited, rapid snow accumulation covers vascular plants used for forage and makes movement difficult, and arboreal lichen availability is low [91,111]. The accumulated snow hardens in late winter, and caribou are able to walk on top of the snow and more easily reach arboreal lichens in the forest canopy [111].

Caribou declined after a series of fires that greatly altered the landscape in British Columbia. Fire reduced 60% to70% of this caribou habitat. However, the decline in the caribou population was not noticed for several years following the fires. Caribou avoided burned areas that had been utilized before the fires [38].

  • 99. Scotter, George W. 1968. Effects of forest fires on the lichen winter ranges of barren-ground caribou in northern Canada. Logan, UT: Utah State University. 127 p. Dissertation. [65839]
  • 1. Adams, Layne G.; Dale, Bruce W. 1998. Timing and synchrony of parturition in Alaskan caribou. Journal of Mammalogy. 79(1): 287-294. [65830]
  • 6. Apps, Clayton D.; McLellan, Bruce N.; Kinley, Trevor A.; Flaa, John P. 2001. Scale-dependent habitat selection by mountain caribou, Columbia Mountains, British Columbia. Journal of Wildlife Management. 65(1): 65-77. [65777]
  • 12. Bergerud, A. T. 1980. Caribou. In: Schmidt, John L.; Gilbert, Douglas L., eds. Big game of North America. Harrisburg, PA: Stackpole Books: 83-101. [14659]
  • 17. Brown, W. Kent; Theberge, John B. 1990. The effect of extreme snowcover on feeding-site selection by woodland caribou. Journal of Wildlife Management. 54(1): 161-168. [65782]
  • 21. Cichowski, Deborah; Williston, Patrick. 2005. Mountain pine beetles and emerging issues in the management of woodland caribou in west central British Columbia. In: McCarthy, L.; Valkenburn, P., eds. Proceedings of the 10th North American caribou workshop; 2004 May 4-6; Girdwood, AK. In: Rangifer. Tromso, Norway: Nordic Council for Reindeer Research; Special Issue No. 16: 97-103. [62094]
  • 24. Coxson, Darwyn S.; Marsh, Janet. 2001. Lichen chronosequences (postfire and postharvest) in lodgepole pine (Pinus contorta) forests of northern interior British Columbia. Canadian Journal of Botany. 79: 1449-1464. [40594]
  • 37. Dunford, Jesse S.; McLoughlin, Philip D.; Dalerum, Fredrik; Boutin, Stan. 2006. Lichen abundance in the peatlands of northern Alberta: implications for boreal caribou. Ecoscience. 13(4): 469-474. [67385]
  • 38. Edwards, R. Y. 1954. Fire and the decline of a mountain caribou herd. Journal of Wildlife Management. 18(4): 521-526. [8394]
  • 39. Ferguson, S. H.; Elkie, P. C. 2004. Seasonal movement patterns of woodland caribou (Rangifer tarandus caribou). Journal of Zoology. 262(2): 125-134. [65791]
  • 54. Johnson, Chris J.; Alexander, Nancy D.; Wheate, Roger D.; Parker, Katherine L. 2002. Charcterizing woodland caribou habitat in sub-boreal and boreal forests. Forest Ecology and Management. 180: 241-248. [44811]
  • 55. Johnson, Donald R.; Miller, Donald R.; Peek, James M. 1977. Guidelines for human activity within the range of mountain caribou, southern Selkirk Mountains. Misc. Publ. No. 3. Moscow, ID: University of Idaho, Forest, Wildlife and Range Experiment Station. 5 p. [13652]
  • 58. Kelsall, John P. 1957. Continued barren-ground caribou studies. Wildlife Management Bulletin Series 1: No. 12. Ottawa: Department of Northern Affairs and National Resources, National Parks Branch, Canadian Wildlife Service. 148 p. [16597]
  • 61. Klein, David R. 1982. Fire, lichens, and caribou. Journal of Range Management. 35(3): 390-395. [10898]
  • 74. Mahoney, Shane P.; Virgl, John A. 2003. Habitat selection and demography of a nonmigratory woodland caribou population in Newfoundland. Canadian Journal of Zoology. 81(2): 321-334. [65802]
  • 78. Miller, D. R. 1980. Wildfire effects on barren-ground caribou wintering on the taiga of northcentral Canada: a reassessment. In: Reimers, Eigil; Gaare, Eldar; Skjenneberg, Sven, eds. Proceedings of the 2nd international reindeer/caribou symposium; 1979 September 17-21; Roros, Norway. Trondheim, Norway: Direktoratet for vilt og ferskvannsfisk: 84-98. [65849]
  • 80. Miller, Donald R. 1976. Biology of the Kaminuriak population of barren-ground caribou. Part 3. Taiga winter range relationships and diet. Canadian Wildlife Service Rep. Series No. 36. Ottawa, ON: Environment Canada, Wildlife Service. 42 p. [13007]
  • 81. Miller, Donald Ray. 1976. Wildfire and caribou on the taiga ecosystem of northcentral Canada. Moscow, ID: University of Idaho. 129 p. Dissertation. [40270]
  • 82. Mosnier, Arnaud; Ouellet, Jean-Pierre; Sirois, Luc; Fournier, Nelson. 2003. Habitat selection and home-range dynamics of the Gaspe caribou: a hierarchical analysis. Canadian Journal of Zoology. 81(7): 1174-1184. [65806]
  • 88. Post, Eric; Boving, Pernille Sporon; Pedersen, Christian; MacArthur, Megan A. 2003. Synchrony between caribou calving and plant phenology in depredated and non-depredated populations. Canadian Journal of Zoology. 81(10): 1709-1714. [65810]
  • 90. Rettie, W. James; Messier, Francois. 2001. Range use and movement rates of woodland caribou in Saskatchewan. Canadian Journal of Zoology. 79(11): 1933-1940. [65813]
  • 91. Rominger, Eric M.; Oldemeyer, John L. 1989. Early-winter habitat of woodland caribou, Selkirk Mountains, British Columbia. Journal of Wildlife Management. 53(1): 238-243. [68116]
  • 96. Saperstein, Lisa Beth. 1993. Winter forage selection by barren-ground caribou: effects of fire and snow. Fairbanks, AK: University of Alaska. 79 p. Thesis. [65836]
  • 97. Schaefer, James A.; Pruitt, William O., Jr. 1991. Fire and woodland caribou in southeastern Manitoba. Wildlife Monograph No. 116. Washington, DC: The Wildlife Society, Inc. 39 p. [15247]
  • 101. Scotter, George Wilby. 1964. Effects of forest fires on the winter range of barren-ground caribou in northern Saskatchewan. Wildlife Management Bulletin, Series 1, No. 18. Ottawa: Canadian Wildlife Service, National Parks Branch, Department of Northern Affairs and National Resources. 111 p. [28989]
  • 102. Servheen, Gregg; Lyon, L. Jack. 1989. Habitat use by woodland caribou in the Selkirk Mountains. Journal of Wildlife Management. 53(1): 230-237. [13651]
  • 103. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 106. Swanson, J. D.; Barker, M. H. W. 1992. Assessment of Alaska reindeer populations and range conditions. Rangifer. 12(1): 22-43. [20496]
  • 107. Terry, Eliot L.; McLellan, Bruce N.; Watts, Glen S. 2000. Winter habitat ecology of mountain caribou in relation to forest management. Journal of Applied Ecology. 37(4): 589-602. [38067]
  • 34. Davis, James L.; Valkenburg, Patrick. 1983. Calving in recently burned habitat by caribou displaced from their traditional calving area. In: Alaska/Canada north, neighbours in science: proceedings of the 34th Alaska science conference; 1983 September 28-October 1; Whitehorse, YT. [Fairbanks, AK]: American Association for the Advancement of Science, Arctic Division; Ottawa, ON: Department of Indian and Northern Affairs, Northern Program: 19. [Abstract]. In cooperation with: Yukon Historical and Museums Association. [65844]
  • 69. Loughrey, A. G.; Kelsall, J. P. 1970. The ecology and population dynamics of the barren-ground caribou in Canada. In: Proceedings, Helsinki symposium; 1966; Helsinki, Finland. [Paris, France]: UNESCO: 275-280. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17029]
  • 111. U.S. Fish and Wildlife Service. 1994. Recovery plan: Selkirk Mountain woodland caribou: Rangifer tarandus caribou. Final Revision 2, [Online]. Portland OR: U.S. Fish and Wildlife Service, Pacific Region (Producer). 79 p. Available: http://ecos.fws.gov/docs/recovery_plans/1994/940304.pdf [2007, September 12]. [68117]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the terms: bog, climax, codominant, cover, lichen, lichens, shrub, shrubs, tundra

Caribou are considered part of the climax biota because of their dependence on late successional forests and associated lichen forage [68,101]. Caribou use old-growth and mature coniferous stands across their range [80,97]. Woodlands with sparse overstories of black spruce-paper birch (Picea mariana-Betula papyrifera) or jack pine (Pinus banksiana) and a dominant ground cover of lichens are heavily utilized [57,79,101]. Caribou frequent peatlands, bogs, muskegs, lake shores, and other wetland and riparian areas [37,61,97].

Alaska: Black spruce and white spruce (Picea glauca) in pure or codominant stands with lichen-moss understories are heavily utilized in Alaska [57,103]. Sedge meadows dominated by water sedge (Carex aquatilis), rock sedge (C. saxatilis), and tall cottonsedge (Eriophorum angustifolium) provide year-round forage. Barren ground caribou also utilize willow stands dominated by feltleaf willow (Salix alaxensis), Barclay's willow (S. barclayi), grayleaf willow (S. glauca), tealeaf willow (S. pulchra), and Richardson's willow (S. richardsonii). Grasslands dominated by rough fescue (Festuca altaica) with birch (Betula spp.) and willow (Salix spp.) associates are frequently utilized. Bog birch (Betula glandulosa) dominates some landscapes at 3,000 to 4,000 feet (900-1,200 m), with tealeaf willow and rough fescue codominant at 3,000 to 3,500 feet (900-1,100 m) [103]. Mountains <7,900 feet (2,400 m) in Denali National Park are characterized by shrub tundra dominated by birch and willow [1,18] and alpine zones dominated by sedges (Carex spp.) [1]. High-elevation tundra in Denali National Park is characterized by mountain avens (Dryas spp.) [18]. A mosaic of spruce (Picea spp.)-dominated forests, cottonsedge (Eriophorum spp.)-dominated tundra, and riparian areas with mixed spruce and willow exists below 2,600 feet (800 m) in Denali National Park [1,18].

Canadian Arctic Archipelago: Wilkinson and others [117] identified 5 distinct caribou habitats in the archipelago. Barren uplands are characterized by arctic dryad (D. integrifolia), sedges, willows, grasses, and lichens. Sedge meadows are dominated by water sedge (C. aquatilis var. stans), white cottonsedge (Eriophorum scheuchzeri), and Fisher's tundragrass (Dupontia fisheri). Sand dune habitats are dominated by feltleaf willow, polar willow (Salix pseudopolaris), dwarf fireweed (Chamerion latifolium), pale Indian paintbrush (Castilleja pallida), and grasses. Tundra tussocks are characterized by willows, arctic dryad, sedges, and grasses. Lakes and lake edges are dominated by water sedge, pendantgrass (Arctophila fulva), and false semaphoregrass (Pleuropogon sabinei) [117].

Idaho, Washington, and British Columbia: Western hemlock-western redcedar (Tsuga heterophylla-Thuja plicata) communities are important in to woodland caribou during autumn and early winter [6,36,102]. Mixed stands of old growth Engelmann spruce-subalpine fir (Picea engelmannii-Abies lasiocarpa) are preferred in late winter [6,36]. Caribou occasionally use interior lodgepole pine (Pinus contorta var. latifolia) forests [24,36].

Alberta: Black spruce-tamarack (Larix laricina) dominates lowland fens and bogs, while uplands are dominated by white spruce-jack pine-quaking aspen (Populus tremuloides) [76].

Northwest Territories, Saskatchewan, and Manitoba: Dominant species include black spruce, white spruce, and jack pine [77,80,89,99,101]. White birch, tamarack, quaking aspen, and balsam poplar (Populus balsamifera) are common associates [77,80,89,99]. Jack pine is abundant on some upland sites. Dominant shrubs on upland sites include mountain cranberry (Vaccinium vitis-idaea), bog blueberry (V. uliginosum), velvetleaf blueberry (V. myrtilloides), and bog Labrador tea (Ledum groenlandicum). Willow, birch, mountain alder (Alnus viridis subsp. crispa), white birch, and tamarack border lakes and streams [80]. Black spruce dominates mature and intermediate bog habitats. Alders (Alnus spp.) and willows form the understory in intermediate bog and bog-forest habitats [97].

Ontario: Star reindeer lichen (Cladonia alpestris), reindeer lichen (C. rangiferina and Cladonia spp.), and spineless reindeer lichen (C. mitis)- rich forests serve as late winter habitat for woodland caribou [116].

Quebec: Alpine zones >3,300 feet (1000 m) are characterized by ericaceous shrubs, lichens, mosses, and graminoids, while subalpine zones 3,000 to 3,300 feet (900-1000 m) are dominated by open white spruce and balsam fir (Picea balsamea) forest [82].

Newfoundland: Balsam fir-dominated forests are heavily utilized [74].

  • 99. Scotter, George W. 1968. Effects of forest fires on the lichen winter ranges of barren-ground caribou in northern Canada. Logan, UT: Utah State University. 127 p. Dissertation. [65839]
  • 1. Adams, Layne G.; Dale, Bruce W. 1998. Timing and synchrony of parturition in Alaskan caribou. Journal of Mammalogy. 79(1): 287-294. [65830]
  • 6. Apps, Clayton D.; McLellan, Bruce N.; Kinley, Trevor A.; Flaa, John P. 2001. Scale-dependent habitat selection by mountain caribou, Columbia Mountains, British Columbia. Journal of Wildlife Management. 65(1): 65-77. [65777]
  • 18. Burson, S. L., III; Belant, J. L.; Fortier, K. A.; Tomkiewicz, W. C., III. 2000. The effect of vehicle traffic on wildlife in Denali National Park. Arctic. 53(2): 146-151. [65783]
  • 24. Coxson, Darwyn S.; Marsh, Janet. 2001. Lichen chronosequences (postfire and postharvest) in lodgepole pine (Pinus contorta) forests of northern interior British Columbia. Canadian Journal of Botany. 79: 1449-1464. [40594]
  • 36. Detrick, Richard W. T. 1985. Effects of fire and logging on arboreal lichen availability to caribou. Moscow, ID: University of Idaho. 49 p. Thesis. [65846]
  • 37. Dunford, Jesse S.; McLoughlin, Philip D.; Dalerum, Fredrik; Boutin, Stan. 2006. Lichen abundance in the peatlands of northern Alberta: implications for boreal caribou. Ecoscience. 13(4): 469-474. [67385]
  • 57. Joly, Kyle; Dale, Bruce W.; Collins, William B.; Adams, Layne G. 2003. Winter habitat use by female caribou in relation to wildland fires in interior Alaska. Canadian Journal of Zoology. 81(7): 1192-1201. [65772]
  • 61. Klein, David R. 1982. Fire, lichens, and caribou. Journal of Range Management. 35(3): 390-395. [10898]
  • 68. Leopold, A. Starker; Darling, F. Fraser. 1953. Effects of land use on moose and caribou in Alaska. Transactions, 18th North American Wildlife Conference. 18: 553-562. [17034]
  • 74. Mahoney, Shane P.; Virgl, John A. 2003. Habitat selection and demography of a nonmigratory woodland caribou population in Newfoundland. Canadian Journal of Zoology. 81(2): 321-334. [65802]
  • 76. McLoughlin, Philip D.; Dzus, Elston; Wynes, Bob; Boutin, Stan. 2003. Declines in populations of woodland caribou. Journal of Wildlife Management. 67(4): 755-761. [65804]
  • 77. Metsaranta, Juha M.; Mallory, Frank F.; Cross, Dale W. 2003. Vegetation characteristics of forest stands used by woodland caribou and those disturbed by fire or logging in Manitoba. In: Couturier, Serge; van Ginhoven, Quentin, eds. Proceedings of the 9th North American caribou workshop; 2001 April 23-27; Kuujjuaq, QC. In: Rangifer. Special Issue No. 14: 255-266. [65833]
  • 79. Miller, Don. 2000. Lichens, wildfire, and caribou on the taiga ecosystem of northcentral Canada. In: Farnell, Rick; Russell, Don; van de Wetering, Debbie. Proceedings of the 8th North American caribou worksop; 1998 April 20-24; Whitehorse, YT. In: Rangifer. Tromso, Norway: Nordic Council for Reindeer Research; Special Issue. No. 12: 197-207. [65848]
  • 80. Miller, Donald R. 1976. Biology of the Kaminuriak population of barren-ground caribou. Part 3. Taiga winter range relationships and diet. Canadian Wildlife Service Rep. Series No. 36. Ottawa, ON: Environment Canada, Wildlife Service. 42 p. [13007]
  • 82. Mosnier, Arnaud; Ouellet, Jean-Pierre; Sirois, Luc; Fournier, Nelson. 2003. Habitat selection and home-range dynamics of the Gaspe caribou: a hierarchical analysis. Canadian Journal of Zoology. 81(7): 1174-1184. [65806]
  • 89. Rettie, W. James; Messier, Francois. 1998. Dynamics of woodland caribou populations at the southern limit of their range in Saskatchewan. Canadian Journal of Zoology. 76(2): 251-259. [65811]
  • 97. Schaefer, James A.; Pruitt, William O., Jr. 1991. Fire and woodland caribou in southeastern Manitoba. Wildlife Monograph No. 116. Washington, DC: The Wildlife Society, Inc. 39 p. [15247]
  • 101. Scotter, George Wilby. 1964. Effects of forest fires on the winter range of barren-ground caribou in northern Saskatchewan. Wildlife Management Bulletin, Series 1, No. 18. Ottawa: Canadian Wildlife Service, National Parks Branch, Department of Northern Affairs and National Resources. 111 p. [28989]
  • 102. Servheen, Gregg; Lyon, L. Jack. 1989. Habitat use by woodland caribou in the Selkirk Mountains. Journal of Wildlife Management. 53(1): 230-237. [13651]
  • 103. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 116. Webb, Elizabeth T. 1998. Survival, persistence, and regeneration of the reindeer lichens, Cladina stellaris, C. rangiferina, and C. mitis following clearcut logging and fores fire in northwestern Ontairo. In: Lankester, Murray; Racey, Gerald; Timmermann, Tim, eds. Proceedings of the 7th North American caribou conference; 1996 August 19-21; Thunder Bay, ON. In: Rangifer. Special Issue. No. 10: 41-47. [65843]
  • 117. Wilkinson, P. F.; Shank, C. C.; Penner, D. F. 1976. Muskox-caribou summer range relations on Banks Island, N.W.T. Journal of Wildlife Management. 40(1): 151-162. [62919]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Requirements

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caribou inhabit arctic tundra and subarctic (boreal) forest regions.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits arctic (including tussock tundra and sedge meadow) and subarctic tundra, open montane habitats, and open woodland, often on high mountain slopes and in alpine zones at elevations of 2,300-3,000 meters, where it feeds on lichens, mosses herbs, ferns, grasses, and shoots and leaves of deciduous shrubs and trees (especially willow--Salix spp.--and birch--Betula spp.).

A social deer, this species forms large regional herds of 50,000-500,000 animals which band together during the spring, although this herd is composed of generally single-sex subgroups with 10-1,000 individuals. Rutting takes place about October. Young are born in May and June after a gestation of about 228 days. One or two young are born; they wean at about 6 months; reach maturity at 2.5-3.5 years; and live up to 20 years. Thick fur and short tail are adaptations to extreme cold winters. Its ability to smell and find lichens and other food under snow is a special adaptation. The major predators are bears and wolves.

A highly nomadic species, caribou may travel 5,000 km/3,000 miles in a year, the longest documented movements of any terrestrial mammal. In addition, most populations undertake extensive migrations in the spring and fall, travelling. During these migrations, herds move at a rate of 19-55 kilometers/11-33 miles per day. The caribou's maximum running speed is 60-80 kmph/36-48 mph. Caribou are excellent swimmers, and will readily cross large rivers or lakes. When swimming, adults can maintain a speed of 6.5 kpmh / 4 mph, and when pressed can swim at 10 kmph / 6 mph. Population densities are very sparse - generally 0.5 animals per square kilometre of suitable habitat. However, during the migration period, concentrations may exceed 19,000 animals per square kilometre. In North America it is a migratory species, making seasonal movements from the coast in summer to the interior in winter, but in Europe reindeer are more sedentary (Herre 1986; Vevers and Pinner, 1948). The species migrates seasonally in Mongolia, but not over long distances (Litvinov and Bazardorj, 1992).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caribou inhabit arctic tundra and subarctic (boreal) forest regions.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Artic tundra (including tussock tundra and sedge meadow), subartic taiga, mature coniferous forest, semi-open and open bogs, rocky ridges with jack pine, and riparian zone. Migratory herds in Alaska, Yukon, and Northwest Territories winter in boreal forest, summer in tundra.

In northern British Columbia, seeks high south slopes in mountains as calving site (Bergerud et al. 1984). Porcupine Herd of northeastern Alaska and northwestern Yukon: females give birth on patches of bare ground within snowfields (Eastland et al. 1989); cows select areas north of the foothills (snow conditions permitting), thereby reducing exposure of calves to predators.

In winter in northeastern Alberta, woodland caribou selected forested fen peatland complexes; feeding activity was concentrated in forested raised bog islands, which may have been related to increased lichen biomass in these habitats (Bradshaw et al. 1995). "Mountain" caribou of southeastern British Columbia depend upon the arboreal lichens of older coniferous forests with high canopy closure, especially in late winter (Apps et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In areas where still ranges freely, may form herds and migrate seasonally. Tundra populations may migrate 800 miles between summer and winter ranges; other popualtions make seasonal elevational migrations. In northern Alaska, winters in northern foothills of Brooks Range, females reach calving areas along coastal plain by mid-May; population highly aggregated near arctic coast and river deltas in July (Carruthers et al. 1987); begin return migration to winter range in September-October; cows annually may travel over 5000 km (Fancy et al. 1989). Heard and Williams (1992) described the migration in the Northwest Territories, Yukon, and Alaska as follows: cows begin migration to tundra in March-April, reach calving grounds in time for early June parturition; adult males migrate later but most reach tundra by June; return to tree line by early September, may not enter forest until October. Did not migrate in southeastern Manitoba (Darby and Pruitt 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

More info for the terms: bog, cover, lichen, lichens, selection, shrubs, tree, wildfire

Food availability influences food selection. Caribou prefer vascular plants and mushrooms but exploit other food sources when these are not available [12]. The vascular plant species most commonly eaten by caribou throughout the United States and Canada include the young buds, catkins, leaves, and/or sprouts of water sedge, water horsetail (E. fluviatile), mountain cranberry, velvetleaf blueberry, bog blueberry, arctic willow (S. arctica), sheathed cottonsedge (Eriophorum vaginatum), bog Labrador tea, northern Labrador tea (Ledum decumbens), bog birch, and leatherleaf (Chamaedaphne calyculata) [2,14,26,66,79,80,96,98,99,103,109]. Other locally important foods include arctic dryad, saxifrage (Saxifraga spp.), bog rosemary (Andromeda spp.), black crowberry (Empetrum nigrum), sheep-laurel (Kalmia angustifolia), bog-laurel (K. polifolia), spruce, jack pine, tamarack, sedges (Cyperaceae), blueberries (Vaccinium spp.), willows (Salix spp.), birches (Betula spp.), grasses, and mosses [12,14,27,66,80,96,98,103,109]. Fungi, especially Boletus spp., Coprinus spp., Lycoperdon spp., and Morchella spp., are readily eaten in late summer and fall [12,80,103]. After fall frost, caribou consume terrestrial lichens and evergreen leaves [12]. In addition to milk, calves as young as 2 weeks old ingest leaves of willows, bog Labrador tea, leaves and stems of sedges and black crowberry, and fruticose lichens, including cup lichens (Cladonia spp.) [103]. For more complete lists of caribou diets, see Bergerud [12,14], Cringan [27], Miller [80], and Skoog [103] .

Lichens are prominent in the caribou diet throughout the year, but reach greatest importance in winter [27,80,96,101]. Lichens commonly eaten are reindeer lichen, star reindeer lichen, spineless reindeer lichen, tree reindeer lichen (Cladonia arbuscula), other reindeer lichens (Cladonia spp.), cup lichens (C. amaurocraea and C. uncialis), cetraria lichen (Flavocetraria nivalis), Iceland-moss (Cetraria islandica), felt lichen (Peltigera canina), and snow lichens (Stereocaulon spp.) [2,12,14,26,80,99,101,108]. Other lichens, including witch's hair lichens (Alectoria jubata, A. sarmentosa, and A. ochroleuca) and brittle lichens (Cornicularia spp.) are locally important food sources when available [2,26]. In British Columbia, horsehair lichens (Bryoria spp.), which are highly valued as forage in the area, are more abundant on subalpine fir and Engelmann spruce than on whitebark pine (Pinus albicaulis), lodgepole pine, or alpine larch (Larix lyallii) [60].

Lichens are the primary foods of caribou in winter [27,80,96,101]. However, lichens are generally low in nutrients, and caribou often lose weight with a winter diet heavy in lichens [12,33,80]. Caribou may persist on a diet that limits or excludes lichens, since caribou are able to exploit vascular plant resources when available [14,33]. In winter, snow accumulation influences caribou diet [12,92]. By mid-April in Saskatchewan, snow hardening made it difficult for the caribou to forage beneath the snow, so arboreal lichens were the primary available food source followed by terrestrial lichens, bog Labrador tea, and other deciduous shrubs and trees [79,80]. When caribou population densities were high on the Slate Islands in Lake Superior, caribou lightly browsed mountain maple (Acer spicatum), American mountain-ash (Sorbus americana), willows, red-osier dogwood (Cornus sericea), and downy arrowwood (Viburnum rafinesquianum) in winter [27]. Woodland caribou in British Columbia forage on arboreal lichens, subalpine fir, Engelmann spruce, and western hemlock in early winter when show accumulation is rapid. Oregon boxwood (Paxistima myrsinites) and other vascular plants were eaten in early winter when snow accumulation was slow [92]. When the snow forms a hard crust in open habitats, caribou move to forests to feed on arboreal lichens [12]. During periods when snow cover was ≤20 inches (51 cm) deep, woodland caribou in British Columbia fed on grouse whortleberry (Vaccinium scoparium), cup lichens, and horsehair lichens. When snow was ≥24 inches (62 cm) deep, they almost exclusively ate horsehair lichens and possibly small amounts of witch's hair lichen [60]. Overgrazing by caribou has reduced the amount of available forage and habitat on Alaskan islands, while wildfire has reduced lichen availability on the Alaskan mainland [106].

During northward migration in Saskatchewan in mid-February, barren ground caribou fed in early morning and early evening [80]. Caribou tend to move almost continuously, even when foraging, which reduces the possibility of overgrazing a feeding area [103]. Snow softens by late winter or early spring, making it possible for the caribou to feed on terrestrial lichens and ericaceous plants under the melting snow [80]. Caribou dig craters in the snow to forage for lichens and other vegetation [12,17]. Caribou prefer to crater in soft, shallow snow [96]. Only one caribou feeds in a crater at a time, and they compete for the most preferred craters [80].

  • 99. Scotter, George W. 1968. Effects of forest fires on the lichen winter ranges of barren-ground caribou in northern Canada. Logan, UT: Utah State University. 127 p. Dissertation. [65839]
  • 2. Ahti, T. 1959. Studies on the caribou lichen stands of Newfoundland. Annals of the Botanical Society. Vanamo. 30(4): 1-44. [18901]
  • 12. Bergerud, A. T. 1980. Caribou. In: Schmidt, John L.; Gilbert, Douglas L., eds. Big game of North America. Harrisburg, PA: Stackpole Books: 83-101. [14659]
  • 14. Bergerud, Arthur T. 1972. Food habits of Newfoundland caribou. Journal of Wildlife Management. 36(3): 913-923. [14760]
  • 17. Brown, W. Kent; Theberge, John B. 1990. The effect of extreme snowcover on feeding-site selection by woodland caribou. Journal of Wildlife Management. 54(1): 161-168. [65782]
  • 26. Crete, Michel; Huot, Jean; Gauthier, Line. 1990. Food selection during early lactation by caribou calving on the tundra in Quebec. Arctic. 43(1): 60-65. [14746]
  • 27. Cringan, Alexander Thom. 1957. History, food habits and range requirements of the woodland caribou of continental North America. Transactions, North American Wildlife Conference. 22: 485-501. [15651]
  • 33. Davis, James L.; Franzmann, Albert W. 1979. Fire-moose-caribou interrelationships: a review and assessment. Proceedings, North American Moose Conference Workshop. 15: 80-118. [7534]
  • 60. Kinley, Trevor A.; Bergenske, John; Davies, Julie-Anne; Quinn, David. 2003. Characteristics of early-winter caribou, Rangifer tarandus caribou, feeding sites in the southern Purcell Mountains, British Columbia. The Canadian Field-Naturalist. 117(3): 352-359. [65798]
  • 66. Larter, Nicholas C.; Nagy, John A. 1997. Peary caribou, muskoxen and Banks Island forage: assessing seasonal diet similarities. Rangifer. 17(1): 9-16. [54042]
  • 79. Miller, Don. 2000. Lichens, wildfire, and caribou on the taiga ecosystem of northcentral Canada. In: Farnell, Rick; Russell, Don; van de Wetering, Debbie. Proceedings of the 8th North American caribou worksop; 1998 April 20-24; Whitehorse, YT. In: Rangifer. Tromso, Norway: Nordic Council for Reindeer Research; Special Issue. No. 12: 197-207. [65848]
  • 80. Miller, Donald R. 1976. Biology of the Kaminuriak population of barren-ground caribou. Part 3. Taiga winter range relationships and diet. Canadian Wildlife Service Rep. Series No. 36. Ottawa, ON: Environment Canada, Wildlife Service. 42 p. [13007]
  • 92. Rominger, Eric M.; Oldemeyer, John L. 1994. Early-winter diet of woodland caribou in relation to snow accumulation, Selkirk Mountains, British Columbia, Canada. Canadian Journal of Zoology. 68(12): 2691-2694. [65814]
  • 96. Saperstein, Lisa Beth. 1993. Winter forage selection by barren-ground caribou: effects of fire and snow. Fairbanks, AK: University of Alaska. 79 p. Thesis. [65836]
  • 98. Scotter, George W. 1967. The winter diet of barren-ground caribou in northern Canada. Canadian Field-Naturalist. 81: 33-39. [16672]
  • 101. Scotter, George Wilby. 1964. Effects of forest fires on the winter range of barren-ground caribou in northern Saskatchewan. Wildlife Management Bulletin, Series 1, No. 18. Ottawa: Canadian Wildlife Service, National Parks Branch, Department of Northern Affairs and National Resources. 111 p. [28989]
  • 103. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 106. Swanson, J. D.; Barker, M. H. W. 1992. Assessment of Alaska reindeer populations and range conditions. Rangifer. 12(1): 22-43. [20496]
  • 108. Thomas, D. C.; Barry, S. J.; Alaie, G. 1996. Fire - caribou - winter range relationships in northern Canada. In: Proceedings, 2nd international arctic ungulate conference; August 13-17; Fairbanks, AK. In: Rangifer. 16(2): 57-67. [28961]
  • 109. Thomas, Donald C.; Edmonds, Janet. 1983. Rumen contents and habitat selection of Peary caribou in winter, Canadian Arctic Archipelago. Arctic and Alpine Research. 15(1): 97-105. [62930]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Caribou are mainly grazing herbivores. Their diet varies depending on the season. In summer they eat the leaves of willows and birches, mushrooms, cotton grass, sedges, and other ground dwelling kinds of vegetation. In the winter lichens are an important food source, although they continue to eat whatever vegetation is available.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; bryophytes; lichens

Other Foods: fungus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Caribou are primarily grazing herbivores. Their diet is most variable during the summer, when they consume the leaves of willows and birches, mushrooms, cotton grass, sedges and numerous other ground dwelling species of vegetation. Lichens are an important component of the diet, especially in winter, but are not eaten exclusively.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; bryophytes; lichens

Other Foods: fungus

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats various plants: leaves, buds and bark of trees and shrubs; grasses; sedges; forbs; mushrooms; terrestrial and arboreal lichens. In summer moves to new areas to find new plant growth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Known predators of adults and calves in North America include gray wolf, grizzly bear, American black bear (Ursus americanus), mountain lion (Puma concolor), wolverine (Gulo gulo), coyote (Canis latrans), arctic fox (Vulpes lagopus), Canada lynx (Lynx canadensis), golden eagle (Aquila chrysaetos), bald eagle (Haliaeetus leucocephalus), and common raven (Corvus corax) [9,11,12,15,58,59,74,83,85,89,103]. Polar bear (Ursus maritimus) may prey on caribou in areas where they cooccur, but no confirmed kills have been observed [16]. Another potential predator is the red fox (Vulpes vulpes fulva) [103].

Gray wolves are the primary predator of adult caribou [76,103]. Fire may lead to an increase in gray wolf populations, especially when other prey species such as moose (Alces alces) increase after fire [15,53].

  • 9. Banci, Vivian. 1994. Wolverine. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 99-127. [29934]
  • 11. Banfield, A. W. F.; Tener, J. S. 1958. A preliminary study of the Ungava caribou. Journal of Mammalogy. 39(4): 560-573. [12994]
  • 12. Bergerud, A. T. 1980. Caribou. In: Schmidt, John L.; Gilbert, Douglas L., eds. Big game of North America. Harrisburg, PA: Stackpole Books: 83-101. [14659]
  • 15. Bergerud, Arthur T. 1974. Decline of caribou in North America following settlement. Journal of Wildlife Management. 38(4): 757-770. [16767]
  • 16. Brook, Ryan K.; Richardson, Evan S. 2002. Observations of polar bear predatory behaviour toward caribou. Arctic. 55(2): 193-196. [65781]
  • 58. Kelsall, John P. 1957. Continued barren-ground caribou studies. Wildlife Management Bulletin Series 1: No. 12. Ottawa: Department of Northern Affairs and National Resources, National Parks Branch, Canadian Wildlife Service. 148 p. [16597]
  • 59. Kinley, Trevor A.; Apps, Clayton D. 2001. Mortality patterns in a subpopulation of endangered mountain caribou. Wildlife Society Bulletin. 29(1): 158-164. [65797]
  • 74. Mahoney, Shane P.; Virgl, John A. 2003. Habitat selection and demography of a nonmigratory woodland caribou population in Newfoundland. Canadian Journal of Zoology. 81(2): 321-334. [65802]
  • 76. McLoughlin, Philip D.; Dzus, Elston; Wynes, Bob; Boutin, Stan. 2003. Declines in populations of woodland caribou. Journal of Wildlife Management. 67(4): 755-761. [65804]
  • 83. Mowat, Garth; Heard, Douglas C. 2006. Major components of grizzly bear diet across North America. Canadian Journal of Zoology. 84(3): 473-489. [65807]
  • 85. Nybakk, Kai; Kjelvik, Ola; Kvam, Tor. 2000. Golden eagle predation on semidomestic reindeer. Wildlife Society Bulletin. 27(4): 1038-1042. [65809]
  • 89. Rettie, W. James; Messier, Francois. 1998. Dynamics of woodland caribou populations at the southern limit of their range in Saskatchewan. Canadian Journal of Zoology. 76(2): 251-259. [65811]
  • 103. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 53. Hunter, Malcom L., Jr. 1993. Natural FIRE REGIMES as spatial models for managing boreal forests. Biological Conservation. 65(2): 115-120. [22132]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
adult of Lipoptena cervi ectoparasitises Rangifer tarandus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Through their foraging activities, caribou have a dramatic impact on communities of vegetation throughout their range. They are also important prey species for large predators, such as bears and wolves, especially during the calving season.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Calves are vulnerable to predation by bears, wolves, and other predators during their first week of life. Healthy adult caribou are less susceptible to predation until old age and illness weakens them. By traveling in herds, caribou increase the number of individuals that can watch for predators.

Known Predators:

  • grizzly bears (Ursus_arctos)
  • gray wolves (Canis_lupus)
  • American black bears (Ursus_americanus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Through their foraging activities, caribou have a dramatic impact on communities of vegetation throughout their range. They are also important prey species for large predators, such as bears and wolves, especially during the calving season.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Calves are highly vulnerable to predation by bears, wolves, and other predators during their first week of life. Healthy adult caribou are less susceptible to predation until old age and illness weakens them. By traveling in herds, caribou increase the number of individuals that can watch for predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Rangifer tarandus is prey of:
Haliaeetus albicilla
Ursus arctos
Ursus americanus
Canis lupus

Based on studies in:
Russia (Tundra)

This list may not be complete but is based on published studies.
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Rangifer tarandus preys on:
phanerogams
lichens
Bryophyta
willows
sedges
grasses
tundra vegetation
fungi

Based on studies in:
Norway: Spitsbergen (Agricultural)
USA: Alaska (Tundra)
Russia (Tundra)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Further contributions to the ecology of Spitzbergen, J. Ecol. 16:193-268, from p. 217 (1928).
  • J. Brown, Ecological investigations of the Tundra biome in the Prudhoe Bay Region, Alaska, Special Report, no. 2, Biol. Pap. Univ. Alaska (1975), from p. xiv.
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: bog, cover, density, fire frequency, fire regime, fire-return interval, forbs, frequency, high-severity fire, lichen, lichens, litter, low-severity fire, mean fire-return interval, natural, selection, severity, shrubs, taiga, top-kill, tree, tundra

In black spruce-white birch forests, jack pine forests, and unburned tundra, caribou generally avoid burned areas ≤35 years after fire and show a preference for communities >50 years of age [57,96,97,101]. Caribou in the Northwest Territories utilized 151- to 250-year-old stands more than any other forest age class [108]. Average caribou use of black spruce forest in northern Canada was highest in >120-year-old stands and lowest in 1- to 10-year-old stands [99]. Jack pine forest and mixed-forest habitats that burned 4 to 5 years previously were significantly avoided (P<0.01) in Manitoba [97]. Woodland caribou showed a significant preference (P<0.01) for foraging and/or traveling in mature bog, intermediate bog, semiopen bog, sedge meadow, bog-forest, and jack pine forest, around lakes, and on roads that had not burned in ≥55 years in Manitoba [97]. A fire simulation model suggests that frequent fire and large fires reduce spruce-lichen habitats preferred by caribou [94]. In Alaska during winter, caribou were observed feeding along the edge of a burn in birch and ericaceous shrub-sedge communities near moraines [46]. In another Alaska study, edge habitats (<1,600 feet (500 m) of burned/unburned stand edge) were highly preferred over habitats >1,600 feet into either the stand or the burned area. Use of burned areas in Alaska was highest in November to December, but declined during late winter and spring [57]. In addition, unburned remnants and unburned stands adjacent to recent burns are used for feeding [78,79,97]. Caribou rarely forage within recent burns [78,79].

Caribou use burned areas for several reasons. For instance, Miller [79,81] reported that caribou used burned areas as refuges to escape predation. In another study, calving occurred in a recent burn adjacent to a traditional calving area in Alaska [34]. Recent burns are also commonly used during migratory and nonmigratory movements [78,81,96]. In late winter, caribou in Saskatchewan and Manitoba migrated through burned areas in long single lines [78]. Caribou also traverse burned areas between mature forest fragments and meadows [46,101]. Fire in tundra habitats removes woody debris, which facilitates travel [96]. However, burns in forested habitats may inhibit travel between unburned foraging sites. Surface fires can kill black spruce and burn off their roots, making standing snags susceptible to windthrow [70]. Windthrow in recent forest burns may hamper the movements of caribou [61,96,101].

The influence of burns on travel appears to depend on habitat characteristics. Large fires in Quebec during 1954 to 1955 appeared to block winter migration routes to the south, causing caribou to congregate in lichen-rich habitats in northern Quebec. This effect appeared to be short term [87]. Snow accumulation and hardness alters caribou movements. In Alaska, snow hardness was almost significantly greater (P=0.0731) in burned plots than in unburned plots. Fire may encourage earlier snow melt [96], which could facilitate spring migration (see Timing of Major Life History Events).

Effects of fire on caribou forage: Historically, fire was considered detrimental to caribou due to the destruction of lichen forage caused by fire [52,101]. Now, however, fire is perceived to improve the nutrient cycling and growth of lichens, sedges, shrubs, and forbs [56,96]. Fire reduces lichen availability, but enhances short-term productivity and quality of vascular plants such as sheathed cottonsedge, bog Labrador tea, and mountain cranberry [61,96,97]. The short-term increase in vascular plants enhances summer ranges, but the decrease in lichen availability is detrimental in winter ranges [97]. Late summer regeneration of sheathed cottonsedge following a midsummer tundra fire in Alaska provided food for a caribou herd moving through the burned area in late October [62]. The use of herbaceous vegetation, including sheathed cottonsedge and horsetail (Equisetum spp.), was limited in another study in Alaskan tundra, although availability increased after recent fire [96].

Lichens are typically consumed by fire, including surface fires, so limited food is available to caribou during early successional stages after fire [61,70]. Frequent fire may delay the regeneration of forests that support lichen growth or convert a burned area into tundra, which may not support lichen growth [61]. Fire affected caribou forage availability but not selection in the Alaskan tundra [96]. Changes in arboreal lichen biomass and availability were affected by high- and low-severity fire and clearcutting in Idaho, Washington, and British Columbia. No arboreal lichens were found on sites that experienced high-severity fire or clearcutting during the previous 40 years. Higher arboreal lichen biomass was found at high-severity burn sites aged 41 to 80 years than on clearcut sites of similar age. Arboreal lichen biomass in low-severity fire sites was higher 41 to 80 years after fire than in low-severity sites 1 to 40 years after fire [36].

Lichen regeneration following fire depends on many factors including burn patchiness, intensity, severity, extent of the burn, prefire vegetation, seral stage, and climate [61,115]. Reindeer and cup lichens (Cladonia spp.) are virtually absent until a recovering habitat reaches midsuccession [99,101,116]. Lichen regeneration, including reindeer lichens, cup lichens, felt lichens (Peltigera spp.), and arboreal lichens, takes 30 to120 years or more depending on the species [2,36,78,79,80,99,101,108]. Available forage of shrubs and lichens on average is highest in 51- to 120+-year-old stands and lowest in 1- to 10-year-old stands [99,108]. Stands <60 years old may have standing crops of lichens similar to 120-year-old stands [80]. Fire at the landscape level maintains a diverse mosaic of vegetation and successional stages in forested ecosystems, which overall contributes to the availability of lichens [61].

Fire is necessary in the landscape to maintain lichen forage availability over the long term [97]. Caribou response to fire is influenced by the duration of lichen recovery and availability of alternate feeding sites [61]. In forests >130 years old, terrestrial lichens are replaced by feathermosses, including mountain-fern moss (Hylocomium splendens) and Schreber's moss (Pleurozium schreberi), and vascular plants such as mountain cranberry [24,75,81,97] due to increasing tree density, canopy closure, and litter accumulation [24,75,81]. Fire destroys thick masses of sphagnum mosses (Sphagnum spp.) and feathermosses (Hylocomium spp.) and removes accumulated litter, allowing lichens to regenerate [3,81,93,97,100].

Feltleaf willow is a preferred caribou browse plant and a common associate in Alaska and the Canadian arctic [103,117]. Feltleaf willow is a fire-adapted species that sprouts from the root crown following top-kill by fire [86,115,119]. Feltleaf willow produces abundant, wind-dispersed seed that is important in colonizing burned areas [112,115].

Fire regime: Caribou habitats in taiga generally experience moderate to long fire-return intervals, while tundra habitats rarely burn. Summer fires are rare in northern Canada because of the heterogeneous landscape of wet and dry tundra and rock barrens. Thus, barren ground caribou are typically only affected by fires in their forested winter habitats [100]. The fire season in the Northwest Territories is mid-June to mid-August [41,56]. The fire season in interior Alaska is 1 April to 30 September, with most fires occurring May to July [40,112]. Fires in black spruce/lichen forests in the Northwest Territories and interior Alaska are primarily lightning-caused [41,50,71].

Black spruce-birch forest has the highest fire frequency of any forest type in interior Alaska [114]. Estimated fire-return intervals in the black spruce-birch ecosystem vary from 50 to 200 years [51,115]. Fires occur every 50 to 70 years in black spruce-white spruce/bog birch/reindeer lichen communities in interior Alaska [40]. Heinselman [51] estimates a fire-return interval of 130 years for open black spruce/reindeer lichen forest and 100 years for closed-canopy black spruce forest. Mean fire-return intervals in lowland black spruce forests on the Kenai Peninsula, Alaska, range from 89 to 195 years [4,72]. Black spruce-birch communities experience high-severity, stand-replacing fires. These communities are highly flammable due to the abundance of ericaceous shrubs, the prevalence of dead, low-hanging branches on the black spruce trees, which are often covered with highly flammable epiphytic lichens, and to the thick moss and lichen mats that cover the forest floor and become highly flammable after periods of low rainfall [70,71,113].

White spruce is also a predominant species in caribou habitat [57,103]. Fire frequency in white spruce forest types is generally 60 to 200 years [84]. Some white spruce forests located in floodplains are >300 years old in Alberta [51].

Jack pine is an important stand component for caribou in eastern Canadian forests [76,80,99,101]. Estimates of fire-return intervals in jack pine forests are generally <50 years [48]. In northern Ontario, major fire events occur every 5 to 30 years in jack pine forests [73]. The mean fire-return interval for jack pine forests in the Athabasca Plains in northern Saskatchewan and northeastern Alberta is 38 years [20]. Upland ridges and ridge complexes that lack natural fire breaks burn most frequently. Jack pine forests that burn more frequently than every 5 to 10 years become pine barrens [31]. Lichen mats develop within 40 years and support fire in jack pine forests [20].

Balsam fir habitats are also utilized in eastern Canada [74,82]. Balsam fir is usually rare or absent for the first 30 to 50 years after fire, but establishes thereafter under the canopy of its seral associates [5,35,42].

Engelmann spruce-subalpine fir forests provide prime habitat for endangered woodland caribou in the Columbia Mountains [6,36,55,102]. Engelmann spruce-subalpine fir forests usually develop in cool, moist locations with an average fire-return interval of ≥150 years [7]. Moist, mid- and high-elevation subalpine fir habitat types experience stand-replacing fires at intervals of ≥90 years [7,105].

The following table provides fire regime information that may be relevant to caribou.

Fire regime information on vegetation communities in which caribou may occur. Fire regime characteristics are taken from the LANDFIRE Rapid Assessment Vegetation Models [65]. These vegetation models were developed by local experts using available literature, local data, and expert opinion as documented in the PDF files linked from the Potential Natural Vegetation Groups listed below.
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northern Rockies Forested
Western larch-lodgepole pine-Douglas-fir Replacement 33% 200 50 250
Mixed 67% 100 20 140
Lower subalpine lodgepole pine Replacement 73% 170 50 200
Mixed 27% 450 40 500
*Fire Severities:
Replacement=Any fire that causes greater than 75% top removal of a vegetation-fuel type, resulting in general replacement of existing vegetation; may or may not cause a lethal effect on the plants.
Mixed=Any fire burning more than 5% of an area that does not qualify as a replacement, surface, or low-severity fire; includes mosaic and other fires that are intermediate in effects [45,64].
  • 99. Scotter, George W. 1968. Effects of forest fires on the lichen winter ranges of barren-ground caribou in northern Canada. Logan, UT: Utah State University. 127 p. Dissertation. [65839]
  • 2. Ahti, T. 1959. Studies on the caribou lichen stands of Newfoundland. Annals of the Botanical Society. Vanamo. 30(4): 1-44. [18901]
  • 6. Apps, Clayton D.; McLellan, Bruce N.; Kinley, Trevor A.; Flaa, John P. 2001. Scale-dependent habitat selection by mountain caribou, Columbia Mountains, British Columbia. Journal of Wildlife Management. 65(1): 65-77. [65777]
  • 24. Coxson, Darwyn S.; Marsh, Janet. 2001. Lichen chronosequences (postfire and postharvest) in lodgepole pine (Pinus contorta) forests of northern interior British Columbia. Canadian Journal of Botany. 79: 1449-1464. [40594]
  • 36. Detrick, Richard W. T. 1985. Effects of fire and logging on arboreal lichen availability to caribou. Moscow, ID: University of Idaho. 49 p. Thesis. [65846]
  • 55. Johnson, Donald R.; Miller, Donald R.; Peek, James M. 1977. Guidelines for human activity within the range of mountain caribou, southern Selkirk Mountains. Misc. Publ. No. 3. Moscow, ID: University of Idaho, Forest, Wildlife and Range Experiment Station. 5 p. [13652]
  • 57. Joly, Kyle; Dale, Bruce W.; Collins, William B.; Adams, Layne G. 2003. Winter habitat use by female caribou in relation to wildland fires in interior Alaska. Canadian Journal of Zoology. 81(7): 1192-1201. [65772]
  • 61. Klein, David R. 1982. Fire, lichens, and caribou. Journal of Range Management. 35(3): 390-395. [10898]
  • 70. Lutz, H. J. 1956. Ecological effects of forest fires in the interior of Alaska. Tech. Bull. No. 1133. Washington, DC: U.S. Department of Agriculture, Forest Service. 121 p. [7653]
  • 74. Mahoney, Shane P.; Virgl, John A. 2003. Habitat selection and demography of a nonmigratory woodland caribou population in Newfoundland. Canadian Journal of Zoology. 81(2): 321-334. [65802]
  • 76. McLoughlin, Philip D.; Dzus, Elston; Wynes, Bob; Boutin, Stan. 2003. Declines in populations of woodland caribou. Journal of Wildlife Management. 67(4): 755-761. [65804]
  • 78. Miller, D. R. 1980. Wildfire effects on barren-ground caribou wintering on the taiga of northcentral Canada: a reassessment. In: Reimers, Eigil; Gaare, Eldar; Skjenneberg, Sven, eds. Proceedings of the 2nd international reindeer/caribou symposium; 1979 September 17-21; Roros, Norway. Trondheim, Norway: Direktoratet for vilt og ferskvannsfisk: 84-98. [65849]
  • 79. Miller, Don. 2000. Lichens, wildfire, and caribou on the taiga ecosystem of northcentral Canada. In: Farnell, Rick; Russell, Don; van de Wetering, Debbie. Proceedings of the 8th North American caribou worksop; 1998 April 20-24; Whitehorse, YT. In: Rangifer. Tromso, Norway: Nordic Council for Reindeer Research; Special Issue. No. 12: 197-207. [65848]
  • 80. Miller, Donald R. 1976. Biology of the Kaminuriak population of barren-ground caribou. Part 3. Taiga winter range relationships and diet. Canadian Wildlife Service Rep. Series No. 36. Ottawa, ON: Environment Canada, Wildlife Service. 42 p. [13007]
  • 81. Miller, Donald Ray. 1976. Wildfire and caribou on the taiga ecosystem of northcentral Canada. Moscow, ID: University of Idaho. 129 p. Dissertation. [40270]
  • 82. Mosnier, Arnaud; Ouellet, Jean-Pierre; Sirois, Luc; Fournier, Nelson. 2003. Habitat selection and home-range dynamics of the Gaspe caribou: a hierarchical analysis. Canadian Journal of Zoology. 81(7): 1174-1184. [65806]
  • 96. Saperstein, Lisa Beth. 1993. Winter forage selection by barren-ground caribou: effects of fire and snow. Fairbanks, AK: University of Alaska. 79 p. Thesis. [65836]
  • 97. Schaefer, James A.; Pruitt, William O., Jr. 1991. Fire and woodland caribou in southeastern Manitoba. Wildlife Monograph No. 116. Washington, DC: The Wildlife Society, Inc. 39 p. [15247]
  • 101. Scotter, George Wilby. 1964. Effects of forest fires on the winter range of barren-ground caribou in northern Saskatchewan. Wildlife Management Bulletin, Series 1, No. 18. Ottawa: Canadian Wildlife Service, National Parks Branch, Department of Northern Affairs and National Resources. 111 p. [28989]
  • 102. Servheen, Gregg; Lyon, L. Jack. 1989. Habitat use by woodland caribou in the Selkirk Mountains. Journal of Wildlife Management. 53(1): 230-237. [13651]
  • 103. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 108. Thomas, D. C.; Barry, S. J.; Alaie, G. 1996. Fire - caribou - winter range relationships in northern Canada. In: Proceedings, 2nd international arctic ungulate conference; August 13-17; Fairbanks, AK. In: Rangifer. 16(2): 57-67. [28961]
  • 116. Webb, Elizabeth T. 1998. Survival, persistence, and regeneration of the reindeer lichens, Cladina stellaris, C. rangiferina, and C. mitis following clearcut logging and fores fire in northwestern Ontairo. In: Lankester, Murray; Racey, Gerald; Timmermann, Tim, eds. Proceedings of the 7th North American caribou conference; 1996 August 19-21; Thunder Bay, ON. In: Rangifer. Special Issue. No. 10: 41-47. [65843]
  • 117. Wilkinson, P. F.; Shank, C. C.; Penner, D. F. 1976. Muskox-caribou summer range relations on Banks Island, N.W.T. Journal of Wildlife Management. 40(1): 151-162. [62919]
  • 50. Heinselman, Miron L. 1981. Fire and succession in the conifer forests of northern North America. In: West, Darrell C.; Shugart, Herman H.; Botkin, Daniel B., eds. Forest succession: concepts and applications. New York: Springer-Verlag: 374-405. [29237]
  • 7. Arno, Stephen F. 1980. Forest fire history in the Northern Rockies. Journal of Forestry. 78(8): 460-465. [11990]
  • 65. LANDFIRE Rapid Assessment. 2007. Rapid assessment reference condition models. In: LANDFIRE. U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab; U.S. Geological Survey; The Nature Conservancy (Producers). Available: http://www.landfire.gov/models_EW.php [66533]
  • 3. Ahti, T.; Hepburn, T. L. 1967. Preliminary studies on woodland caribou range, especially on lichen stands, in Ontario. Res. Rep. (Wildlife) No. 74. Toronto, ON: Ontario Department of Lands and Forests, Research Branch. 134 p. [13294]
  • 5. Apfelbaum, Steven; Haney, Alan. 1981. Bird populations before and after wildfire in a Great Lakes pine forest. The Condor. 83: 347-354. [8556]
  • 20. Carroll, S. B.; Bliss, L. C. 1982. Jack pine - lichen woodland on sandy soils in northern Saskatchewan and northeastern Alberta. Canadian Journal of Botany. 60: 2270-2282. [7283]
  • 31. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 35. Day, R. J.; Harvey, E. M. 1981. Forest dynamics in boreal mixedwood. In: Whitney, R. D.; McClain, K. M., compilers. Boreal mixedwood: Proceedings of a symposium; 1980 September 16-18; Thunder Bay, ON. COJFRC Symp. Proceedings O-P-9. Sault Ste. Marie, ON: Environment Canada, Canadian Forestry Service, Great Lakes Forestry Research Centre: 29-41. [14204]
  • 40. Foote, M. Joan. 1983. Classification, description, and dynamics of plant communities after fire in the taiga of interior Alaska. Res. Pap. PNW-307. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 108 p. [18707]
  • 41. Forster, W.; Epp, H.; Lanoville, R. A. 1994. Fire ecology of the caribou range of northwest Canada. In: Proceedings, 12th conference on fire and forest meteorology; 1993 October 26-28; Jekyll Island, GA. Bethesda, MD: Society of American Foresters: 620-627. [26333]
  • 42. Foster, D. R.; King, G. A. 1986. Vegetation pattern and diversity in s.e. Labrador, Canada: Betula papyrifera (birch) forest development in relation to fire history and physiography. Journal of Ecology. 74: 465-483. [14651]
  • 46. Hanson, William A. 1979. Preliminary results of the Bear Creek fire effects studies. Proposed open file report. Anchorage, AK: U.S. Department of the Interior, Bureau of Land Management, Anchorage District Office. 83 p. [6400]
  • 48. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 52. Holechek, Jerry L. 1981. Brush control impacts on rangeland wildlife. Journal of Soil and Water Conservation. 36(5): 265-269. [1182]
  • 56. Johnson, E. A.; Rowe, J. S. 1975. Fire in the subarctic wintering ground of the Beverly caribou herd. The American Midland Naturalist. 94(1): 1-14. [8384]
  • 62. Klein, David. 1979. Wildfire, lichens and caribou. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Government of Yukon, Yukon Wildlife Branch: 37-65. [14074]
  • 71. Lutz, H. J. 1960. Fire as an ecological factor in the boreal forest of Alaska. Journal of Forestry. 58: 454-460. [16603]
  • 72. Lynch, Jason A.; Hollis, Jeremy L.; Hu, Feng Sheng. 2004. Climatic and landscape controls of the boreal forest fire regime: Holocene records from Alaska. Journal of Ecology. 92(3): 477-489. [48477]
  • 73. Lynham, Timothy J.; Stocks, B. J. 1991. The natural fire regime of an unprotected section of the boreal forest in Canada. In: Proceedings, 17th Tall Timbers fire ecology conference; 1989 May 18-21; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 99-109. [17602]
  • 75. Maikawa, E.; Kershaw, K. A. 1976. Studies on lichen-dominated systems. XIX. The postfire recovery sequence of black spruce-lichen woodland in the Abitau Lake region, N.W.T. Canadian Journal of Botany. 54: 2679-2687. [7225]
  • 84. Nienstaedt, Hans; Zasada, John C. 1990. Picea glauca (Moench) Voss white spruce. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 204-226. [13385]
  • 86. Parminter, John. 1984. Fire-ecological relationships for the biogeoclimatic zones of the northern portion of the Mackenzie Timber Supply Area. In: Northern Fire Ecology Project: Northern Mackenzie Timber Supply Area. Victoria, BC: Province of British Columbia, Ministry of Forests. 102 p. [9206]
  • 87. Payette, Serge; Boudreau, Stephane; Morneau, Claude; Pitre, Nadia. 2004. Long-term interactions between migratory caribou, wildfires and Nunavik hunters inferred from tree rings. Ambio. 33(8): 482-486. [61106]
  • 93. Rowe, J. S.; Scotter, G. W. 1973. Fire in the boreal forest. Quaternary Research. 3: 444-464. [72]
  • 100. Scotter, George W. 1971. Wildfires in relation to the habitat of barren-ground caribou in the taiga of northern Canada. In: Proceedings, annual Tall Timbers fire ecology conference; 1970 August 20-21; Fredericton, NB. No. 10. Fredericton, NB: Tall Timbers Research Station: 85-105. [18935]
  • 105. Sneck, Kathleen M. Davis. 1977. The fire history Coram Experimental Forest. Missoula, MT: University of Montana. 134 p. Thesis. [7441]
  • 112. Viereck, Leslie A. 1973. Wildfire in the taiga of Alaska. Quaternary Research. 3: 465-495. [7247]
  • 113. Viereck, Leslie A. 1975. Forest ecology of the Alaska taiga. In: Proceedings of the circumpolar conference on northern ecology; 1975 September 15-18; Ottawa, ON. Washington, DC: U.S. Department of Agriculture, Forest Service: 1-22. [7315]
  • 114. Viereck, Leslie A.; Foote, Joan; Dyrness, C. T.; Van Cleve, Keith; Kane, Douglas; Seifert, Richard. 1979. Preliminary results of experimental fires in the black spruce type of interior Alaska. Res. Note PNW-332. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 27 p. [7077]
  • 115. Viereck, Leslie A.; Schandelmeier, Linda A. 1980. Effects of fire in Alaska and adjacent Canada--a literature review. BLM-Alaska Tech. Rep. 6; BLM/AK/TR-80/06. Anchorage, AK: U.S. Department of the Interior, Bureau of Land Management, Alaska State Office. 124 p. [28862]
  • 119. Wolff, Jerry O.; Zasada, John C. 1979. Moose habitat and forest succession on the Tanana River floodplain and Yukon-Tanana upland. In: Proceedings, North American Moose Conference and Workshop No 15; 1979 March 12-16; Soldotna-Kenai, AK. Thuderbay, ON: Lakehead University, School of Forestry: 213-244. [6860]
  • 4. Anderson, R. S.; Hallett, D. J.; Berg, E.; Jass, R. B.; Toney, J. L.; de Fontaine, C. S.; DeVolder, A. 2006. Holocene development of boreal forests and FIRE REGIMES on the Kenai lowlands of Alaska. The Holocene. 16(6): 791-803. [66312]
  • 51. Heinselman, Miron L. 1981. Fire intensity and frequency as factors in the distribution and structure of northern ecosystems. In: Mooney, H. A.; Bonnicksen, T. M.; Christensen, N. L.; Lotan, J. E.; Reiners, W. A., technical coordinators. FIRE REGIMES and ecosystem properties: Proceedings of the conference; 1978 December 11-15; Honolulu, HI. Gen. Tech. Rep. WO-26. Washington, DC: U.S. Department of Agriculture, Forest Service: 7-57. [4390]
  • 94. Rupp, T. Scott; Olson, Mark; Adams, Layne G.; Dale, Bruce W.; Joly, Kyle; Henkelman, Jonathan; Collins, William B.; Starfield, Anthony M. 2006. Simulating the influences of various FIRE REGIMES on caribou winter habitat. Ecological Applications. 16(5): 1730-1743. [65276]
  • 64. LANDFIRE Rapid Assessment. 2005. Reference condition modeling manual (Version 2.1), [Online]. In: LANDFIRE. Cooperative Agreement 04-CA-11132543-189. Boulder, CO: The Nature Conservancy; U.S. Department of Agriculture, Forest Service; U.S. Department of the Interior (Producers). 72 p. Available: http://www.landfire.gov/downloadfile.php?file=RA_Modeling_Manual_v2_1.pdf [2007, May 24]. [66741]
  • 45. Hann, Wendel; Havlina, Doug; Shlisky, Ayn; [and others]. 2005. Interagency fire regime condition class guidebook. Version 1.2, [Online]. In: Interagency fire regime condition class website. U.S. Department of Agriculture, Forest Service; U.S. Department of the Interior; The Nature Conservancy; Systems for Environmental Management (Producer). Variously paginated [+ appendices]. Available: http://www.frcc.gov/docs/1.2.2.2/Complete_Guidebook_V1.2.pdf [2007, May 23]. [66734]
  • 34. Davis, James L.; Valkenburg, Patrick. 1983. Calving in recently burned habitat by caribou displaced from their traditional calving area. In: Alaska/Canada north, neighbours in science: proceedings of the 34th Alaska science conference; 1983 September 28-October 1; Whitehorse, YT. [Fairbanks, AK]: American Association for the Advancement of Science, Arctic Division; Ottawa, ON: Department of Indian and Northern Affairs, Northern Program: 19. [Abstract]. In cooperation with: Yukon Historical and Museums Association. [65844]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Direct Effects of Fire

More info for the terms: taiga, tundra

Since caribou are highly mobile, the chances of caribou being directly killed by fire are minimal [33]. Fire-related deaths of large mammals are typically a result of smoke inhalation [63]. Evidence of caribou deaths via smoke inhalation was not found in this literature review. A small group of caribou was seen lying in an open area with low vegetation that was completely surrounded by fire in Alaska [43]. The group was later observed moving away from the area without any apparent harm caused by the fire [43]. At no time did the observers indicate that the caribou appeared panicked by the fire. Many caribou herds spend the fire season in tundra habitats where fire danger is lower than in taiga habitats [33], so risk of mortality from fire is low for caribou in tundra.

Starvation following the loss of forage due to fire is a potential threat. During the winter following the large fires in Yellowstone National Park in 1988, thousands of elk (Cervus elaphus) died from starvation [63]. With a long-term loss of forage following fire, major declines in caribou herd size would likely result.

  • 33. Davis, James L.; Franzmann, Albert W. 1979. Fire-moose-caribou interrelationships: a review and assessment. Proceedings, North American Moose Conference Workshop. 15: 80-118. [7534]
  • 43. Hakala, John B.; Seemel, Robert K.; Richey, Robert A.; Kurtz, John E. 1971. Fire effects and rehabilitation methods--Swanson-Russian Rivers fires. In: Slaughter, C. W.; Barney, Richard J.; Hansen, G. M., eds. Fire in the northern environment--a symposium: Proceedings of a symposium; 1971 April 13-14; Fairbanks, AK. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Range and Experiment Station: 87-99. [15721]
  • 63. Koch, Peter. 1996. Lodgepole pine commercial forests: an essay comparing the natural cycle of insect kill and subsequent wildfire with management for utilization and wildlife. Gen. Tech. Rep. INT-GTR-342. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 24 p. [27158]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: natural, parturition, polygamous, tundra

Originally, an estimated 3 to 5 million caribou roamed North America. The estimated caribou population in North America as of 1980 had declined to 935,000 [12]. The size of individual herds can fluctuate widely over time [12,103,106]. Thus, the population fluctuations of a single herd may not reflect the overall dynamics of the species.

Caribou migrate between summer and winter habitats. Spring migration begins as early as mid-February and is typically completed by June [58,69,80]. Early spring thaws allow caribou to migrate to calving grounds early, while late-melting snow packs can delay migrations for a full month [103]. All adult males as well as females that have not successfully bred begin the spring migration in June, often when pregnant females and their yearlings have already reached the calving grounds [69]. A sudden decrease in caribou movements occurs during calving [39]. Winter migrations commence by late September or October. Breeding in migratory herds occurs early into the winter migration [103]. Caribou often follow the same migration routes year after year [58]. For herds summering in northern tundra, forested wintering grounds are up to 800 miles (1,300 km) away. Herds in mountainous areas may move from alpine tundra in summer to forests at lower elevations in winter [10] instead of undertaking long-distance migrations.

Other seasonal movements are common as well. Midsummer migrations were observed in Northwest Territories herds beginning around mid-August and possibly ending sometime in September [58]. Movements during summer are attributed to harassment by black flies (Simuliidae), bot flies (Oestridae), and mosquitoes (Culicidae) [103]. Caribou move to cool shady forests, windy hilltops, and snow and ice fields to reduce insect attacks. Caribou continue moving and running if they cannot escape insects [12]. Some herds migrate to new areas throughout winter as well [58,80]. In Manitoba, winter movements were most consistent during the coldest periods [80].

Caribou show strong site fidelity to calving areas [39,103]. Summering ground use is somewhat variable, but the same general areas are often used repeatedly [103]. The locations of wintering sites are highly variable, although some areas are used year after year [29,39,103].

Caribou reach sexual maturity at 16 to 17 months of age [69,89], but yearlings rarely mate [12,103]. Females begin mating at 28 to 41 months of age [12,15,103]. Most males do not breed successfully until they are 4 to 5 years old [69].

The breeding season ranges from late August to late October or at the beginning of the winter migration [12,103]. Males are polygamous and travel with small bands of females and their calves during the rut [10,69]. Gestation lasts 225 to 235 days [10,12,103]. Parturition takes place in May and June in most herds [1,10,11,12,69,88,90], with a maximum range between late April and early July [10,58]. Females from northern herds typically calve later than those to the south [10]. Females give birth to 1 calf [10,12,15]. Births are highly synchronized, with up to 90% of calves in a herd being born during a 5- to 15-day period [1,12,88]. Post and others [88] suggested that regardless of predation pressure, calving synchrony and timing are largely influenced by the emergence of edible plants.

Calves are highly vulnerable to predation, which is the most common cause of calf mortality [12,15]. Calf mortality is typically 14% to 77% during the first year [12,67,74,89]. In areas with high densities of gray wolves (Canis lupus) or grizzly bears (Ursus arctos horribilis), calf mortality can exceed 90% [12]. Weather conditions also influence calf production and survival [15]. Winter calf survival in a Peary caribou herd in the Northwest Territories was highest in years with deep, hard snow. However, in the same study, mild winters and less snowfall led to an increase in calf production the following year [67].

Annual adult mortality is also influenced by predator densities [12]. Natural adult mortality generally ranges 4% to 16% annually [12,74,76,89]. Adults in a small population of woodland caribou in British Columbia suffered unusually high mortality, with an average annual rate of 24% [59]. The maximum lifespan of caribou is around 12 to 16 years [32,69,103].

  • 1. Adams, Layne G.; Dale, Bruce W. 1998. Timing and synchrony of parturition in Alaskan caribou. Journal of Mammalogy. 79(1): 287-294. [65830]
  • 10. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 11. Banfield, A. W. F.; Tener, J. S. 1958. A preliminary study of the Ungava caribou. Journal of Mammalogy. 39(4): 560-573. [12994]
  • 12. Bergerud, A. T. 1980. Caribou. In: Schmidt, John L.; Gilbert, Douglas L., eds. Big game of North America. Harrisburg, PA: Stackpole Books: 83-101. [14659]
  • 15. Bergerud, Arthur T. 1974. Decline of caribou in North America following settlement. Journal of Wildlife Management. 38(4): 757-770. [16767]
  • 29. Cumming, H. G. 1992. Woodland caribou: facts for forest managers. Forestry Chronicle. 68(4): 481-491. [19294]
  • 32. Cuyler, Christine; Ostergaard, Jette Buch. 2005. Fertility in two West Greenland caribou Rangifer tarandus groenlandicus populations during 1996/97: potential for rapid growth. Wildlife Biology. 11(3): 221-227. [55813]
  • 39. Ferguson, S. H.; Elkie, P. C. 2004. Seasonal movement patterns of woodland caribou (Rangifer tarandus caribou). Journal of Zoology. 262(2): 125-134. [65791]
  • 58. Kelsall, John P. 1957. Continued barren-ground caribou studies. Wildlife Management Bulletin Series 1: No. 12. Ottawa: Department of Northern Affairs and National Resources, National Parks Branch, Canadian Wildlife Service. 148 p. [16597]
  • 59. Kinley, Trevor A.; Apps, Clayton D. 2001. Mortality patterns in a subpopulation of endangered mountain caribou. Wildlife Society Bulletin. 29(1): 158-164. [65797]
  • 67. Larter, Nicholas C.; Nagy, John A. 2000. Calf production and overwinter survival estimates for Peary caribou, Rangifer tarandus pearyi, on Banks Island, Northwest Territories. The Canadian Field-Naturalist. 114(4): 661-670. [65799]
  • 74. Mahoney, Shane P.; Virgl, John A. 2003. Habitat selection and demography of a nonmigratory woodland caribou population in Newfoundland. Canadian Journal of Zoology. 81(2): 321-334. [65802]
  • 76. McLoughlin, Philip D.; Dzus, Elston; Wynes, Bob; Boutin, Stan. 2003. Declines in populations of woodland caribou. Journal of Wildlife Management. 67(4): 755-761. [65804]
  • 80. Miller, Donald R. 1976. Biology of the Kaminuriak population of barren-ground caribou. Part 3. Taiga winter range relationships and diet. Canadian Wildlife Service Rep. Series No. 36. Ottawa, ON: Environment Canada, Wildlife Service. 42 p. [13007]
  • 88. Post, Eric; Boving, Pernille Sporon; Pedersen, Christian; MacArthur, Megan A. 2003. Synchrony between caribou calving and plant phenology in depredated and non-depredated populations. Canadian Journal of Zoology. 81(10): 1709-1714. [65810]
  • 89. Rettie, W. James; Messier, Francois. 1998. Dynamics of woodland caribou populations at the southern limit of their range in Saskatchewan. Canadian Journal of Zoology. 76(2): 251-259. [65811]
  • 90. Rettie, W. James; Messier, Francois. 2001. Range use and movement rates of woodland caribou in Saskatchewan. Canadian Journal of Zoology. 79(11): 1933-1940. [65813]
  • 103. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 106. Swanson, J. D.; Barker, M. H. W. 1992. Assessment of Alaska reindeer populations and range conditions. Rangifer. 12(1): 22-43. [20496]
  • 69. Loughrey, A. G.; Kelsall, J. P. 1970. The ecology and population dynamics of the barren-ground caribou in Canada. In: Proceedings, Helsinki symposium; 1966; Helsinki, Finland. [Paris, France]: UNESCO: 275-280. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17029]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gregarious; in tundra, usually in bands of 10-50 or loose herds of about 1,000. Sexes may segregate seasonally. May form herds after fawning (not in southeastern Manitoba). Tundra caribou may travel extensively in summer in attempt to avoid bothersome insects (Fancy et al. 1989).

Often incurs high calf loss, mostly due to predation (Bergerud et al. 1984). In south-central Alaska, Bergerud and Ballard (1988) concluded that wolf predation limited caribou recruitment, though winter starvation was proposed as the important population control by another researcher.

In northeastern Alaska and adjacent Canada, first-year survival of calves was 51%; mean annual survival rate was 84% for adult females and 83% for adult males; hunting mortality for the herd averaged 2-3% annually (Fancy et al. 1994).

In Quebec, home range size of adult females averaged 148 sq km and did not vary seasonally or annually (Ouellet et al. 1996).

White-tailed deer carry and disperse into the environment meningeal worms that usually are fatal to moose and caribou but are clinically benign in deer; hence, white-tailed deer, through worm-mediated impacts, commonly are believed to exclude moose and caribou from areas where deer occur (see Schmitz and Nudds 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Caribou communicate among themselves through vocal, visual, chemical, and tactile cues. They have a keen sense of smell, which allows them to find food buried deep under snow.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Caribou communicate among themselves through vocal, visual, chemical, and tactile cues. They have a keen sense of smell, which allows them to find food buried deep under snow.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Primarily diurnal, feeding crepuscularly.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Females generally have longer life spans than males, some over 15 years. Bulls are highly susceptible to predation after the rut, which can leave them injured and/or exhausted. Bulls typically live less than 10 years in the wild. Average life expectancy is 4.5 years.

Average lifespan

Status: wild:
10 to 15 years.

Average lifespan

Status: wild:
4.5 years.

Average lifespan

Sex: male

Status: wild:
8.0 years.

Average lifespan

Sex: female

Status: wild:
10.0 years.

Average lifespan

Status: wild:
15.0 years.

Average lifespan

Status: captivity:
20.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Females generally have longer life spans than males, some over 15 years. Bulls are highly susceptible to predation after the rut, which can leave them injured and/or exhausted. Bulls typically live less than 10 years in the wild. Average life expectancy is 4.5 years.

Average lifespan

Status: wild:
10 to 15 years.

Average lifespan

Status: wild:
4.5 years.

Average lifespan

Sex: male

Status: wild:
8.0 years.

Average lifespan

Sex: female

Status: wild:
10.0 years.

Average lifespan

Status: wild:
15.0 years.

Average lifespan

Status: captivity:
20.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.7 years (captivity) Observations: A gradual ageing process has been documented in this species (Weladji et al. 2002). One captive specimen lived 21.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males compete for access to females during the fall breeding season, or rut. This occurs in October and early November. During this time males may engage in battles that leave them injured and exhausted. Dominant males restrict access to small groups of 5 to 15 females. Males stop feeding during this time and may lose weight rapidly.

Mating System: polygynous

In late August and September, prime bulls shed the velvet that surrounds their antlers. Fighting among males (sparring) begins shortly after that, with the rut (breeding season) usually occurring in October. Females can breed as early as 16 months of age but usually begin to breed at 28 months. With good nutrition females give birth to calves each year, but may skip years in areas with low quality forage. A single calf, weighing 3 to 12 kg, is born after about 228 days, in May or June. Twins have been reported, but are rare. Calves are weaned during the first week of July, but also begin to graze on grasses soon after birth. Calves rely mainly on grazing for nutrition after 45 days old.

Breeding interval: Caribou breed once yearly.

Breeding season: Breeding typically occurs in October.

Range number of offspring: 2 (high) .

Average number of offspring: 1.

Average gestation period: 7.6 months.

Average weaning age: 1.5 months.

Range age at sexual or reproductive maturity (female): 16 (low) months.

Average age at sexual or reproductive maturity (female): 28 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 6500 g.

Average gestation period: 228 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
680 days.

Newborn calves are precocial, being able to suckle minutes after birth, follow their mother after an hour and are capable of outrunning a human at one day of age. Calves nurse exclusively for their first month, after which they begin to graze. They will continue to nurse occasionally through early fall, when they become independent.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males compete for access to females during the fall rut, which occurs in October and early November. During this time males may engage in battles that leave them injured and exhausted. Dominant males restrict access to small groups of 5 to 15 females. Males stop feeding during this time and lose much of their body reserves.

Mating System: polygynous

In late August and September, prime bulls shed the velvet that surrounds their antlers. Sparring begins shortly there after, with the rut typically occurring in October. Females can be sexually mature as early as 16 months of age but more commonly at 28 months. With good nutrition females give birth to calves each year, but may skip years in poor ranges. A single calf, weighing 3 to 12 kg, is born approximately 228 days after impregnation, in May or June. Twinning has been reported, but is very rare. The suckling period rarely last past the first week of July and grazing commences shortly after birth. Calves rely mainly on foraging for nutrition after 45 days old.

Breeding interval: Caribou breed once yearly.

Breeding season: Breeding typically occurs in October.

Range number of offspring: 2 (high) .

Average number of offspring: 1.

Average gestation period: 7.6 months.

Average weaning age: 1.5 months.

Range age at sexual or reproductive maturity (female): 16 (low) months.

Average age at sexual or reproductive maturity (female): 28 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 6500 g.

Average gestation period: 228 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
680 days.

Newborn calves are precocial, being able to suckle minutes after birth, follow their mother after an hour and are capable of outrunning a human at one day of age. Calves nurse exclusively for their first month, after which they begin to graze. They will continue to nurse occasionally through early fall, when they become independent.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds mostly in October. Gestation lasts about 227-230 days. Cows bear usually 1, sometimes 2, young in May and June (early June in northern British Columbia). Calves precocious. Adult females sometimes skip reproduction for a year, in response to nutritional stress (Cameron, 1994, J. Mamm. 75:10-13). In northeastern Alaska and adjacent Canada, 80% of adult females (age 3 years or older) gave birth each year (Fancy et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Panting cools blood: reindeer
 

The tongue of the reindeer or caribou cools blood heading to the brain under duress by being high vascularized.

     
  "The reindeer (Rangifer tarandus) is an Arctic animal that has adapted to annual changes of 80°C in ambient temperature by growing a fur of excellent insulation value in the autumn to be shed in the following spring. That together with a reduction of surface temperature caused by vascular changes (Johnsen et al., 1985b) and an efficient nasal heat exchange mechanism (Blix and Johnsen, 1983) result in a 30°C reduction in lower critical temperature from summer to winter (Nilssen et al., 1984a). The animal, so equipped to withstand cold, consequently has few avenues of heat loss in winter and runs the risk of hyperthermia during exercise when metabolic heat production rises rapidly with running speed (Nilssen et al., 1984b)...We have observed that moderately heat-stressed reindeer pant, first with the mouth closed, but, under severe heat stress, they resort to open-mouth panting (OMP) to dissipate heat from their big and richly vascularized tongue...We propose that reindeer regulate body and, particularly, brain temperature under heavy heat loads by a combination of panting, at first through the nose, but later, when the heat load and the minute volume requirements increase due to exercise, primarily through the mouth and that they eventually resort to selective brain cooling." (Blix et al. 2011:3850,3855)
  Learn more about this functional adaptation.
  • Blix AS; Walløe L; Folkow LP. 2011. Regulation of brain temperature in winter-acclimatized reindeer under heat stress. Journal of Experimental Biology. 214: 3850-3856.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Dense underfur insulates: reindeer
 

The coat of a reindeer insulates against polar cold via dense underfur.

   
  "Naturally, animals that live in polar regions have the warmest coats of all. The reindeer's coat combines long, water-repelling guard hairs with an extremely dense underfur, deep-piled like a shag carpet." (Foy and Oxford Scientific Films 1982:84)


"The winter fur of adult reindeer consisted of thick guard hairs with air-filled cavities and an underfur of thin and woolen hairs...The density of guard hairs varied considerably and averaged 2000/cm2 and 12 mm on the legs, 1000/cm2 and 30 mm on the abdomen, and 1700/cm2 and 30 mm on the back. The corresponding count on the back of calves was 3200/cm2 and 10 mm...All hairs were wool-like and hollow...The thick underfur is very important, since it effectively prevents air movement within it and thus reduces heat dissipation...[T]he results suggest that the prime mechanism by which adult reindeer thermoregulate in a cold environment is insulation." (Soppela et al. 1986:275, 277)

  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
  • Soppela P; Nieminen M; Timisjàrvi J. 1986. Thermoregulation in reindeer. Rangifer. 1: 273-278.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Guard hairs repel water: reindeer
 

The coat of reindeer repels water via long guard hairs.

   
  "Naturally, animals that live in polar regions have the warmest coats of all. The reindeer's coat combines long, water-repelling guard hairs with an extremely dense underfur, deep-piled like a shag carpet." (Foy and Oxford Scientific Films 1982:84)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Seasonally breeding mammals typically use the annual change in the photoperiod cycle (light-darkness ratio) to drive rhythmic daily melatonin signals from the pineal gland, providing a critical cue to time seasonal reproduction. The daily light cycle resets the animal's internal clock (circadian clock) roughly every 24 hours, keeping it synchronized with the environment. Production of melatonin and other hormones rises and falls with this daily cycle, regulated by the internal clock. At high latitudes, however, where there is continuous light or continuous darkness for months at a time, no photoperiod information is available for much of the year. Lu et al. (2010) studied two circadian clock genes in fibroblast cells of Arctic Reindeer and found they did not turn on and off on a daily cycle, as in most other animals that have been studied. However, melatonin production responded strongly to light and darkness (dropping in the light and rising in the dark), regardless of the activity of the circadian clock genes being monitored. Lu et al. suggest that in the Arctic environment, where a 24 hour cycle has little meaning, natural selection has reduced or eliminated the circadian clock in Reindeer (and perhaps other Arctic animals). Instead, they speculate, informative melatonin signals associated with the spring and fall equinoxes (when daily light cycles are available) may directly entrain a ‘‘circannual clock’’ [24, 29] that may not involve circadian mechanisms. (Lu et al. 2010) This phenomenon must be investigated in other Arctic animals, and using other genes in Reindeer, but these data suggest that, as might be expected, time-keeping in the far north may be quite different than at lower latitudes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rangifer tarandus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 120 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTTTCAACTAATCACAAAGACATTGGCACCTTGTATTTACTATTTGGTGCTTGAGCAGGCATAGTAGGAACTGCCCTAAGCTTACTAATCCGTGCTGAACTGGGCCAACCTGGGACCCTACTCGGAGACGATCAAATTTATAATGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGACTTGTCCCTCTAATAATTGGTGCCCCAGATATAGCATTCCCTCGGATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCTTTTCTACTTCTTCTAGCATCATCCATAATTGAAGCTGGAACAGGAACAGGTTGAACTGTTTACCCTCCTTTAGCTGGTAACCTAGCTCACGCAGGAGCTTCAGTAGACTTAACTATTTTCTCTTTACACTTAGCAGGTGTCTCCTCAATTTTAGGGGCAATTAACTTTATCACAACAATTATTAATATAAAACCTCCTGCTATATCACAGTATCAAACCCCTTTATTTGTATGATCTGTCTTAATCACTGCTGTATTATTACTTCTCTCACTTCCTGTACTAGCAGCCGGAATTACAATACTACTAACAGACCGAAATTTAAATACAACTTTCTTCGACCCAGCAGGAGGCGGGGATCCCATCCTATATCAACATTTATTCTGATTCTTTGGACACCCTGAAGTTTATATTCTTATTTTACCTGGATTTGGTATAATCTCCCACATTGTAACCTACTACTCGGGAAAAAAAGAACCATTTGGGTACATAGGAATAGTCTGAGCCATAATATCAATTGGATTTTTAGGATTTATTGTATGAGCCCACCATATATTTACAGTTGGAATGGACGTTGACACACGAGCCTATTTTACATCAGCTACCATGATTATTGCAATTCCAACCGGGGTAAAAGTCTTTAGCTGACTAGCAACACTTCACGGAGGTAATATCAAATGATCACCTGCTATAATATGAGCTCTGGGCTTTATTTTCCTTTTTACAGTTGGAGGACTAACCGGAATTGTTCTTGCTAATTCTTCCCTTGACATTGTTCTCCACGACACTTATTATGTGGTTGCACATTTCCACTATGTCTTATCAATAGGAGCTGTATTTGCTATTATAGGGGGGTTTGTTCACTGATTTCCACTATTTTCAGGCTATACCCTTAATGATACATGAGCTAAAATTCATTTTGTAATTATATTTGTAGGTGTAAACATAACATTCTTTCCACAACATTTCCTAGGATTATCTGGTATACCACGACGATATTCTGACTATCCAGACGCATATACAATGTGAAATACAATTTCTTCTATAGGCTCATTTATCTCTCTAACAGCAGTTATACTAATAATTTTTATCATCTGAGAAGCATTCGCATCTAAGCGAGAAGTATCAACCGTAGAGCTAACAACAACAAATTTAGAGTGACTGAATGGGTGCCCCCCACCATATCATACATTTGAAGAACCTACATACGTTAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rangifer tarandus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 135
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

U.S. Federal Legal Status

Rangifer tarandus caribou: Endangered
Rangifer tarandus pearyi: Candidate
Rangifer tarandus eogroenlandicus: Candidate [110]
  • 110. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although Alaska, with its more than 30 herds, has nearly double the number of caribou (1,000,000) than people, caribou in the lower 48 United States are considered endangered. Caribou in Alaska are of the barren-ground subspecies, whereas living (in Washington and Idaho) and extinct (Maine) herds are of the woodland subspecies. The Selkirk Herd, inhabiting Washington, Idaho, and southern British Columbia numbers only around 30 members. They are listed as Endangered under the Endangered Species Act in these regions. Loss of habitat, overhunting, and other factors has contributed to the precarious position of woodland caribou in the United States. Worldwide, the caribou population is estimated to be around 5 million. The largest herds now occur in Alaska, Canada, and Russia. Humans have heavily hunted this species. They have been extinct in most parts of Europe since at least the 1600s. Exploration for oil and minerals in Canada may threaten woodland caribou habitat. High Arctic caribou populations are also thought to be vulnerable.

Despite their status in the wild, domestic herds of reindeer flourish in the Old World, in Canada, in Alaska, and in the lower 48 states including Michigan.

IUCN Red List of Threatened Species: least concern

US Federal List: endangered

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Henttonen, H. & Tikhonov, A.

Reviewer/s
Black, P., González, S. (Deer Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern due to a wide circumpolar distribution and presumed large populations.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although Alaska, with its more than 30 herds, has nearly double the number of caribou (1,000,000) than people, caribou in the contiguous US are considered endangered. Caribou in Alaska are of the barren-ground subspecies, whereas extant (WA, ID) and extinct (ME) herds are of the woodland subspecies. The Selkirk Herd, inhabiting WA, ID, and southern British Columbia numbers only around 30 members. They are listed as Endangered under the Endangered Species Act in these regions. Loss of habitat, overhunting, and other factors has contributed to the precarious position the woodland caribou now exists in the US. Worldwide, the caribou population is estimated to be around 5 million. The largest herds now occur in Alaska, Canada, and Russia. Humans have heavily hunted this species. They have been extinct in most parts of Europe since at least the 1600s. Exploration for oil and minerals in Canada may threaten woodland caribou habitat. High Arctic caribou populations are also thought to be vulnerable.

Despite their status in the wild, domestic herds of reindeer flourish in the Old World, in Canada, in Alaska, and in the lower 48 states including Michigan.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The Peary caribou or reindeer, Rangifer tarandus pearyi, is an Endangered subspecies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are large numbers of reindeer (locally known as caribou) in North America.

There are approximately 30,000 wild reindeer in southern Norway and 10,000 in Svalbard (Andersen and Hustad 2004). The population trend in Norway is believed to be stable, and hunting is controlled. In Finland, forest reindeer (subspecies R. t. fennicus) were driven extinct in the early 1900s, but are now starting to recover as a result of animals moving in from Karelia in Russia and from some captive bred stock that were released (Ruusila and Kojola in press). Forest Reindeer remain very rare in Finland (about 1,200 in the eastern subpopulation and 1,000 individuals in the western subpopulation).

The Finnish population trend is difficult to determine, as the population in eastern Finland has expanded rapidly from c. 40 reintroduced individuals in 1980 to c.1,200 today, whereas the western subpopulation has declined from c.1,800 to c.1,000 during 2001-2006 (although in the last few years prior to 2001 it had been increasing) (H. Henttonen pers. comm. 2006, Ruusila and Kojola in press). Overall, the current Finnish population trend is one of growth rather than decline. Numbers in European Russia are very low with presumed ongoing declines, and the reindeer is now absent from large tracts of tundra and taiga. It is not known whether the small Kola Peninsula population in Russia is derived from autochthonous wild reindeer or from semi domesticated animals (A. Tikhonov pers. comm. 2006). The Novaya Zemlya subspecies pearsoni has a small population (less than 1,000 mature individuals), which is undergoing continuing decline (A. Tikhonov pers. comm. 2006). The reindeer's status in Asia is poorly known, although it is significantly more abundant there than in Europe, with a population estimated at 400,000 in the 1950s (Koubek and Zima 1999). There are also large numbers of reindeer (locally known as caribou) in North America. The feral population in Iceland numbers c.1000, and there are approximately 0.5 million semi-domesticated reindeer in Lappland (H. Henttonen pers. comm. 2006).

Numbers in European Russia are very low with presumed ongoing declines, and the reindeer is now absent from large tracts of tundra and taiga. It is not known whether the small Kola Peninsula population in Russia is derived from autochthonous wild reindeer or from semi domesticated animals (A. Tikhonov pers. comm. 2006). The Novaya Zemlya subspecies pearsoni has a small population (less than 1,000 mature individuals), which is undergoing continuing decline (A. Tikhonov pers. comm. 2006).

The reindeer's status in Asia is poorly known, although it is significantly more abundant there than in Europe, with a population estimated at 400,000 in the 1950s (Koubek and Zima 1999). Two separate populations of this species are present in Mongolia (Litvinov and Bazardorj, 1992). No robust data on population trends or abundance are currently available, although the total Mongolian population is believed to consist of fewer than 1,000 individuals.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 50-70%

Comments: Vors and Boyce (2009) gathered population data for 58 major caribou and reindeer herds throughout the global range and found that 34 were reported as declining, eight were increasing, and 16 had no data. The authors gathered 40 time series of population estimates for smaller herds within the major herd ranges. The time series spanned an average of 21.6 years and population estimates were available for an average of 9.9 years. Of these herds, 11 were in decline for fewer than 10 years, eight were in decline for 10-19 years, and six were in decline for more than 20 years. Mean percentage decline from known population maxima for these herds was 57 percent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The Porcupine caribou herd in northeastern Alaska and adjacent northwestern Canada and the adjacent Central Arctic herd are potentially threatened by onshore petroleum exploration and development; industrial development on the coastal plain of the Arctic National Wildlife Refuge could increase calf mortality if calving were displaced south and east of potential development areas (Fancy and Whitten 1991). However, Pollard et al. (1996) documented high use of oil fields by caribou during periods of high mosquito and fly activity.

Poaching is a major threat in the Russian Federation (A. Tikhonov pers. comm. 2006). The causes of decline of the Novaya Zemlya subspecies pearsoni are not known (A. Tikhonov pers. comm. 2006). Loss of habitat in Finland (through logging) may pose problems, and there is increased disturbance to the species in some areas due to winter sporting activities. Hybridisation with semi domesticated reindeer is a potential problem for some subspecies and subpopulations (H. Henttonen pers. comm. 2006, Ruusila and Kojola in press).

White-tailed deer carry and disperse into the environment meningeal worms that usually are fatal to moose and caribou but are clinically benign in deer; hence, white-tailed deer, through worm-mediated impacts, commonly are believed to exclude moose and caribou from areas where deer occur (see Schmitz and Nudds 1994). Predation by an expanding coyote population threatened a remnant caribou herd in southeastern Quebec (Crete and Desrosiers 1995). Long-term steady decline in the taiga-dwelling population in Ontario has been associated with the expansion of forest harvesting (Schaefer 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Recent global declines in caribou and reindeer populations appear to be associated with changes in phenology, spatiotemporal changes in species overlap (e.g., other ungulate species, predators, disease organisms), and increased frequency of extreme weather events (Vors and Boyce 2009).

The Porcupine caribou herd in northeastern Alaska and adjacent northwestern Canada and the adjacent Central Arctic herd are potentially threatened by onshore petroleum exploration and development; industrial development on the coastal plain of the Arctic National Wildlife Refuge could increase calf mortality if calving were displaced south and east of potential development areas (Fancy and Whitten 1991). However, Pollard et al. (1996) documented high use of oil fields by caribou during periods of high mosquito and fly activity.

Peary caribou (subspecies PEARYI), low arctic islands population: high winter mortality, low reproduction, and minimal recruitment, with additional pressure from hunting and disturbances associated with industrial activities (see 1991 COSEWIC report by F. L. Miller; also 1979 COSEWIC report by Gunn et al.).

Failed reintroductions often result when white-tailed deer are common; caribou probably contract meningeal worm disease from white-tailed deer (Bernard and Horn 1989).

Predation by an expanding coyote population threatened a remnant caribou herd in southeastern Quebec (Crete and Desrosiers 1995).

Long-term steady decline in the taiga-dwelling population in Ontario has been associated with the expansion of forest harvesting (Schaefer 2003). See also files for subspecies CARIBOU (woodland caribou).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the terms: bryophytes, climax, cover, fire exclusion, fire management, lichen, lichens, shrub

At this time, the effects of fire management on caribou habitat are not completely understood. Since lichen cover declines for decades following fire, extensive prescribed fire is not recommended for caribou habitat improvement. However, given that mosses and other bryophytes replace lichens in climax ecosystems, complete fire exclusion would be a poor management policy over the long term [95]. Bergerud [13] suggested that fire would create usable habitat by converting closed-canopy forests to lichen woodlands and shrub barrens. However, the creation of permanent shrub barrens would lead to a reduction in lichen forage [13]. Caribou range is typically very extensive, so most fire activity is too small in scale to have any lasting effect on caribou populations [62].
  • 13. Bergerud, Arthur T. 1971. Abundance of forage on the winter range of Newfoundland caribou. The Canadian Field-Naturalist. 85: 39-52. [14759]
  • 62. Klein, David. 1979. Wildfire, lichens and caribou. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Government of Yukon, Yukon Wildlife Branch: 37-65. [14074]
  • 95. Russell, Don. 1979. Fire and the Porcupine caribou winter range. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Yukon Wildlife Branch: 200-201. [14086]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the terms: association, basal area, cover, density, lichen, lichens, muskeg, natural, tree

Caribou populations are declining in North America [27,101,111]. Many factors may play a role in the caribou decline. Some possible explanations include poor physical condition of females, loss of habitat due to logging and fire, an increase in energy expenditure due to increased movements, delayed births, overgrazing, high predation, overhunting, and unusually harsh winter conditions leading to high snow accumulations [11,23,27,70]. The loss of winter habitat and lichen forage by wildfires and escaped campfires is commonly cited as a primary cause for the decline of caribou [11,68,70,99]. Gray wolf predation is also a cause of high mortality in some populations [68]. Bergerud [15] speculated that an increase in predation or parasitism may account for population declines after fire rather than a loss of lichen forage following fire. However, evidence that major declines in caribou populations could be attributed to predation or disease has not been conclusive [27]. Overhunting is detrimental to small caribou populations [11,27,70]. Declines along the United States/Canadian border are largely attributed to overhunting and habitat changes caused by logging and fire [11,49]. The primary causes of caribou mortality in the Selkirk Mountains are predation, other natural causes, and hunting [111].

A review by Cumming [29] outlined management guidelines for maintaining caribou populations. Adequate winter habitat includes forest and muskeg fens that provide lichen forage, which is crucial for winter survival. Habitat must provide adequate supplies of other foods and protection against predation. Predator control may be necessary near major calving grounds [29].

Lichen cover can be maintained or improved by silviculture, whereas fire often has a negative effect. Percent cover of reindeer lichens, cup lichens, and arboreal lichens is typically higher in logged plots than in burned plots [36,116]. Reindeer lichen and cup lichen recovery was greater in a lodgepole pine forest in British Columbia 15 years after a winter harvest than in burned stands in the area. Lichen cover following summer harvest was comparable to burned stands in the area. Partial cutting can maintain arboreal lichen loading over the short term. In the same study, results indicated 80% to 90% of lichen loading remained in Engelmann spruce-subalpine fir forest 2 years after tree harvest [25]. In Ontario, reindeer lichens were observed 2 years after logging [116].

Caribou have a negative response to clearcut logging. Woodland caribou in Alberta maintained an average distance of 0.75 mile (1.2 km) from recent cut blocks [104]. In Ontario, clearcuts were avoided for 12 years after harvest within traditional caribou winter habitats [30]. Courtois and others [22] suggested that protecting large mature forest blocks, concentrating tree harvesting activities to large management blocks, and maintaining corridors connecting large forest blocks would benefit caribou. Smith and others [104] also recommended leaving core caribou habitat intact, limiting the number of fragmented stands created by timber harvesting, and creating large cut blocks to mimic the effects of large-scale fires and minimize edge effects that may promote the expansion of other ungulate species. Small-scale timber harvest promotes an increase in moose populations, which in turn leads to an increase in gray wolf populations. Large-scale timber harvest could benefit caribou by keeping moose and gray wolf populations low [53]. In winter, woodland caribou in British Columbia show a preference for Engelmann spruce-subalpine fir forests with low basal area, moderate timber volume, and moderate slope that are >5,000 feet (1,525 m) elevation. Woodland caribou move through lower elevations, however, to reach the high-elevation habitats. Logging could be possible at lower elevations in this habitat, which would reduce conflicts with caribou [107]. For more detailed information on land management recommendations, see Courtois and others [22].

Disturbances in caribou habitats have potentially detrimental effects on caribou populations. Caribou avoid railways, roads, and human settlements. Rail and road systems that bisect caribou range may inhibit seasonal movements [2]. A study in Ontario documented an increase in caribou mortality near logging roads via an increase in predation, poaching, and train and traffic accidents. These increases were related to, but not directly caused by, logging activities [30]. Limiting road access and recreation, such as snowmobile use, would benefit caribou [107]. Unexpectedly, an increase in traffic through Denali National Park in Alaska has not caused any noticeable effects on caribou abundance, distribution, or behavior. Individual caribou may become habituated to traffic while others avoid roadways [18].

The effects of petroleum development on caribou are uncertain. A traditional calving ground near an active Prudhoe Bay oil field shifted approximately 12 miles (20 km) south of the oil field as the herd grew over time. The herd's shift in utilized habitat may have been influenced by petroleum development, but this is uncertain [47]. The use of traditional calving grounds may reduce calf mortality due to reduced predation and higher-quality forage [19]. Shifts away from traditional calving grounds may lead to greater calf mortality and a decline in population size.

Cameron and others [19] advise using caution in when developing oil fields in caribou habitat. After construction of an oil field access road through a caribou calving ground in Prudhoe Bay, Alaska, caribou density declined significantly (P=0.05) within 0.6 mile (1 km) of the road. Relative caribou use of areas adjacent to the road also significantly declined (P<0.02), in apparent conjunction with an increase in surface development. Caribou densities increased significantly (P=0.04) 3 to 4 miles (5-6 km) from the road [19], indicating a possible shift in habitat utilization. In another study on Prudhoe Bay oil fields, male caribou were observed within 1.2 miles (2 km) of oil field infrastructure during the postcalving season. However, calves were primarily observed 4 to 5 miles (6-8 km) from oil field infrastructure during the postcalving season, although calves were observed closer to infrastructure in some years [28]. These results suggest that oil field development generally has a negative affect on caribou calves and calving females, but more research is needed to make the association clearer.
  • 99. Scotter, George W. 1968. Effects of forest fires on the lichen winter ranges of barren-ground caribou in northern Canada. Logan, UT: Utah State University. 127 p. Dissertation. [65839]
  • 2. Ahti, T. 1959. Studies on the caribou lichen stands of Newfoundland. Annals of the Botanical Society. Vanamo. 30(4): 1-44. [18901]
  • 11. Banfield, A. W. F.; Tener, J. S. 1958. A preliminary study of the Ungava caribou. Journal of Mammalogy. 39(4): 560-573. [12994]
  • 15. Bergerud, Arthur T. 1974. Decline of caribou in North America following settlement. Journal of Wildlife Management. 38(4): 757-770. [16767]
  • 18. Burson, S. L., III; Belant, J. L.; Fortier, K. A.; Tomkiewicz, W. C., III. 2000. The effect of vehicle traffic on wildlife in Denali National Park. Arctic. 53(2): 146-151. [65783]
  • 19. Cameron, Raymond D.; Reed, Daniel J.; Dau, James R.; Smith, Walter T. 1992. Redistribution of calving caribou in response to oil field development on the Arctic Slope of Alaska. Arctic. 45(4): 338-342. [65784]
  • 22. Courtois, Rehaume; Ouellet, Jean-Pierre; Dussault, Claude; Gingras, Andre. 2004. Forest management guidelines for forest-dwelling caribou in Quebec. The Forestry Chronicle. 80(5): 598-607. [65773]
  • 23. Couturier, Serge; Brunelle, Josee; Vandal, Denis; St. Martin, Guy. 1990. Changes in the population dynamics of the George River caribou herd, 1976-87. Arctic. 43(1): 9-20. [14745]
  • 25. Coxson, Darwyn; Stevenson, Susan; Campbell, Jocelyn. 2003. Short-term impacts of partial cutting on lichen retention and canopy microclimate in an Engelmann spruce - subalpine fir forest in north-central British Columbia. Canadian Journal of Forest Research. 33: 830-841. [44620]
  • 27. Cringan, Alexander Thom. 1957. History, food habits and range requirements of the woodland caribou of continental North America. Transactions, North American Wildlife Conference. 22: 485-501. [15651]
  • 28. Cronin, Matthew A.; Amstrup, Steven C.; Durner, George M.; Noel, Lynn E.; McDonald, Trent L.; Ballard, Warren B. 1998. Caribou distribution during the post-calving period in relation to infrastructure in the Prudhoe Bay oil field, Alaska. Arctic. 51(2): 85-93. [65787]
  • 29. Cumming, H. G. 1992. Woodland caribou: facts for forest managers. Forestry Chronicle. 68(4): 481-491. [19294]
  • 30. Cumming, H. G.; Beange, D. B. 1993. Survival of woodland caribou in commercial forests of northern Ontario. The Forestry Chronicle. 69(5): 579-588. [65775]
  • 36. Detrick, Richard W. T. 1985. Effects of fire and logging on arboreal lichen availability to caribou. Moscow, ID: University of Idaho. 49 p. Thesis. [65846]
  • 47. Haskell, Shawn; Ballard, Warren B.; Cronin, Matthew. 2002. Caribou road surveys in the northern oilfields of Alaska: retrospective analysis. In: Wilde, Gene R.; Smith, Loren M., eds. Research highlights--2002: Range, wildlife, and fisheries management. Volume 33. Lubbock, TX: Texas Tech University, College of Agricultural Sciences and Natural Resources: 14. [43681]
  • 49. Heinselman, Miron L. 1973. Restoring fire to the canoe country. Naturalist. 24: 21-31. [15810]
  • 68. Leopold, A. Starker; Darling, F. Fraser. 1953. Effects of land use on moose and caribou in Alaska. Transactions, 18th North American Wildlife Conference. 18: 553-562. [17034]
  • 70. Lutz, H. J. 1956. Ecological effects of forest fires in the interior of Alaska. Tech. Bull. No. 1133. Washington, DC: U.S. Department of Agriculture, Forest Service. 121 p. [7653]
  • 101. Scotter, George Wilby. 1964. Effects of forest fires on the winter range of barren-ground caribou in northern Saskatchewan. Wildlife Management Bulletin, Series 1, No. 18. Ottawa: Canadian Wildlife Service, National Parks Branch, Department of Northern Affairs and National Resources. 111 p. [28989]
  • 104. Smith, Kirby G.; Ficht, E. Janet; Hobson, David; Sorensen, Troy C.; Hervieux, David. 2000. Winter distribution of woodland caribou in relation to clear-cut logging in west-central Alberta. Canadian Journal of Zoology. 78(8): 1433-1440. [38916]
  • 107. Terry, Eliot L.; McLellan, Bruce N.; Watts, Glen S. 2000. Winter habitat ecology of mountain caribou in relation to forest management. Journal of Applied Ecology. 37(4): 589-602. [38067]
  • 116. Webb, Elizabeth T. 1998. Survival, persistence, and regeneration of the reindeer lichens, Cladina stellaris, C. rangiferina, and C. mitis following clearcut logging and fores fire in northwestern Ontairo. In: Lankester, Murray; Racey, Gerald; Timmermann, Tim, eds. Proceedings of the 7th North American caribou conference; 1996 August 19-21; Thunder Bay, ON. In: Rangifer. Special Issue. No. 10: 41-47. [65843]
  • 53. Hunter, Malcom L., Jr. 1993. Natural FIRE REGIMES as spatial models for managing boreal forests. Biological Conservation. 65(2): 115-120. [22132]
  • 111. U.S. Fish and Wildlife Service. 1994. Recovery plan: Selkirk Mountain woodland caribou: Rangifer tarandus caribou. Final Revision 2, [Online]. Portland OR: U.S. Fish and Wildlife Service, Pacific Region (Producer). 79 p. Available: http://ecos.fws.gov/docs/recovery_plans/1994/940304.pdf [2007, September 12]. [68117]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
It is listed on Appendix III of the Bern Convention. Subspecies R. t. fennicus is strictly protected under Annex II of the EU Habitats and Species Directive. In eastern parts of Russia there are strict anti-hunting measures in place, but there is continued poaching (A. Tikhonov pers. comm. 2006). Hunting in Norway is also strictly controlled. In Finland, a large fence has been constructed between areas occupied by semi domesticated reindeer and forest reindeer, to prevent hybridisation (Koubek and Zima 1999, H. Henttonen pers. comm. 2006). Research is urgently required to determine the causes of population decline of R. t. pearsoni on Novaya Zemlya, and to identify appropriate conservation actions.

In China the species is rare; only a few hundred animals remain there. Most of its habitat was burned in great fires in 1986. It is listed on the China Red List as Not Applicable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Based on genetic differences, translocations of caribou from the southern tier of arctic islands in Canada to arctic islands farther north would not be biologically sound (Miller, 1991 COSEWIC report).

Murphy and Curatolo (1987) recommended that elevated pipelines and heavily traveled roads be separated to minimize impact on caribou in northern Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative impacts of caribou.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Caribou have been used extensively for their meat, fur and antlers. Reindeer, the domesticated subspecies of caribou, have been herded throughout their range for thousands of years.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative impacts of caribou.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Caribou have been used extensively for their meat, fur and antlers. Reindeer, the domesticated subspecies of caribou, have been herded throughout their range for thousands of years.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Reindeer

The reindeer (Rangifer tarandus), also known as the caribou in North America, is a species of deer native to Arctic and Subarctic regions. This includes both resident and migratory populations. While overall widespread and numerous,[1] some of its subspecies are rare and at least one has already gone extinct.[2][3]

Reindeer vary considerably in color and size. Both sexes grow antlers, though they are typically larger in males. However, there are a few populations in which females lack antlers completely.

Wild reindeer hunting and herding of semi-domesticated reindeer (for meat, hides, antlers, milk and transportation) are important to several Arctic and Subarctic peoples.[4] The reindeer is well known in folklore due to Santa Claus's sleigh being pulled by flying reindeer, a popular element of Christmas.[5] In Lapland, reindeer pull pulks.[6]

Contents

Distribution and habitat [edit]

Large male reindeer

The reindeer is a widespread and numerous species in the northern Holarctic, being present in both tundra and taiga (boreal forest).[7] Originally, the reindeer was found in Scandinavia, eastern Europe, Greenland, Russia, Mongolia, and northern China north of the 50th latitude. In North America, it was found in Canada, Alaska (USA), and the northern conterminous USA from Washington to Maine. In the 19th century, it was apparently still present in southern Idaho.[1] Even in historical times, it probably occurred naturally in Ireland. During the late Pleistocene era, reindeer were found as far south as Nevada and Tennessee in North America, and as far south as Spain in Europe.[7][8] Today, wild reindeer have disappeared from many areas within this large historical range, especially from the southern parts, where it vanished almost everywhere. Large populations of wild reindeer are still found in Norway, Finland, Siberia, Greenland, Alaska, and Canada.

The George River reindeer herd in the tundra of Quebec and Labrador in eastern Canada, once the world's largest with 8-900,000 animals, had been reduced to 74,000 by December 2011 – a drop of up to 92% – because of iron-ore mining, flooding for hydro-power and road-building.[9]

Southernmost reindeer: a South Georgian reindeer with velvet-covered antlers

Domesticated reindeer are mostly found in northern Fennoscandia and Russia, with a herd of approximately 150-170 reindeer living around the Cairngorms region in Scotland. The last remaining wild tundra reindeer in Europe are found in portions of southern Norway.[10]

A few reindeer from Norway were introduced to the South Atlantic island of South Georgia in the beginning of the 20th century. The South Georgian reindeer total some 2,600 animals in two distinct herds separated by glaciers. Although the flag and the coat of arms of the territory contain an image of a reindeer, a decision was taken in 2011 to completely eradicate the animals from the island because of the environmental damage they cause.[11][12]

Around 4,000 reindeer have been introduced into the French sub-Antarctic archipelago of Kerguelen Islands. East Iceland has a small herd of about 2,500–3,000 animals.[13]

Caribou and reindeer numbers have fluctuated historically, but many herds are in decline across their range.[14] This global decline is linked to climate change for northern, migratory herds and industrial disturbance of habitat for non-migratory herds.[15]

Morphology [edit]

Size [edit]

The characteristically small and relatively short-legged reindeer from Svalbard

The females usually measure 162–205 cm (64–81 in) in length and weigh 80–120 kg (180–260 lb).[16] The males (or "bulls") are typically larger (although the extent to which varies in the different subspecies), measuring 180–214 cm (71–84 in) in length and usually weighing 159–182 kg (350–400 lb),[16] though exceptionally large males have weighed as much as 318 kg (700 lb).[16] Shoulder height typically measure from 85 to 150 cm (33 to 59 in), and the tail is 14 to 20 cm (5.5 to 7.9 in) long. The subspecies R. t. platyrhynchus from Svalbard island is very small compared to other subspecies (a phenomenon known as insular dwarfism), with females having a length of approximately 150 cm (59 in), and a weight around 53 kg (120 lb) in the spring and 70 kg (150 lb) in the autumn.[17] Males are approximately 160 cm (63 in) long, and weigh around 65 kg (140 lb) in the spring and 90 kg (200 lb) in the autumn.[17] The reindeer from Svalbard are also relatively short-legged and may have a shoulder height of as little as 80 cm (31 in),[17] thereby following Allen's rule.

Domesticated reindeer are shorter-legged and heavier than their wild counterparts.[citation needed]

Fur [edit]

The colour of the fur varies considerably, both individually and depending on season and subspecies. Northern populations, which usually are relatively small, are whiter, while southern populations, which typically are relatively large, are darker. This can be seen well in North America, where the northernmost subspecies, the Peary caribou, is the whitest and smallest subspecies of the continent, while the southernmost subspecies, the Woodland Caribou, is the darkest and largest.[18] The coat has two layers of fur: a dense woolly undercoat and longer-haired overcoat consisting of hollow, air-filled hairs.

Antlers [edit]

Reindeer antlers grow again each year under a layer of fur called velvet. This reindeer is losing the velvet layer on one of its antlers.

In most populations both sexes grow antlers and it is the only cervid species in which females grow them as well as males.[19] In the Scandinavian populations, old males' antlers fall off in December, young males' fall off in the early spring, and females' fall off in the summer. The antlers typically have two separate groups of points, a lower and upper. There is considerable subspecific variation in the size of the antlers (e.g., rather small and spindly in the northernmost subspecies),[18] but, on average, the bull reindeer's antlers are the second largest of any extant deer, after the moose. In the largest races, the antlers of big males can range up to 100 cm (39 in) in width and 135 cm (53 in) in beam length. They have the largest antlers relative to body size among living deer species.[19]

Nose and hooves [edit]

Like moose, reindeer have specialized noses featuring nasal turbinate bones that dramatically increase the surface area within the nostrils. Incoming cold air is warmed by the animal's body heat before entering the lungs, and water is condensed from the expired air and captured before the deer's breath is exhaled, used to moisten dry incoming air and possibly absorbed into the blood through the mucous membranes.

Reindeer hooves adapt to the season: in the summer, when the tundra is soft and wet, the footpads become sponge-like and provide extra traction. In the winter, the pads shrink and tighten, exposing the rim of the hoof, which cuts into the ice and crusted snow to keep it from slipping. This also enables them to dig down (an activity known as "cratering")[20][21] through the snow to their favorite food, a lichen known as reindeer moss. The knees of many species of reindeer are adapted to produce a clicking sound as they walk.[22]

Vision [edit]

Reindeer are thought to be the only mammals that can see ultraviolet light. A study conducted by researchers from the University College London in 2011 revealed that reindeer can see light with wavelengths as short as 320 nm, considerably below the human threshold of 400 nm. It is thought that this ability helps them to survive in the Arctic, because many objects that blend into the landscape in normally visible light, such as urine and fur, produce sharp contrasts in ultraviolet.[23]

Ecology and behavior [edit]

Diet [edit]

Caribou licking salt from roadway in British Columbia
The size of the antlers plays a significant role in establishing the hierarchy in the group[7]
A herd of barren-ground caribou at the Thelon River. This subspecies is a long-distance migrant.[18]

Reindeer are ruminants, having a four-chambered stomach. They mainly eat lichens in winter, especially reindeer moss. However, they also eat the leaves of willows and birches, as well as sedges and grasses. There is some evidence to suggest that on occasion, they will also feed on lemmings,[24] arctic char, and bird eggs.[25] Reindeer herded by the Chukchis have been known to devour mushrooms enthusiastically in late summer.[26]

Reproduction [edit]

Mating occurs from late September to early November. Males battle for access to females. Two males will lock each other's antlers together and try to push each other away. The most dominant males can collect as many as 15-20 females to mate with. A male will stop eating during this time and lose much of its body reserves.[27]

Calves may be born the following May or June. After 45 days, the calves are able to graze and forage but continue suckling until the following autumn and become independent from their mothers.[28]

Migration [edit]

Some populations of the North American caribou migrate the furthest of any terrestrial mammal, travelling up to 5,000 km (3,100 mi) a year, and covering 1,000,000 km2 (390,000 sq mi).[1][29] Other populations (e.g., in Europe) have a shorter migration, and some, for example the subspecies R. t. pearsoni and R. t. platyrhynchus (both restricted to islands), are residents that only make local movements.[citation needed]

Normally travelling about 19–55 km (12–34 mi) a day while migrating, the caribou can run at speeds of 60–80 km/h (37–50 mph).[1] During the spring migration smaller herds will group together to form larger herds of 50,000 to 500,000 animals but during autumn migrations, the groups become smaller, and the reindeer begin to mate. During the winter, reindeer travel to forested areas to forage under the snow. By spring, groups leave their winter grounds to go to the calving grounds. A reindeer can swim easily and quickly, normally at 6.5 km/h (4.0 mph) but if necessary at 10 km/h (6.2 mph), and migrating herds will not hesitate to swim across a large lake or broad river.[1]

Predators [edit]

Reindeer standing on snow to avoid blood-sucking insects.

A variety of predators prey heavily on reindeer. Golden eagles prey on calves and are the most prolific hunter on calving grounds.[30] Wolverines will take newborn calves or birthing cows, as well as (less commonly) infirm adults. Brown bears and polar bears prey on reindeer of all ages, but like the wolverines they are most likely to attack weaker animals, such as calves and sick deer, since healthy adult reindeer can usually outpace a bear. The gray wolf is the most effective natural predator of adult reindeer and sometimes takes large numbers, especially during the winter. A single wolf pack can follow and live off of a particular reindeer herd for months.[citation needed]

As carrion, reindeer are fed on opportunistically by foxes, ravens and hawks. Blood-sucking insects, such as black flies and mosquitoes, are a plague to reindeer during the summer and can cause enough stress to inhibit feeding and calving behaviors.[31] In one case, the entire body of a reindeer was found in the stomach of a Greenland shark,[32] a species found in the far northern Atlantic, although this was quite possibly a case of scavenging considering the dissimilarity of habitats between the ungulate and the large, slow-moving fish. The population numbers of some of these predators is influenced by the migration of reindeer.[citation needed]

Subspecies [edit]

The Peary caribou is a relatively small and pale subspecies found in the tundra of far northern North America. Unsurprisingly, it is part of the group known as Tundra reindeer.

In 1961 the reindeer classification was divided into two major groups, the tundra reindeer (with six subspecies) and the woodland reindeer (with three subspecies).[citation needed] Some of the tundra's subspecies are small-bodied, high-Arctic island forms. These island subspecies are probably not closely related, since the Svalbard reindeer seems to have evolved from large European reindeer, whereas Peary caribou and the extinct Arctic reindeer are closely related and probably evolved in high-Arctic North America.[2]

The Svalbard reindeer is special in several ways. There are peculiarities in its metabolism. The skeleton shows a remarkable relative shortening of the legs, thus parallelling many extinct insular deer species.[33]

The following is a partial list; four subspecies which are restricted to Russia and neighbouring regions have been left out. These are R. tarandus buskensis, R. tarandus pearsoni (Novaya Zemlya reindeer), R. tarandus phylarchus (Kamchatka/Okhotsk reindeer) and R. tarandus sibiricus (Siberian Tundra reindeer).[34]

Tundra reindeer [edit]

Approximate range of caribou subspecies in North America. Overlap is possible for contiguous range. Subspecies groenlandicus and pearyi mix on some arctic islands, and granti is probably a synonym of groenlandicus. Populations here included in caribou are sometimes divided into four separate subspecies (see text)

Woodland reindeer [edit]

  • Finnish forest reindeer (R. tarandus fennicus), found in the wild in only two areas of the Fennoscandia peninsula of Northern Europe, in Finnish/Russian Karelia, and a small population in central south Finland. The Karelia population reaches far into Russia, however, so far that it remains an open question whether reindeer further to the east are R. t. fennicus as well.[citation needed]
  • Migratory woodland caribou (R. tarandus caribou), or forest caribou, once found in the North American taiga (boreal forest) from Alaska to Newfoundland and Labrador and as far south as New England, Idaho, and Washington. Woodland caribou have disappeared from most of their original southern range and are considered threatened where they remain, with the notable exception of the Migratory woodland caribou of northern Quebec and Labrador, Canada. The name of the Cariboo district of central British Columbia relates to their once-large numbers there, but they have almost vanished from that area in the last century. A herd is protected in the Caribou Mountains in Alberta. The above quoted range includes R. tarandus caboti (Labrador caribou), R. tarandus osborni (Osborn's caribou – from British Columbia) and R. tarandus terraenovae (Newfoundland caribou). Based on a review in 1961, these were considered invalid and included in R. tarandus caribou, but some recent authorities have considered them all valid, even suggesting that they are quite distinct.[34][36] An analysis of mtDNA in 2005 found differences between the caribous from Newfoundland, Labrador, south-western Canada and south-eastern Canada, but maintained all in R. tarandus caribou.[35]
  • Queen Charlotte Islands caribou (R. tarandus dawsoni) from the Queen Charlotte Islands was believed to represent a distinct subspecies. It became extinct at the beginning of the 20th century. However, recent DNA analysis from mitochondrial DNA of the remains from those reindeer suggest that the animals from the Queen Charlotte Islands were not genetically distinct from the Canadian mainland reindeer subspecies.[3]

Reindeer and humans [edit]

Hunting [edit]

Reindeer pulling a sled in Russia

Reindeer hunting by humans has a very long history, and caribou/wild reindeer "may well be the species of single greatest importance in the entire anthropological literature on hunting."[4]

Humans started hunting reindeer in the Mesolithic and Neolithic periods, and humans are today the main predator in many areas. Norway and Greenland have unbroken traditions of hunting wild reindeer from the ice age until the present day. In the non-forested mountains of central Norway, such as Jotunheimen, it is still possible to find remains of stone-built trapping pits, guiding fences, and bow rests, built especially for hunting reindeer. These can, with some certainty, be dated to the Migration Period, although it is not unlikely that they have been in use since the Stone Age.[citation needed]

Norway is now preparing to apply for nomination as a World Heritage Site for areas with traces and traditions of reindeer hunting in Dovrefjell-Sunndalsfjella National Park, Reinheimen National Park and Rondane National Park in Central Sør-Norge (Southern Norway). There is in these parts of Norway an unbroken tradition of reindeer hunting from post-glacial Stone Age until today.[citation needed]

Wild caribou are still hunted in North America and Greenland. In the traditional lifestyle of the Inuit people, Northern First Nations people, Alaska Natives, and the Kalaallit of Greenland, the caribou is an important source of food, clothing, shelter, and tools. Many Gwichʼin people, who depend on the Porcupine caribou, still follow traditional caribou management practices that include a prohibition against selling caribou meat and limits on the number of caribou to be taken per hunting trip.[37]

The blood of the caribou was supposedly mixed with alcohol as drink by hunters and loggers in colonial Quebec to counter the cold. This drink is now enjoyed without the blood as a wine and whiskey drink known as Caribou.[38][39]

Reindeer husbandry [edit]

A reindeer sled, Arkhangelsk, Russia. Late nineteenth-century photochrom.
Milking reindeer in the 19th century
Reindeer fur coat

Reindeer have been herded for centuries by several Arctic and Subarctic people including the Sami and the Nenets. They are raised for their meat, hides, and antlers and, to a lesser extent, for milk and transportation. Reindeer are not considered fully domesticated, as they generally roam free on pasture grounds. In traditional nomadic herding, reindeer herders migrate with their herds between coast and inland areas according to an annual migration route and herds are keenly tended. However, reindeer were not bred in captivity, though they were tamed for milking as well as for use as draught animals or beasts of burden.[citation needed]

The use of reindeer as semi-domesticated livestock in Alaska was introduced in the late 19th century by the U.S. Revenue Cutter Service, with assistance from Sheldon Jackson, as a means of providing a livelihood for Native peoples there.[40] Reindeer were imported first from Siberia, and later also from Norway. A regular mail run in Wales, Alaska, used a sleigh drawn by reindeer.[41] In Alaska, reindeer herders use satellite telemetry to track their herds, using online maps and databases to chart the herd's progress.[citation needed]

Economy [edit]

The reindeer has (or has had) an important economic role for all circumpolar peoples, including the Saami, Nenets, Khants, Evenks, Yukaghirs, Chukchi, and Koryaks in Eurasia. It is believed that domestication started between the Bronze and Iron Ages. Siberian deer owners also use the reindeer to ride on (Siberian reindeer are larger than their Scandinavian relatives). For breeders, a single owner may own hundreds or even thousands of animals. The numbers of Russian herders have been drastically reduced since the fall of the Soviet Union. The fur and meat is sold, which is an important source of income. Reindeer were introduced into Alaska near the end of the 19th century; they interbreed with native caribou subspecies there. Reindeer herders on the Seward Peninsula have experienced significant losses to their herds from animals (such as wolves) following the wild caribou during their migrations.[citation needed]

Reindeer meat is popular in the Scandinavian countries. Reindeer meatballs are sold canned. Sautéed reindeer is the best-known dish in Lapland. In Alaska and Finland, reindeer sausage is sold in supermarkets and grocery stores. Reindeer meat is very tender and lean. It can be prepared fresh, but also dried, salted, hot- and cold-smoked. In addition to meat, almost all internal organs of reindeer can be eaten, some being traditional dishes.[42] Furthermore, Lapin Poron liha, fresh reindeer meat completely produced and packed in Finnish Lapland, is protected in Europe with PDO classification.[43][44]

Reindeer antler is powdered and sold as an aphrodisiac, nutritional or medicinal supplement to Asian markets.

Caribou have been a major source of subsistence for Canadian Inuit.

In history [edit]

Both Aristotle and Theophrastus have short accounts – probably based on the same source – of an ox-sized deer species, named tarandos, living in the land of the Bodines in Scythia, which was able to change the colour of its fur to obtain camouflage. The latter is probably a misunderstanding of the seasonal change in reindeer fur colour. The descriptions have been interpreted as being of reindeer living in the southern Ural Mountains at c. 350 BC[45]

Tragelaphus or Deer-Goat

A deer-like animal described by Julius Caesar in his Commentarii de Bello Gallico (chapter 6.26) from the Hercynian Forest in the year 53 BC is most certainly to be interpreted as reindeer:[45][46]

There is an ox shaped like a stag. In the middle of its forehead a single horn grows between its ears, taller and straighter than the animal horns with which we are familiar. At the top this horn spreads out like the palm of a hand or the branches of a tree. The females are of the same form as the males, and their horns are the same shape and size.

According to Olaus Magnus's Historia de Gentibus Septentrionalibus – printed in Rome in 1555 – Gustav I of Sweden sent 10 reindeer to Albert I, Duke of Prussia, in the year 1533. It may be these animals that Conrad Gessner had seen or heard of.

During World War II, the Soviet Army used reindeer as pack animals to transport food, ammunition and posts from Murmansk to the Karelian front and bringing wounded soldiers, pilots and equipment back to the base. About 6 000 reindeer and more than 1 000 reindeer herders were part of the operation. Most herders were Nenets, who were mobilized from the Nenets Autonomous Okrug, but reindeer herders from Murmansk, Arkhangelsk and Komi also participated.[47][48]

Name etymology [edit]

The name rangifer, which Linnaeus chose as the name for the reindeer genus, was used by Albertus Magnus in his De animalibus, fol. Liber 22, Cap. 268: "Dicitur Rangyfer quasi ramifer". This word may go back to a Saami word raingo.[45] For the origin of the word tarandus, which Linnaeus chose as the species epithet, he made reference to Ulisse Aldrovandi's Quadrupedum omnium bisulcorum historia fol. 859–863, Cap. 30: De Tarando (1621). However, Aldrovandi – and before him Konrad Gesner[49] – thought that rangifer and tarandus were two separate animals.[50] In any case, the tarandos name goes back to Aristotle and Theophrastus – see above.

Local names [edit]

The name rein (-deer) is of Norse origin (Old Norse hreinn, which again goes back to Proto-Germanic *hrainaz and Proto-Indo-European *kroinos meaning "horned animal"). In the Uralic languages, Sami poatsu (in Northern Sami boazu, in Lule Sami boatsoj, in Pite Sami båtsoj, in Southern Sami bovtse), Mari pučə and Udmurt pudžej, all referring to domesticated reindeer, go back to *počaw, an Iranian loanword deriving from Proto-Indo-European *peḱu-, meaning "cattle". The Finnish name poro may also stem from the same.[51] The name caribou comes, through French, from Mi'kmaq qalipu, meaning "snow shoveler", referring to its habit of pawing through the snow for food.[52] In Inuktitut, the caribou is known by the name tuktu.[53][54] In Cree-Montagnais-Naskapi dialects the caribou is called atihkw.[citation needed]

Reindeer in fiction [edit]

Two Scottish reindeer relax after pulling Santa's sleigh at the switching on of Christmas lights

Santa Claus's reindeer [edit]

In the Santa Claus tale, Santa Claus's sleigh is pulled by flying reindeer. These were first named in the 1823 poem "A Visit from St. Nicholas", where they are called Dasher, Dancer, Prancer, Vixen, Comet, Cupid, Dunder, and Blixem.[55] Dunder was later changed to Donder and—in other works—Donner (in German, "thunder"), and Blixem was later changed to Bliksem, then Blitzen (German for "lightning"). Some consider Rudolph as part of the group as well, though he was not part of the original named work referenced previously. Rudolph was added by Robert L. May in 1939 as "Rudolph the Red-Nosed Reindeer".[citation needed]

According to the British comedy panel game QI, Rudolph the Red-Nosed Reindeer and all of Santa's other reindeer must be either female or castrated, because male reindeer lose their antlers during winter.

Reindeer in film [edit]

Sur la piste du renne blanc (Tracking the white reindeer) [edit]

In this documentary, a young man of the Tsaatan tribe in northern Mongolia must prove himself a fit son-in-law by raising a herd of reindeer. Part of his quest involves tracking down and capturing a large, half-wild white reindeer for his herd. The tale demonstrates the skills that the people use to live in their harsh climate and shows people riding and roping reindeer and using their skins and antlers. The filmmaker is Hamid Sardar.[56][57]

Heraldry and symbols [edit]

Several Norwegian municipalities have one or more reindeer depicted in their coats-of-arms: Eidfjord, Porsanger, Rendalen, Tromsø, Vadsø, and Vågå. The historic province of Västerbotten in Sweden has a reindeer in its coat of arms. The present Västerbotten County has very different borders and uses the reindeer combined with other symbols in its coat-of-arms. The city of Piteå also has a reindeer. The logo for Umeå University features three reindeer.[58]

The Canadian 25-cent coin, or "quarter" features a depiction of a caribou on one face. The caribou is the official provincial animal of Newfoundland and Labrador, Canada, and appears on the coat of arms of Nunavut. A caribou statue was erected at the center of the Beaumont-Hamel Newfoundland Memorial, marking the spot in France where hundreds of soldiers from Newfoundland were killed and wounded in the First World War and there is a replica in Bowring Park, in St. John's, Newfoundland's capital city.[citation needed]

Two municipalities in Finland have reindeer motifs in their coats-of-arms: Kuusamo[59] has a running reindeer and Inari[60] a fish with reindeer antlers.

See also [edit]

References [edit]

  1. ^ a b c d e f Henttonen, H. & Tikhonov, A. (2008). Rangifer tarandus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 April 2010.
  2. ^ a b Peter Gravlund, Morten Meldgaard, Svante Pääbo, and Peter Arctander (1998). "Polyphyletic Origin of the Small-Bodied, High-Arctic Subspecies of Tundra Reindeer (Rangifer tarandus)". Molecular Phylogenetics and Evolution 10 (2): 151–9. doi:10.1006/mpev.1998.0525. PMID 9878226. 
  3. ^ a b S. A. Byun, B. F. Koop, and T. E. Reimchen (2002). "Evolution of the Dawson caribou (Rangifer tarandus dawsoni)". Can. J. Zool. 80 (5): 956–960. doi:10.1139/z02-062. 
  4. ^ a b "In North America and Eurasia the species has long been an important resource—in many areas the most important resource—for peoples inhabiting the northern boreal forest and tundra regions. Known human dependence on caribou/wild reindeer has a long history, beginning in the Middle Pleistocene (Banfield 1961:170; Kurtén 1968:170) and continuing to the present....The caribou/wild reindeer is thus an animal that has been a major resource for humans throughout a tremendous geographic area and across a time span of tens of thousands of years." Ernest S. Burch, Jr. (1972). "The Caribou/Wild Reindeer as a Human Resource". American Antiquity 37 (3): 339–368. doi:10.2307/278435. JSTOR 278435. 
  5. ^ Flying Reindeer and Santa Claus: Fact, Fiction and Myth. Icr.arcticportal.org (2008-12-15). Retrieved on 2011-09-16.
  6. ^ The Sámi and their reindeer – University of Texas at Austin
  7. ^ a b c Novak, R. M., ed. (1999). Walker's Mammals of the World. Vol. 2 (6th edition ed.). Baltimore: Johns Hopkins University Press. pp. 1128–1130. ISBN 0-8018-5789-9. 
  8. ^ Sommer R. S. and Nadachowski A. (2006). "Glacial refugia of mammals in Europe: evidence from fossil records". Mammal Rev 36 (4): 251–265. doi:10.1111/j.1365-2907.2006.00093.x. 
  9. ^ Christmas reindeer mystery as world’s largest herd plummets "Christmas reindeer mystery as world's largest herd plummets". Survival International Charitable Trust. 21 December 2011. Retrieved 16 November 2012. 
  10. ^ Europe's last wild reindeer herds in peril. Newscientist. 19 December 2003. Retrieved on 2011-09-16.
  11. ^ "Report on the outputs of the Advisory Group on Reindeer Management Methodology", Terrestrial: Invasive Species (Government of South Georgia and the South Sandwich Islands), 2011, retrieved 16 November 2012, "Following a wide consultation, the Government of South Georgia and the South Sandwich Islands took the decision in early 2011 to responsibly and humanely eradicate reindeer from South Georgia." 
  12. ^ South Georgia and South Sandwich Islands Environment Documents - Report on Reindeer Management Methodology
  13. ^ Reindeer Hunting in Iceland. International Adventure. Accessed 12 November 2010.
  14. ^ BBC Earth News-Reindeer herds in global decline. BBC News (2009-06-11). Retrieved on 2011-09-16.
  15. ^ Vors, L. S and Boyce, M. S. (2009). "Global declines of caribou and reindeer". Global Change Biology 15 (11): 2626–2633. doi:10.1111/j.1365-2486.2009.01974.x. 
  16. ^ a b c Caribou at the Alaska Department of Fish & Game. Adfg.state.ak.us. Retrieved on 2011-09-16.
  17. ^ a b c Aanes, R. (2007). Svalbard reindeer. Norwegian Polar Institute.
  18. ^ a b c Reid, F. (2006). Mammals of North America. Peterson Field Guides. ISBN 978-0-395-93596-5
  19. ^ a b New World Deer (Capriolinae).[dead link] Answers.com
  20. ^ "In the winter, the fleshy pads on these toes grow longer and form a tough, hornlike rim. Caribou use these large, sharp-edged hooves to dig through the snow and uncover the lichens that sustain them in winter months. Biologists call this activity "cratering" because of the crater-like cavity the caribou’s hooves leave in the snow." All About Caribou – Project Caribou
  21. ^ Image of reindeer cratering in snow. Arcticphoto.co.uk. Retrieved on 2011-09-16.
  22. ^ Banfield AWF: The caribou. In The Unbelievable Land. Smith I.N. (ed.) Ottawa: Queen's Press; 1966: 25–28, cited in Jakob Bro-Jørgensen and Torben Dabelsteen (2008). "Knee-clicks and visual traits indicate fighting ability in eland antelopes: multiple messages and back-up signals". BMC Biology 6: 47. doi:10.1186/1741-7007-6-47. PMC 2596769. PMID 18986518. 
  23. ^ Reindeer use UV light to survive in the wild. Ucl.ac.uk (2011-05-26). Retrieved on 2011-09-16.
  24. ^ Lemmings at Hinterland Who's Who
  25. ^ Terrestrial Mammals of Nunavut by Ingrid Anand-Wheeler. ISBN 1-55325-035-4.
  26. ^ ''The Sun, the Moon and Firmament in Chukchi Mythology and on the Relations of Celestial Bodies and Sacrifice'' by Ülo Siimets at 140. (PDF) . Retrieved on 2011-09-16.
  27. ^ http://www.animalcorner.co.uk/wildlife/caribou.html.  Missing or empty |title= (help)
  28. ^ http://www.animalcorner.co.uk/wildlife/caribou.html.  Missing or empty |title= (help)
  29. ^ Caribou Migration Monitoring by Satellite Telemetry. Mrnf.gouv.qc.ca. Retrieved on 2011-09-16.
  30. ^ Walker, Matt. (2009-10-20) Eagles filmed hunting reindeer. BBC News. Retrieved on 2011-09-16.
  31. ^ Caribou Foes: Natural Predators in the Wilderness. Learner.org. Retrieved on 2011-09-16.
  32. ^ Greenland Shark (Somniosus microcephalus). Postmodern.com. Retrieved on 2011-09-16.
  33. ^ Willemsen, G.F.(1983). Osteological measurements and some remarks on the evolution of the Svalbard reindeer, Rangifer tarandus platyrhynchus. Zeitschrift für Säugetierkunde 48 (3):175-185
  34. ^ a b c Grubb, P. (16 November 2005). In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  35. ^ a b Cronin, M. A., M. D. Macneil, and J. C. Patton (2005). Variation in Mitochondrial DNA and Microsatellite DNA in Caribou (Rangifer tarandus) in North America. Journal of Mammalogy 86(3): 495–505.
  36. ^ Geist, V. (2007). Defining subspecies, invalid taxonomic tools, and the fate of the woodland caribou. The Eleventh North American Caribou Workshop (2006). Rangifer, Special Issue 17: 25-28.
  37. ^ Gwichʼin Traditional Management Practices. Arcticcircle.uconn.edu. Retrieved on 2011-09-16.
  38. ^ Mieusset, Sébastien. "Le "Temps des sucres" au Québec" 
  39. ^ Ovenell-Carter, Julie (06-02-2009). "Quebec's Carnaval is worth freezing your a** off for". theseboots.travel 
  40. ^ King, Irving H.(1996). The Coast Guard Expands, p. 86–91. Naval Institute Press, Annapolis, Maryland. ISBN 1-55750-458-X.
  41. ^ United States. Bureau of Education; United States. Bureau of Education. Alaska Division (1905). Annual report on introduction of domestic reindeer into Alaska 14. Govt. Print. Off. pp. 18–. Retrieved 16 September 2011. 
  42. ^ Reindeer. Saunalahti.fi. Retrieved on 2011-09-16.
  43. ^ 'Lapland Reindeer meat protected in the EU' North Magazine (Accessed 19 July 2010)
  44. ^ European Commission PDO/PGI list (Accessed 19 July 2010)
  45. ^ a b c Sarauw, Georg (1914). "Das Rentier in Europa zu den Zeiten Alexanders und Cæsars" [The reindeer in Europe to the times of Alexander the Great and Julius Caesar]. In Jungersen, H. F. E.; Warming, E.. Mindeskrift i Anledning af Hundredeaaret for Japetus Steenstrups Fødsel (in German). Copenhagen. pp. 1–33. 
  46. ^ "Est bos cervi figura, cuius a media fronte inter aures unum cornu* exsistit excelsius magisque directum his, quae nobis nota sunt, cornibus: ab eius summo sicut palmae ramique* late diffunduntur. Eadem est feminae marisque natura, eadem forma magnitudoque cornuum." Greenough, J. B.; D'Ooge, Benjamin L.; Daniell, M. Grant (1898). "book 6, chapter 26". Commentary on Caesar, Gallic War. Boston: Ginn and Company. 
  47. ^ Trude Pettersen: War memorial to honor WWII reindeer battalions Barents Observer, 27 february, 2012
  48. ^ In WWII, Reindeer Were Our Animal Allies National Public Radio, 14 August, 2011
  49. ^ Gesner, K. (1617) Historia animalium. Liber 1, De quadrupedibus viviparis. Tiguri 1551. p. 156: De Tarando. 9. 950: De Rangifero.
  50. ^ Aldrovandi, U. (1621) Quadrupedum omnium bisulcorum historia. Bononiæ. Cap. 30: De Tarando – Cap. 31: De Rangifero.
  51. ^ Koivulehti, Jorma (2007): Saamen ja suomen 'poro'. Mémoires de la Société Finno-Ougrienne 253. http://www.sgr.fi/sust/sust253/sust253_koivulehto.pdf
  52. ^ Flexner, Stuart Berg and Leonore Crary Hauck, eds. (1987). The Random House Dictionary of the English Language, 2nd ed. (unabridged). New York: Random House, pp. 315–16)
  53. ^ Spalding, Alex, Inuktitut – A Multi-Dialectal Outline Dictionary (with an Aivilingmiutaq base). Nunavut Arctic College, Iqaluit, Nunavut, Canada, 1998.
  54. ^ Eskimoisches Wörterbuch, gesammelt von den Missionaren in Labrador, revidirt und herausgegeben von Friedrich Erdmann. Budissin [mod. Bautzen] 1864.
  55. ^ "The Legendary Role of Reindeer in Christmas, Jeff Westover, My Merry Christmas, accessed 27 December 2007
  56. ^ Hamid Sardar (2008). "Sur la piste du renne blanc". ZED. Retrieved 2012-12-21. 
  57. ^ Trailer: Sur la piste du renne blanc
  58. ^ Logotyp (in Swedish) Umeå University, retrieved 7 March, 2012
  59. ^ Coat of arms for Kuusamo.
  60. ^ Coat of arms for Inari.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Cronin (1992) found considerable variation in mtDNA among populations in Alberta, Labrador, Newfoundland, and Alaska; geographic differentiation was evident, but woodland and barren ground subspecies were not distinguishable by mtDNA genotypes. Populations of R. t. pearyi on the Queen Elizabeth Islands are genetically and possibly ecologically distinct from all other forms of Rangifer, including those on the southern tier of arctic islands (south of 74 degrees N latitude, excluding Baffin and Bylot islands) (Miller, 1991 COSEWIC report). See Grubb (in Wilson and Reeder 2005) for brief discussion of currently recognized subspecies and subspecies groups.

See Cronin (1991) for a phylogeny of the Cervidae based on mitochondrial-DNA data. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!