Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Description

The White-tailed Deer is distinguished from the Mule Deer by the smaller size of its ears, the color of its tail, and most strikingly, by antler shape. In Whitetails, the main beam of the antlers grows forward rather than upwards, and each tine develops as its own separate branch rather than being split into a forked pair. The two species also run differently when they are alarmed. Mule Deer stot, a boing-boing-boing motion in which all four feet leave and hit the ground with each bound, whereas White-tailed Deer spring forward, pushing off with their hind legs and landing on their front feet. Today White-tails are very widespread in North America: there may be as many as 15 million in the United States. These Deer are adaptable browsers, feeding on leaves, twigs, shoots, acorns, berries, and seeds, and they also graze on grasses and herbs. In areas where they live alongside Mule Deer, the species naturally separate ecologically, the Whitetails staying closer to moist streams and bottomlands, the Mule Deer preferring drier, upland places.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the Key deer  More images, video and sound of the Key deer, a subspecies
  • Original description: Zimmermann, E.A.W., 1780.  Geographische Geschichte des Menschen, und der allgemein verbreiteten vierfüssigen Thiere. Zweiter Band. Enthält ein vollständiges Verzeichniss aller bekannten Quadrupeden.  Weygandschen Buchhandlung, Leipzig, (2nd volume) p. 129.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs from southern Canada south through most of the U.S. and Mexico to South America (Peru, Ecuador, Bolivia, Colombia, northern Brazil, Venezuela, and the Guianas). Southernmost populations in the neotropics may represent other species (Molina and Molinari 1999). Absent from much of southwestern U.S. The species has been introduced in Czechoslovakia, Finland, New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range extends from northwestern and southern Canada south through most of the United States, Mexico, and Central America to northern South America (Bolivia, northern Brazil, Colombia, French Guiana, Guyana, Peru, Surinam, and Venezuela). Southernmost populations in the neotropics may represent other species (Molina and Molinari 1999). The species has been introduced in the Czech Republic, Finland, New Zealand, and the West Indies(Grubb, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The white-tailed deer is native to North America, Central America, and South America. In North America, the white-tailed deer ranges from southern Yukon and Northwest Territories, across the southern provinces of Canada, and southward throughout most of the conterminous United States. It is rare or absent in Alaska, California, Nevada, and Utah. It is found in all of Canada, except Nunavut, Newfoundland, and Labrador [122,155,279,381]. The range of the Key deer is composed of 17 islands in the lower Florida Keys that total about 38 miles² (98 km²) [95]. Columbian white-tailed deer exist in 2 geographically isolated populations: in about 460 miles² (1,200 km²) of oak (Quercus spp.) woodland in Douglas County, Oregon, and about 90 miles² (240 km²) of bottomland in and around the Julia Butler Hansen Refuge for the Columbian White-tailed Deer in southwestern Washington [122,378]. White-tailed deer have been introduced and established in many parts of the world, including New Zealand, Finland, Serbia, Croatia, and the Caribbean Islands [155]. This review focuses on white-tailed deer in the United States. NatureServe provides a distributional map of white-tailed deer.

States and provinces [289]:
United States: AL, AR, AZ, CO, CT, DC, DE, FL, GA, IA, ID, IL, IN, KS, KY, LA, MA, MD, ME, MI, MN, MO, MS, MT, NC, ND, NE, NH, NJ, NM, NY, OH, OK, OR, PA, RI, SC, SD, TN, TX, UT, VA, VT, WA, WI, WV, WY
Canada: AB, BC, LB, MB, NB, NS, NT, ON, PE, QC, SK, YT
Mexico

  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 155. Heffelfinger, James R. 2011. Taxonomy, evolutionary history, and distribution. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 3-39. [85220]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 289. NatureServe. 2013. NatureServe Explorer: An online encyclopedia of life, [Online]. Version 7.1. Arlington, VA: NatureServe (Producer). Available http://www.natureserve.org/explorer. [69873]
  • 378. Smith, Winson Paul. 1987. Dispersion and habitat use by sympatric Columbian white-tailed deer and Columbian black-tailed deer. Journal of Mammalogy. 68(2): 337-347. [86776]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

White-tailed deer are native to both the Nearctic and Neotropical regions. They inhabit most of southern Canada and all of the mainland United States except portions of the west central states to the California coast. Their range extends throughout Central America to Bolivia.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Whitetail deer inhabit most of southern Canada and all of the mainland United States except two or three states in the west. Their range reaches throughout Central America to Bolivia.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical description

More info for the term: mast

White-tailed deer vary in size depending upon region. The smallest occur at latitudes nearer the equator and/or at low elevations [131,381]. Island white-tailed deer are typically smaller than their mainland counterparts [79,98,131]. Key deer are one of the smallest subspecies; mature males (bucks) weigh about 79 pounds (36 kg) and mature females (does) weigh about 64 pounds (29 kg) [131]. The largest subspecies occurs in the Northeast and Great Lakes regions. Adult bucks (≥2.5 years old) weigh about 220 pounds (100 kg), and adult does weigh about 145 pounds (66 kg). Large changes in body size occur over relatively small geographic distances. White-tailed deer bucks in the Florida Everglades are 1.5 times the weight (mean: 117 pounds (53 kg)) of Key deer [131]. Body size is plastic and varies within and between regions depending upon nutritional condition [131,179,279]. Nutritional condition is often related to soil fertility, with the most fertile soils producing heavier-bodied and larger-antlered individuals than low fertility soils [179]. For example, in Mississippi, the eviscerated body mass of white-tailed deer in the fertile Delta region was 30% to 40% more than that of equivalent-aged white-tailed deer in the less fertile Coastal Flatwood region [397]. White-tailed deer body mass is generally highest in the agricultural Midwest, where white-tailed deer have access to mast, fertile alluvial land, and fertilized, high-protein agricultural crops [131]. Mature, nonpregnant does weigh roughly 60% to 75% of what adult bucks weigh [279]. For more information, see Growth.
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 98. Ditchkoff, Stephen S. 2011. Anatomy and physiology. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 43-73. [85221]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 179. Jacobson, Harry A.; DeYoung, Charles A.; DeYoung, Randy W.; Fulbright, Timothy E.; Hewitt, David G. 2011. Management on private property. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 453-479. [85234]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 397. Strickland, Bronson K.; Demarais, Stephen. 2000. Age and regional differences in antlers and mass of white-tailed deer. The Journal of Wildlife Management. 64(4): 903-911. [86296]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

White-tailed deer have different colors depending on the season and their location. Usually they have greyish fur in winter and reddish-brown fur in summer. They have white patches of fur on their face and lower legs. The tail is brownish-red above and white below. When startled the deer lift this tail as they bound away, making the white patch prominent. Males have antlers that begin growing in April or May with a layer of velvety fur on them. In August and September the antlers shed this velvety covering for the mating season. The antlers fall off in January and are re-grown the next year. With each year of age a male will grow larger antlers with more points.

Range mass: 57.0 to 137.0 kg.

Range length: 160.0 to 220.0 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 123.447 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Head and body length is 150 to 200 cm, tail length is 10 to 28 cm, and height at the shoulders is between 80 and 100 cm.

Odocoileus virginianus dorsal coloration differs in shading locally, seasonally, and among subspecies; however in general it is grayer in the winter and redder in the summer. White fur is located in a band behind the nose, in circles around the eyes, inside the ears, over the chin and throat, on the upper insides of the legs and beneath the tail. Whitetail deer have scent glands between the two parts of the hoof on all four feet, metatarsal glands on the outside of each hind leg, and a larger tarsal gland on the inside of each hind leg at the hock. Scent from these glands is used for intraspecies communication and secretions become especially strong during the rutting season. Males possess antlers which are shed from January to March and grow out again in April or May, losing their velvet in August or September. At birth, fawns are spotted with white in coloration and weight between 1.5 and 2.5 kg. Their coats become grayish lose their spots by their first winter. Whitetail deer have good eyesight and acute hearing, but depend mainly on their sense of smell to detect danger.

Range mass: 57.0 to 137.0 kg.

Range length: 160.0 to 220.0 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 123.447 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 206 cm

Weight: 135000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: "Males are about 20% larger than females. "

Length:
Range: 0.85-2.4 m males

Weight:
Range: 22-137 kg males
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sierra Madre Occidental Pine-oak Forests Habitat

This taxon is found in the Sierra Madre Occidental pine-oak forests ecoregion, which boasts some of the richest biodiversity anywhere in North America, and contains about two thirds of the standing timber in Mexico. Twenty-three different species of pine and about 200 species of oak reside within the Sierra Madre Occidental pine-oak forests ecoregion.

Pine-oak forests here typically grow on elevations between approximately 1500 and 3300 meters, and occur as isolated habitat islands in northern areas within the Chihuahuan Desert. Soils are typically deep, where the incline allows soil build-up and derived from igneous material, although metamorphic rocks also form part of the soils in the west and northwest portions of the sierra. Steep-sloped mountains have shaped some portions of the Sierra, while others are dominated by their deep valleys, tall canyons and cliffs. These steep-sided cliffs have thinner soils limiting vegetation to chaparral types; characterized by dense clumps of Mexican Manzanita (Arctostaphylos pungens), Quercus potosina and Netleaf Oak (Q. rugosa). There are also zones of natural pasture, with grasses from the genera Arisitida, Panicum, Bromus and Stevis.

The pine-oak forests gradually transform into an oak-grassland vegetative association. Such communities represent an ecological transition between pine-oak forests and desert grasslands..  Here, species such as Chihuahuan Oak (Quercus chihuahuensis), Shin Oak (Q. grisea),  Q. striatula and Emory Oak (Q. emoryi), mark a transition zone between temperate and arid environments, growing in a sparse fashion and with a well-developed herbaceous stratum resembling xeric scrub. Cacti are also part of these transition communities extending well into the woodlands. Some cacti species such as the Little Nipple Cactus (Mammillaria heyderi macdougalii), Greenflower Nipple Cactus (M. viridiflora), Mojave Mound Cactus (Echinocereus triglochidiatus), and Leding's Hedgehog Cactus (E. fendleri var. ledingii) are chiefly centered in these biotic communities. The dominant vegetation in the northernmost part of the ecoregion in the Madrean Sky Islands includes Chihuahua Pine (Pinus leiophylla), Mexican Pinyon (P. cembroides), Arizona Pine (P. arizonica), Silverleaf Oak (Quercus hypoleucoides), Arizona White Oak (Q. arizonica), Emory Oak (Q. emoryi), Netleaf Oak (Q. rugosa), Alligator Juniper (Juniperus deppeana), and Mexican Manzanita (Arctostaphylos pungens).

This ecoregion is an important area for bird richness and bird endemism. Likewise, virtually all of the ecoregion is included in the Sierra Madre Occidental and trans-mexican range Endemic Bird Area. Endemic bird species include the Thick-billed Parrot (Rhynchopsitta pachyrhyncha EN) which is in danger of extinction, with population estimates as low as 500 pairs; the Tufted Jay (Cyanocorax dickeyi NT), Eared Quetzal (Euptilptis neoxenus NT) and the Green-striped Brush Finch (Buarremon virenticeps). Temperate and tropical influences converge in this ecoregion, forming a unique and rich complex of flora and fauna. Many other birds are found in this ecoregion including the Green Parakeet (Aratinga holochlora), Eared Trogon (Euptilotis neoxenus NT), Coppery-tailed Trogon (Trogon elegans), Grey-breasted Jay (Aphelocoma ultramarina), Violet-crowned Hummingbird (Amazilia violiceps), Spotted Owl (Strix occidentalis NT), and Golden Eagle (Aguila chryaetos).  Some species found only in higher montane areas are the Gould's Wild Turkey (Meleagris gallopavo mexicana), Band-tailed Pigeon (Patagioenas fasciata), Mexican Chickadee (Poecile sclateri) and Hepatic Tanager (Piranga flava).

The Sierra Madre Mantled Ground Squirrel (Spermophilus madrensis NT) is an endemic to the Sierra Madre Occidental pine-oak forests, restricted to southwestern Chihuahua, Mexico. The Mexican Gray Wolf (Canis lupus baileyi) and Mexican Grizzly Bear (Ursus horribilis), although considered by most to be extinct from this ecoregion, once roamed these mountains. Mammals also present include White-tailed Deer (Odocoileus virginianus), American Black Bear (Ursus americanus), Buller’s Chipmunk (Tamias bulleri), endemic Zacatecan Deer Mouse (Peromyscus difficilis), rock Squirrel (Spernophilis variegatus), Zacatecas Harvest Mouse (Reithrodontomys zacatecae) and Coati (Nasua nasua), to set forth a subset of mammals present.

Reptiles are also numerous in this ecoregion. Fox´s Mountain Meadow Snake (Adelophis foxi) is an endemic taxon to the ecoregion, only observed at the type locality at four kilometers east of  Mil Diez, about  3.2 kilometers west of El Salto, in southwestern Durango, Mexico. There are at least six species of rattlesnakes including the Mexican Dusky Rattlesnake (Crotalis triseriatus), Mojave Rattlesnake (C. scutulatus), Rock Rattlesnake (C. lepidus), Western Diamondback Rattlesnake (C. atrox), Twin-spotted Rattlesnake (C. pricei), and Ridgenose Rattlesnakes (C. willardi).  Clark's Spiny Lizard (Sceloporus clarkii) and Yarrow's Spiny Lizard (S. jarrovii), Bunchgrass Lizard (S. scalaris), and Striped Plateau Lizard (S. virgatus) are several of the lizards found in the Sierra Madre Occidental pine-oak forests.

Along springs and streams the Western Barking Frog (Craugastor augusti) and the Tarahumara Frog (Rana tamahumarae) are two anuran taxa occurring in the ecoregion. Other anuran taxa found here include: Bigfoot Leopard Frog (Lithobates megapoda), Northwest Mexico Leopard Frog (Lithobates magnaocularis) and the Blunt-toed Chirping Frog (Eleutherodactylus modestus VU). The Sacramento Mountains Salamander (Aneides hardii) is an endemic salamander found in the Sierra Madre Occidental pine-oak forests, restricted to the Sacramento Mountains, Capitan Mountains, and Sierra Blanca in Lincoln and Otero Counties within southern New Mexico, USA.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Moist Pacific Coast Mangroves Habitat

This taxon occurs in the Moist Pacific Coast mangroves, an ecoregion along the Pacific coast of Costa Rica with a considerable number of embayments that provide shelter from wind and waves, thus favouring mangrove establishment. Tidal fluctuations also directly influence the mangrove ecosystem health in this zone. The Moist Pacific Coast mangroves ecoregion has a mean tidal amplitude of three and one half metres,

Many of the streams and rivers, which help create this mangrove ecoregion, flow down from the Talamanca Mountain Range. Because of the resulting high mountain sediment loading, coral reefs are sparse along the Pacific coastal zone of Central America, and thus reef zones are chiefly found offshore near islands. In this region, coral reefs are associated with the mangroves at the Isla del Caño Biological Reserve, seventeen kilometres from the mainland coast near the Térraba-Sierpe Mangrove Reserve. The Térraba-Sierpe, found at the mouths of the Térraba and Sierpe Rivers, is considered a wetland of international importance.

Because of high moisture availability, the salinity gradient is more moderate than in the more northern ecoregion such as the Southern dry Pacific Coast ecoregion. Resulting mangrove vegetation is mixed with that of marshland species such as Dragonsblood Tree (Pterocarpus officinalis), Campnosperma panamensis, Guinea Bactris (Bactris guineensis), and is adjacent to Yolillo Palm (Raphia taedigera) swamp forest, which provides shelter for White-tailed Deer (Odocoileus virginianus) and Mantled Howler Monkeys (Alouatta palliata). Mangrove tree and shrub taxa include Red Mangrove (Rhizophora mangle), Mangle Caballero (R. harrisonii) R. racemosa (up to 45 metres in canopy height), Black Mangrove (Avicennia germinans) and Mangle Salado (A. bicolor), a mangrove tree restricted to the Pacific coastline of Mesoamerica.

Two endemic birds listed by IUCN as threatened in conservation status are found in the mangroves of this ecoregion, one being the Mangrove Hummingbird (Amazilia boucardi EN), whose favourite flower is the Tea Mangrove (Pelliciera rhizophorae), the sole mangrove plant pollinated by a vertebrate. Another endemic avain species to the ecoregion is the  Yellow-billed Cotinga (Carpodectes antoniae EN).  Other birds clearly associated with the mangrove habitat include Roseate Spoonbill (Ajaia ajaja), Gray-necked Wood Rail (Aramides cajanea), Rufous-necked Wood Rail (A. axillaris), Mangrove Black-hawk (Buteogallus anthracinus subtilis),Striated Heron (Butorides striata), Muscovy Duck (Cairina moschata), Boat-billed Heron (Cochlearius cochlearius), American White Ibis (Eudocimus albus), Amazon Kingfisher (Chloroceryle amazona), Mangrove Cuckoo (Coccyzus minor), Yellow Warbler (Setophaga petechia), and Black-necked Stilt (Himantopus mexicanus VU) among other avian taxa.

Mammals although not as numerous as birds, include species such as the Lowland Paca (Agouti paca), Mantled Howler Monkey (Alouatta palliata), White-throated Capuchin (Cebus capucinus), Silky Anteater (Cyclopes didactylus), Central American Otter (Lontra longicaudis annectens), White-tailed Deer (Odocoileus virginianus), feeds on leaves within A. bicolor and L. racemosa forests. Two raccoons: Northern Raccoon (Procyon lotor) and Crab-eating Raccoon (P. cancrivorus) can be found, both on the ground and in the canopy consuming crabs and mollusks. The Mexican Collared Anteater (Tamandua mexicana) is also found in the Moist Pacific Coast mangroves.

There are a number of amphibians in the ecoregion, including the anuran taxa: Almirante Robber Frog (Craugastor talamancae); Chiriqui Glass Frog (Cochranella pulverata); Forrer's Grass Frog (Lithobates forreri), who is found along the Pacific versant, and is at the southern limit of its range in this ecoregion. Example salamanders found in the ecoregion are the Colombian Worm Salamander (Oedipina parvipes) and the Gamboa Worm Salamander (Oedipina complex), a lowland organism that is found in the northern end of its range in the ecoregion. Reptiles including the Common Basilisk Lizard (Basiliscus basiliscus), Boa Constrictor (Boa constrictor), American Crocodile (Crocodilus acutus), Spectacled Caiman (Caiman crocodilus), Black Spiny-tailed Iguana (Ctenosaura similis) and Common Green Iguana (Iguana iguana) thrive in this mangrove ecoregion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
White-tailed deer inhabit a wide range of habitats from north temperate to subtropical and semi-arid environments in North America, and include rainforests and other equatorial associations, as deciduous forests and savannas of Central America and Northern South America (Brokx 1984, Danields 1991, Smith 1991). It is abundant in mixed pine-oak forests of Mexico (Ffollott and Gallina 1981), and in second-growth forests and thickets and forest-savanna ecotones of Guatemala, Honduras, Belize, El Salvador, Costa Rica and Panama (Mendez 1984). Ecological limitations in northern or montane habitats are related to depth, quality and duration of snow (Blouch 1984) and in more southern latitudes and lower elevations, the amount and temporal distribution of precipitation (Ffolliott and Gallina 1981, Mendez 1984, Villarreal 1999). O. virginianus favour more mesic climates and vegetation within arid regions. In the Andes countries, distribution of the white-tailed deer is not limited by elevation but rather by steep arid habitat and by rainforest on the mountain slopes (Brokx 1984). White-tailed deer is an extremely adaptable species (see compilation of 500 deer studies in Mexico by Mandujano 2004). The species thrives in close association with man and his agricultural and industrial pursuits. Its requirements are met in practically every ecological type including grasslands, prairies and plains, mountains, hardwoods, coniferous and tropical forests, deserts, and even in woodlots associated with farmland. In the United States, it reaches its largest densities in hardwood forests and bushlands (Teer 1991).

White-tailed deer occupy a well defined home range, but they are not territorial. Home range are influenced by age, sex, density, social interactions, latitude, season and habitat characteristics. Size of home ranges varies inversely with density and vegetative cover. Annual home range averages 59- 520 ha (Marchinton and Hirth 1984). In northeastern Mexico, O. v. texanus home range averages 193 ha for females, and 234 ha for males in a xerophyllous brushland (Bello et al.2004), and O. v. sinaloae in a tropical dry forest in the Pacific Coast of Mexico had a home range of 34 ha during the wet season (Sánchez Rojas et al.1994).

The white-tailed deer is a polytypic species that has become well adapted to different environments. This diversity is reflected in body weight, external dimensions, coat coloration, antler growth and, no doubt assorted physiological, biochemical and behavioural distinctions. In general, the colour is darker in the humid, forested areas, and paler in the drier, more open brushland, reddish in subtropical and tropical environments (Backer 1984). In the northern hemisphere undergo two complete molts per year and exhibit seasonal variation in pelage. The summer coat consists of short, thin, wiry hairs and varies from red-brown to bright tan; the winter coat varies from blue-gray to gray-brown and has longer, thicker and more brittle hairs (Smith 1991). High Andean populations may retain a greyish pelage year-round, while tropical whitetails may keep the tawny,
eddish phase (Baker 1984). Adults have a white nose band, orbital region and throat patch. All underparts including lower tail, insides of legs, venter, and chin are white. Fawns have a reddish-brown with white dorsal spots that disappear at 3-4 months of age (Hesselton and Hesselton 1982).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Terrestrial

Comments: White-tailed deer occupy many types of habitats in mountains and lowlands, including various forests and woodlands, forest edges, shrublands, grasslands with shrubs, and residential areas. They are often associated with successional vegetation, especially near agricultural lands. In the north in winter, they tend to be in areas with minimal snow cover (if possible) and often use stands of conifers for shelter. Within arid regions, white-tailed deer prefer mesic situations (riparian zones, montane woodlands).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: Predation risk

More info for the terms: association, cover, density, forbs, frequency

A review stated that antipredator strategies used by white-tailed deer include hiding in dense vegetation; using trails to outrun predators; going into water; and forming groups in open areas [130,131]. Geist [131] suggested that the white-tailed deer's antipredator strategies partly determine the species' preference for flat terrain and/or areas without obstacles. Yarding behavior may be an antipredator strategy. Some authors found that white-tailed deer using yards have higher survival rates than nonyarding white-tailed deer [277,292]. Trail systems within yards may enhance an animal's ability to escape gray wolves and coyotes [19,292]. In contrast, Whitlaw and others [452] found no differences in predator-caused mortality rates between yarding and nonyarding white-tailed deer populations in northern and southern New Brunswick.

Predators or human hunters may alter white-tailed deer habitat use, movements, diet, and behavior [94]. During hunting season, for example, white-tailed deer may move to habitats with dense cover and become more nocturnal [121]. Mech [270,273] found that white-tailed deer densities in a declining white-tailed deer population tended to be greater along gray wolf pack territory buffer zones than in territory centers, possibly due to reduced risk of predation. On the Rob and Bessie Welder Wildlife Refuge in southern Texas, predation risk appeared to reduce segregation between male and female white-tailed deer. At moderate population density (39 white-tailed deer/km²), females with young used blackbrush acacia-honey mesquite savanna with dense cover more than males. At high population density (77 white-tailed deer/km²), which was a result of predator control, segregation among males and females decreased during all seasons (P< 0.05). Males that otherwise used more open habitats increased their use of the blackbrush acacia-honey mesquite savanna as population density increased. As spatial segregation between males and females decreased at the high population density, diets of both sexes shifted away from forbs toward more graminoids and browse, and shifts were more pronounced among males [192].

Snow depth and hardness may affect white-tailed deer predation risk. In central Ontario's mixed-forest French River-Burwash ecosystem, white-tailed deer had a stronger positive association with predation risk (defined as the frequency of a predator's occurrence across the landscape) in 2006 compared with the previous winter. The authors suggested this was due to deep, dense snow during 2006 that forced white-tailed deer to congregate in areas of shallower, light snow, where gray wolves typically hunt [196].

Habitat type partly determined fawn susceptibility to predation in Illinois. Rohm and others (2007 cited in [19]) examined causes of fawn mortality during 5 years in southern Illinois. Overall fawn survival was 59%, and predation was the leading cause of mortality (64%), with coyotes accounting for 56% of predation mortalities. Fawn survival was best explained by fawn age and landscape and forest characteristics. The authors indicated that areas inhabited by surviving fawns had forest patches next to nonforest patches and contained more edge habitats. They speculated that these habitats were areas where coyotes were less successful at locating and killing fawns (Rohm and others 2007 cited in [19]). Females with fawns appear to select fawning areas with reduced predation risk. For more information, see Fawning areas.

For information about how predation risk may affect use of burned areas, see White-tailed deer, predator, and fire interactions.

  • 19. Ballard, Warren. 2011. Predator-prey relationships. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 251-286. [85227]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 130. Geist, Valerius. 1981. Behavior: adaptive strategies in mule deer. In: Wallmo, Olof C., ed. 1981. Mule and black-tailed deer of North America. Lincoln, NE: University of Nebraska Press: 157-224. [84942]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 192. Kie, John G.; Bowyer, R. Terry. 1999. Sexual segregation in white-tailed deer: density-dependent changes in use of space, habitat selection, and dietary niche. Journal of Mammalogy. 80(3): 1004-1020. [86425]
  • 196. Kittle, Andrew M.; Fryxell, John M.; Desy, Glenn E.; Hamr, Joe. 2008. The scale-dependent impact of wolf predation risk on resource selection by three sympatric ungulates. Oecologia. 157(1): 163-175. [71062]
  • 270. Mech, L. David. 1977. Wolf-pack buffer zones as prey reservoirs. Science. 198(4314): 320-321. [86411]
  • 273. Mech, L. David; Dawson, Deanna K.; Peek, James M.; Korb, Mark; Rogers, Lynn L. 1980. Deer distribution in relation to wolf pack territory edges. The Journal of Wildlife Management. 44(1): 253-258. [86412]
  • 277. Messier, Francois; Barrette, Cyrille. 1985. The efficiency of yarding behavior by white-tailed deer as an antipredator strategy. Canadian Journal of Zoology. 63(4): 785-789. [86422]
  • 292. Nelson, Michael E.; Mech, L. David. 1991. Wolf predation risk associated with white-tailed deer movements. Canadian Journal of Zoology. 69(10): 2696-2699. [86416]
  • 452. Whitlaw, Heather A.; Ballard, Warren B.; Sabine, Dwayne L.; Young, Steven J.; Jenkins, Roger A.; Forbes, Graham J. 1998. Survival and cause-specific mortality rates of adult white-tailed deer in New Brunswick. The Journal of Wildlife Management. 62(4): 1335-1341. [86420]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: Edge habitat

More info for the terms: cover, density, selection

The white-tailed deer is often considered an "edge species" because it does best in landscapes where cover and food are in close proximity [430]. White-tailed deer commonly use edges between clearcut and mature forests [422] (see Logging). Edge habitat is generally considered important to deer because of high habitat diversity in ecotones and easy access to more than one habitat type [30,63]. In contrast, in southeastern Arizona's Mexican pinyon (Pinus cembroides) stands in Madrean oak-conifer communities, both browse use and the rate of deposition of white-tailed deer pellet groups in burned stands 6.5 years after fire decreased significantly within 1,391 feet (424 m) of habitat edges (P<0.05) [23]. Like mule deer, white-tailed deer use of edge habitats may be greater where there is less interspersion of forage and cover. A review stated that studies finding little response of deer to edges tended to be in areas that had a high degree of interspersion of forage habitats and cover habitats or had a fine-grained interspersion where forage and cover were available in the same habitat [204]. On Anticosti Island, Quebec, July through November habitat selection by female white-tailed deer was driven mainly by forage acquisition rather than a trade-off between forage acquisition and proximity to protective cover. The island had no white-tailed deer predators, little hunting of females, and high population density (>20 white-tailed deer/km²). The authors suggested that preference for open–forest edges may be reduced when predation is absent and conspecific density is high [258].
  • 23. Barsch, Bob Knight. 1977. Distribution of the Coues deer in pinyon stands after a wildfire. Tucson, AZ: University of Arizona. 52 p. Thesis. [85060]
  • 30. Bendell, J. F. 1974. Effects of fire on birds and mammals. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 73-138. [16447]
  • 63. Clark, T. P.; Gilbert, F. F. 1982. Ecotones as a measure of deer habitat quality in central Ontario. Journal of Applied Ecology. 19(3): 751-758. [86413]
  • 204. Kremsater, Laurie L.; Bunnell, Fred L. 1992. Testing responses to forest edges: the example of black-tailed deer. Canadian Journal of Zoology. 70(12): 2426-2435. [85545]
  • 258. Masse, Ariane; Cote, Steeve D. 2009. Habitat selection of a large herbivore at high density and without predation: trade-off between forage and cover? Journal of Mammalogy. 90(4): 961-970. [86407]
  • 422. Tomm, H. O.; Beck, J. A., Jr.; Hudson, R. J. 1981. Response of wild ungulates to logging practices in Alberta. Canadian Journal of Forest Research. 11(3): 606-614. [85750]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, forbs, mesic

Figure 2. Yearling white-tailed deer doe at Great Bay National Wildlife Refuge, Newington, New Hampshire. Photo courtesy of Greg Thompson, US Fish and Wildlife Service.

White-tailed deer are generalists that can use a variety of habitats. They are often associated with shrublands, woodlands, and forests throughout their range in North America. Woody vegetation is used for forage and cover. Disturbed communities that produce abundant forbs or browse often support relatively high densities of white-tailed deer. Important components of habitat for white-tailed deer vary across their distribution. In northern and eastern ranges, white-tailed deer are associated with forests and spend the winter in yards to avoid deep snow and mitigate cold temperatures. In western ranges, mesic habitats and riparian zones are important for foraging and cover. In southern regions, optimum habitat generally consists of openings containing herbaceous forage species interspersed in a woodland matrix [392]. In general, white-tailed deer herds are most productive in areas with a variety of habitat types and diversity of stand age classes [3,79,121,251,407].

  • 3. Adams, Kip P.; Hamilton, R. Joseph. 2011. Management history. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 355-377. [85230]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 251. Maas, Deborah S.; Musson, Robin L.; Hayden, Timothy J. 2003. Effects of prescribed burning on game species in the southeastern United States, a literature review. ERDC/CERL TR-03-13. Champaign, IL: U.S. Army Corps of Engineers, Engineer Research and Development Center, Construction Engineering Research Laboratory. 71 p. [86560]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]
  • 407. Telfer, E. S. 1974. Logging as a factor in wildlife ecology in the boreal forest. The Forestry Chronicle. 50(5): 186-190. [16537]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Data

Numerous reviews describing the biology of white-tailed deer are available and cited frequently in this review. These include the following sources: [79,131,156,302,318]. Among these sources, this review relies most heavily on Biology and Management of White-tailed Deer (compiled and edited by Hewitt [156]), particularly the following chapters: [3,19,55,70,92,94,95,98,122,146,155,157,179,182,286,392,430]. This review includes information for many aspects of white-tailed deer biology but focuses on those most relevant to fire.
  • 3. Adams, Kip P.; Hamilton, R. Joseph. 2011. Management history. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 355-377. [85230]
  • 19. Ballard, Warren. 2011. Predator-prey relationships. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 251-286. [85227]
  • 55. Campbell, Tyler A.; VerCauteren, Kurt C. 2011. Diseases and parasites. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 219-249. [85226]
  • 70. Cote, Steeve D. 2011. Impacts on ecosystems. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 379-398. [85217]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 92. DeYoung, Charles A. 2011. Population dynamics. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 147-180. [85224]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 98. Ditchkoff, Stephen S. 2011. Anatomy and physiology. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 43-73. [85221]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 146. Hansen, Lonnie. 2011. Extensive management. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 409-451. [85233]
  • 155. Heffelfinger, James R. 2011. Taxonomy, evolutionary history, and distribution. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 3-39. [85220]
  • 156. Hewitt, David G., ed. 2011. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press. 686 p. [84914]
  • 157. Hewitt, David G. 2011. Nutrition. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 75-105. [85222]
  • 179. Jacobson, Harry A.; DeYoung, Charles A.; DeYoung, Randy W.; Fulbright, Timothy E.; Hewitt, David G. 2011. Management on private property. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 453-479. [85234]
  • 182. Jenks, Jonathan A.; Leslie, David M., Jr. 2011. Interactions with other large herbivores. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 287-309. [85228]
  • 286. Murphy, Brian P. 2011. The future of white-tailed deer management. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 623-643. [85240]
  • 302. Olson, Rich. 1992. White-tailed deer habitat requirements and management in Wyoming. B-964. Laramie, WY: University of Wyoming, Cooperative Extension Service. 17 p. [20678]
  • 318. Peek, James M.; Scott, Michael D.; Nelson, Louis J.; Pierce, D. John. 1982. Role of cover in Habitat management for big game in northwestern United States. Transactions, 47th North American Wildlife and Natural Resources Conference. Washington, DC: Wildlife Management Institute. 47: 363-373. [13901]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the terms: cover, fire exclusion, fire regime, forbs, frequency, fresh, hardwood, mesic, presence, shrubs, tree

"Few mammalian species occupy such a wide range of latitudes or inhabit such a diverse array of habitats as the white-tailed deer" [279]. White-tailed deer occur in habitats from north-temperate to subtropical and arid environments in North America to rainforests of Central and northern South America [131,279,381]. In the United States, they are most abundant in the East. In the West, the white-tailed deer's distribution is limited by a lack of cover, and populations are restricted to riparian areas, wooded draws, and other areas in and adjacent to hardwood cover [279,381,430]. See the Fire Regime Table for a list of plant communities in which white-tailed deer may occur and information on the FIRE REGIMES associated with those communities.

Pacific Northwest: Columbian white-tailed deer originally occupied river valleys and surrounding foothills dominated by shrubs along the Columbia River drainage of the Pacific Northwest [122]. Local populations of Columbian white-tailed deer have decreased historically as woodland habitats were lost due to fire exclusion and development [279]. Plant communities receiving the highest use by Columbian white-tailed deer on the Julia Butler Hansen Refuge for the Columbian White-tailed Deer were Sitka spruce (Picea sitchensis) parklands with a grass understory and open-canopied western redcedar-red alder (Thuja plicata-Alnus rubra)-Sitka spruce forests with a "grass-shrub" understory [400]. In the Umpqua River basin, Columbian white-tailed deer used "grass-shrub" communities, Oregon white oak (Q. garryana) and California black oak (Q. kelloggii) savannas, open- and closed-canopy oak woodlands, riparian habitats, and conifer (mostly Douglas-fir (Pseudotsuga menziesii) and ponderosa pine (Pinus ponderosa)) forests more than expected based upon their availability. Highest Columbian white-tailed deer densities in the region occurred in areas with ≥50% woody plant cover [378]. In the Blue Mountains of northeastern Oregon, white-tailed deer are primarily associated with riparian areas and croplands, but they also use adjacent slopes [122].

Southwest: White-tailed deer favor the most mesic microclimates and associated vegetation within the arid Southwest [381]. In Arizona and New Mexico, white-tailed deer populations are highest in Madrean evergreen woodlands and in riparian hardwood forests, particularly those above 3,500 feet (1,100 m). Semidesert grasslands may be important in areas adjacent to Madrean evergreen woodlands, particularly where thickets of ocotillo (Fouquieria splendens) provide escape cover. White-tailed deer also occur in interior Arizona chaparral, oak woodlands containing Arizona white oak (Q. arizonica) and Emory oak (Q. emoryi), pinyon-juniper (Pinus-Juniperus spp.) woodlands, and ponderosa pine forests along the Mongollon Rim [122,155,365]. Within the Sonoran Desert, white-tailed deer are uncommon but prefer the most mesic habitats available: grasslands, mesas, benches, grassy slopes, and ridges [41]. The presence of surface water influences white-tailed deer distribution in some parts of the Southwest (see Water). Because of their high frequency in white-tailed deer's diet, lechuguilla (Agave lechuguilla), pricklypear (Opuntia spp.), oak, and madrone (Arbutus spp.) are important in the region [122].

Rocky Mountains: In the northern Rocky Mountains, white-tailed deer are restricted largely to bottomlands with dense vegetation [69]. Broad, flat cottonwood (Populus spp.) and willow (Salix spp.) floodplains are considered the most important habitats in the region [365]. In the northern Rocky Mountains, white-tailed deer prefer hardwood-dominated habitats at low and intermediate elevations. Habitats with Douglas-fir, spruce (Picea spp.), quaking aspen (Populus tremuloides), cottonwood, redstem ceanothus (Ceanothus sanguineus), chokecherry (Prunus virginiana), willow, Saskatoon serviceberry (Amelanchier alnifolia), and hollyleaved barberry (Berberis aquifolium) are important. Habitats with grasses and forbs may be important during spring in some areas [122,365]. In British Columbia, riparian brushlands and young Douglas-fir stands were among the most important white-tailed deer habitats [461]. In the Swan Valley, Montana, wintering white-tailed deer preferred mature conifer forests adjacent to riparian zones [117]. White-tailed deer in Wyoming use open meadows, cottonwood-willow riparian areas, ponderosa pine forests, brushy areas, and croplands [302].

Great Plains and South-central US: White-tailed deer distribution in the Great Plains is limited by the availability of vegetation providing cover [381]. Wooded draws, lowlands, and floodplains are preferred habitats of white-tailed deer in the region [320,430,443]. Common trees include northern red oak (Q. rubra), white oak (Q. alba), sugar maple (Acer saccharum), American beech (Fagus grandifolia), paper birch (Betula papyrifera), boxelder (A. negundo), American elm (Ulmus americana), green ash (Fraxinus pennsylvanica), and cottonwood, with Rocky Mountain juniper (Juniperus scopulorum) and ponderosa pine in draws and uplands [320,430]. Shrublands with western snowberry (Symphoricarpos occidentalis), silver buffaloberry (Shepherdia argentea), and chokecherry provide valuable year-round cover and food [430]. White-tailed deer are common in the Midwest agricultural subregion, which covers much of what once comprised the mixed-grass and tallgrass prairie ecosystems. In this region, croplands are important white-tailed deer habitats seasonally. Permanent cover is extensively fragmented, and white-tailed deer in this region must cope with dramatic seasonal changes in available cover and food associated with the harvest of crops [430]. Miller and others [279] stated that white-tailed deer probably did not occur in upland prairies of eastern Montana until agricultural crops were established. Quaking aspen and ponderosa pine stands are important white-tailed deer habitats in the Black Hills [90].

White-tailed deer habitats in the South-central United States consist largely of woodland communities along streams and rivers and in ephemeral drainages, but white-tailed deer may forage in adjacent plains grasslands, particularly those with a scattered, clumped overstory of oaks, and in croplands [122,365]. Common tree species in wooded riparian areas include cottonwood, green ash, bur oak (Q. macrocarpa), and eastern redcedar (J. virginiana). Habitats with snowberry (Symphoricarpos spp.), rose (Rosa spp.), grape (Vitis spp.), western soapberry (Sapindus saponaria var. drummondii), oak, and agricultural crops are also important to white-tailed deer in this region [430]. White-tailed deer are common in the Tamaulipan thorn scrub vegetation of southern Texas as well as in the Gulf Coast Prairies and Marshes ecological region [122].

Great Lakes and Northeast: Most of the Great Lakes and Northeast is comprised of hardwood and conifer forests important to white-tailed deer [430]. The Great Lakes-St Lawrence region includes elements of boreal and hardwood forest, and is characterized by eastern white pine (Pinus strobus), red pine (P. resinosa), eastern hemlock (Tsuga canadensis), and yellow birch (Betula alleghaniensis). Balsam fir (Abies balsamea), white spruce (Picea glauca), black spruce (P. mariana), paper birch, and quaking aspen are important species in the northern section close to the boreal forest ecotone, whereas sugar maple, northern red oak, and basswood (Tilia americana) are more abundant in the southern section of the region. [170]. Mature northern whitecedar (Thuja occidentalis) forests are often preferred by white-tailed deer during periods of cold temperatures and deep snow. Spruce, eastern hemlock, and balsam fir forests are also used [94,279]. Conifer forests interspersed with hardwood forests located along lakes and rivers are "among the best" winter rangelands for white-tailed deer in the St Lawrence Region [170]. In Michigan, quaking aspen communities are some of the most productive types for white-tailed deer [38,50]. In many parts of the Great Lakes region, croplands are important to white-tailed deer [430]. In the Northeast, white-tailed deer are abundant in the northern hardwood forests and common in spruce-fir (Abies spp.) forest. They use mature forest communities during periods of deep snow and old fields and various other early-successional habitats as well as brackish and freshwater marshes during the rest of the year [79,265]. The boreal forest region covers the northern edge of the white-tailed deer range. The principal trees of this region are white and black spruce and balsam fir. Generally only small, scattered white-tailed deer populations occur in boreal forest [170].

Southern Appalachians and Southeast: In the southern Appalachians, oak and hickory (Carya spp.) forests are important white-tailed deer habitats. Other common tree species in white-tailed deer habitats include sweetgum (Liquidambar styraciflua), tupelo (Nyssa spp.), baldcypress (Taxodium distichum), and pine (Pinus spp.). Habitats with dogwood (Cornus spp.), eastern redbud (Cercis canadensis), serviceberry (Amelanchier spp.), sumac (Rhus spp.), strawberry bush (Euonymus americanus), elderberry (Sambucus spp.), spicebush (Lindera spp.), blueberry (Vaccinium spp.), tree sparkleberry (V. arboreum), blackhaw (Viburnum prunifolium), deciduous holly (Ilex decidua), yaupon (I. vomitoria), and oak are important. Cropland is relatively common in this region and is also important white-tailed deer habitat [430]. In the Atlantic Coastal Plain, coastal marshes, longleaf pine-slash pine (P. palustris-P. elliottii), shortleaf pine (P. echinata)-oak, loblolly pine (P. taeda)/hardwood, pitch pine-bear oak (P. rigida-Q. ilicifolia), and bottomland hardwood forests are important white-tailed deer habitats. Bottomland hardwood forests are one of the most productive types for white-tailed deer in the region [150,294]. In Florida, some of the highest white-tailed deer populations occur in sand pine (P. clausa) sandhills [230]. A study on Big Pine Key and No Name Key found that Key deer preferred upland habitats (>3.3 feet (1 m) above mean sea level), particularly rock pinelands and hardwood hammocks, and avoided lowland habitats such as button mangrove (Conocarpus erectus)-scrub and mangrove (red (Rhizophora mangle), black (Avicennia germinans), and white (Laguncularia racemosa) mangrove) swamps. Upland habitats were important sources of food and permanent fresh water sources [241]. Regardless of plant communities, only islands with permanent fresh water are used consistently by Key deer [148] (see Water).
  • 38. Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and management in the Lake States. Agric. Handb. 486. Washington, DC: U.S. Department of Agriculture, Forest Service. 52 p. [5107]
  • 41. Brown, David E.; Henry, Robert S. 1981. On relict occurrences of white-tailed deer within the Sonoran Desert in Arizona. The Southwestern Naturalist. 26(2): 147-152. [86414]
  • 50. Byelich, John D.; Cook, Jack L.; Blouch, Ralph I. 1972. Management for deer. In: Aspen: Symposium proceedings; [Date of conference unknown]; [Location of conference unknown]. Gen. Tech. Rep. NC-1. St. Paul, MI: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 120-125. [12048]
  • 69. Compton, Bradley B.; Mackie, Richard J.; Dusek, Gary L. 1988. Factors influencing distribution of white-tailed deer in riparian habitats. The Journal of Wildlife Management. 52(3): 544-548. [86775]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 90. DePerno, Christopher S.; Jenks, Jonathan A.; Griffin, Stephen L.; Rice, Leslie A.; Higgins, Kenneth F. 2002. White-tailed deer habitats in the central Black Hills. Journal of Range Management. 55(3): 242-252. [86435]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 117. Freedman, June D. 1983. The historical relationship between fire and plant succession within the Swan Valley white-tailed deer winter range, western Montana. Missoula, MT: University of Montana. 139 p. Dissertation. [6486]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 148. Hardin, James W.; Klimstra, Willard D.; Silvy, Nova J. 1984. Florida Keys. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 381-390. [14296]
  • 150. Harlow, Richard F.; Whelan, James B.; Crawford, Hewlette S.; Skeen, John E. 1975. Deer foods during years of oak mast abundance and scarcity. The Journal of Wildlife Management. 39(2): 330-336. [10088]
  • 155. Heffelfinger, James R. 2011. Taxonomy, evolutionary history, and distribution. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 3-39. [85220]
  • 170. Huot, Jean; Potvin, Francois; Belanger, Michel. 1984. Southeastern Canada. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 293-304. [86446]
  • 230. Lewis, Clifford E. 1973. Understory vegetation, wildlife, and recreation in sand pine forests. In: Sand pine symposium: Proceedings; 1972 December 5-7; Panama City Beach, FL. Gen. Tech. Rep. SE-2. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station: 180-192. [45432]
  • 241. Lopez, Roel R.; Silvy, Nova J.; Wilkins, R. Neal; Frank, Philip A.; Peterson, Markus J.; Peterson, M. Nils. 2004. Habitat-use patterns of Florida Key deer: implications of urban development. The Journal of Wildlife Management. 68(4): 900-908. [86777]
  • 265. Mattfeld, George F. 1984. Eastern hardwood and spruce-fir forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 305-330. [14291]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 294. Newsom, John D. 1984. Coastal Plain. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 367-380. [14295]
  • 302. Olson, Rich. 1992. White-tailed deer habitat requirements and management in Wyoming. B-964. Laramie, WY: University of Wyoming, Cooperative Extension Service. 17 p. [20678]
  • 320. Petersen, Lyle E. 1984. Northern Plains. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 441-448. [14300]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 378. Smith, Winson Paul. 1987. Dispersion and habitat use by sympatric Columbian white-tailed deer and Columbian black-tailed deer. Journal of Mammalogy. 68(2): 337-347. [86776]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 400. Suring, Lowell H.; Vohs, Paul A., Jr. 1979. Habitat use by Columbian white-tailed deer. The Journal of Wildlife Management. 43(3): 610-619. [37245]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]
  • 443. Wallmo, Olof C. 1981. Mule and black-tailed deer distribution and habitats. In: Wallmo, Olof C., ed. 1981. Mule and black-tailed deer of North America. Lincoln, NE: University of Nebraska Press: 1-26. [14391]
  • 461. Wishart, William D. 1984. Western Canada. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 475-486. [14303]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White-tailed deer are able to survive in a variety of land habitats, from the forests of northern Maine to the swamps of Florida. They also inhabit farmlands, brushy areas, and the cactus and thornbrush deserts of southern Texas and Mexico. White-tailed deer prefer forest edges that are close to farmlands, old fields, and brushland. These kinds of habitats are commonly created by humans by forest cutting and clearing and through agricultural practices. As a result white-tailed deer do well near human habitations.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: chaparral ; forest ; rainforest ; scrub forest

Wetlands: swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whitetail deer are able to survive in a variety of terrestrial habitats, from the big woods of northern Maine to the deep saw grass and hammock swamps of Florida. They also inhabit farmlands, brushy areas and such desolate areas of the west such as the cactus and thornbrush deserts of southern Texas and Mexico. Ideal whitetail deer habitat would contain dense thickets (in which to hide and move about) and edges (which furnish food).

Habitat Regions: temperate ; tropical

Terrestrial Biomes: chaparral ; forest ; rainforest ; scrub forest

Wetlands: swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonal migrations averaging 16-23 km are common in northern and montane regions. In northern New York, groups that used the same winter range were genetically more similar than groups using different winter ranges; this may be due to the traditional use of winter yards by matrilineal groups and may be maintained by female philopatry (Mathews and Porter 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History: Movements and home range: Seasonal movements and migration

More info for the terms: cover, density, severity

White-tailed deer exhibit multiple types of migratory strategies: they may be nonmigratory (year-round residents), obligate migrators (migrating every year), or conditional migrators (migrating some years but not others). All 3 strategies may be observed within the same population, although in general, young of mothers that migrate are more likely to migrate than young of nonmigratory mothers [392]. In an agricultural region of southwestern Minnesota, 15% of female white-tailed deer were nonmigratory, 35% were conditional migrators, and 43% were obligate migrators [39]. In east-central Illinois, 20% of does migrated seasonally [296]. In northern and central South Dakota and southern Minnesota, white-tailed deer in highly fragmented landscapes, with sparse (≤0.9 forest patch/100 ha) and small (≤1.5-acre (0.6 ha)) forest patches, were more likely to migrate. Where forest patch density and mean patch size on summer rangelands were intermediate (ranged between 0.9 and 2.7 patches/100 ha and 1.5 and 3.0 acres (0.6-1.2 ha), respectively), white-tailed deer were more likely to be conditional migrants. Conditional migrators were more likely to initiate migration as winter severity increased [137].

Migration between summer and winter ranges tends to be more pronounced where there are marked differences in seasonal weather patterns, such as in northern or mountainous areas, particularly in regions with deep snow [94,392]. In northern areas, white-tailed deer migrate in winter in response to cold temperatures and snowfall. They return to summer ranges as forage becomes available [94,255,381,392]. On the Chippewa National Forest in north-central Minnesota, fall migration usually occurred in November, but it ranged from early November to January, depending weather. As snow depth increased, the annual cumulative proportion of white-tailed deer migrating also increased [114]. In the Northeast and Midwest, migratory deer concentrate in yards during winter [392]. In yards, snow depth governs movements and habitat use. Deep snow (approximately >70% of chest heights or >16 inches (40 cm) deep) makes travel difficult [255,264,365]. When snow is deep, travel within yards is confined to well-used trails that minimize energy expenditure [94,279,408]. White-tailed deer may select yards with abundant forage [392]. However, white-tailed deer apparently select cover over food abundance when snow is deep [381]. Migratory white-tailed deer may remain on summer ranges during mild winters [173]. In agricultural areas, migration appears to be driven partly by changing availability of cover following harvest in autumn, which causes white-tailed deer to move to areas of permanent cover on winter ranges [392]. In the Florida Everglades, nonmigratory white-tailed deer shift habitats seasonally in response to water levels. Movements in response to flooding are common in extensive southern river swamps [255].

According to reviews, mean migration distances range from 4 to 55 miles (6-89 km) [79,279,381]. However, migrations to winter ranges generally are <10 miles (16 km) [94]. Longer seasonal migrations are most common in populations at northern latitudes and in mountainous terrain [255,381]. Migration distances of white-tailed deer in some areas of Minnesota and the Upper Peninsula of Michigan are among the longest [94,279].

White-tailed deer show high fidelity to seasonal ranges [94,173,255,293,381]. Although wintering areas can be used annually for long periods, their use may change over time [95]. Boer [34] identified 99 wintering areas in New Brunswick in 1975 and found that 42 of these were vacant 13 years later. Small yards (<124 acres (50 ha)) were more likely to be vacant in the subsequent survey than large yards (>247 acres (100 ha)) [34].

  • 34. Boer, Arnold H. 1992. Transience of deer wintering areas. Canadian Journal of Forestry. 22(9): 1421-1423. [86423]
  • 39. Brinkman, Todd J.; Deperno, Christopher S.; Jenks, Jonathan A.; Haroldson, Brian S.; Osborn, Robert G. 2005. Movement of female white-tailed deer: effects of climate and intensive row-crop agriculture. The Journal of Wildlife Management. 69(3): 1099-1111. [86308]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 114. Fieberg, John; Kuehn, David W.; DelGiudice, Glenn D. 2008. Understanding variation in autumn migration of northern white-tailed deer by long-term study. Journal of Mammalogy. 89(6): 1529-1539. [86402]
  • 137. Grovenburg, Troy W.; Jacques, Christopher N.; Klaver, Robert W.; DePerno, Christopher S.; Brinkman, Todd J.; Swanson, Christopher C.; Jenks, Jonathan A. 2011. Influence of landscape characteristics on migration strategies of white-tailed deer. Journal of Mammalogy. 92(3): 534-543. [86403]
  • 173. Hygnstrom, Scott E.; Groepper, Scott R.; VerCauteren, Kurt C.; Frost, Chuck J.; Boner, Justin R.; Kinsell, Travis C.; Clements, Greg M. 2008. Literature review of mule deer and white-tailed deer movements in western and midwestern landscapes. Great Plains Research: A Journal of Natural and Social Sciences. Paper 962: 219-231. [85432]
  • 255. Marchinton, R. Larry.; Hirth, David H. 1984. Behavior. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 129-168. [86443]
  • 264. Matschke, George H.; Fagerstone, Kathleen A.; Harlow, Richard F.; Hayes, Frank A.; Nettles, Victor F.; Parker, Warren; Trainer, Daniel O. 1984. Population influences. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 169-188. [86444]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 293. Nelson, Michael E.; Mech, L. David. 1999. Twenty-year home-range dynamics of a white-tailed deer matriline. Canadian Journal of Zoology. 77(7): 1128-1135. [85034]
  • 296. Nixon, Charles M.; Hansen, Lonnie P.; Brewer, Paul A.; Chelsvig, James E. 1991. Ecology of white-tailed deer in an intensively farmed region of Illinois. Wildlife Monographs. 118: 1-77. [81245]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]
  • 408. Telfer, E. S. 1978. Silviculture in the eastern deer yards. The Forestry Chronicle. 54(4): 203-208. [85130]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Daily activity

White-tailed deer are active throughout the day and night but are most active at dusk and dawn [79,94,255,279,381]. Activity varies with individual age and sex, season, habitat, weather, latitude, and human disturbance [255,279,381]. Male white-tailed deer move farthest during the breeding season, whereas females move least during and after fawning [94,122,255,279,392].
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 255. Marchinton, R. Larry.; Hirth, David H. 1984. Behavior. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 129-168. [86443]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

More info for the terms: cover, density

White-tailed deer may disperse year-round [153] but are most likely to disperse during the fawning period or the rut [153,255,381,392]. Young males (1-1.5 years old) are most likely to disperse [94,121,255,279,381,392]. According to a review, about 50% to 80% of males disperse as yearlings [392]. Males commonly disperse away from their natal area but often settle within the region occupied by their natal population. Yearling does tend to remain relatively close to natal sites [79,94,188]. A review noted that rates of doe dispersal are typically low, ranging from 2% to 20% [94]. Annual rates for Crab Orchard National Wildlife Refuge, Illinois, averaged 4%, 7%, 10%, 13%, and 80% for fawns, adult females, adult males, yearling females, and yearling males, respectively [153]. According to a review, dispersal rates of males appear to increase as population density increases [79]. In the highly fragmented ranges of the agricultural Midwest, female fawns and yearlings disperse more frequently than females in other regions, regardless of population density [279]. Over 5 years in east-central Illinois, 50% of female and male fawns and 20% of yearling females dispersed 28 to 31 miles (45-50 km) between April and June [296]. A study in an agricultural region of central and northern Illinois reported some of the highest dispersal rates: 65% for males and 39% for females. Female fawn dispersal decreased as white-tailed deer density (yearling and adult females) and forest cover increased. Higher than expected female dispersal was attributed to habitat scarcity in spring coupled with high fawn survival [297].

Dispersal distances vary but are typically short (<6 miles (10 km)), but distances of >93 miles (150 km) have been reported [279]. Habitat features may influence dispersal distances, where bucks disperse farther in more open or fragmented habitats than in forested or dense habitats. For example, dispersal distances of males may exceed 19 to 25 miles (30-40 km) in agricultural habitats of the Midwest, where vegetative cover is fragmented and patchy [94]. In Pennsylvania, dispersal distances of yearling males were greater in habitat with less forest cover (r²=0.94, P<0.001). The authors suggested that in less forested landscapes, white-tailed deer may travel farther to find suitable habitat patches [239].

  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 153. Hawkins, R. E.; Klimstra, W. D.; Autry, D. C. 1971. Dispersal of deer from Crab Orchard National Wildlife Refuge. The Journal of Wildlife Management. 35(2): 216-220. [86305]
  • 188. Kelly, Amy C.; Mateus-Pinilla, Nohra E.; Douglas, Marlis; Douglas, Michael; Brown, William; Ruiz, Marilyn O.; Killefer, John; Shelton, Paul; Beissel, Tom; Novakofski, Jan. 2010. Utilizing disease surveillance to examine gene flow and dispersal in white-tailed deer. Journal of Applied Ecology. 47(6): 1189-1198. [81436]
  • 239. Long, Eric S.; Diefenbach, Duane R.; Rosenberry, Christopher S.; Wallingford, Bret D.; Grund, Marrett D. 2005. Forest cover influences dispersal distance of white-tailed deer. Journal of Mammalogy. 86(3): 623-629. [86309]
  • 255. Marchinton, R. Larry.; Hirth, David H. 1984. Behavior. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 129-168. [86443]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 296. Nixon, Charles M.; Hansen, Lonnie P.; Brewer, Paul A.; Chelsvig, James E. 1991. Ecology of white-tailed deer in an intensively farmed region of Illinois. Wildlife Monographs. 118: 1-77. [81245]
  • 297. Nixon, Charles M.; Mankin, Philip C.; Etter, Dwayne R.; Hansen, Lonnie P.; Brewer, Paul A.; Chelsvig, James E.; Esker, Terry L. 2007. White-tailed deer dispersal behavior in an agricultural environment. The American Midland Naturalist. 157(1): 212-220. [86379]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: White-tailed deer prepare for harsh northern winters when high-quality food is scarce by fattening up in autumn. In many areas, a diet of acorns is important in this process. They tend to lose weight all through winter on a diet of woody browse.

In the north, the diet dominated by grasses in spring, forbs in early summer, leafy green browse in late summer, acorns and other fruits in fall, evergreen woody browse in winter (grasses and forbs if low snow cover or low deer density) (McCullough 1985). They also commonly eats mushroom, especially in late summer and fall (Great Basin Nat. 52:321), as well as various farm crops in midwestern, plains, and southeastern agricultural regions of the U.S.

See Miller et al. (1992) for information on impacts on endangered and threatened vascular plants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

More info for the terms: cacti, cool-season, cover, ferns, forb, forbs, lichens, litter, mast, mesic, shrubs, succession, tree

White-tailed deer are classified as browsers because they primarily consume browse and forbs [121]. However, they are opportunistic and consume a wide variety of plant species and plant parts [131,182,279]. For example, more than 610 different plant species are consumed by white-tailed deer in Arizona (Knipe 1977 cited in [122]). They consume the stalks, flowers, fruits, and seeds of grasses and forbs. They eat the buds, fruits, seeds (particularly acorns), stems, leaves, and bark of trees and shrubs [346,381]. Diversity apparently is important in the white-tailed deer's diet [346]. Cacti and other succulents may be seasonally important in some areas [121,157,201,365,381]. White-tailed deer also eat ferns [79,244], fungi [79,157,279,346,381], and lichens [157,346]. In agricultural areas, crops are an important food source [131,279,381]. Orchards, nurseries, vineyards, and lawns are also common food sources wherever available [131,279,381]. White-tailed deer can only access forage that is <5 feet (1.5 m) tall [15]. Generally, younger, less fibrous plants and plant parts are preferred over old plants and plant parts [79,121]. White-tailed deer sometimes consume aquatic vegetation [131,177,346] and may opportunistically eat birds, fish, and insects [131].

Forbs, browse, soft mast (berries, drupes, and pomes), and hard mast (acorns, beechnuts, and hickory nuts) are the most important white-tailed deer forages throughout the much of species' range [279,365,384]. A 2011 review of white-tailed deer diets throughout the species' range concluded that white-tailed deer diets consist of 46% browse, 24% forbs, 11% mast, 8% grass, 4% agricultural crops, 2% cacti, 2% fungi, and 3% other items. The author split the species' range into 5 regions: Midwest, Northwest, Southeast, and Southwest. Spring diets in the Midwest and Northwest contained less browse and forbs and more crops and grass than in other regions. Diets were most similar among regions in summer. Fall diets varied greatly among regions, with mast particularly important in the Midwest and Southeast. Browse, crops, and grass were particularly important in the Northwest in fall, whereas lichens and fungi were important in the Northeast. Browse and forbs composed most of the diet in the Southwest. In winter, there was a strong latitudinal gradient in browse use: Browse averaged 74% to 91% of white-tailed diets in northern regions. Forbs were important during winter in the Southwest. Mast was most important in winter diets in the Midwest and Southeast, and grass was least important in the Northeast [157].

Forage availability greatly influences white-tailed deer food habits [157]. Forbs are generally more digestible and richer in nutrients than browse, and white-tailed deer strongly prefer them over browse. Abundance and biomass of forbs on the landscape depend on many biological and environmental influences, particularly season of year, amount and timing of rainfall, and physical and chemical characteristics of the soil. Intensity of livestock grazing and land management practices also influence forb production and thus white-tailed deer diets. Compared to forbs, browse plants provide more seasonally stable food supplies and are less affected by periods of low rainfall and intensity of livestock use. The amount of browse in white-tailed deer diets generally varies inversely with abundance of forbs. In habitats where forbs are abundant most of the year, white-tailed deer generally eat less browse than in habitats where forbs are rare [121]. Near the Gulf Coast of southern Texas, where forbs are available on mesic rangelands, forbs comprise 50% to 98% of seasonal diets, whereas 90 miles (150 km) inland, where rangelands are more arid, browse and succulents comprise 50% to 75% of seasonal diets [157]. Although browse may not be preferred, its abundance and year-round availability make it important [79,346]. Although browse and forbs are often the dominant forage classes in white-tailed deer diets, in some areas grasses and sedges (Carex spp.) may contribute substantially to white-tailed diets, particularly during spring green-up. New growth of cool-season grasses may be important in fall [79,121].

High-quality forages, such as crops and mast, compose large portions of white-tailed deer diets if available. Crops are "exceedingly important" to white-tailed deer during summer and fall in the Midwest and along riparian areas in northwestern portions of the species' range [157]. Because they are highly digestible and nutritious, most agricultural crops are preferred when available, regardless of the availability of naturally occurring foods [79]. Mast is often highly preferred by white-tailed deer and is often a critical source of forage; however, its availability is seasonal [121]. Common sources of mast include persimmons (Diospyros spp.), American beech, apples (Malus spp.), American pokeweed (Phytolacca americana), cherries (Prunus spp.), oaks, blackberries (Rubus spp.), blueberries, and grapes [279]. Honey mesquite pods often become an important source of food during summer droughts in the southwestern and south-central United States [121].

Among mast types, acorns are a highly preferred food [79,108,279]. According to a review, acorns can constitute >70% of the fall diet of white-tailed deer in oak woodlands [279]. In southwestern Virginia, acorns made up an average of 76% by volume of the white-tailed deer diet when acorns were abundant [150]. In many habitats, although acorns are heavily used, they are not considered a "critical" component of the white-tailed deer's diet. However, in some southeastern ranges, such as in the southern Appalachians or the southern Coastal Plain, acorns are considered critical, and white-tailed deer population dynamics can be driven by acorn production [279]. Feldhamer [108] noted that acorn availability is especially critical where the quality and quantity of spring or summer forage is inadequate for white-tailed deer to develop the energy reserves necessary for winter survival. In Land Between The Lakes National Recreation Area, Tennessee, mean body mass of hunter-harvested male and female fawns and yearlings over 13 years was positively correlated with acorn yield the previous fall. Acorn yields ranged from 0.37 to 55.07 kg/ha during this period and accounted for 42% to 56% of the variation in mean body mass in each age and sex group [109]. Male and female fawns, yearling males, and ≥3.5-year-old females in Georgia weighed more in years when mast availability was "good" than years when mast availability was "poor". Other age and sex groups showed no effect. Body mass of males was more strongly correlated with the previous year's mast index than with the current year's index, indicating a lag effect [449]. In contrast, in Craig County, Virginia, weights of 1.5-year-old bucks killed by hunters did not differ between years of acorn abundance and scarcity. This might have been because they were harvested too early in the winter for an effect to be evident [150]. Wentworth and others (1990 cited in [108]) found that adult reproductive rates in the southern Appalachians were not affected by acorn abundance, but yearling reproduction was greater when acorns were abundant. Some researchers documented either an increased percentage of yearlings in white-tailed deer populations following years with good acorn crops or a decrease in the percent of yearlings following years with poor acorn crops (e.g., [110,449]).

High-preference winter foods for white-tailed deer in the northern Great Lakes and Ontario include northern whitecedar, red maple (Acer rubrum), eastern hemlock, American mountain-ash (Sorbus americana), and alternate-leaf dogwood (Cornus alternifolia). Second-level preference species include eastern white pine, yellow birch, mountain maple (A. spicatum), serviceberry, and jack pine (Pinus banksiana). Next are aspen (Populus spp.), northern red oak, beaked hazelnut (Corylus cornuta subsp. cornuta), paper birch, balsam fir, and red pine. Speckled alder (Alnus incana subsp. rugosa), black spruce, white spruce, and tamarack (Larix laricina) are "last resort" foods [33]. Preferred foods in the Northeast include the following species and genera: maple (Acer spp.), birch (Betula spp.), trumpet creeper (Campsis radicans), sweetfern (Comptonia peregrina), dogwood, hawthorn (Crataegus spp.), ash (Fraxinus spp.), holly (Ilex spp.), pinweed (Lechea spp.), honeysuckle (Lonicera spp.), apple, bayberry (Myrica spp.), black tupelo (Nyssa sylvatica), pricklypear, black cherry (Prunus serotina), oak, sumac, blackberry, willow, sassafras (Sassafras albidum), greenbrier (Smilax spp.), goldenrod (Solidago spp.), mountain-ash (Sorbus spp.), northern whitecedar, basswood, eastern hemlock, blueberry, viburnum (Viburnum spp.), and grape [79]. A review stated that the most prevalent plants in white-tailed deer diets in the Southwest are hairy mountain-mahogany (Cercocarpus breviflorus), Wright's eriogonum (Eriogonum wrightii), falsemesquite calliandra (Calliandra eriophylla), range ratany (Krameria parvifolia), and junipers, primarily alligator juniper (J. deppeana) and oneseed juniper (J. monosperma) [365]. Red mangrove, black mangrove, Florida Keys blackbead (Pithecellobium keyense), redgal (Morinda royoc), Florida silverpalm (Coccothrinax argentata), Key thatch palm (Thrinax microcarpa), and pencilflower (Stylosanthes spp.) are some of the most heavily eaten species by Key deer (Dooley 1974 cited in [148]). In Montana and South Dakota, some preferred browse species include chokecherry, kinnikinnick (Arctostaphylos uva-ursi), serviceberry, skunkbush sumac (Rhus trilobata), common snowberry (Symphoricarpos albus), and dogwood [320].

Weather and growing conditions affect white-tailed deer forage preferences. Forbs that dominate white-tailed deer diets during spring or high rainfall years may be replaced by more heat or drought-tolerant species during summer or dry years. Browse increases in importance in white-tailed deer diets during droughts because lack of rainfall reduces forb abundance [122]. During a drought year in southeastern Arizona, white-tailed deer and mule deer diets changed from succulent deciduous forage to drought-tolerant evergreen species [10]. Ocotillo (Fouquieria splendens) did not rank high as a forage plant in southern Arizona; however, its rapid response to available moisture from summer rains produced green forage that was avidly sought by white-tailed deer when available [451]. In the Rolling Plains of Texas, browse (mast and foliage) declined from 57% of white-tailed deer diets during a drought year to 39% of diets during a year with greater rainfall; forbs increased from 18% of diets during the drought to 38% of diets during the wetter year [341]. In the Cross Timbers and Prairies region of Texas, browse in white-tailed deer diets declined from 46% during a dry summer to 29% during a wet summer, whereas forbs increased from 13% of diets during the dry summer to 43% of diets during the wet summer [96].

Deep snow makes forage less accessible to white-tailed deer. Moen and Evans (1971 cited in [444]) estimated that 12 inches (30 cm) of snow rendered 97% of potential food unavailable to white-tailed deer in New York. White-tailed deer may meet nutritional requirements during deep snow periods by foraging on materials found above the snow, such as arboreal lichens or conifer browse [122,368,409]. They also create networks of trails in snow and may dig and root to obtain food from beneath the snow. In areas with deep snow, they migrate to locations with snow conditions that permit better locomotion and easier foraging [409] (see Cover and foraging habitats).

Fire may affect white-tailed diet composition. For more information, see Indirect Fire Effects.

Diet composition varies by sex and age of individual animals, which may result from spatial segregation and use of separate habitats [121] (see Age and sex). Reviews on this topic are available: [122,157].

White-tailed deer foraging effects: White-tailed deer are sometimes called "keystone herbivores" [136,349,350,442] or "ecosystem engineers" [17,71] because of their foraging impacts under high population densities. Because white-tailed deer forage selectively, they can influence plant species composition and diversity by consuming palatable species, which may allow unpalatable species to gain dominance and eventually alter plant community dynamics and succession [70,71,144,298,349,350,354,392,430,442]. Overabundant populations commonly reduce tree diversity in boreal and temperate forests [71]. They can influence rates of nutrient cycling by altering litter quantity and quality and via urination and defecation [70,71,350,354,392]. Also, white-tailed deer may affect plant growth [71,354]. They exert cascading effects on animals by competing directly for resources with other herbivores and by modifying the composition and structure of habitats [6,17,70,71,136,329,350,392,442]. Maximum animal species diversity in a stand often appears to occur at moderate browsing levels, whereas heavy white-tailed deer browsing reduces vegetative cover and diversity in the understory, which may lead to reduced habitat availability for other animals [71]. Studies have shown that heavy white-tailed deer foraging is correlated with declines in native plant abundance and increases in nonnative plant abundance [70,105]. Reviews describing white-tailed deer foraging effects are available: [24,70,71,349,354,392]. For information about white-tailed deer effects on postfire succession, see Effects of herbivory on vegetation.

  • 24. Bartos, Dale L. 2007. Aspen. In: Hood, Sharon M.; Miller, Melanie, eds. Fire ecology and management of the major ecosystems of southern Utah. Gen. Tech. Rep. RMRS-GTR-202. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 39-55. [71079]
  • 6. Allombert, Sylvian; Gaston, Anthony J.; Martin, Jean-Louis. 2005. A natural experiment on the impact of overabundant deer on songbird populations. Biological Conservation. 126(1): 1-13. [54519]
  • 10. Anthony, Robert G. 1976. Influence of drought on diets and numbers of desert deer. The Journal of Wildlife Management. 40(1): 140-144. [11558]
  • 15. Asherin, Duane A. 1975. Changes in elk use and available browse production on north Idaho winter ranges following prescribed burning. In: Hieb, Susan R., ed. Proceedings, elk logging-roads symposium; 1975 December 16-17; Moscow, ID. Moscow, ID: University of Idaho: 122-134. [17049]
  • 17. Baiser, Benjamin; Lockwood, Julie L.; La Puma, David; Aronson, Myla F. J. 2008. A perfect storm: two ecosystem engineers interact to degrade deciduous forests of New Jersey. Biological Invasions. 10(6): 785-795. [73302]
  • 33. Blouch, Ralph I. 1984. Northern Great Lakes States and Ontario forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 391-410. [14297]
  • 70. Cote, Steeve D. 2011. Impacts on ecosystems. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 379-398. [85217]
  • 71. Cote, Steeve D.; Rooney, Thomas P.; Tremblay, Jean-Pierre; Dussault, Christian; Waller, Donald M. 2004. Ecological impacts of deer overabundance. Annual Review of Ecology and Systematics. 35: 113-147. [85547]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 96. Dillard, Jim; Jester, Steve; Baccus, John; Simpson, Randy; Poor, Lin. 2005. White-tailed deer food habits and preferences in the Cross Timbers and Prairies Region of Texas. Austin, TX: Texas Parks and Wildlife Department. 65 p. [86798]
  • 105. Eschtruth, Anne K.; Battles, John J. 2008. Deer herbivory alters forest response to canopy decline caused by an exotic insect pest. Ecological Applications. 18(2): 360-376. [86826]
  • 108. Feldhamer, George A. 2002. Acorns and white-tailed deer. Interrelationships in forest ecosystems. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 215-223. [43532]
  • 109. Feldhamer, George A.; Kilbane, Thomas P.; Sharp, Dennis W. 1989. Cumulative effect of winter on acorn yield and deer body weight. The Journal of Wildlife Management. 53(2): 292-295. [86790]
  • 110. Feldhamer, George A.; Sharp, Dennis W.; Davin, Terrence. 1992. Acorn yield and yearling white-tailed deer on Land Between The Lakes, Tennessee. Journal of the Tennessee Academy of Science. 67(3): 46-48. [86794]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 136. Greenwald, Katherine R.; Petit, Lisa J.; Waite, Thomas A. 2008. Indirect effects of a keystone herbivore elevate local animal diversity. The Journal of Wildlife Management. 72(6): 1318-1321. [86347]
  • 144. Hanley, Thomas P. 1984. Relationships between Sitka black-tailed deer and their habitat. Gen. Tech. Rep. PNW-168. Portland, OR: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 21 p. [14397]
  • 148. Hardin, James W.; Klimstra, Willard D.; Silvy, Nova J. 1984. Florida Keys. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 381-390. [14296]
  • 150. Harlow, Richard F.; Whelan, James B.; Crawford, Hewlette S.; Skeen, John E. 1975. Deer foods during years of oak mast abundance and scarcity. The Journal of Wildlife Management. 39(2): 330-336. [10088]
  • 157. Hewitt, David G. 2011. Nutrition. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 75-105. [85222]
  • 177. Irwin, Larry L. 1985. Foods of moose, Alces alces, and white-tailed deer, Odocoileus virginianus, on a burn in boreal forest. The Canadian Field-Naturalist. 99(2): 240-245. [4513]
  • 182. Jenks, Jonathan A.; Leslie, David M., Jr. 2011. Interactions with other large herbivores. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 287-309. [85228]
  • 201. Krausman, Paul R. 1978. Forage relationships between two deer species in Big Bend National Park, Texas. The Journal of Wildlife Management. 42(1): 101-107. [68492]
  • 244. Loveless, Charles M. 1959. The Everglades deer herd life history and management. Federal Aid Project W-39-R, Tech. Bull. No. 6. Talahassee, FL: Florida Game and Fresh Water Fish Commission. 104 p. [37438]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 298. Nowacki, Gregory J.; Abrams, Marc D. 2008. The demise of fire and "mesophication" of forests in the eastern United States. BioScience. 58(2): 123-138. [70112]
  • 320. Petersen, Lyle E. 1984. Northern Plains. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 441-448. [14300]
  • 329. Rambo, Jennie L.; Faeth, Stanley H. 1999. Effect of vertebrate grazing on plant and insect community structure. Conservation Biology. 13(5): 1047-1054. [51843]
  • 341. Richardson, Calvin; Lionberger, Jim; Miller, Gene. 2008. White-tailed deer management in the Rolling Plains of Texas. Austin, TX: Texas Parks and Wildlife Department. 36 p. [86797]
  • 346. Rogers, Lynn L.; Mooty, Jack J.; Dawson, Deanna. 1981. Foods of white-tailed deer in the Upper Great Lakes Region -- a review. General Technical Report NC-65. St. Paul, MN: U.S. Dept. of Agriculture, Forest Service, North Central Forest Experiment Station. 24 p. [86350]
  • 349. Rooney, T. P. 2001. Deer impacts on forest ecosystems: a North American perspective. Forestry. 74(3): 201-208. [86383]
  • 350. Rooney, Thomas P.; Waller, Donald M. 2003. Direct and indirect effects of white-tailed deer in forest ecosystems. Forest Ecology and Management. 181(1-2): 165-176. [45138]
  • 354. Russell, F. Leland; Zippin, David B.; Fowler, Norma L. 2001. Effects of white-tailed deer (Odocoileus virginianus) on plants, plant populations and communities: a review. The American Midland Naturalist. 146(1): 1-26. [39287]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 368. Shepperd, Wayne D.; Battaglia, Michael A. 2002. Ecology, silviculture, and management of Black Hills ponderosa pine. Gen. Tech. Rep. RMRS-GTR-97. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 112 p. [44794]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 384. Sosebee, Ronald E.; Britton, Carlton M.; Bryant, Fred C.; Wester, David Bsolela. 1999. Noxious brush and weed control research at Texas Tech University. In: Wester, David B.; Britton, Carlton M., eds. Research highlights - 1999: Noxious brush and weed control: Range, wildlife, and fisheries management. Volume 30. Lubbock, TX: Texas Tech University, College of Agricultural Sciences and Natural Resources: 6-13. [35496]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]
  • 409. Telfer, Edmund S.; Kelsall, John P. 1984. Adaptation of some large North American mammals for survival in snow. Ecology. 65(6): 1828-1834. [85395]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]
  • 442. Waller, Donald M.; Alverson, William S. 1997. The white-tailed deer: a keystone herbivore. Wildlife Society Bulletin. 25(2): 217-226. [86348]
  • 444. Wallmo, Olof C.; Regelin, Wayne L. 1981. Rocky Mountain and Intermountain habitats: Part 1. Food habits and nutrition. In: Wallmo, Olof C., ed. 1981. Mule and black-tailed deer of North America. Lincoln, NE: University of Nebraska Press: 387-398. [14387]
  • 449. Wentworth, James M.; Johnson, A. Sydney; Hale, Philip E.; Kammermeyer, Kent E. 1992. Relationships of acorn abundance and deer herd characteristics in the southern Appalachians. Southern Journal of Applied Forestry. 16(1): 5-8. [18136]
  • 451. White, Robert W. 1961. Some foods of white-tailed deer in southern Arizona. The Journal of Wildlife Management. 25(4): 404-409. [86795]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

White-tailed deer feed on a variety of vegetation, depending on what is available in their habitat. In eastern forests, buds and twigs of certain trees and shrubs are eaten. In desert areas, certain cacti and other plants are eaten. Evergreen trees are eaten in the winter when other sources of food are not available. White-tailed deer feed mainly from before dawn until several hours after, and again from late afternoon until dusk.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Whitetail deer feed on a variety of vegetation, depending on what is available in their habitat. In eastern forests, buds and twigs of maple, sassafras, poplar, aspen and birch (to name a few) are consumed, as well as many shrubs. In desert areas, plants such as huajillo brush, yucca, prickly pear cactus, comal, ratama and various tough shrubs may be the main components of a whitetail's diet. Conifers are often utilized in winter when other foods are scarce. Whitetail deer are crepuscular, feeding mainly from before dawn until several hours after, and again from late afternoon until dusk.

Primary Diet: herbivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Indirect Effects of Fire: Diseases and parasites

Numerous bacterial diseases and parasites infest white-tailed deer and may cause mortality. Occasional epizootics in wild populations have been responsible for high mortality in some populations [263,264]. White-tailed deer may be more vulnerable to the detrimental effects of diseases and parasites when malnourished [79,279]. White-tailed deer also harbor diseases, such as meningeal worm (Parelaphostrongylus tenuis), that may be fatal to other ruminants [131]. Fire may indirectly affect the prevalence of diseases and parasites in white-tailed deer (see Fire effects on white-tailed deer diseases and parasites). For a comprehensive review of diseases and parasites that infest white-tailed deer, see Campbell and VerCauteren [55]. See also the following sources: [263,264].
  • 55. Campbell, Tyler A.; VerCauteren, Kurt C. 2011. Diseases and parasites. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 219-249. [85226]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 263. Mather, Thomas N.; Duffy, David C.; Campbell, Scott R. 1993. An unexpected result from burning vegetation to reduce Lyme disease transmission risks. Journal of Medical Entomology. 30(3): 642-645. [86298]
  • 264. Matschke, George H.; Fagerstone, Kathleen A.; Harlow, Richard F.; Hayes, Frank A.; Nettles, Victor F.; Parker, Warren; Trainer, Daniel O. 1984. Population influences. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 169-188. [86444]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

White-tailed deer can greatly influence the composition of plant communities through their grazing, especially where they are abundant. In severe winters white-tailed deer can be responsible for girdling and killing large numbers of trees. White-tailed deer are also important prey animals for a number of large predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

White-tailed deer have good eyesight and acute hearing, but depend mainly on their sense of smell to detect danger and their ability to run and bound quickly through dense vegetation to escape danger. White-tailed deer are preyed on by large predators such as humans, Canis lupus, Puma concolor, Ursidae, Panthera onca, and Canis latrans.

Known Predators:

  • humans (Homo_sapiens)
  • gray wolves (Canis_lupus)
  • mountain lions (Puma_concolor)
  • coyotes (Canis_latrans)
  • bears (Ursidae)
  • jaguars (Panthera_onca)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

White-tailed deer can greatly influence the composition of plant communities through their grazing, especially where they are abundant. In severe winters white-tailed deer can be responsible for girdling and killing large numbers of trees. White-tailed deer are also important prey animals for a number of large predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

White-tailed deer have good eyesight and acute hearing, but depend mainly on their sense of smell to detect danger and their ability to run and bound quickly through dense vegetation to escape danger. White-tailed deer are preyed on by large predators such as humans, wolves, mountain lions, bears, jaguars, and coyotes.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Odocoileus virginianus is prey of:
Ursidae
Homo sapiens
Panthera onca
Canis lupus
Canis latrans
Puma concolor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Odocoileus virginianus preys on:
Schismus barbatus
mistletoe
leaves

Based on studies in:
USA: Arizona, Sonora Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population density

More info for the terms: cover, hardwood

According to a review, population densities range from less than 1 to >80 white-tailed deer/km² [381]. Availability of agricultural crops improves habitat quality for white-tailed deer, and some of the highest population densities (80 white-tailed deer/km²) occur in areas with numerous, small agricultural plots in a matrix of mature oak-hickory forests [381,430]. Bottomland hardwood forests produce high-quality white-tailed deer forage on the Coastal Plain, supporting a mean of 25 white-tailed deer/km². In oak savannas of interior valleys of southwestern Oregon, densities approach 34 white-tailed deer/km². Quaking aspen parklands in southern Alberta are "prime" habitat for white-tailed deer, supporting 12 white-tailed deer/km². Distribution in arid regions is typically patchy, and densities seldom exceed 4 white-tailed deer/km² [381]. Relatively low white-tailed deer densities are found in landscapes with dense, contiguous forests such as in the northern Great Lakes and Northeast [430]. However, during severe winter weather in these regions, white-tailed deer may concentrate in yards at densities ranging from 16 to 39 white-tailed deer/km² [131]. Low densities also occur in western Great Plains grasslands where forests and agricultural lands are sparse, in the Corn Belt where wooded cover is sparse, and in urban areas [430].
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Two basic social groups: adult female(s) and young, and adult and occasionally yearling males (though adult males are solitary during the breeding season except when attending estrous females).

Home range 16-120 ha (40-300 acres) (Banfield 1974); varies with conditions, smallest in summer. Annual home range of sedentary populations averages 59-520 ha (Smith 1991). Some populations undergo annual migrations of 10 to 50 kilometers (Marchinton and Hirth 1984).

Population density 1 per 6-46 acres, depending upon environmental conditions (Baker 1983). In some areas density may exceed 50/sq km (Rooney 1995).

Dispersal from mother's home range is mostly by yearling males. In Minnesota, 7 of 35 yearling females dispersed 18-168 km from natal ranges during late May through June; dispersal was independent of deer density (Nelson and Mech 1992); 95% of all yearlings dispersed not more than 38 km (Nelson 1993). Home range formation may extend over 2-3 years.

Winter weather (snow accumulation) may strongly affect populations, even more so than density of wolves in areas where the latter are present (Mech et al. 1987, Potvin et al. 1992). In many areas, coyotes or domestic dogs are significant predators.

White-tailed deer carry and disperse into the environment meningeal worms that usually are fatal to moose and caribou but are clinically benign in deer; hence, white-tailed deer, through worm-mediated impacts, commonly are believed to exclude moose and caribou from areas where deer occur; however, an analysis by Schmitz and Nudds (1994) concluded that moose may be able to coexist with deer, albeit at lower densities, even in the absence of habitat refuges from the disease. Also, Whitlaw and Lankester (1994) found that the evidence that brainworm has caused moose declines is weak. Further study is needed.

Deer browsing may significantly impact vegetation characteristics (e.g., Anderson 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Regime Table

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Management Considerations

More info for the terms: basal area, competition, cool-season, cover, density, fire intensity, fire severity, fire use, forb, forbs, fuel, hardwood, high-severity fire, lichen, lichens, litter, low-severity fire, mast, mesic, mosaic fire, prescribed fire, presence, series, severity, shrub, shrubs, succession, surface fire, swamp, top-kill, tree, vines, warm-season, wildfire

General recommendations:
Prescribed fire is commonly used in white-tailed deer habitats, typically to stimulate the production of more abundant, available, and nutritious forage [403]. Fire benefits white-tailed deer by increasing the quantity and improving the quality of woody and herbaceous foods, which ultimately affect a population through growth, development, reproduction, and survival. Potential negative effects of fire on white-tailed deer include reduced hard mast availability and reduced cover for escape or protection from weather [251].

Wild and prescribed fire can affect the nutrient content, palatability, and accessibility of forage for white-tailed deer [403]. Plant nutrient levels may remain unchanged, increase, or decrease after burning, depending on season, soil, weather, fire type, and other factors [30,247,251]. Postfire levels are generally higher than levels on prefire or control areas after moderate- or high-severity fires [365], but short duration, low-severity fires may not increase foliage nutrients [365,388]. Although increased plant nutrient levels may last up to 20 years after fire, according to reviews, most studies of moderate or severe fires indicate that nutrient contents revert to prefire or control levels in 2 years or less [30,89,247,365]. Vegetation >5 feet (1.5 m) tall is inaccessible to white-tailed deer (see Diet), and fire can increase white-tailed deer forage accessibility by reducing browse height [251,365].

Wild and prescribed fire can increase some important white-tailed deer forage species, especially those that can sprout after top-kill, while decreasing others [248,251,394]. For example, Canada yew (Taxus canadensis) is highly preferred browse of white-tailed deer in the North that is poorly adapted to fire (e.g., shallow roots and slow growth) [460], whereas most shrubs in Texas are sprouters [122,361] that persist and often thrive after fire. Effect of season of burning on postfire sprout production varies among woody species. Growing-season fires may damage shrubs more than cool-season fires because warm ambient temperatures result in greater fire intensity, and damage to plants may be more likely when plants are actively growing [80]. Sprouting of shrubs in longleaf pine savannas, for example, tended to be greater following dormant-season fires than growing-season fires [100]. In addition, reproductive characteristics, plant size, fuel load, and shrub location relative to other shrubs can affect shrub survival following fire [80]. For more information, see FEIS reviews of plant species of interest.

Soft and hard masts are important to white-tailed deer throughout the species' range. Wild and prescribed fire often increase soft mast by 2 to 4 postfire growing seasons [70]. However, fires that kill mature trees may reduce hard mast production for many years [251]. For more information, see Southern Appalachians. Annual growing-season fires, which can result in extensive grass cover, may not provide high-quality white-tailed deer forage. Periodic dormant-season fires, which can result in increased forbs, could provide abundant white-tailed deer forage during the growing season. However, any management practice that involves removing shrubs or overstory plants may reduce browse or mast [157]. The effects of prescribed fire vary depending on fire timing, type, and size; weather conditions before and after fire; site productivity; and other factors [157].

Fire timing: Season of burning may affect white-tailed deer forage availability [102]. A review of prescribed burning effects on white-tailed deer in Florida stated that because white-tailed deer eat a wide variety of foods, including grasses, forbs, browse, hard mast, soft mast, and mushrooms, different seasonal burning regimes could promote different components of the diet: Growing-season fires tend to promote herbs while dormant-season fires tend to promote browse [342]. Thus, planning prescribed fires in multiple seasons may benefit white-tailed deer. For more information, see Southeast forests. A review cautioned that managing for a variety of plant species—for example, by burning under prescription at different times of year—may be more important than managing for certain preferred forages. It noted that in Texas, some poor forage species such as coyotillo (Karwinskia humboldtiana) may be valuable hiding cover [121].

Fires that occur in fall or early winter may remove important cover during an entire winter, whereas fires that occur during the growing season are likely to reduce cover for a much shorter period [254]. Fires that occur during fawning may remove important fawning cover, potentially resulting in increased predation of fawns [19,59] (see Malnutrition and weather). If fire occurs during the hiding period, it could potentially kill fawns [107,127,194,342] (see Direct Fire Effects).

Fire type: Patchy burns may be best for white-tailed deer [159,217,247,467]. Discontinuous burning is most beneficial to white-tailed deer and wildlife in general because it results in cover close to feeding habitat, increased variety of forage species, and staggered maturation rates of individual stands [247]. In a review of fire effects on ungulates in the Northern Great Plains, Higgins and others [159] stated that "optimum" benefits of fire for white-tailed deer occur where fire creates a mosaic pattern of burned and unburned vegetation that provides new forage growth, seasonal habitats, and vegetation in early to late stages of succession. According to Wright [467], a patchy burn with about 20% unburned vegetation is most desirable for wildlife because it would leave adequate cover and result in abundant forage. Lay [217] stated that the pattern that produces the most diverse understory (e.g., a mixture of stand sizes, types and species, and well-distributed clearings) will most benefit white-tailed deer. He also stated that most white-tailed deer rangelands are likely improved by fire, in part because of differences in plant composition between burned and unburned areas [219]. Although a large fire could reduce the interspersion of food and cover for white-tailed deer by producing uniform vegetation, reviews stated that fires rarely burn evenly and typically produce a mosaic of vegetation beneficial for deer [30,247].

Fire size: Several small fires may be more beneficial to white-tailed deer than one large fire because of increased edge habitat. Large fires may be detrimental to white-tailed deer in the short term by causing initial food shortages and removing too much cover [30]. Regardless of habitat, because portions of large burns that are far from suitable cover may be unused, small burns are often considered better for deer [30]. Bendell [30] hypothesized that deer may benefit most from small fires because they result in more edge and greater interspersion of habitats than one large fire. Other researchers agreed that the pattern that produces the most habitat diversity will be the most beneficial to white-tailed deer [79,121,164,369]. Scifres and Hamilton [361] stated that the goal of white-tailed deer Habitat management should be to create a vegetation mosaic of adequate structure (height, stem density) and species diversity to retain critical screening cover while increasing forage. They recommend that when planning prescribed fires, managers consider: 1) placement of burned areas relative to the core of white-tailed deer activity, 2) placement of burned areas relative to other burns and unburned areas, and 3) the ratio of burned to unburned area [361]. Brown [42] considered small burned areas, especially those on winter rangelands, vulnerable to damage by deer and other ungulates because browsing may be concentrated in small areas. He suggested either burning multiple small areas within a landscape or burning a single, large area with a mosaic fire to disperse animals [42]. For more information, see Effects of herbivory on vegetation.

Management recommendations for white-tailed deer for specific geographic regions often include a maximum opening size or minimum distance to cover (e.g., [178,187,361]). For example, 2 radiocollared white-tailed deer in Clarke County, Alabama, had home ranges of 301 acres (122 ha) and 321 acres (130 ha). The authors suggested that small prescribed burns (<74 acres (30 ha)) would be best for white-tailed deer in this region because "sizable" portions of the home range of a given white-tailed deer would be unaffected by a given fire [178]. In southern Texas shrublands, Scifres and Hamilton [361] suggested creating 5-acre (2 ha) patches. They assumed that white-tailed deer home ranges were approximately 1.0 mile² (2.6 km²). They suggested that alternating burned and unburned strips is less desirable than burning patches because patches provide more edge habitat than strips. For more information, see Size and shape of burned areas.

Other general considerations: Because travel patterns of white-tailed deer prior to fire may affect postfire use, Pengelly [319] suggested it is important that Habitat management for white-tailed deer be based on the particular movement patterns and needs of the individuals making up that population. Prescribed fires on steep slopes at high elevations are unlikely to benefit white-tailed deer on northern Rocky Mountain winter rangelands because they do not use these areas in winter, while prescribed fires on shallow slopes at low elevations may be beneficial [319]. Telfer [406] cautioned that cover should be left in yarding areas because of herd fidelity to these locations.

White-tailed deer may affect postfire succession. Thus, white-tailed deer population densities are often considered in burning plans. At the Kerr Wildlife Management Area in Texas, Armstrong [12] stated that prior to prescribed burning in areas with high white-tailed deer densities, the white-tailed population should be reduced because vegetation on recent burns is vulnerable to overgrazing. Springer [385] recommended reducing white-tailed deer populations after burning to improve forage and deer body condition. Krefting [203] stated that "burning seems to be particularly beneficial in areas that have not been subjected to excessive white-tailed deer populations of long standing". For more information, see Effects of herbivory on vegetation.

White-tailed deer may not be able to take advantage of postfire successional communities because of high predation risk in these areas. See White-tailed deer, predator, and fire interactions.

Fire may influence interspecific interactions. For example, resource competition with bighorn sheep and mule deer may increase in the absence of fire (see White-tailed deer, other ungulate, and fire interactions). Asherin [14] suggested using several small prescribed fires scattered across winter rangelands to reduce interspecific interactions and disperse browsing pressure across burned and adjacent unburned areas.

The presence of cattle and other livestock may reduce the benefits of prescribed fire to white-tailed deer. At the Kerr Wildlife Management Area in Texas, Armstrong [12] stated that on burns, livestock should be managed using a rotational grazing system to prevent overgrazing of white-tailed deer foods. Furthermore, burned areas should be rested from livestock grazing for at least one growing season after fire, depending on fire severity and postfire precipitation [121,341]. In southern and western Texas, Bryant and Demarais [45] cautioned that if a recently burned area is grazed, rotational grazing should be used. Otherwise, livestock may concentrate on burned areas. Grazing may need to be deferred during at least a portion of the growing season in areas to be burned, to ensure fuels are sufficient to carry the fire [341]. See Livestock presence in burned areas for more information.

In northern regions, snow depth, duration, and hardness are likely to influence white-tailed deer use of burned areas [247], while in arid and semiarid regions precipitation may affect white-tailed deer use of burned areas [275]. For more information see Weather and use of burned areas.

Prescribed fire may reduce parasites afflicting white-tailed deer and reduce the prevalence of diseases, but the benefits are likely to be short term (see Diseases and parasites).

Differential habitat use by male and female white-tailed deer (see Age and sex) may warrant different uses of fire in their habitat [192,393]. For more information, see Sex differences in burn use.

Prescribed burning and its associated human activities may reduce white-tailed deer populations in the short term by increasing their vulnerability to hunting. The fall after the Moose Creek Fire on the Salmon National Forest, Idaho, hunting pressure on deer using the burned area was high, despite road closures [68]. Sampson [358] cautioned that the attraction of deer to small burned areas may lead to excessive hunting and require restricted hunting seasons after fire to maintain populations.

Proximity of burns to water may affect their use, particularly in the Southwest. In Mexican pinyon stands in the Madrean evergreen woodlands of southeastern Arizona, white-tailed deer pellet groups accumulated twice as fast on an area burned by a severe June wildfire 6.5 years prior that was near (980 feet (300 m)) permanent water than on a burned area that was far (3,940 feet (1,200 m)) from permanent water (Southwest woodlands) [23].

Fire affects the spread of nonnative invasive plants, which may be beneficial or detrimental to white-tailed deer. For more information on white-tailed deer use of nonnative invasive plants, see Nonnative invasive plants. See also FEIS reviews of nonnative invasive plants of interest.

Recommendations specific to each region: Boreal forest
Telfer [407] considered preservation of wintering yards critical in the boreal forest region, where climate tends to be marginal for survival of white-tailed deer. He suggested that diverse habitat—where a variety of age and composition classes occur interspersed in small stands—would be optimal for white-tailed deer in this region.

Pacific Northwest
Degradation of riparian areas is the major factor that reduced populations of Columbian white-tailed deer historically [122]. Fulbright [122] suggested planting native trees and shrubs such as cottonwood, spruce, alder (Alnus spp.), salal, ninebark (Physocarpus spp.), dogwood, and elderberry in riparian areas where woody plants are absent to provide browse and cover. He also suggested protecting riparian areas with remaining woody plants [122].

In Douglas-fir and grand fir types of northern Idaho, Pengelly [319] concluded that slash burning often favors early establishment of seral shrubs, many of which are preferred white-tailed deer forage species, and that broadcast burning of logging debris would increase preferred forage more than pile burning. He cautioned that creating large openings in stands may increase snow depth, making forage inaccessible to white-tailed deer in winter [319]. In ponderosa pine forests, decreasing Douglas-fir in overstories, increasing spacing between trees, and reducing conifers in the understory via fire or other means potentially reduces white-tailed deer habitat by reducing arboreal lichen litter fall and thermal cover important in winter. Fulbright [122] stated that managing forests to maintain high rates of arboreal lichen litter fall is likely to benefit white-tailed deer populations in the Pacific Northwest because white-tailed deer often consume lichens in winter.

Southwest
Mesquite: Mesquite shrublands are an important habitat for white-tailed deer in the Southwest, and treatments that reduce large areas of mesquite may reduce fruit and browse production and cover for white-tailed deer. In the Texas Rio Grande Plain, white-tailed deer preferred untreated areas to areas that were rootplowed and seeded with nonnative blue panicgrass (Panicum antidotale), especially under drought conditions, apparently because preferred food and cover were more abundant [84]. While large clearings via fire or other means may be detrimental, particularly during drought years, small openings in a mosaic pattern may create forage, especially in dense, extensive stands [365]. In general, lack of sufficient rain after a burn may lead to minimal regrowth of vegetation and thus little advantage to white-tailed deer [275]. For more considerations about precipitation, see recommendations for the South-central US.

Gambel oak: Gambel oak is an important white-tailed deer food in the Southwest. Its mast and browse are used extensively [365]. Burning or clearcutting patches in Gambel oak habitat may produce abundant browse because of its sprouting ability, but this would reduce mast. For this reason, selective cutting, in which the best acorn-producing trees are left, was recommended to ensure both browse and mast production in a single stand [365]. Anderson (1969 cited in [58]) cautioned against using prescribed fire in Gambel oak communities as a general policy because of the importance of Gambel oak acorns and browse to mule deer. Kruse [207] suggested using prescribed fire in Gambel oak woodlands on poor-quality sites to enhance brushy growth but avoiding prescribed fire use on better-quality sites with mature oaks. For more information, see Southwest shrublands. For a comprehensive review of Gambel oak management with fire and other methods see Onkonburi [303] and the FEIS review of Gambel oak.

Rocky Mountains
In the Rocky Mountains, prescribed fire can benefit white-tailed deer by increasing forb production on summer and transitional rangelands, removing litter, and stimulating the sprouting of browse species such as true mountain-mahogany, chokecherry, serviceberry, snowberry, and quaking aspen on winter rangelands. Olson [302] provided the following guidelines for burning under prescription on white-tailed deer rangelands in Wyoming:
  • 1. Conduct prescribed fires only in years with average or above-average precipitation. Adequate soil moisture is essential for plant growth following fire.
  • 2. Conduct prescribed fires in late summer or early fall in 50- to 100-acre (20-40 ha) patches to favor grass and forb growth. Conduct prescribed fires in spring to favor growth of sprouting shrubs.
  • 3. Exclude livestock for at least 2 postfire growing seasons to allow for plant reestablishment.
  • 4. Avoid reburning grass and/or forb communities for at least 5 to 7 years and shrublands for at least 10 to 12 years, depending on soils and weather [302].
White-tailed deer in the Rocky Mountains require conifer forests for cover in winter. Fire that reduces too much winter cover may be detrimental. In the Priest River drainage of northern Idaho, white-tailed deer preferred old-growth western hemlock/queencup beadlily (Clintonia uniflora) and western redcedar/wild ginger (Asarum caudatum) stands to adjacent habitats where snow was >16 inches (40 cm) deep. Despite their depauperate understories, the dense canopies cover and shallow snow made those stands more attractive than the adjacent sites. When snow was shallow, wintering white-tailed deer selected lodgepole pine and Douglas-fir pole stands that provided more preferred forage species. The authors suggested that in regions with deep snow, managers retain old-growth forest—or mature 2nd-growth forest stands with similar structural attributes—for white-tailed deer [314]. Because of the importance of cover in winter in the Douglas-fir zone of northern Idaho, Pengelly [319] recommended only small clearcuts followed by burning.

Northern Great Plains
Bur oak: Distribution of bur oak (Quercus macrocarpa) in the Black Hills and Bear Lodge Mountains of South Dakota and Wyoming coincides with primary white-tailed deer winter rangeland. Burning or clearcutting bur oak stands typically produces abundant bur oak sprouts. Although bur oak is palatable to white-tailed deer, burning or clearcutting may be a poor practice in these habitats because bur oak browse is of poor nutritional quality and production of bur oak's highly-nutritious acorns would be reduced [364]. Severson and Kranz [364] recommended selective cutting of bur oak to provide a more productive forage complex on deer winter rangelands. In mixed pine-oak stands, selective removal of ponderosa pine trees may enhance oak and shrub production that benefits white-tailed deer [368]. See FEIS review of bur oak for more information on fire effects and management recommendations.

Quaking aspen: In the Black Hills, Sheppard and Battaglia [368] suggested that providing a variety of seral quaking aspen stands will maximize cover and forage diversity for white-tailed deer. Fencing or other means of excluding white-tailed deer may be needed to allow quaking aspen sprouts to establish after treatments [368]. For further recommendations for quaking aspen forests, see Great Lakes.

Ponderosa pine: In the Black Hills, Sheppard and Battaglia [368] suggested that forage production for white-tailed deer can be increased through prescribed burning of stands, thinning of trees, and reduction of pine litter. Burning ponderosa pine stands with preferred white-tailed deer browse species such as chokecherry, serviceberry, and quaking aspen in the understory can be beneficial because these understory species sprout after fire, and young sprouts are usually more nutritious than unburned mature plants [368].

Great Lakes
In the extensive forests of the northern Great Lakes region, the "greatest number of (white-tailed deer) will be produced by keeping the habitat in the early stages of plant succession" such as by burning under prescription [424]. Byelich and others [50] recommend for Michigan that 25% of an upland forest type be 1 to 10 years of age and interspersed with other age classes. They also recommend that 35% of upland areas be maintained as aspen stands and 15% as forest openings. In lowland coniferous habitats, they recommended 35% be maintained as openings or in early-seral stages [50]. Jenkins [181] recommended using prescribed fire to maintain open areas in forested regions of the Great Lakes. He suggested that such areas be burned every 5 to 10 years, either in early spring or in late fall. He recommended burning areas with aspen, cherry, serviceberry, young jack pine, and maple to produce shrubby cover and open the canopy. Burning bear oak was not recommended because it takes 15 to 20 years or more to reach mast-producing age [181]. In Wisconsin, McCaffery and Creed (1969 cited in [133]) recommended openings of 5 acres (2 ha) or less to improve white-tailed deer habitat.

Quaking aspen: Quaking aspen is heavily browsed by white-tailed deer in the Great lakes [38]. In Minnesota forests with aspen, numerous small and well-distributed areas of various age classes are most likely to benefit white-tailed deer (Rutske 1969 cited in [133]), though most use of quaking aspen by white-tailed deer occurs during the first 3 to 5 years after a stand is cut or burned [38]. However, fires at 2- to 3-year intervals should be avoided because the quaking aspens may fail to sprout [38]. See Timmermann [421] for a review of white-tailed deer habitat guidelines for quaking aspen communities. See Gullion [139] for recommendations on the size and distribution of cuts, rotation age, and reentry periods for quaking aspen stands.

Northern whitecedar: Northern whitecedar is common in white-tailed deer yards, but it is difficult to regenerate after burning and clearcutting because of heavy white-tailed deer browsing [163]. Verme and Johnston [435] found that in the absence of white-tailed deer browsing in the Petrel Grade yard near Shingleton, Michigan, broadcast burning slash in strip and small-block clearcuts in northern whitecedar forests prepared a seedbed conducive to northern whitecedar regeneration. To regenerate northern whitecedar, the authors recommended broadcast burning following clearcutting when 1) there was little advance reproduction; 2) thick slash deposits occur; 3) a large amount of deciduous "brush" is present; and/or 4) the site is likely to convert naturally to other conifers such as balsam fir. They cautioned, however, that in drought years or in areas with high white-tailed deer populations, northern whitecedar seedling mortality could be high: "It is imperative that few or no (white-tailed) deer use the area until the saplings have grown beyond their reach, in 20-40 years depending upon site quality" [435]. Thus, they concluded that northern whitecedar yard rehabilitation should only be attempted where either: 1) white-tailed deer density could be closely controlled through antlerless harvest; 2) the existing herd could be drawn away from regenerating areas through annual logging of northern whitecedar in other areas; or 3) a large (40-158 acre (16-64 ha)) area could be completely logged in 5 to 10 years, leaving no shelter to attract white-tailed deer during winter [435]. Davis and others [83] found that although high numbers of northern whitecedar seedlings were recruited after low-severity surface fire in northern whitecedar plots from which white-tailed deer were excluded, plots without white-tailed deer exclosures had no northern whitecedar seedlings after 10 years. He recommended clearcutting small patches located adjacent or close to each other so that 40 to 158 acres (16-64 ha) are completely cut in 5 to 10 years. This method assumed that white-tailed deer would avoid the center of large clearcuts due to lack of cover in these open patches, "thus thwarting browsing" [83]. However, Telfer [406] cautioned against removing too much cover in any white-tailed deer yard because high fidelity to wintering areas could cause high deer mortality (see Travel patterns). Because northern whitecedar seedlings grow slowly, a review suggested that managers desiring to regenerate northern whitecedar be prepared for extended time periods before northern whitecedar saplings grow above white-tailed deer browsing height [163]. See Hofmeyer and others [163] for a review of northern whitecedar ecology and management. For further recommendations about yards, see Northeast.

Northeast
Management of white-tailed deer yards primarily involves locating and evaluating them, preserving shelter within them, and providing food sources within and adjacent to them. Burning under prescription or cutting to control stand density, species composition, and age class distribution along with planting conifers are the main management tools [408]. Diefenbach and Shea [95] stated that in the northern range of white-tailed deer, the most important Habitat management tool is protection and maintenance of yards. Other researchers also advocated protecting and maintaining yards [79,430]. Management guidelines suggest maintaining about 50% to 60% dense conifer cover in yards, with the remaining portion a mixture of openings and early-successional forests that provide browse. These early-successional forests could be created by burning and/or clearcutting [95,157,408]. Miller and others [279] stated that in white-tailed deer yards, burned and/or logged areas should be small (5-10 acres (2-4 ha)) and well dispersed. In New Hampshire, Williamson and Langley [457] gave the following recommendations for managing spruce-fir yards: 1) maintain cover within most of the yard; 2) encourage spruce and fir regeneration in the yard and in adjacent stands; and 3) where possible, manage adjacent hardwood stands for browse production. For a review of silvicultural recommendations for yard management in spruce-fir and northern whitecedar forests, see Telfer [408].

South-central US
Shrublands: Shrubs provide cover and food (browse and mast) for white-tailed deer. However, too much shrub cover can hinder white-tailed deer movements, reduce herbaceous forage, and potentially increase predation mortality. Thus, shrub removal in some parts of the south-central United States may benefit white-tailed deer, although removing too many shrubs may be detrimental [341]. According to Richardson [341], white-tailed deer generally prefer a mosaic of shrubs and trees interspersed within open areas at an approximate 3:1 ratio of shrublands to openings. Benefits of prescribed fire to white-tailed deer in South-central US shrublands include: 1) removing old growth and litter build-up from bunchgrasses that are used as fawning cover; 2) increasing palatability of forage; 3) increasing plant nutrients for 3 to 4 months; and 3) suppressing "undesirable" woody plants such as mesquite, Pinchot juniper (Juniperus pinchotii), and shinnery oak (Quercus havardii) [341]. In shrublands in southern Texas, white-tailed deer generally benefit from prescribed fire because it increases forage availability [361]. A review provided the following guidelines for planning a prescribed fire in arid and semiarid regions of Texas and Oklahoma to benefit white-tailed deer [121]:
  • Warm-season (summer) prescribed fire might be selected in preference to cool-season (winter) prescribed fire if the objective is to increase woody plant kill and open dense shrublands. In contrast, early-winter prescribed fire might be selected to increase the standing crop of forbs.
  • High-severity fire usually reduces shrubs more than low-severity fire and may be used as a follow-up treatment to mechanical or chemical treatments.
  • Winter prescribed fire may be used to create a mosaic of burned and unburned areas to enhance vegetation diversity.
  • If the objective is to create feeding areas for white-tailed deer, burned patches ranging from 20 to 40 acres (8-16 ha) might be interspersed across the landscape with perhaps 1 burned patch/km².
  • Prescribed burns could be conducted at different times of the year to promote greater patchiness and vegetation diversity. For example, if a management area is 4 mile² (10 km²) and 10 patches are to be burned, 33% could be burned during summer, 33% in early fall, and the remainder in early winter.
  • Burned areas should be rested from livestock grazing for at least one growing season after fire, depending on precipitation following the fire and fire severity.
In the Texas Rolling Plains, late winter fire tends to favor perennial, warm-season grasses, whereas early winter fire tends to promote the production of cool-season annuals and perennial forbs, such as legumes, that are highly preferred by white-tailed deer. Thus, late winter prescribed fires are generally recommended for white-tailed deer management in the Texas Rolling Plains [341]. According to Bryant and Demarais [45], the best time to burn for white-tailed deer in Texas is December, because December prescribed fires tend to result in the greatest amount of forbs. However, the authors cautioned that during winters of "good" winter forb production, when forbs may have already germinated by December, December burning may damage or kill them [45]. At the Kerr Wildlife Management Area, burning prior to mid-January—a period when many cool-season forbs begin to germinate and form rosettes—was recommended [12]. Scifres and Hamilton [361] stated that burning in early winter is likely to promote forbs, especially if late winter rainfall is adequate. However, late winter prescribed fires may also result in a flush of forb growth. Regardless of timing, they suggested that burning be conducted on sites with a "propensity" for forb production such as mesic sites [361].

In 2008, Richardson and others [341] stated that summer prescribed fire is seldom used in the Texas Rolling Plains because of inconsistent rainfall in summer and fall. High temperatures generated by a summer fire can damage root systems of grasses, especially if they are already stressed from drought and/or heavy grazing. However, native grasses and forbs can respond quickly to rainfall following summer fires [341]. In semiarid rangeland in Uvalde County, Texas, 6 and 10 months after three 100-acre (40 ha) late-September prescribed fires, low use of burned areas by white-tailed deer was attributed to drought, which limited vegetation growth on burned areas. The authors stated that use of prescribed fire for the improvement of white-tailed deer rangelands can be a valuable asset, but only when environmental conditions are suitable [275].

Various sizes for burned areas have been recommended for white-tailed deer management in Texas shrublands. In southern and western Texas, Bryant and Demarais [45] recommended burned areas be <150 acres (60 ha) and scattered throughout an area, suggesting one 150-acre burned area per 600 acres (240 ha). The authors also provide guidelines for open:cover ratios, maximum opening width, ideal opening width, and opening pattern [45]. Holechek [164] recommended small openings (5-40 acres (2-16 ha)) in dense shrublands. He cautioned that too frequent (<20 years) use of fire in semiarid rangelands may reduce browse plant numbers and thus deplete white-tailed deer range [12]. According to Richardson and others [341], the most beneficial burning programs in the Texas Rolling Plains for white-tailed deer were those that incorporated a multiyear rotation so that 10% to 20% of an area was burned each year, rather than an entire area. This schedule allowed at least 5 to 10 years between fires for any given area and provided for a diverse pattern of food and cover at various stages of growth. The authors stated that highly erodible areas should be protected from fire [341].

Sparse fuels in arid and semiarid regions may require livestock grazing deferment during at least a portion of the previous growing season in areas to be burned. In addition, it will likely be necessary to defer grazing immediately after a prescribed fire to promote plant growth and rangeland recovery [341]. Several researchers cautioned that if a burned area is grazed by livestock, rotational grazing should be used. Otherwise livestock may concentrate on burned areas and potentially damage postfire vegetation [12,45]. Armstrong [12] stated that prior to burning shrublands in the Edwards Plateau, white-tailed deer populations should be "heavily" reduced when the objective of burning is to stimulate white-tailed deer food production and vegetation. Ruthven and others [355] speculated that slow recovery of spiny hackberry and decline of Texas lignum-vitae following fire resulted from browsing by white-tailed deer and other herbivores. They suggested that it may benefit white-tailed deer to limit the use of prescribed fire in areas dominated by highly preferred species that decline following fire and target areas dominated by vulnerable, less desirable species (e.g., twisted acacia and lantana (Lantana camara)) and desirable fire-tolerant species (e.g., Texas hogplum (Colubrina texensis)) [355].

Removal of shrubs over large areas may be detrimental to white-tailed deer by removing too much hiding and thermal cover. In addition, many shrub species are important forages during the dormant season and during extended dry periods [45,164,341]. Large-scale (>640 acres (260 ha)) clearing of woody plants by mechanical methods such as root plowing and chaining generally reduces white-tailed deer population densities [122,164]. Some researchers stated that nonsprouting species, such as Ashe juniper, be protected from disturbance because many do not recover quickly after fire and that some mature sprouting species be protected from fire to produce hard and soft mast important to white-tailed deer [45,121]. Fulbright [122] suggested that areas in western Texas containing Mexican blue oak (Quercus oblongifolia) and juniper be protected from cutting to maintain thermal cover for white-tailed deer. Scifres and Hamilton [361] stated that most rangeland fires do not reduce white-tailed deer cover in proportion to the area burned because most fires are patchy due to sparse or poorly distributed fuels. Thus, cover from unburned stems and from standing dead stems remains after most fires. In addition, most southern Texas shrubs sprout after fire and recover to prefire values quickly after fire [122,361]. Thus, white-tailed deer cover in South-central US shrublands is normally reduced for no longer than a growing season. Still, researchers caution that managers be aware of white-tailed deer cover requirements and ascertain that adequate cover is retained across the landscape after prescribed fire [361]. Several researchers stated that a mosaic of shrubs and openings is generally best for white-tailed deer [12,122,164] (see Fire size).

Oak and pine-oak: To increase growth and availability of important white-tailed deer foods, Masters and others [260] recommended a prescribed burning rotation of 2 to 4 years on harvested sites in post oak-shortleaf pine-blackjack oak stands on the Pushmataha Wildlife Management Area, Oklahoma, to increase growth and availability of important white-tailed deer foods [260]. Yantis [468] suggested that post oak woodlands be burned between early December and early February once every 4 years or more to benefit white-tailed deer. Burning post oak woodlands too often may decrease mast production, however. They also suggested that a variety of oaks be retained in the overstory [468].

Southern Appalachians and Southeast
White-tailed deer Habitat management in the southeastern United States is primarily concerned with providing diverse browse and forage species, and secondarily with providing cover for escape or protection from severe weather [251]. Benefits of prescribed fire in southeastern forests include: 1) reduced "undesirable" understory hardwoods (e.g., sweetgum, red maple, southern bayberry (Myrica caroliniensis)); 2) reduced height of palatable species; 3) improved nutrient quality of browse; 4) increased herbaceous foods under semiopen overstory conditions; and 5) increased understory fruit production under sparse overstories. Negative effects commonly noted by researchers include reduction in browse and vines for a year or longer, reduced soft mast for approximately 3 or 4 years, and reduced acorn abundance for >25 years [213,369].

In the southern Appalachians and the Ouachita and Ozark Mountains and some coastal islands, white-tailed deer productivity depends on acorn production; thus, retention of stands with high mast production is important [279]. Acorn yield is highly variable from year to year and is related to oak species; age, basal area, and crown size of individual trees; tree stand density; and weather [135,333]. Substantial mast yield is rare in oak trees <25 years old [333]. Best acorn yields occur from large-diameter trees with well-developed crowns. Late spring frosts may reduce acorn yields [333]. Managers may help promote a steady supply of acorns by maintaining a diversity of species of red and white oak sections of different age classes within an area [108,333]. For example, a last spring freeze in March 1955 in east Texas and Louisiana caused nearly complete mast failures in 1955 for species in the white oak section (post oak, white oak, and swamp chestnut oaks (Quercus michauxii)), which flower and fruit in 1 year. Species in the red oak section had a good acorn crop that year but a poor crop the next year, because these species require 2 years to fruit [333]. "Hot" surface fires in forests with oaks can consume acorns on the forest floor. However, "light" surface fires may expose recently fallen acorns which may be little damaged [149]. Ivey and Causey [178] reported that 2 weeks after burning, white-tailed deer preferred the hardwood/pine habitat to the pine habitat because hardwood mast had been exposed by the fire. The conflicting requirement of accessible browse versus hard mast production suggests that managing browse production areas apart from major acorn-producing stands would benefit white-tailed deer [213]. Stransky and Halls (1967 cited in [369]) stated that when mast-producing hardwoods are a major component of upland forests, prescribed fires should not be used until hardwoods are at least pole size, if at all. Because white-tailed deer browsing can severely reduce oak regeneration, fencing or other means of reducing browsing may be necessary if fire is used in these habitats [389] (see Effects of herbivory on vegetation).

Some researchers recommended using prescribed fire to increase soft mast production in southeastern forests for white-tailed deer. In Table Mountain pine (Pinus pungens)-pitch pine-hardwood/mountain-laurel (Kalmia latifolia) stands in western North Carolina, Randles [331] recommended maintaining a "patchwork" of areas with low-severity fire to increase cover of blueberry and other mast-producing shrubs favorable to white-tailed deer and other wildlife. He also recommended burning some areas with high-severity fire to increase grass production and pine regeneration. He recommended some areas be left unburned as cover [331]. According to a review, mast production for most shrubs and small trees in the Southeast peaks 2 to 6 years after burning [149]. For example, to maintain fruit production for white-tailed deer, Fults [126] recommended burning saw-palmetto understories of longleaf pine-slash pine forests every 3 to 5 years.

In general, annual burning is considered detrimental to white-tailed deer in southeastern forests because of reduced cover, browse, and mast [149]. Annual summer burning may eliminate browse species and annual winter burning limits mast production [251]. Burning every 2 to 3 years generally produces an herbaceous community with scattered shrubs, and burning every 3 to 4 years is likely to produce a mixed-grass and forb community with a substantial shrub component, which would allow soft mast production from blackberries and other species and provide winter cover [151]. Thus, Harlow [151] and Lewis [230] recommended burning every 3 to 4 years. Van Lear and Waldrop [428] stated that use of low-severity fires every 2 to 6 years may help provide browse for white-tailed deer in southeastern pine stands. Other researchers recommended using prescribed fire every 2 to 3 years in slash pine forests to promote shrub and hardwood sprouting ([254], Hurst 1989 cited in [238]). Landers [213] stated that because white-tailed deer browse plants "surpass their prime" about 5 growing seasons after fire, white-tailed deer rangeland would be maintained in "optimum" condition with a 5-year cycle that burns about 20% of an area each year in small parcels. Shrauder and Miller [369] recommended burning every 3 to 5 years to maintain or increase legumes and keep browse plants low and accessible to white-tailed deer in 40- to 60-year-old longleaf pine-slash pine forests. They noted, however, that food benefits for white-tailed deer resulting from fire can last up to 10 years, depending on site characteristics [369]. Without fire for long periods, a dense midstory is likely to develop out of the reach of white-tailed deer [251,369]. In 2003, Maas and others [251] hypothesized that the nutritional benefits of burning for white-tailed deer and other wildlife may be diminished by repeated burning, noting that the effects of repeated fires and various burning regimes need further evaluation.

Different seasonal burning regimes promote different components of the white-tailed deer's diet. Growing-season fires tend to promote herbaceous plants, while dormant-season fires tend to promote browse production [342]. Because browse is often considered the "more important" component, prescribed burning guidelines for managing white-tailed deer habitat in southeastern forests usually recommend dormant-season burning (e.g., [151,231,254,369]). Harper [151] advocated burning late in the dormant season rather than early to manage early-successional habitat for wildlife in the Southeast. Although burning early in the dormant season can increase cool-season grasses, many cool-season grasses in the Southeast are nonnative (e.g., tall fescue (Schedonorus arundinaceus), orchardgrass (Dactylis glomerata), brome (Bromus spp.), and common velvet grass (Holcus lanatus)) and displace desirable native grasses and forbs. Burning early in the dormant season also reduces cover at a time when it may already be limited. Burning late in the dormant season (late March-early April) is likely to increase warm-season grasses and help reduce cool-season grasses that have already started growing. Burning in the late dormant season or early growing season (through mid-April) may also allow white-tailed deer to use cover throughout winter [151]. Another benefit of late dormant-season or early growing-season fires to white-tailed deer is that recovery of herbaceous vegetation occurs more rapidly during the early growing season than during the dormant season. Hence, fires conducted later in the dormant season may promote fast recovery of vegetation [254]. If the objective is to reduce woody plants in dense stands, then burning during the late growing season (September) may be most effective because burning at this time top-kills woody stems before carbohydrates are transported from the leaves to the root system in preparation for senescence. Therefore, root systems are depleted of much of the energy needed to sprout [151].

The importance of forbs to white-tailed deer has prompted some researchers in the Southeast to suggest possible benefits of growing-season fires. Landers [213] proposed that a patchy growing-season fire and the resulting succulent growth of herbs may better meet the nutritional requirements of pregnant does and fawns than dormant-season fires. Stransky and Harlow [394] concluded that infrequent summer fires can increase the abundance and kinds of herbs beneficial to white-tailed deer but that annual summer fires may eliminate browse plants [342]. Shrauder and Miller [369] stated that in 40- to 60-year-old longleaf pine-slash pine stands with dense hardwood understories, a series of annual summer fires ("reclamation fires") may be needed to reduce undesirable species and increase desirable foods such as greenbrier, panicgrass, legumes, and ragweed (Ambrosia spp.). However, they noted that "hot" summer fires may also reduce desirable species, especially fruiting species. "Once the desired understory hardwood thinning on the white-tailed deer range has been obtained, frequent, hot summer fires should be discontinued, lest the range become predominantly mixed grasses and low herbaceous species" less suitable for white-tailed deer. At that time, the authors suggested switching to burning in winter every 3 to 5 years to maintain or increase legumes and keep browse plants accessible to white-tailed deer [369]. Several researchers recommended alternating between growing-season fires and dormant-season fires to enhance white-tailed deer habitat [251,342]. Ultimately, any burning regime should strive to maintain hardwoods in the understory and ensure a diversity of plant species that includes hardwood browse and forbs [251].
  • 12. Armstrong, W. E. 1980. Impact of prescribed burning on wildlife. In: White, Larry D., ed. Prescribed range burning in the Edwards Plateau of Texas: Proceedings of a symposium; 1980 October 23; Junction, TX. College Station, TX: The Texas A&M University System, Texas Agricultural Extension Service: 22-26. [11430]
  • 14. Asherin, Duane A. 1973. Prescribed burning effects on nutrition, production and big game use of key northern Idaho browse species. Moscow, ID: University of Idaho. 96 p. Dissertation. [360]
  • 19. Ballard, Warren. 2011. Predator-prey relationships. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 251-286. [85227]
  • 23. Barsch, Bob Knight. 1977. Distribution of the Coues deer in pinyon stands after a wildfire. Tucson, AZ: University of Arizona. 52 p. Thesis. [85060]
  • 30. Bendell, J. F. 1974. Effects of fire on birds and mammals. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 73-138. [16447]
  • 38. Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and management in the Lake States. Agric. Handb. 486. Washington, DC: U.S. Department of Agriculture, Forest Service. 52 p. [5107]
  • 42. Brown, James K. 1985. Fire effects and application of prescribed fire in aspen. In: Saunders, Ken; Durham, Jack; [and others], eds. Rangeland fire effects: Proceedings of the symposium; 1984 November 27-29; Boise, ID. Boise, ID: U.S. Department of the Interior, Bureau of Land Management, Idaho State Office: 38-47. [3658]
  • 45. Bryant, Fred C.; Demarais, Steve. 1991. Habitat management guidelines for white-tailed deer in south and west Texas. In: Lutz, R. Scott; Wester, David B., eds. Research highlights--1991: Noxious brush and weed control; range and wildlife management. Volume 22. Lubbock, TX: Texas Tech University, College of Agricultural Sciences: 9-13. [18350]
  • 50. Byelich, John D.; Cook, Jack L.; Blouch, Ralph I. 1972. Management for deer. In: Aspen: Symposium proceedings; [Date of conference unknown]; [Location of conference unknown]. Gen. Tech. Rep. NC-1. St. Paul, MI: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 120-125. [12048]
  • 58. Carpenter, Len H.; Wallmo, Olof C. 1981. Rocky Mountain and Intermountain habitats: Part 2. Habitat evaluation and management. In: Wallmo, Olof C., ed. 1981. Mule and black-tailed deer of North America. Lincoln, NE: University of Nebraska Press: 399-422. [14383]
  • 59. Carroll, Bob K.; Brown, Dennis L. 1977. Factors affecting neonatal fawn survival in southern-central Texas. The Journal of Wildlife Management. 41(1): 63-69. [86810]
  • 68. Collins, Thomas C. 1980. A report on the Moose Creek Fire of August, 1979. North Fork, ID: U.S. Department of Agriculture, Forest Service, Salmon National Forest, North Fork Range District. Unpublished report on file at: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 27 p. [+ appendices]. [666]
  • 70. Cote, Steeve D. 2011. Impacts on ecosystems. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 379-398. [85217]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 80. Dacy, Emily C.; Fulbright, Timothy E. 2009. Survival of sprouting shrubs following summer fire: effects of morphological and spatial characteristics. Rangeland Ecology & Management. 62(2): 179-185. [74755]
  • 83. Davis, Alaina; Puettmann, Klaus; Perala, Don. 1998. Site preparation treatments and browse protection affect establishment and growth of northern white-cedar. Research Paper NC-300. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 9 p. [86860]
  • 84. Davis, R. B.; Winkler, C. K. 1968. Brush vs. cleared range as deer habitat in southern Texas. The Journal of Wildlife Management. 32(2): 321-329. [86879]
  • 89. Demarchi, Dennis A.; Lofts, Susan. 1985. The effects of spring burning on the productivity and nutrient concentration of several shrub species in the southern Rocky Mountain Trench. MOE Technical Report 19. Victoria, BC: British Columbia Ministry of Environment, Wildlife Branch, Wildlife Habitat and Inventory Section. 89 p. [28269]
  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 100. Drewa, Paul B.; Platt, William J.; Moser, E. Barry. 2002. Fire effects on resprouting of shrubs in headwaters of southeastern longleaf pine savannas. Ecology. 83(3): 755-767. [41150]
  • 102. Dubreuil, Robert P. 2003. Habitat selection of white-tailed and mule deer in the southern Black Hills, South Dakota. Brookings, SD: South Dakota State University. 212 p. Thesis. [85337]
  • 107. Esque, Todd C.; Schwalbe, Cecil R. 2002. Alien annual grasses and their relationships to fire and biotic change in Sonoran desertscrub. In: Tellman, Barbara, ed. Invasive exotic species in the Sonoran region. Arizona-Sonora Desert Museum studies in natural history. Tucson, AZ: The University of Arizona Press; The Arizona-Sonora Desert Museum: 165-194. [48660]
  • 108. Feldhamer, George A. 2002. Acorns and white-tailed deer. Interrelationships in forest ecosystems. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 215-223. [43532]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 126. Fults, Gene A. 1991. Florida ranchers manage for deer. Rangelands. 13(1): 28-30. [14566]
  • 127. Gabrielson, Ira N. 1928. Forest fire and wildlife: A naturalist tells about the things that happen when the woods are burning. Four L Lumber News. 10(13): 32. [34525]
  • 133. Gordon, Floyd A. 1976. Spring burning in an aspen-conifer stand for maintenance of moose habitat, West Boulder River, Montana. In: Proceedings, Montana Tall Timbers fire ecology conference and Intermountain Fire Research Council fire and land management symposium; 1974 October 8-10; Missoula, MT. No. 14. Tallahassee, FL: Tall Timbers Research Station: 501-538. [13529]
  • 135. Greenberg, Cathryn H. 2000. Individual variation in acorn production by five species of southern Appalachian oaks. Forest Ecology and Management. 132(2-3): 199-210. [36020]
  • 139. Gullion, Gordon W. 1977. Maintenance of the aspen ecosystem as a primary wildlife habitat. Proceedings, 13th International Congress of Game Biologists. 13: 256-265. [16724]
  • 149. Harlow, R. F.; Van Lear, D. H. 1989. Effects of prescribed burning on mast production in the southeast. In: McGee, C. E., ed. Proceedings of the workshop: southern Appalachian mast management; 1989 August 14-16; Knoxville, TN. Knoxville, TN: University of Tennessee, Department of Forestry, Wildlife and Fisheries: 54-65. [86322]
  • 151. Harper, Craig A. 2007. Strategies for managing early succession habitat for wildlife. Weed Technology. 21(4): 932-937. [86319]
  • 157. Hewitt, David G. 2011. Nutrition. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 75-105. [85222]
  • 159. Higgins, Kenneth F.; Kruse, Arnold D.; Piehl, James L. 1989. Effects of fire in the Northern Great Plains. Ext. Circ. EC-761. Brookings, SD: South Dakota State University, Cooperative Extension Service; South Dakota Cooperative Fish and Wildlife Research Unit. 47 p. [14749]
  • 163. Hofmeyer, Philip V.; Kenefic, Laura S.; Seymour, Robert S. 2009. Northern white-cedar ecology and silviculture in the northeastern United States and southeastern Canada: a synthesis of knowledge. Northern Journal of Applied Forestry. 26(1): 21-27. [86421]
  • 164. Holechek, Jerry L. 1981. Brush control impacts on rangeland wildlife. Journal of Soil and Water Conservation. 36(5): 265-269. [1182]
  • 178. Ivey, T. L.; Causey, M. K. 1984. Response of white-tailed deer to prescribed fire. Wildlife Society Bulletin. 12(2): 138-141. [8393]
  • 181. Jenkins, B. C. 1946. What about controlled burning? Michigan Conservationist. 15(4): 12-14. [16763]
  • 187. Keay, Jeffrey A.; Peek, James M. 1980. Relationships between fires and winter habitat of deer in Idaho. The Journal of Wildlife Management. 44(2): 372-380. [125]
  • 192. Kie, John G.; Bowyer, R. Terry. 1999. Sexual segregation in white-tailed deer: density-dependent changes in use of space, habitat selection, and dietary niche. Journal of Mammalogy. 80(3): 1004-1020. [86425]
  • 194. Kirkpatrick, R. C. 1944. Effect of fires on wildlife. Wisconsin Conservation Bulletin. 6(5): 28-30. [16374]
  • 203. Krefting, Laurits W. 1962. Use of silvicultural techniques for improving deer habitat in the Lake States. Journal of Forestry. 60(1): 40-42. [17092]
  • 207. Kruse, William H. 1992. Quantifying wildlife habitats within Gambel oak/forest/woodland vegetation associations in Arizona. In: Ffolliott, Peter F.; Gottfried, Gerald J.; Bennett, Duane A.; Hernandez C., Victor Manuel; Ortega-Rubio, Alfred; Hamre, R. H., tech. coords. Ecology and management of oak and associated woodlands: perspectives in the southwestern United States and northern Mexico: Proceedings; 1992 April 27-30; Sierra Vista, AZ. Gen. Tech. Rep. RM-218. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 182-186. [19762]
  • 213. Landers, J. Larry. 1987. Prescribed burning for managing wildlife in southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene, eds. Managing southern forests for wildlife and fish: a proceedings; 1986 October 5-8; Birmingham, AL. Gen. Tech. Rep. SO-65. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experimental Station: 19-27. [Proceedings of the Wildlife and Fish Ecology Technical Session, 1986 Society of American Foresters National Convention]. [25968]
  • 217. Lay, Daniel W. 1956. Effects of prescribed burning on forage and mast production in southern pine forests. Journal of Forestry. 54(9): 582-584. [13828]
  • 219. Lay, Daniel W. 1967. Browse palatability and the effects of prescribed burning in southern pine forests. Journal of Forestry. 65(11): 826-828. [145]
  • 230. Lewis, Clifford E. 1973. Understory vegetation, wildlife, and recreation in sand pine forests. In: Sand pine symposium: Proceedings; 1972 December 5-7; Panama City Beach, FL. Gen. Tech. Rep. SE-2. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station: 180-192. [45432]
  • 231. Lewis, Clifford E.; Harshbarger, Thomas J. 1976. Shrub and herbaceous vegetation after 20 years of prescribed burning in the South Carolina coastal plain. Journal of Range Management. 29(1): 13-18. [7621]
  • 238. Long, A. J.; Behm, A.; Cassidy, L.; DiMartino, J.; Doran, D.; Freeman, D.; Helmers, J.; Keefe, K.; Miller, A.; Ranasinghe, S.; Randall, C.; Rasser, M.; Ruth, A.; Shipley, D.; Van Loan, A. 2004. Prescribed fire and slash pine. In: Dickens, E. D.; Barnett, J. P.; Hubbard, W. G.; Jokela, E. J., eds. Slash pine: still growing and growing! Proceedings of the slash pine symposium; 2002 April 23-25; Jekyll Island, GA. Gen. Tech. Rep. SRS-76. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 66-78. [55324]
  • 247. Lyon, L. Jack; Crawford, Hewlette S.; Czuhai, Eugene; Fredriksen, Richard L.; Harlow, Richard F.; Metz, Louis J.; Pearson, Henry A. 1978. Effects of fire on fauna: a state-of-knowledge review--National fire effects workshop; 1978 April 10-14; Denver, CO. Gen. Tech. Rep. WO-6. Washington, DC: U.S. Department of Agriculture, Forest Service. 41 p. [25066]
  • 248. Lyon, L. Jack; Hooper, Robert G.; Telfer, Edmund S.; Schreiner, David Scott. 2000. Fire effects on wildlife foods. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 51-58. [44448]
  • 251. Maas, Deborah S.; Musson, Robin L.; Hayden, Timothy J. 2003. Effects of prescribed burning on game species in the southeastern United States, a literature review. ERDC/CERL TR-03-13. Champaign, IL: U.S. Army Corps of Engineers, Engineer Research and Development Center, Construction Engineering Research Laboratory. 71 p. [86560]
  • 254. Main, Martin B.; Richardson, Larry W. 2002. Response of wildlife to prescribed fire in southwest Florida pine flatwoods. Wildlife Society Bulletin. 30(1): 213-221. [41806]
  • 260. Masters, Ronald E.; Lochmiller, Robert L.; Engle, David M. 1993. Effects of timber harvest and prescribed fire on white-tailed deer forage production. Wildlife Society Bulletin. 21(4): 401-411. [23422]
  • 275. Meek, M. G.; Cooper, S. M.; Owens, M. K.; Cooper, R. M.; Wappel, A. L. 2008. White-tailed deer distribution in response to patch burning on rangeland. Journal of Arid Environments. 72(11): 2026-2033. [71523]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 302. Olson, Rich. 1992. White-tailed deer habitat requirements and management in Wyoming. B-964. Laramie, WY: University of Wyoming, Cooperative Extension Service. 17 p. [20678]
  • 303. Onkonburi, Jeanmarie. 1999. Growth response of Gambel oak to thinning and burning: implications for ecological restoration. Flagstaff, AZ: Northern Arizona University. 129 p. Dissertation. [40612]
  • 314. Pauley, George R.; Peek, James M.; Zager, Peter. 1993. Predicting white-tailed deer habitat use in northern Idaho. The Journal of Wildlife Management. 57(4): 904-913. [24403]
  • 319. Pengelly, W. Leslie. 1963. Timberlands and deer in the northern Rockies. Journal of Forestry. 61(10): 734-740. [175]
  • 331. Randles, Russell B. 2001. Effects of multiple, low-intensity fires on vegetation and wildlife habitat in Pinus pungens-Pinus rigida stands of the southern Appalachians. Clemson, SC: Clemson University. 48 p. Thesis. [61347]
  • 333. Reid, Vincent H.; Goodrum, Phil D. 1957. The effect of hardwood removal on wildlife. In: Proceedings of the Society of American Foresters meeting; 1957 November 10-13; Syracuse, NY. Washington, DC: Society of American Foresters: 141-147. [10477]
  • 341. Richardson, Calvin; Lionberger, Jim; Miller, Gene. 2008. White-tailed deer management in the Rolling Plains of Texas. Austin, TX: Texas Parks and Wildlife Department. 36 p. [86797]
  • 342. Robbins, Louise E.; Myers, Ronald L. 1992. Seasonal effects of prescribed burning in Florida: a review. Misc. Publ. No. 8. Tallahassee, FL: Tall Timbers Research. 96 p. [21094]
  • 355. Ruthven, Donald C., III; Braden, Anthony W.; Knutson, Haley J.; Gallagher, James F.; Synatzske, David R. 2003. Woody vegetation response to various burning regimes in South Texas. Journal of Range Management. 56(2): 159-166. [47629]
  • 358. Sampson, Arthur W. 1944. Plant succession on burned chaparral lands in northern California. Bull. 65. Berkeley, CA: University of California, College of Agriculture, Agricultural Experiment Station. 144 p. [2050]
  • 361. Scifres, C. J.; Hamilton, W. T. 1993. Prescribed burning for brushland management: The South Texas example. College Station, TX: Texas A&M University Press. 246 p. [51017]
  • 364. Severson, Kieth E.; Kranz, Jeremiah J. 1978. Management of bur oak on deer winter range. Wildlife Society Bulletin. 6(4): 212-216. [82170]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 368. Shepperd, Wayne D.; Battaglia, Michael A. 2002. Ecology, silviculture, and management of Black Hills ponderosa pine. Gen. Tech. Rep. RMRS-GTR-97. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 112 p. [44794]
  • 369. Shrauder, Paul A.; Miller, Howard A. 1969. The effects of prescribed burning on deer food and cover. In: White-tailed deer in the southern forest habitat: Proceedings of a symposium; 1969 March 25-26; Nacogdoches, TX. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experiment Station: 1-16. [17173]
  • 385. Springer, Marlin David. 1977. The influence of prescribed burning on nutrition in white-tailed deer on the coastal plain of Texas. College Station, TX: Texas A&M University. 92 p. Dissertation. [86293]
  • 388. Stark, N. 1980. Light burning and the nutrient value of forage. Res. Note INT-280. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 7 p. [2223]
  • 389. Steiner, Kim C.; Finley, James C.; Gould, Peter J.; Fei, Songlin; McDill, Marc. 2008. Oak regeneration guidelines for the central Appalachians. Northern Journal of Applied Forestry. 25(1): 5-16. [73711]
  • 393. Stewart, Kelley M.; Fulbright, Timothy E.; Drawe, D. Lynn; Bowyer, R. Terry. 2003. Sexual segregation in white-tailed deer: responses to habitat manipulations. Wildlife Society Bulletin. 31(4): 1210-1217. [86428]
  • 394. Stransky, John J.; Harlow, Richard F. 1981. Effects of fire on deer habitat in the Southeast. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings of a symposium; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 135-142. [14820]
  • 403. Taber, Richard D.; Murphy, James L. 1971. Controlled fire in the management of North American deer. In: The scientific management of animal and plant communities for conservation: Proceedings, 11th symposium of the British Ecological Society; 1970 July 7-9; Norwich, Great Britian. Oxford: Blackwell Scientific Publications: 425-435. [16732]
  • 406. Telfer, E. S. 1970. Relationships between logging and big game in eastern Canada. WS Index 2566 (B-1) ODC 31:156. In: 52nd annual meeting of the Woodlands Section, Canadian Pulp and Paper Association; 1970 March 9-12; Montreal, QC. [Montreal, QC]: [Canadian Pulp and Paper Association]: 3-6. [16534]
  • 407. Telfer, E. S. 1974. Logging as a factor in wildlife ecology in the boreal forest. The Forestry Chronicle. 50(5): 186-190. [16537]
  • 408. Telfer, E. S. 1978. Silviculture in the eastern deer yards. The Forestry Chronicle. 54(4): 203-208. [85130]
  • 421. Timmermann, H. R. 1991. Ungulates and aspen management. In: Navratil, S.; Chapman, P. B., eds. Aspen management for the 21st century: Proceedings of a symposium; 1990 November 20-21; Edmonton, AB. Edmonton, AB: Forestry Canada, Northwest Region, Northern Forestry Centre; Poplar Council of Canada: 99-110. [18550]
  • 424. Troester, Herbert G. 1970. Managed prairie burning for wildlife. North Dakota Outdoors. 32(11): 7-9. [14898]
  • 428. Van Lear, David H.; Waldrop, Thomas A. 1991. Prescribed burning for regeneration. In: Duryea, M. L.; Dougherty, P. M., eds. Forest regeneration manual. The Netherlands: Kluwer Academic Publishers: 235-250. [23045]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]
  • 435. Verme, Louis J.; Johnston, William F. 1986. Regeneration of northern white cedar deeryards in Upper Michigan. The Journal of Wildland Management. 50(2): 307-313. [18683]
  • 457. Williamson, Scott J.; Langley, David E. 1992. Forester's guide to wildlife habitat improvement. 2nd ed. Durham, NH: University of New Hampshire, Cooperative Extension. 56 p. [73376]
  • 460. Windels, Steve K.; Flaspohler, David J. 2011. The ecology of Canada yew (Taxus canadensis Marsh.): a review. Botany. 89(1): 1-17. [84283]
  • 467. Wright, Henry A. 1974. Range burning. Journal of Range Management. 27(1): 5-11. [2613]
  • 468. Yantis, James H.; Frentress, Carl D.; Daniel, Walton S.; Veteto, George H. 1983. Deer management in the post oak belt. PWD Bulletin 7000-96. Austin, TX: Texas Parks and Wildlife Department, Wildlife Division. 28 p. [86299]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Regimes

More info for the terms: fire regime, hardwood, mixed-severity fire, stand-replacement fire, surface fire

Historically, white-tailed deer occurred in most habitats of the continental United States except some desert ecosystems of the Southwest (see General Distribution). Thus, they are probably adapted to a wide range of FIRE REGIMES. White-tailed deer occur in habitats with historically short (e.g., longleaf pine/bluestem and southern tallgrass prairie) to long (e.g., bottomland hardwood forest and eastern white pine-northern hardwood) fire-return intervals, and in areas with surface FIRE REGIMES (e.g., Appalachian shortleaf pine, oak-hickory savanna, and pine rocklands), mixed-severity FIRE REGIMES (e.g., Douglas-fir-western hemlock (dry mesic) >and Southeast Gulf Coastal Plain Blackland prairie and woodland), and stand-replacement FIRE REGIMES (e.g., northern hardwoods-spruce, palmetto prairie, and sand pine scrub). The Fire Regime Table summarizes characteristics of FIRE REGIMES for vegetation communities in which white-tailed deer may occur. See Threats for information about how changing FIRE REGIMES affected white-tailed deer populations historically.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inderect Effects of Fire: Other factors: Size and shape of burned areas

More info for the term: cover

Several small fires may be more beneficial to white-tailed deer than one large fire because of increased edge habitat. Large fires may be detrimental to white-tailed deer in the short term by causing initial food shortages and removing cover [30,319]. Kipp [193] noted that the large summer wildfires of 1930 in Wisconsin "caused dangerous concentrations of game" in winter, noting that in the mild winter following the fire, 93 white-tailed deer were observed in a 3-mile² (8 km²) area adjacent to a burned area on the eastern edge of Wood County.

The size and distribution of burns are important to white-tailed deer. In Mexican pinyon stands in Madrean oak-conifer communities of southeastern Arizona, both browse use and the rate of deposition of white-tailed deer pellet groups in burned stands 6.5 years after fire decreased significantly within 1,391 feet (424 m) of habitat edges (P<0.05) [23]. See Southwest woodlands for more information on this study. Size and shape of clearcuts are also important to white-tailed deer (see Size and shape of openings).

  • 23. Barsch, Bob Knight. 1977. Distribution of the Coues deer in pinyon stands after a wildfire. Tucson, AZ: University of Arizona. 52 p. Thesis. [85060]
  • 30. Bendell, J. F. 1974. Effects of fire on birds and mammals. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 73-138. [16447]
  • 193. Kipp, Duane H. 1931. Wild life in a fire. American Forests. 37(6): 323-325. [16774]
  • 319. Pengelly, W. Leslie. 1963. Timberlands and deer in the northern Rockies. Journal of Forestry. 61(10): 734-740. [175]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inderect Effects of Fire: Other factors: Weather and use of burned areas

More info for the terms: cover, forb, tree

In northern regions, snow depth, duration, and hardness influence white-tailed deer use of burned areas [247] (see Cover and foraging habitats). Generally, less snow reaches the ground in unburned forest because of interception by the canopy. Where melting occurs in tree crowns, dripping water further reduces the snow depth. Since temperatures fluctuate less in a forest and winds are reduced, any crust that forms on the snow tends to remain. Snow may persist longer in a forest than on an open burned area because the forest shields the snow from sunlight and insulates the ground. When trees are removed by burning or logging, deeper snow, alternating crusting and thawing, and shorter duration of snow cover may result. Blackened soil on burns may accelerate snowmelt. Deer generally leave a burned area when the snow is soft and deep and live in the surrounding forest where the snow is relatively hard and shallow, even when abundant food occurs on the burned area [30]. However, early snowmelt and green-up on burned areas in spring may benefit deer [30,200].

In arid and semiarid regions, precipitation may affect white-tailed deer use of burned areas. In semiarid rangeland in Uvalde County, Texas, 6 and 10 months after three 100-acre (40 ha) areas were burned under prescription in late September, male and female white-tailed deer did not show a preference for burned areas, possibly because drought had limited vegetation growth on burns. During the 1st postfire summer, grass and forb production decreased and bare ground cover increased in both burned and unburned areas. Male and female white-tailed deer used the burns more than expected only during postfire months 1 and 2 (P≤0.001), after rainfall had triggered a brief flush of grass [275].

  • 30. Bendell, J. F. 1974. Effects of fire on birds and mammals. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 73-138. [16447]
  • 200. Kramp, Betty A.; Patton, David R.; Brady, Ward W. 1983. The effects of fire on wildlife habitat and species. Wildlife Unit Tech. Rep. RUN WILD: Wildlife/habitat relationships. Albuquerque, NM: U.S. Department of Agriculture, Forest Service, Southwestern Region, Wildlife Unit. 29 p. [152]
  • 247. Lyon, L. Jack; Crawford, Hewlette S.; Czuhai, Eugene; Fredriksen, Richard L.; Harlow, Richard F.; Metz, Louis J.; Pearson, Henry A. 1978. Effects of fire on fauna: a state-of-knowledge review--National fire effects workshop; 1978 April 10-14; Denver, CO. Gen. Tech. Rep. WO-6. Washington, DC: U.S. Department of Agriculture, Forest Service. 41 p. [25066]
  • 275. Meek, M. G.; Cooper, S. M.; Owens, M. K.; Cooper, R. M.; Wappel, A. L. 2008. White-tailed deer distribution in response to patch burning on rangeland. Journal of Arid Environments. 72(11): 2026-2033. [71523]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inderect Effects of Fire: Other factors: Physical barriers

More info for the terms: cover, fern, fronds, wildfire

Postfire accumulations of deadfall might discourage use of burned habitats by white-tailed deer, mule deer, and other ungulates by creating impassable areas. Burning may also remove such obstructions in some habitats and allow white-tailed deer and other wildlife to move about and access forage more easily [247,319,324]. Many researchers noted that white-tailed deer cannot feed easily on young plants growing in dense postfire woody debris [235] or logging slash (e.g., [81,85,420]). For example, most of the large pitch pine seedlings that escaped browsing by white-tailed deer during the 2nd postfire winter in the New Jersey Pine Barrens had been protected by dead fronds of western bracken fern or by slash that accumulated following a July wildfire that burned about 3 acres (7 ha) [235]. In contrast, a study on the effects of woody debris on white-tailed deer herbivory in windthrow gaps in a Pennsylvania forest found that the amount and arrangement of woody debris in slash piles did not affect white-tailed deer browsing of plants growing in logging slash. However, logging slash cover was generally <50% [205].
  • 81. Davidson, David; Davidson, Patricia. 2008. Ten years of ecological restoration on a Texas Hill Country site. Ecological Restoration. 26(4): 331-339. [73848]
  • 85. deCalesta, David S. 1990. Impact of prescribed burning on damage to conifers by wildlife. In: Walstad, John D.; Radosevich, Steven R.; Sandberg, David V., eds. Natural and prescribed fire in Pacific Northwest forests. Corvallis, OR: Oregon State University Press: 105-110. [47585]
  • 205. Krueger, Lisa M.; Peterson, Chris J. 2009. Effects of woody debris and ferns on herb-layer vegetation and deer herbivory in a Pennsylvania forest blowdown. Ecoscience. 16(4): 461-469. [86846]
  • 235. Little, Silas; Moorhead, George R.; Somes, Horace A. 1958. Forestry and deer in the pine region of New Jersey. Stn. Pap. No. 109. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 33 p. [11681]
  • 247. Lyon, L. Jack; Crawford, Hewlette S.; Czuhai, Eugene; Fredriksen, Richard L.; Harlow, Richard F.; Metz, Louis J.; Pearson, Henry A. 1978. Effects of fire on fauna: a state-of-knowledge review--National fire effects workshop; 1978 April 10-14; Denver, CO. Gen. Tech. Rep. WO-6. Washington, DC: U.S. Department of Agriculture, Forest Service. 41 p. [25066]
  • 319. Pengelly, W. Leslie. 1963. Timberlands and deer in the northern Rockies. Journal of Forestry. 61(10): 734-740. [175]
  • 324. Phillips, T. A. 1973. The effects of fire on vegetation and wildlife on a lodgepole pine burn in Chamberlain Basin, Idaho. Range Improvement Notes. 18(1): 1-9. [16548]
  • 420. Tilghman, Nancy G. 1989. Impacts of white-tailed deer on forest regeneration in northwestern Pennsylvania. The Journal of Wildlife Management. 53(3): 524-532. [8914]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inderect Effects of Fire: Other factors: Travel patterns

More info for the terms: cover, hardwood, litter, mast, prescribed fire, severity

White-tailed deer movements after fire may be somewhat consistent with prefire movement patterns. For example, white-tailed deer may move out of their home ranges while the ranges burn but return soon after [178,465]. White-tailed deer in central Pennsylvania did not completely leave their home ranges after fire in mixed-oak forests. Two to 10 years after burning they tended to feed more in burned than unburned portions of their home ranges [465]. Following a January prescribed fire in "improved" pastures at the Kerr Wildlife Management Area, white-tailed deer in a 1,065-acre (2,631 ha) enclosure temporarily shifted their home ranges to unburned areas, but then returned when vegetation greened up and generally expanded their use of the burned area due to increased availability of forage [25].

Fire severity may influence white-tailed deer movements during and soon after fire. Two weeks after a prescribed fire in Clarke County, Alabama, 2 radiocollared white-tailed deer showed a strong preference for a burned hardwood/pine forest over a burned pine forest. The hardwood/pine forest, representing 8% to 10% of each home range, had burned incompletely in a mosaic pattern, whereas the pine forest burned almost completely. Use of unburned bottomland sites was similar before and after fire. Visual observations suggested they selected the burned hardwood/pine forest because the fire removed litter and exposed hardwood mast. The deer did not appear to shift their home ranges, which were 69% and 70% burned [178].

The timing of a white-tailed deer's use of a burned area may be influenced by its seasonal movements. Irwin [177] suggested that white-tailed deer populations may not respond immediately to the creation of favorable habitats because yearling females tend to remain with their mothers and yearling males may not disperse until fall. See Movements and home range for more information. Telfer [406] hypothesized that fire or other disturbance that removes cover in a yard may eliminate a local white-tailed deer population because fidelity to yards may cause white-tailed deer to use the yard despite lack of cover, which could lead to high overwinter mortality.

Sex differences in burn use: Habitat use differs according to the sex and age of individuals (Age and sex). Thus, use of burned areas is also likely influenced by these factors. During winter in the central Black Hills, burned ponderosa pine habitats (mostly >40 years old) were selected by both sexes, but male use of burned ponderosa pine forest was nearly 3 times that of does (P< 0.05) [90] (see Black Hills ponderosa pine for more information on this study). On burned and herbicide-treated Cross Timbers and Prairie rangeland in Oklahoma, females preferred burned areas in winter but avoided them in spring and summer, whereas males avoided burned areas in summer and fall. Both sexes used these areas according to availability in other seasons (see South-central US forests) [228].

  • 25. Beechinor, Diane Blanche. 1986. Preburn and postburn activity patterns of the white-tailed deer (Odocoileus virginianus). San Marcos, TX: Southwest Texas State University. 69 p. Thesis. [85122]
  • 90. DePerno, Christopher S.; Jenks, Jonathan A.; Griffin, Stephen L.; Rice, Leslie A.; Higgins, Kenneth F. 2002. White-tailed deer habitats in the central Black Hills. Journal of Range Management. 55(3): 242-252. [86435]
  • 177. Irwin, Larry L. 1985. Foods of moose, Alces alces, and white-tailed deer, Odocoileus virginianus, on a burn in boreal forest. The Canadian Field-Naturalist. 99(2): 240-245. [4513]
  • 178. Ivey, T. L.; Causey, M. K. 1984. Response of white-tailed deer to prescribed fire. Wildlife Society Bulletin. 12(2): 138-141. [8393]
  • 228. Leslie, David M., Jr.; Soper, Roderick B.; Lochmiller, Robert L.; Engle, David M. 1996. Habitat use by white-tailed deer on cross timbers rangeland following brush management. Journal of Range Management. 49(5): 401-406. [86509]
  • 406. Telfer, E. S. 1970. Relationships between logging and big game in eastern Canada. WS Index 2566 (B-1) ODC 31:156. In: 52nd annual meeting of the Woodlands Section, Canadian Pulp and Paper Association; 1970 March 9-12; Montreal, QC. [Montreal, QC]: [Canadian Pulp and Paper Association]: 3-6. [16534]
  • 465. Wood, George W. 1971. Deer feeding capacity reduced by wildfire in central Pennsylvania. Science in Agriculture. 18(4): 10. [34973]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inderect Effects of Fire: Other factors: Livestock presence in burned areas

More info for the terms: competition, forbs

Because burns attract livestock [218,330,413], fire could increase the potential for white-tailed deer-livestock interactions, particularly on relatively small burns. Meek and others [275] suggested that if cattle gathered on small burns, they could possibly displace white-tailed deer from prime feeding areas because white-tailed deer tend to avoid concentrations of cattle. However, the authors suggested that this was unlikely on large burned areas [275].

According to a review, competition between white-tailed deer and cattle on burned areas is likely to be most intense during the time when postfire vegetation is most succulent and accessible [361]. On longleaf pine-bluestem rangelands in central Louisiana, dietary overlap between cattle and tame white-tailed deer was greater on 2- and 3-year-old burns than on 1-year-old burns during all seasons except summer, when it was negligible [412]. White-tailed deer diets from 1-year-old burned sites contained less browse and more forbs than those from 2- and 3-year-old burned sites [411]. For more information, see Livestock grazing.

  • 218. Lay, Daniel W. 1957. Browse quality and the effects of prescribed burning in southern pine forests. Journal of Forestry. 55(5): 342-347. [7633]
  • 275. Meek, M. G.; Cooper, S. M.; Owens, M. K.; Cooper, R. M.; Wappel, A. L. 2008. White-tailed deer distribution in response to patch burning on rangeland. Journal of Arid Environments. 72(11): 2026-2033. [71523]
  • 330. Ramirez-Yanez, Luis Enrique; Ortega-S., J. Alfonso; Brennan, Leonard A.; Rasmussen, George A. 2007. Use of prescribed fire and cattle grazing control guineagrass. In: Masters, Ronald E.; Galley, Krista E. M., eds. Fire in grassland and shrubland ecosystems: Proceedings of the 23rd Tall Timbers fire ecology conference; 2005 October 17-20; Bartlesville, OK. Tallahassee, FL: Tall Timbers Research Station: 240-245. [69928]
  • 361. Scifres, C. J.; Hamilton, W. T. 1993. Prescribed burning for brushland management: The South Texas example. College Station, TX: Texas A&M University Press. 246 p. [51017]
  • 411. Thill, Ronald E.; Martin, Alton, Jr. 1986. Deer and cattle diet overlap on Louisiana pine-bluestem range. The Journal of Wildlife Management. 50(4): 707-713. [86438]
  • 412. Thill, Ronald E.; Martin, Alton, Jr. 1989. Deer and cattle diets on heavily grazed pine-bluestem range. The Journal of Wildlife Management. 53(3): 540-548. [86437]
  • 413. Thill, Ronald E.; Martin, Alton, Jr.; Morris, Hershel F., Jr.; McCune, E. Donice. 1987. Grazing and burning impacts on deer diets on Louisiana pine-bluestem range. The Journal of Wildlife Management. 51(4): 873-880. [2931]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indirect Effects of Fire: Indirect fire effects by region

More info for the terms: bog, cacti, cactus, codominant, cohort, cool-season, cover, crown fire, density, fern, ferns, fire exclusion, fire frequency, fire management, fire regime, fire severity, forb, forbs, frequency, fuel, graminoid, ground fire, hardwood, high-severity fire, liana, lichens, litter, mast, moderate-severity fire, natural, prescribed fire, presence, selection, series, severity, shrub, shrubs, stand-replacement fire, stand-replacing fire, succession, surface fire, swamp, top-kill, tree, vine, vines, warm-season, wildfire

Boreal forest and aspen parkland
Boreal forest: According to a review, deer in boreal forests, including white-tailed deer, are usually associated with early-successional stages of burns. Fire stimulates rapid growth of deciduous shrubs, which increases the food supply for deer. As trees regenerate and their crowns close, the food supply is reduced, resulting in lower deer populations [352]. Stand-replacing fire in boreal forest can greatly increase the production of woody browse for moose [248] and likely for white-tailed deer. Telfer [407] considered boreal forest stands 10 to 25 years after disturbance the most favorable summer habitat for white-tailed deer. The forage benefits of burning to moose, and possibly white-tailed deer, may peak 20 to 25 years after stand-replacing fire and last less than 50 years [248]. (See the FEIS review of moose for more information on fire effects on browse in boreal forests.) However, stand-replacing fires reduce cover and lichens that white-tailed deer may use as forage in winter [248,407]. Lichens may be reduced for up to 50 years after fire in boreal forest. Lichens decline in old stands (≥200 years), indicating that infrequent fires of moderate to high severity may be important for maintaining lichens in the long term [248]. Telfer [407] considered preservation of wintering yards critical in the boreal forest, where climate tends to be marginal for survival of white-tailed deer, and suggested that diverse habitat—where a variety of age and composition classes occur interspersed in small stands—would be optimal for white-tailed deer.

White-tailed deer and moose occur together in boreal forests and may consume many of the same browse species, but fire may affect the 2 species differently. Postfire browse is likely to grow out of reach and become inaccessible to white-tailed deer before becoming inaccessible to moose, and forbs in postfire successional communities tend to be more important to white-tailed deer than to moose [316]. On the Little Sioux Burn, resulting from a 14,600-acre (5,920 ha) May wildfire in balsam fir-paper birch forests of northeastern Minnesota, forbs were important to white-tailed deer, whereas browse comprised almost all of the moose diet during the 2nd postfire summer. White-tailed deer fed mostly on plants 12 to 30 inches (30-76 cm) tall, whereas moose fed mostly on plants 48 to 72 inches (122-183 cm) tall [316]. Irwin [177] thought that the Little Sioux Burn would benefit moose longer than white-tailed deer because the flush of forbs lasted only 2 years after fire, whereas the abundant growth of shrubs and saplings was expected to persist much longer. White-tailed deer appeared less able to use large postfire successional shrubfields as late into the fall as moose because of deep snow and appeared to require substantially greater amounts of cover within their wintering habitats than did moose [175]. For more information on white-tailed deer use of the Little Sioux Burn, see Great Lakes forests.

Historical increases in white-tailed deer populations in British Columbia were attributed to logging and extensive fires at low elevations in the mid-1930s that increased deciduous growth and thus white-tailed deer forage quantity and quality [461]. In some areas fire exclusion has resulted in large stands of even-aged conifer forests that are generally unproductive for white-tailed deer. For example, the potential big game winter range in southeastern British Columbia was reduced by 58% during 40 years of fire exclusion (Langin and Demarchi 1977 cited in [461]). In areas with extensive, contiguous tracts of mature forest, small forest openings created by fire, logging, or other disturbances benefit white-tailed deer [461]. However, large (several km²) clearings in quaking aspen or mixed forests are considered "disastrous" for white-tailed deer in this region [461].

Stand-replacing fire in boreal forest often increases the nutritional content of woody browse for up to 3 postfire growing seasons [248]. White-tailed deer browse species may be more nutritious in early than late succession [352].

Aspen parkland: In western Canada the quaking aspen parklands and boreal forests with abundant quaking aspen provide "prime" white-tailed deer habitat [421,461]. A review stated that using prescribed fire in quaking aspen parklands may benefit white-tailed deer and mule deer by: 1) top-killing woody plants that can sprout after fire, 2) providing a seedbed for establishment of forage species, and 3) increasing the nutrient level and digestibility of browse and herbs the first 2 years after burning [16]. Fire reduces the spread of quaking aspen and common snowberry into grasslands, which may be detrimental to white-tailed deer, but it allows quaking aspen to expand into conifer forests, which is likely beneficial [461]. For more information about white-tailed deer use of aspen communities, see Great Lakes forests.

Pacific Northwest
In presettlement times, fires set by American Indians maintained many of the oak woodlands preferred by Columbian white-tailed deer. Fire exclusion and agricultural and residential development during the 1900s reduced available habitats [380,410]. Some evidence indicates that fire in oak woodlands may maintain palatable forage for Columbian white-tailed deer [128].

Southwest Southwest grasslands
Fires may improve the palatability of plants to white-tailed deer in southwestern grasslands. Old growth of tobosa (Pleuraphis mutica), big sacaton (Sporobolus wrightii), and Johnson grass (Sorghum halepense) is relatively coarse and unpalatable to white-tailed deer, mule deer, and other ungulates, but their postfire new growth is succulent and readily eaten [438]. For more information, see FEIS reviews of species of interest.

White-tailed deer are infrequent visitors to desert grasslands but may use adjacent wooded areas [365]. Fires at the grassland-woodland ecotone may remove woody vegetation without increasing ground cover [248], which may be detrimental to white-tailed deer.

Southwest shrublands
Succulents: Fires may improve the palatability of succulents. Fires burn off the spines from cacti (cholla (Cylindropuntia spp.), pricklypear (Opuntia spp.), and barrel cactus (Ferocactus spp.)), making cacti more palatable and/or available as forage [145,226,248,256]. In grazed southwestern shrubsteppe near Tucson, Arizona, deer were attracted "almost immediately" to an area that was burned under prescription in November, partly because of the attractiveness of pricklypear. Deer and other animals consumed nearly all pricklypears from which spines were burned "within a few weeks" [256]. In thorn scrub in the Texas savanna, white-tailed deer ate the scorched pads of Engelmann's pricklypear (O. engelmannii) soon after a fire that removed the thorns [232].

Mesquite: Mesquite (Prosopis spp.) shrublands are an important habitat for white-tailed deer in the Southwest, and fires that reduce large areas of mesquite may reduce fruit and browse production and cover. However, mosaic fires in dense mesquite stands may increase white-tailed deer forage [365].

Arizona chaparral: White-tailed deer and mule deer are common in Arizona chaparral [158,365]. Because most shrubs dominant in this habitat sprout and/or germinate from seeds soon after fire, fire in this habitat may increase forage [51,158]. Forbs and grasses develop rapidly after fire in Arizona chaparral and are generally abundant for 3 or 4 postfire years, followed by an abrupt drop to prefire levels in 2 to 3 more years, with forbs dropping out more rapidly than grasses. The decrease in herbs is associated with an increase in shrubs. Shrubs generally recover rapidly and dominate the site in about 5 years, regaining prefire values approximately 11 years after fire [365]. In Arizona chaparral in the Mingus Mountain area, forb production peaked at about 281 pounds/acre in the 3rd postfire growing season after an 18,000-acre (7,300 ha) June wildfire, while grasses peaked at 213 pounds/acre in the 5th postfire growing season. Shrub cover and biomass were still increasing 6 years after the fire, when the study ended [309]. On the Three Bar Wildlife Area, Arizona, forb and grass production was about 217 to 325 pounds/acre in the 5th and 6th postfire growing seasons and 109 to 110 pounds/acre in the 7th and 10th postfire growing seasons [158]. In Arizona chaparral that was seeded with nonnative weeping lovegrass (Eragrostis curvula) following a severe prescribed fire, shrub growth in the burned area was fastest the first 2 years after fire and by postfire year 5, shrub density was equal to that on the unburned control [51].

Burning may increase the nutritional content of mule deer browse, and likely white-tailed deer browse, in Arizona chaparral. Protein content of mule deer browse in recently burned areas in 3 regions of Arizona was generally higher than that in unburned areas but declined over time. Protein content of plants on a 9-month-old and a 3-year-old burned site was similar to that on adjacent, unburned sites, indicating that the effects of burning on plant nutritive quality were short lived. Browse use by mule deer was much greater on burned than unburned sites [402]. See the FEIS review of mule deer for more information.

Gambel oak: Gambel oak provides shelter, forage, and mast for white-tailed deer and other wildlife [65,112]. In the northern portion of Gambel oak range, mature Gambel oak stands often have little forage within reach of deer, whereas young stands of Gambel oak may be "nearly impenetrable" to deer [65]. Gambel oak sprouts after fire, and fire in Gambel oak communities may result in abundant, succulent browse for mule deer [208,210] and likely white-tailed deer. On the Uinta National Forest, Utah, examination of Gambel oak stands that had been burned 3 and 15 years prior to the study indicated that burned stands recovered to unburned control heights in 6 to 35 years, with stands at low elevations recovering faster than stands at high elevations (r=0.99, P<0.01) [210]. See the FEIS reviews of Gambel oak and mule deer for more information.

Southwest woodlands
Madrean encinal oak and Madrean oak-conifer: White-tailed deer may be attracted to burned Madrean oak-conifer communities because of abundant browse there. In a Mexican pinyon-oak woodland in southeastern Arizona, white-tailed deer deposited 7.2 times more fecal pellets in summer and fall in burned than in unburned stands 6.5 years after a wildfire. The fire was "intense" and burned 18,000 acres (7,285 ha) in the Whetstone Mountains in June. White-tailed deer were apparently attracted to the relatively more abundant browse in burned areas. Browsing was 2.5 times greater on a burned stand—where browse cover was 20 times greater—than on unburned stands [23]. In contrast, white-tailed deer fecal counts were similar before and 1 year after prescribed fires in encinal oak savannas of the Southwestern Borderlands of Arizona and New Mexico [111]. Warm-season (May) and cool-season (November-April) prescribed fires were conducted in 12 watersheds (range: 20-60 acres (8-24 ha) for a total of 451 acres (183 ha)) on the eastern side of the Peloncillo Mountains in southwestern New Mexico [112]. Fecal pellet counts [111] and browse utilization [112] were similar among burned sites. The authors stated that the lack of a difference between burned and unburned areas was "not surprising given that all fires were of low severity" and the fact that the forest overstory structure and production of herbs and shrubs were similar before and after the fires [111].

In burned Madrean oak-conifer communities, white-tailed deer may concentrate their use near water. For example, in Mexican pinyon-oak woodlands of southeastern Arizona, white-tailed deer pellet groups accumulated twice as fast on an area burned by a severe June wildfire that was near (980 feet (300 m)) permanent water than on a burned area that was far (3,940 feet (1,200 m)) from permanent water [23].

Pinyon and juniper: See South-central US woodlands.

Southwest forests
Ponderosa pine: Fire in ponderosa pine stands may benefit white-tailed deer by increasing forage nutritional quality [363,365]. Fire generally increases nutrient availability and concentrations in ponderosa pine forests for at least the 1st postfire growing season [363]. A study in Arizona ponderosa pine found that in the 1st growing season after fire, crude protein, phosphorus, and in vitro digestible dry matter were higher in ungulate forage from areas burned in a severe May wildfire than in adjacent unburned controls. Increases in phosphorus and digestible dry matter lasted to the 2nd postfire year, but increases in protein did not. By the end of the 2nd growing season, however, there were no differences in nutritional content of ungulate forage between burned and unburned areas [315].

White-tailed deer use of ponderosa pine stands may increase after fire in response to increased forage production and edge. Deer use of a ponderosa pine forest near Flagstaff, Arizona, that had been burned in a high-severity May wildfire increased for the first 2 years after fire. Use became "inconsistent" during the 3rd postfire year, possibly due to reinstated cattle grazing on the burned area [206]. In a recently logged ponderosa pine forest on the Coconino National Forest, Arizona, that burned in a May wildfire, deer pellet densities were higher in a moderate-severity burned area during postfire summers 1 to 3 than in an unburned control. However, pellet group densities were higher in the control than in a high-severity burned area during postfire summers 1 and 2. During postfire summer 3, pellet group densities were higher in the high-severity burned area than in the control (Table 1). The result was attributed to the production of palatable herbaceous species on burned areas. Herbaceous plant production was similar on all sites during the 1st postfire summer (range: 452-582 pounds/acre). During the 3rd postfire summer, however, production averaged 1,651 pounds/acre on the high-severity burned area, 1,275 pounds/acre on the moderate-severity burned area, and only 559 pounds/acre on the unburned control [54].

Table 1. Mean deer pellet groups/acre in a logged and burned ponderosa pine forest on the Coconino National Forest, Arizona, 1 to 3 summers after wildfire [54]
Summers since fire Moderate-severity fire High-severity fire Unburned control
1 1,001 257 672
2 398 191 267
3 363 262 116

Although total biomass of grasses and forbs often increases in ponderosa pine forest after fire, the quantity of useable deer forage may actually be less on burned areas if species composition shifts to relatively unpalatable species [248]. Prescribed understory burning in ponderosa pine stands near Flagstaff, Arizona, failed to improve herbaceous forage production for deer. Although herbaceous plant production increased dramatically during the 1st postfire year, nonnative common mullein (Verbascum thapsus), an unpalatable species, dominated the understory [113]. For more information about white-tailed deer use of ponderosa pine habitats, see Black Hills ponderosa pine. See also FEIS reviews of Arizona pine and interior ponderosa pine.

Rocky Mountains
Lyon [246] provided a generalized description of white-tailed deer and mule deer response to postfire succession in forests in the northern Rocky Mountains: Immediately following a severe fire, the landscape may appear barren and provide little forage for deer. As early as the 1st growing season after fire, some woody seedlings may appear, and plants not killed by fire may sprout. In the first few postfire years, forbs and grasses dominate the area, and shrub cover increases. As shrub cover increases, forbs and grasses decrease. If the shrubs are palatable to deer, they can provide abundant forage. Shrub dominance may continue for 10 to 100 years, but shrubs are eventually displaced by trees. In mature forests, understory vegetation is typically sparse and provides little forage for deer [246]. Plant succession on large, severely burned areas may be slow compared with that on small burns because of low plant survival in burned areas and remoteness of seed sources [246,290]. Reviews stated that the positive effects of fire on deer forage generally last <30 years [248,319], although white-tailed deer use burns of a variety of ages. In grand fir and western redcedar forests in Idaho, trees established and shrubs grew out of reach of white-tailed deer about 25 years after fire. Although young burns (<25 years old) had the greatest browse cover among 2- to >150-year-old burned areas (both wild and prescribed fires), white-tailed pellet group counts were highest on >60-year-old burns with high tree and shrub cover [134].

White-tailed deer used postfire shrubfields only rarely in Glacier National Park, appearing to prefer forested habitats [257]. In enclosures in the Hatter Creek drainage in northern Idaho, white-tailed deer pellet group counts were significantly higher on burned than adjacent unburned sites (PTable 2). The enclosures were within a Douglas-fir/mallow ninebark (Physocarpus malvaceus) winter rangeland that had been spring- or fall-burned under prescription 6 to 12 months prior. Before the prescribed fires, no "recent" fires had been recorded [15].

Table 2. White-tailed deer pellet group densities 6 and 12 months after spring and fall prescribed fires in Douglas-fir/mallow ninebark habitat in northern Idaho [15]
Time since fire Pellet groups/acre
Burned area Unburned control
6 months after a spring prescribed fire* 345 65
12 months after a fall prescribed fire* 438 100
*Sites sampled in October. Sites were not cleared of pellets prior to sampling.

Snow depth affects white-tailed deer use of postfire successional communities. In Idaho, white-tailed deer foraged primarily in unburned habitats because of deep snow. In the Selway-Bitterroot Wilderness, the Snake Creek and Fritz Creek mixed-severity, August wildfires burned 2,700 acres (1,100 ha) of white-tailed deer and mule deer winter rangelands. Based on proportion of use versus availability during the 3rd postfire winter, which was mild, white-tailed deer preferred unburned Douglas-fir/mallow ninebark habitat from January to March, except in February. Then, they preferred unburned bluebunch wheatgrass/bluegrass (Pseudoroegneria spicata/Poa spp.) habitat, which was the only habitat free of snow at that time. During the other winter months, snow was shallower in the Douglas-fir/mallow ninebark and other forested habitats than in the bluebunch wheatgrass/bluegrass habitat. White-tailed deer used unburned ponderosa pine/bluebunch wheatgrass and burned Douglas-fir/mallow ninebark habitats in proportion to their availability. Use of these habitats might have been due to their close proximity to the unburned Douglas-fir/mallow ninebark habitat. White-tailed deer preferred sites that had the shortest average distance to cover. The average distance to cover in unburned Douglas-fir/ninebark habitat was only 5 feet (1.5 m) [187].

Fire that removes too much snow-interception and hiding cover may be detrimental to white-tailed deer in areas with deep snow. On the North Fork of the Flathead River in Montana, white-tailed deer yard during deep snow periods. The winter after the 1910 wildfire that consumed >50% of the vegetation in the North Fork Yard, 70% of the white-tailed deer died of starvation [224]. The winter and spring after the August Moose Creek Fire, deer pellet group counts were "negligible". In summer, pellet group counts were substantially reduced compared with prefire counts. Prefire cover in and adjacent to the burned area was limited due to previous logging and the natural sparseness of the forest. The fire removed much of the remaining cover, and only one "sizeable" patch of cover remained. The author noted that despite road closures, hunting pressure on deer using the burn during the fall immediately after the fire was high. The fire was of mixed severity, in a mosaic of curlleaf mountain-mahogany (Cercocarpus ledifolius)/bluebunch wheatgrass, bluebunch wheatgrass-needle-and-thread grass (Hesperostipa comata), spiny grease bush (Glossopetalon spinescens), mountain big sagebrush (Artemisia tridentata subsp. vaseyana), ponderosa pine, and Douglas-fir communities on the Salmon National Forest, Idaho [68].

Although fire in an area with limited cover may be detrimental, small burns in areas of abundant cover may benefit white-tailed deer by increasing understory forage [319]. Peek [317] stated that when mature forests are burned or cut, white-tailed deer may shift to adjacent areas during the severest times of winter; otherwise, they prefer the seral growth on the burned or cut areas, which is likely to provide excellent forage.

Fire in Rocky Mountain forests may increase forage quantity, quality, and palatability. Pengelly [319] showed that burning of slash yielded an initial decrease and later a large increase in the amount of palatable big game forage in Douglas-fir and grand fir habitats in northern Idaho. Although the ratio of good:poor browse 1 year after wildfire in logged grand fir stands was similar to unburned controls, species composition was very different [319]. This suggested diet quality for white-tailed deer might be improved by increasing species richness across the landscape. In western redcedar forests in northern Idaho, shrub biomass production was nearly 60 times higher on a 30-year-old burn than on a 100-year-old stand (Table 3) [176]. In the Selway-Bitterroot Wilderness, Idaho, following the Snake Creek and Fritz Creek mixed-severity wildfires in August, relatively unpalatable species such as mallow ninebark were eaten more frequently on burned sites than on unburned sites, suggesting that burning increased their palatability [187]. In Hatter Creek drainage in northern Idaho, 6 to 12 months after spring and fall prescribed fires on winter rangelands in Douglas-fir/mallow ninebark habitat, plant species such as thimbleberry (Rubus parviflorus), mallow ninebark, oceanspray (Holodiscus discolor), Lewis' mockorange (Philadelphus lewisii), and western bracken fern (Pteridium aquilinum), which are normally avoided by white-tailed deer, were readily eaten during the 1st postfire growing season [15]. Gordon [133] speculated that slashing (complete overstory removal) and early-spring (prior to plant growth) prescribed fire on 40 acres (16 ha) of winter rangelands in the Absaroka Range in Montana was beneficial to white-tailed deer because it increased the availability of quaking aspen browse. The rangelands were comprised of mature quaking aspen-Engelmann spruce (Picea engelmannii) forest, Douglas-fir/mallow ninebark forest, and hawthorn shrublands. Two years after the fire, density of quaking aspen and willows had increased due to sprouting. Prior to treatment, quaking aspen was too tall for white-tailed deer and moose to reach; after treatment, it was low and could be utilized [133]. For more information on white-tailed deer use of aspen forests, see Great Lakes forests.

Table 3. Shrub biomass production in different-aged forests within the western redcedar-western hemlock ecosystem of northern Idaho [176]
Site description Mean biomass production
(kg/ha)
30-year-old burn in western redcedar/Oregon boxwood (Paxistima myrsinites) habitat 19,475
100-year-old undisturbed western redcedar-western hemlock habitat 331

Postlogging site preparation practices in Rocky Mountain forests often include prescribed fire. Burning slash often favors the establishment of seral shrubs, many of which are preferred white-tailed deer browse species. Limited evidence suggested that removal of slash by broadcast burning rather than pile burning resulted in "heavier initial stands of preferred white-tailed deer forage" [319].

Northern Great Plains Northern Great Plains grasslands
In Northern Great Plains grasslands white-tailed deer often use recently burned areas more than unburned areas. For example, the number of white-tailed deer fawns was greater on burned than unburned grasslands the 2nd summer following a late May prescribed fire in east-central North Dakota on the Woodworth Study Area in the midgrass prairie vegetation zone. No fawns were found on an unburned 124-acre (50 ha) area, compared to 4 fawns each during the 2nd growing season on nearby burned areas of 135 acres (55 ha) and 121 acres (49 ha) [195]. At the Crescent Lake National Wildlife Refuge in the Nebraska Sandhills, white-tailed deer were found closer to burned areas than to random points. Six areas, from 20 to 700 acres (8-283 ha), were burned under prescription in April. All of the burns were in native sandreed (Calamovilfa spp.)-bluestem grasslands. Three burns were in grasslands that were either subirrigated or seasonally flooded. Although concealment cover was reduced in May and June following the fire, it returned to prefire levels by July. Results indicated that prescribed burning did not negatively affect white-tailed deer [223]. In contrast, in another study in Nebraska Sandhills prairie, white-tailed deer used burned areas about 8% of the time during the year of the fire and about 5% the following year, suggesting that use declined. However, no data on control or prefire use were provided [462].

Spring prescribed burning at the ecotone of prairie and quaking aspen parkland may reduce woody plant establishment in prairie habitat [401], which may be detrimental to white-tailed deer by removing cover. Spring burning may benefit white-tailed deer, however, by "rejuvenating" certain prairie species such as purple prairie clover (Dalea purpurea) and native warm-season grasses such as big bluestem (Andropogon gerardii) [401].

Fire often increases the percentage of protein and minerals in prairie grasses and shrubs important to white-tailed deer, although effects vary with season of burning [248]. However, repeated annual prescribed fires in April had no effect on white-tailed deer browsing rates of Jersey tea (Ceanothus herbaceus) in tallgrass prairie at the Konza Prairie Research Natural Area, Kansas. The authors concluded that because white-tailed deer browse Jersey tea most in fall and winter, any differences in plant quality on burned areas might have been diminished by the time of use [418]. The effects of fire on grassland nutrients may interact with the effects of grazing. Cattle-grazed patches in a tallgrass prairie in eastern Kansas contained less biomass than ungrazed patches and therefore lost less nitrogen to volatilization by fire. The authors suggested that grazing may control whether burning results in net increases or decreases in nitrogen on a site. Grazing also increases heterogeneity in grasslands, contributing to patchy fuels and thus variation in fire behavior and severity. Patches that are intensely grazed fail to burn as a result of insufficient fuel, while accumulated fuels in ungrazed patches increase fire severity [161].

Figure 3. White-tailed deer feeding in native prairie after the Headquarters West prescribed fire in Wind Cave National Park, South Dakota. Photo courtesy of Charlie Barker, Wind Cave National Park.

Northern Great Plains woodlands and forests
Black Hills ponderosa pine: Wintering white-tailed deer may avoid recently burned ponderosa pine habitats. For example, in ponderosa pine forests in the southern Black Hills, male and female white-tailed deer selected unburned habitat and avoided burned areas the 1st winter after the 2000 Jasper Fire, a 83,500-acre (334,800 ha), mixed-severity August through September wildfire. The fire created a mosaic of burned and unburned patches that increased diversity and quality of forage considered favorable to white-tailed deer. However, in winter, males and females selected unburned ponderosa pine habitats with >40% canopy cover and a grass-forb understory and avoided burned ponderosa pine and ponderosa pine/curlleaf mountain-mahogany/Rocky Mountain juniper habitats. When winter locations of female white-tailed deer in burned and unburned areas were pooled, the author found most foraging locations were in unburned areas (80.8%), 8.6% were in severely surface-burned areas, 7.5% were in lightly burned areas, and 3.2% were in areas burned in a crown fire. Most bedding locations were also in unburned areas (86.5%), whereas only 6.2% were in severely surface-burned areas, 4.5% were in lightly burned areas, and 2.8% were burned in a crown fire. He suggested that selection for unburned habitat was related to the relative lack of cover and forage in burned areas compared with unburned areas. He stated that because the fire occurred at the end of the growing season and white-tailed deer were monitored only during the 1st winter and spring after the fire, "it was likely too soon for any beneficial effects on available habitats to be realized" [102].

In the short term, fire may reduce fawning habitat in Black Hills ponderosa pine forests. High fawn mortality rates during the 1st postfire summer after the 2000 Jasper Fire were attributed to the loss of fawning habitat (Schmitz personal communication cited in [102]).

Fire in Black Hills ponderosa pine habitats may increase nutritional quality of white-tailed deer forage, which may result in better white-tailed deer body condition in the first few postfire years. Following the 2000 Jasper Fire, nitrogen isotopes in the livers of white-tailed deer were higher on burned than unburned habitat during the 2nd and 3rd postfire winters and summers, suggesting that white-tailed deer consumed more nutritious forage on burned habitat during both seasons [445].

Although lack of winter and fawning cover during the 1st postfire year may be detrimental to white-tailed deer, fire may be beneficial in the long term. In the Black Hills, male and female white-tailed deer selected burned habitats on winter rangelands but not summer rangelands, a result attributed to the scarcity of burned habitats on summer rangelands [90].

Lack of fire in ponderosa pine habitats for long periods may be detrimental to white-tailed deer. Several researchers hypothesized that lack of fire and resultant maturing and closing-in of ponderosa pine communities resulted in white-tailed deer population declines in the Black Hills [90,370].

Jack pine: After a May wildfire in a jack pine plantation on the Nebraska National Forest, white-tailed deer used unburned areas 80% of the time and rarely used burned areas [462]. For more information about white-tailed deer use of jack pine forests, see Great Lakes forests.

Riparian areas: In many parts of the Great Plains, white-tailed deer's distribution is limited by a lack of cover, so populations are restricted to riparian areas, wooded draws, and others areas in and adjacent to hardwood cover [279,381,430]. Historically, white-tailed deer occurred in riparian bottomlands in the Great Plains, which burned less frequently than the surrounding landscape [159].

Great Lakes
Great Lakes grasslands
In Wisconsin, small marshes often provide the only winter cover available to white-tailed deer in agricultural landscapes; thus, fire in these habitats in the fall and winter could be detrimental in the short term [436].

Great Lakes forests
Laurentian forest: In the Laurentian mixed-forest region of the Great Lakes and Northeast—a transitional zone between boreal and deciduous forests—quaking aspen and paper birch are 2 of the most important white-tailed deer browse species. Quaking aspen forests in particular are considered "the region's leading white-tailed deer-producing forest type" (Byelich and others 1972 cited in [33]). Both quaking aspen and paper birch usually sprout after fire. According to reviews, paper birch reaches peak browse production 10 to 16 years after stand-replacing fire, whereas quaking aspen production may remain greater than that of unburned stands for >25 years [139,249]. Leaves of young quaking aspen and bigtooth aspen, especially those from sprouts <1 year old, are a preferred white-tailed deer food. Aspen forest understories often have abundant white-tailed deer forage species, including maple, birch, willow, serviceberry, hazelnut (Corylus spp.), cherry, honeysuckle (Lonicera spp.), bush-honeysuckle (Diervilla lonicera), rose, bigleaf aster (Eurybia macrophylla), and strawberry (Fragaria spp.) [139,175,346].

The effects of prescribed fire on quaking aspen stands and fire's resulting effect on white-tailed deer partly depends upon the amount of postfire sprouting. Young quaking aspen trees are more likely to sprout than old trees [365]. See the FEIS review of quaking aspen for more detailed information. Sprout densities typically peak in the 1st and 2nd postfire years, followed by a gradual decline [365]. White-tailed deer browse is typically abundant for 5 to 8 years following fire, after which the leafy crowns typically grow out of reach. Deer and other browsing animals may concentrate in small burned areas or clearcuts to the point where quaking aspen browse is eliminated [312,365] (see Effects of herbivory on vegetation). Thinning quaking aspen stands, rather than burning or clearcutting, may promote herbaceous understory production rather than quaking aspen sprouting [365]. Mature quaking aspen stands may provide better cover for white-tailed deer and mule deer than clearcut stands [421]. See the review by Timmermann [421] on managing quaking aspen for white-tailed deer, mule deer, and other ungulates.

Because fire in Laurentian forests may increase white-tailed deer forage, white-tailed deer use of burned stands often increases after fire. White-tailed deer were using the Little Sioux Burn, which resulted from a 14,600-acre (5,920 ha) May wildfire in logged and unlogged forests of jack pine, quaking aspen, and/or paper birch in northern Minnesota, the 1st month following the fire [316]. Two years after the fire, white-tailed deer used burned quaking aspen-paper birch stands most frequently. These stands had the greatest biomass density following the fire, with abundant quaking aspen and bigtooth aspen sprouts. Burned stands of balsam fir-paper birch, where sprouts of white birch, pin cherry, and beaked hazelnut proliferated, were the 2nd most frequently used stands. White-tailed deer used stands that were logged prior to the fire more frequently than expected, based upon their availability, during all periods of the study except May and November. The study was conducted from April through November. Important herbaceous foods for white-tailed deer, such as grasses, white clover (Trifolium repens), Canada goldenrod (Solidago canadensis), jewelweed (Impatiens capensis), and fireweed (Chamerion angustifolium), were most abundant in these areas. Results indicated that white-tailed deer selected burned areas because of increased forage availability [175]. In Wisconsin, white-tailed deer summer track density was 2.4 times greater on roads in a burned area than on roads in an unburned control area. The burned area was "brush prairie savanna" with abundant sprouting oaks, while the unburned control was a northern pin oak (Quercus ellipsoidalis)-bur oak-jack pine forest. The 20,000-acre (8,100 ha) Grantsburg-Webster Wildfire had occurred 8 years prior, in May. White-tailed deer appeared to be attracted to the burned area because of earlier spring growth and more available and palatable browse [437]. On the Beltrami Island State Forest in northwestern Minnesota, a quaking aspen stand was burned under prescription in early May 4 times during 8 years (1968, 1971, 1973, and 1975). By the 4th fire, the stand had converted to an open shrubland of chokecherry, pin cherry (Prunus pensylvanica), willow, redosier dogwood (Cornus sericea), and dense quaking aspen sprouts. White-tailed deer densities (according to pellet group counts) were declining on the burned area and on an unburned control area for 4 years prior to burning. The study area was first burned in 1968. That year, white-tailed deer densities continued to decline on the burn and the control. In 1969, however, density in the burned area increased to 8 white-tailed deer/km², while white-tailed deer density continued to decline in the control area, reaching a low of 0.8 white-tailed deer/km². White-tailed deer density in the burn peaked at 18 white-tailed/km² in 1972, 1 year after the 2nd burn, and then declined gradually to 5.0 white-tailed deer/km² in 1978, 3 years after the 4th burn. White-tailed deer density fluctuated in the unburned control area during the study but was always less than that on the burned area. The increase in white-tailed deer density after the 1st and 2nd fires was attributed to increased habitat quality, while the subsequent decrease was attributed to reduced winter habitat (i.e., increased openness, lack of conifer cover, and snow drifts) [31,32]. Four and 5 years after the 4th burn, densities fluctuated but averaged 8 white-tailed deer/km² in the burned area and 5 white-tailed deer/km² in the unburned control [32].

Increased forage following fire may result in increased white-tailed deer populations. In the Kenora District of western Ontario, fires burned an average of 10,000 acres (4,000 ha) annually in the 1930s but only 1,000 acres (400 ha) annually in the 1940s. According to Cringan [74], a white-tailed deer population "erupted" following the fires of the 1930s because the fires resulted in large areas of "choice" feeding habitat, and unburned conifer swamps scattered throughout the burns provided shelter. The population reached peak densities between 1945 and 1950, then "crashed" as forests succeeded [74]. Similarly, around 1900, the white-tailed deer population in Voyageurs National Park in northern Minnesota was about 220 individuals. The population was low because of uncontrolled hunting in the area. From 1910 to 1950, it increased to approximately 3,500 individuals due to logging and fires that opened the forest and resulted in shrub-herb communities and pine (eastern white, red, and jack pine), quaking aspen, and/or paper birch communities. Populations of other ungulates and most carnivores decreased during this time. From 1951 to 1985, the white-tailed deer population declined, but white-tailed deer remained "abundant" or "common". By 1975, the population had declined to 2,600 individuals because of forest succession. By 1983 to 1985, it had declined to approximately 800 individuals because of the combination of succession, increased gray wolf predation, and periodic severe winters [67].

White-tailed deer populations may not increase after fire if cover is insufficient. The 1976 Seney National Wildlife Refuge wildfire increased edge habitats favorable to white-tailed deer. The fire lasted from late July to late September, burning over 64,000 acres (26,000 ha) of mixed hardwood-conifer forest, conifer forest, tamarack-red maple bog, and shrubby bog habitats. The fire "burned patchily and with varying degrees of intensity". However, the refuge had little winter habitat. White-tailed deer populations showed little change during the first 3 postfire years, after which the study ended [9]. White-tailed deer used the Little Sioux Fire area during the 1st and 2nd postfire summers but used the periphery of the burn (i.e., 0.25 mile (0.4 km) from the burn perimeter) and unburned forest during the 1st and 2nd postfire winters (P<0.10). This shift to dense cover in fall and winter was attributed to deep snow in the burned area, which had little forest cover to intercept snow [175].

Increases in some nutrients have been reported after fire in Laurentian Forest, which presumably would benefit white-tailed deer. Levels of potassium, calcium, and magnesium in 18 trees, shrubs, and herbs generally increased during the first 5 years after the Little Sioux Fire and generally exceeded levels on unburned sites. Phosphorus levels on burned sites also exceeded those on unburned sites for the 2nd and 3rd postfire years, and then generally decreased. Nitrogen levels were consistently higher on burned than unburned sites but declined during the first 5 growing seasons after fire [299]. In a 30-year-old quaking aspen stand in southern Ontario, levels of nitrogen, phosphorus, potassium, calcium, and magnesium in quaking aspen leaves were 24% to 42% higher the 1st growing season after "light" April and May surface fires than in an unburned area. Accumulation of nutrients in the trunk, lateral branches, and twigs was generally not different between burned and unburned areas, although the level of potassium in twigs was lower in burned than unburned stands [180].

For information on white-tailed deer use of oak and hickory forests of the southern Great Lakes region, see Southern Appalachians. For information on white-tailed deer use of northern whitecedar, balsam fir, spruce, and other conifer forests, see Northeast forests.

Northeast
Northeast grasslands
Old fields: White-tailed deer commonly use old fields and other forest openings in the Northeast [79,265], and fire in these fields may increase their use. In old fields on the Green Mountain National Forest, Vermont, and in openings maintained along transmission lines in Rochester, New Hampshire, burning at different seasons produced different vegetation responses. White-tailed deer grazed mostly on herbs in burned and unburned openings, and browse was "only taken incidentally or casually". Their use of all burned areas increased during the 1st postfire growing season. Mid-April prescribed fires resulted in the greatest increase in flowering forbs, abundant fruits and sprouts, and a moderate increase in grasses compared with unburned controls. Late May and early June prescribed fires reduced young (<1.0 inch (2.5 cm) diameter and <3.3 feet (1.5 m) tall) trees the most and resulted in the greatest increase in grasses. Fires in all months (April, May, June, August, and October) reduced the frequency of ferns, mosses, shrubs, and bare ground compared with unburned controls. Browse use indicated that white-tailed deer preferred sprouts on May and June burns. Browse preferences of white-tailed deer changed between the 1st and 2nd growing season after burning on these sites. They browsed black cherry, chokecherry, pin cherry, and sugar maple—which are generally not preferred browse—more the 1st postfire growing season than the 2nd postfire growing season [304], suggesting that palatability may have declined. The authors recommended burning every 5 years to maintain openings and prevent tree encroachment. They also recommended creating new openings while letting other openings succeed to paper birch, quaking aspen, and eastern white pine [304].

Northeast shrublands
Hawthorn: Hawthorn is considered an important food for white-tailed deer (see Diet). In McKean County, Pennsylvania, an April, low-severity prescribed fire resulted in 60% top-kill of hawthorn in a riparian zone with dense, 5- to 8-foot (1.5-2.4 m) tall hawthorn and a sparse understory. All top-killed hawthorns sprouted within 9 months of the fire. Based upon a single burn, the author recommended burning hawthorn for white-tailed deer forage and cover every 7 years [49]. For more information on this study, see the Research Project Summary by Smith [375].

Northeast woodlands
Pine Barrens: In the New Jersey Pine Barrens, fire may help maintain white-tailed deer browse in the understory, but burning too frequently may eliminate some important browse species such as bear oak [278]. Shrub and herbaceous cover in New Jersey Pine Barrens was similar in unburned stand and stands where the understory was burned under prescription at 10- and 15-year intervals. As intervals between burns decreased from 5 years to 1 year, however, shrub cover decreased [48]. Burning too frequently may also reduce or eliminate bear oak and other shrubs from the forest understory [278]. Pitch pine seedlings and young sprouts on burned Pine Barrens may be heavily browsed by white-tailed deer in winter [235]. For more information, see Effects of herbivory on vegetation.

Northeast forests
Coastal communities: Severe fire may be detrimental to white-tailed deer in many northeastern coastal communities where coarse, sandy soils typically occur. In these areas, litter and humus layers are reduced by fire and nutrients are quickly leached away, often resulting in slow postfire regeneration consisting primarily of poor-quality white-tailed deer foods [79].

Hardwood forests: Many northeastern hardwood species sprout in the 1st growing season after fire, providing abundant forage for white-tailed deer. However, the benefits may be short term. In Montgomery County, Virginia, in 30- to 100-year-old yellow-poplar (Liriodendron tulipifera)-white oak-northern red oak forests, a May prescribed fire resulted in 2.8 times as much browse the following September (38.9 pounds/acre) as on an unburned control (13.95 pounds/acre, P=0.001) [285]. In oak-hickory-eastern white pine forest in southeastern New Hampshire, white-tailed deer browse use was greater on prescribed burned areas and on areas both thinned and burned under prescription than on untreated areas and those that were thinned only. In most cases, white-tailed deer browsed the treated areas more heavily in summer than winter (Table 4). Browse utilization was greatest in areas with the most open canopies. Because use was less on plots burned 2 growing seasons previously than on plots burned 1 growing season previously, the authors concluded that burning should be done in 1- to 2-year intervals [323]. In a bear oak community in central Pennsylvania, white-tailed deer summer and winter use of bear oak after April prescribed surface fires was greatest on the most recently burned plots and tended to decrease with time since fire. For example, during one summer, browsing on bear oak amounted to 43% of shoots on plots burned the previous spring compared with 26% on plots burned 3 growing seasons previously and 23% on unburned control plots. During another summer, use of shoots on plots burned the previous spring was 57%, whereas use on plots burned 2 or more growing seasons previously and on control plots was ≤25%. Because the average height of bear oak browse was about 5 feet (1.5 m) the 4th growing season after fire, the authors suggested burning every 5 years to maximize white-tailed deer browse [142].

Table 4. Browse utilization by white-tailed deer on 8 forest plots on East Foss Farm, Durham, New Hampshire, for the summer of 1976 and winter of 1977 [323]
Treatment Growing seasons since fire Stems utilized in summer (%) Stems utilized in winter (%)
Untreated control not applicable 1.4 1.4
Prescribed fire in spring of 1973 and 1975* 2 0.7 0
Thinned in 1973 and burned in spring of 1973 and 1975 2 2.9 2.7
Thinned in 1973 only not applicable 2.3 5.3
2 annual spring burns in 1975 and 1976** 1 25.5 4.5
Mixed hardwood stand clearcut in 1975 and slash burned in spring 1976** 1 23.1 13.5
Eastern white pine stand clearcut in 1975 and slash burned in spring 1976** 1 8.9 14.9
*Dense overstory and a closed canopy after treatments.
**Open or no canopy after treatments.

Studies from the Northeast report increased nutrient content of white-tailed deer foods after fire. For example, nutrient contents of bear oak, blueberry, and huckleberry (Gaylussacia spp.) in a bear oak community in central Pennsylvania were examined following low-severity, April prescribed surface fires that top-killed all plants. These species comprised about 90% of the total woody forage available to white-tailed deer. For 4 years, levels of crude protein, calcium, and magnesium in composite samples of foliage and shoots were greater in burned plots than in unburned controls plots [142].

The effect of fire on nutritional quality of white-tailed deer browse may vary with fire severity. A study was conducted at the Patuxent Research Refuge, Maryland, to determine chemical composition and nutritive value of 4 species of plants commonly used as browse by white-tailed deer. The study followed a low-severity spring prescribed fire (1947) and a high-severity wildfire (1949). Data were collected the 1st and 2nd growing seasons after the prescribed fire and the 1st and 3rd growing seasons after the wildfire. Total solids, ash, ether extract, crude fiber and nitrogen-free extract contents of red maple, flowering dogwood (Cornus florida), white oak, and common greenbrier (Smilax rotundifolia) during the 1st postfire growing season were similar between burned and unburned sites. Protein contents of common greenbrier, red maple, and flowering dogwood foliage were higher in the burned area the 1st postfire growing season after the prescribed fire than in the unburned controls, but no effects of burning were apparent in the 2nd postfire growing season. In contrast, protein contents of all 4 species were higher in the burned area the 1st growing season following the wildfire than in the unburned controls, and effects were still apparent in common greenbrier, red maple, and flowering dogwood at the end of the 3rd postfire growing season [91].

For information on quaking aspen forests and mixed forests in the Laurentian Forest zone, see Great Lakes forests. For information on oak and mixed-oak forests, see Southern Appalachians.

Conifer forests: Conifer forests are important for cover in the Northeast and Great Lakes regions. Mature northern whitecedar forests are the preferred forest type for yards in the Northeast and Great lakes regions because they provide cover as well as nutritious browse [94,279]. Atlantic white-cedar forests are also important [234]. Many northern whitecedar and Atlantic white-cedar communities originated from seed sources after fire, but both species are susceptible to injury by fire and are easily killed. See FEIS reviews of northern whitecedar and Atlantic white-cedar for more information. Postfire growth of both species may be hindered by heavy white-tailed deer browsing [233,234] (see Effects of herbivory on vegetation). Mature spruce, eastern hemlock, and balsam fir forests are also used as yards in the Northeast and Great Lakes regions [94,279].

Mature forests provide important cover in winter, while young conifer forests may provide nutritious white-tailed deer forage. On the Moosehorn National Wildlife Refuge in eastern Maine, digestible energy of white-tailed and moose forage available on 15- to 17-year-old plots in balsam fir forest burned in a wildfire was substantially lower than that on 3- to 4-year-old plots in balsam fir forest that were defoliated by eastern spruce budworm, logged, and then burned under prescription [73].

South-central US
South-central US grasslands
Burning of pastures in the south-central United States often increases white-tailed deer use. Within the same month of a prescribed winter fire in nonnative guineagrass (Urochloa maxima) pastures in Willacy County, Texas, white-tailed deer presence was greater in unburned pastures (19 white-tailed deer/3-mile transect) than burned pastures (5 white-tailed deer/3-mile transect, P=0.033). During the next 4 months, white-tailed deer presence in unburned pastures gradually decreased until just 2 white-tailed deer were observed on the transect. The opposite trend was observed in the burned pastures. White-tailed deer use decreased soon after burning, probably because of decreased food resources. One month after burning, white-tailed deer numbers gradually increased in burned areas and decreased in unburned areas, likely due to increased native plant species richness and nutritious regrowth of shrubs in the burned areas. By 4 months after fire, presence increased to 14 white-tailed deer/3-mile transect [330].

South-central US shrublands
Fire's effects on forage and cover plants for white-tailed deer in arid and semiarid shrublands of the south-central United States depends on the species. For example, fire may kill nonsprouting species such as Ashe juniper, whereas shrubs such as honey mesquite may sprout soon after fire [121]. Thus, fire may alter the composition of white-tailed deer forage, which may be beneficial or detrimental to white-tailed deer.

Conflicting results make it difficult to predict the effects of different seasons and frequencies of fire on composition of browse species after fire [121]. Woody plant species composition was unaffected by prescribed burning in a honey mesquite-acacia savanna in the western South Texas Plains, regardless of season (dormant or growing) or frequency of burning (annually or biennial burns during 4 years) [305]. In contrast, Ruthven and others [355] detected declines in abundance of several woody plants following winter and winter-summer prescribed fires in a honey mesquite-spiny hackberry (Celtis ehrenbergiana) woodland. Their study on the Chaparral Wildlife Management Area looked at sites that received 2 dormant-season (November-March) prescribed fires (winter burns); sites that received a combination of 1 dormant-season prescribed fire and 1 growing-season (August) prescribed fire (winter-summer burns); and unburned control sites. In the late spring and early summer (about 17 months after the last winter fire and about 22 months after the last summer fire), total woody plant cover and density were greatest on unburned controls (P<0.001 for both variables). Cover of honey mesquite, twisted acacia (Acacia schaffneri), Texas persimmon (Diospyros texana), lotebush (Ziziphus obtusifolia), and Christmas cactus (Opuntia leptocaulis) was highest on unburned controls. Density of Berlandier wolfberry (Lycium berlandieri), lotebush, desert yaupon (Schaefferia cuneifolia), spiny hackberry, and Christmas cactus was highest on unburned controls. Because woody plants declined after fire, the authors suggested that burning was detrimental to white-tailed deer [355]. A March prescribed fire in an Oklahoma Indiangrass (Sorghastrum nutans) tallgrass prairie with encroaching shrubs appeared to be more severe than a July prescribed fire and thus appeared to be more detrimental to woody plants likely to be used by white-tailed deer. However, both March and July fires reduced woody species. Two woody species (smooth sumac (Rhus glabra) and common persimmon (Diospyros virginiana)) had greater densities 12 to 16 months after March and July fires than before the fires, while the density of 9 species (poison-ivy (Toxicodendron spp.), roughleaf dogwood (Cornus drummondii), black willow (Salix nigra), green ash, winged elm (Ulmus alata), eastern cottonwood (Populus deltoides), eastern redcedar (Juniperus virginiana), black hickory (Carya texana), and post oak) was less after the fires than before. Responses of 2 woody species (Chickasaw plum (Prunus angustifolia) and flameleaf sumac (Rhus copallina)) depended upon season of burning [2]. In honey mesquite-acacia chaparral in the Texas Gulf Prairies and Marshes region, a September prescribed fire damaged woody plants more than December fires did. Some sites were pretreated by shredding, chopping, scalping, root plowing, and/or raking and others were not [36]. One year following a September prescribed fire in mesquite-acacia-bristlegrass (Setaria spp.) shrubland, average shrub cover on all burned plots (12%) was less than that on unburned controls (39%). Some plots were shredded, chopped, or scalped before burning. Frequency of occurrence of lotebush, Berlandier wolfberry, creeping mesquite (Prosopis reptans var. cinerascens), brasil (Condalia obovata), and Texas persimmon was significantly less on burned plots than controls (P<0.05 for all variables) [35].

Forb and grass production are influenced by season of burning. Some researchers reported greatest forb production following early winter fires. In honey mesquite-acacia chaparral in the Texas Gulf Prairies and Marshes region, plots burned under prescription in September had the most grass the following August, whereas December-burned plots had the most forbs. Some sites were pretreated before burning [36]. At the Rob and Bessie Welder Wildlife Foundation Refuge in southern Texas, honey mesquite-mixed grass and bunchgrass-annual forb communities were burned under prescription in mid-December, immediately after the first frost. This resulted in the highest yield of forbs and lowest yield of grasses when compared with mid- and late-winter fires. Late-winter prescribed burns resulted in the lowest yield of forbs and highest yield of grasses. Twenty-two percent of all forb species increased in frequency on burned areas compared with controls, regardless of the timing of burning [147]. Springer [385] concluded that fall burns seemed better suited for white-tailed deer production, noting that herbage production tended to increase more on fall-burned sites than spring-burned sites 1 and 2 years after prescribed fires in "thicketized" live oak savanna on the Texas Coastal Plain. Increased herbage production on fall-burned areas the 1st and 2nd postfire years was primarily due to increased forbs. See the South-central US subsection of Fire Management Considerations for recommendations concerning season of burning in the south-central United States.

Postfire precipitation may affect white-tailed deer use of burned areas. In honey mesquite-spiny hackberry savanna at the Chaparral Wildlife Management Area, Texas, white-tailed deer crossings/km, an index of white-tailed deer movement into and out of treated clearings, did not differ between pretreatment levels and levels of either twice-aerated plots or plots that were aerated and burned under prescription. The authors suggested that the lack of a treatment effect was likely due to below-average rainfall and higher than average temperatures the summer following treatments that resulted in similarly poor plant growth and survival on all plots. Forage biomass, forage nutritional value, tannin content, and cover were similar between treatments. Thus, "there was no reason for white-tailed deer to exhibit preference for either treatment" [345]. Following a March wildfire on the Chaparral Wildlife Management Area, white-tailed deer shifted their diet to accommodate changes in forage availability. The wildfire burned 67,000-acres (27,000 ha) and >90% of the 15,199-acre (6,151 ha) Chaparral Wildlife Management Area. The fire was moderate or high severity over 85% of the area, and "light" severity over 7%; 9% of the area was unburned. White-tailed deer could not move off of the area because of fencing. For 1, 2, and 3 months following the wildfire, female white-tailed deer were harvested in the burned area, and body condition, pregnancy status, and rumen contents were sampled. Despite drier than average conditions prior to the fire and reduced forage abundance immediately after the fire, white-tailed body condition measurements did not change during the first 3 postfire months. This suggested that individuals acquired sufficient nutrients to meet requirements. Fetal development rates also appeared normal. Soon after the fire, white-tailed deer ate Engelmann's pricklypear pads. They consumed emergent grasses and forbs as they became available. Later in spring, they used forbs and browse. About 2 to 3 months after the fire, they shifted to honey mesquite pods and fruits of Texas persimmon and Engelmann's pricklypear. White-tailed deer are "highly adaptable" to changes in habitat, and ample precipitation (4.5 inches (114 mm)) from late April to May probably allowed good postfire vegetation recovery. The authors speculated that had drought conditions persisted through the 1st postfire summer, the wildfire might have been detrimental to white-tailed deer body condition [232].

Increased forage quantity and quality on burned areas may improve white-tailed deer body condition and fawn production. The first year after burning 5,000 acres (2,000 ha) of "thicketized" live oak in the Texas Coastal Plain, "large numbers" of white-tailed deer used the burned areas soon after growth began. Dressed carcass weights of male and female white-tailed deer 1 year after the fire were similar between burned and unburned areas, and there was no significant difference in either mean kidney fat or bone marrow fat content between animals harvested from burned and unburned areas. Thus, general nutritional condition of white-tailed deer was similar between burned and unburned areas. The only difference in body condition or growth attributable to burning was antler size. When antler sizes of 2- and 3-year-old white-tailed deer bucks were examined, antlers of 2-year-olds were longer and wider on burned than unburned areas during the 1st postfire year. Although nutritional condition was similar between burned and unburned areas, white-tailed deer fawn production on the burned area during the 1st postfire year appeared to be greater on the burned area (0.33 fawn/doe) than the unburned area (0.20 fawn/doe). Ovulation rates and fetal counts in utero, however, were not different between burned and unburned areas during the 1st postfire winter [385].

Fire in South-central United States shrublands may reduce important hiding cover. The 1st year after burning "thicketized" live oak savanna in the Texas Coastal Plain, cover was generally reduced compared to prefire levels, although the burn was patchy in some locations. "White-tailed deer in the burned areas seemed much more nervous and sensitive to disturbance by humans and flight would often take them 1.6 km to adequate unburned cover" [385]. The authors speculated that reduced cover in burned areas may have made fawns more vulnerable to coyote and bobcat predation, noting an increase in the amount of coyote and bobcat scats with white-tailed deer fawn hair. The author suggested that care should be taken to not remove too much cover during prescribed fires [385].

The form of woody plants may be changed by burning. For example, on land that has never been disturbed, a large proportion of honey mesquite stems may occur as single-stemmed trees or as shrubs with few stems originating at ground level. Postfire sprouting may result in multiple-stemmed shrubby growth by the end of the 1st growing season. The growth form is usually maintained for the life of the plant. Thus, hiding cover on burned areas may be greater 18 to 24 months after fire than before fire [361].

South-central US woodlands
Pinyon-oak-juniper: White-tailed deer use of burned areas may increase in burned pinyon-oak-juniper woodlands soon after fire. In the Chisos Mountains of southwestern Texas in Mexican pinyon-oak-juniper woodland, Mexican pinyon-juniper grassland, oak shrubland, and finestem needlegrass (Nassella tenuissima) meadows, a March (1980), mixed-severity wildfire occurred after 7 months of drought. White-tailed deer pellet group densities were lowest on the burn soon after the fire, then peaked in March, 12 months after the fire, likely due to increased forage availability and palatability. Soon after the fire, white-tailed deer fed on burned cacti and fallen trees. When rainfall increased in the summer, they fed on herbs. Twenty months after the fire, pellet group densities declined to about 25% of the postfire maximum as forage production "stabilized". On average, pellet group densities 1 to 2 years after the fire were over twice that 6 to 8 years before the fire (P=0.02) [226]. For information on white-tailed deer use of Mexican pinyon-oak woodlands, see Southwest woodlands.

Forbs may be reduced in mechanically treated and burned Ashe juniper communities immediately after treatment. This reduction is usually followed by increased forb production as warm-season forbs germinate [12]. On the YO Ranch in Kerr County, Texas, forb biomass was 5 to 6 times greater in spring and summer 22 months after double-chaining and slash pile burning that removed 80% of trees than on adjacent untreated control stands. The study was conducted during a drought year when livestock grazing was deferred, in Ashe juniper-Texas live oak-sandpaper oak (Quercus virginiana var. fusiformis-Q. vaseyana) woodlands. Important white-tailed deer forages that increased were oaks—primarily sandpaper oak, plantain (Plantago spp.)—and Pennsylvania pellitory (Parietaria pensylvanica) [347].

Although white-tailed deer may increase use of mechanically treated and burned Ashe juniper communities because of increased forage, removal of too much woody cover in these communities may be detrimental. Rollins and others [348] looked at white-tailed deer response to chaining and slash pine burning treatments in Ashe juniper-Texas live oak-sandpaper oak woodlands on the Kerr Wildlife Management Area, Texas, that reduced trees to various densities. Where 80% of trees were removed, white-tailed deer counts declined soon after treatments relative to pretreatment counts. In addition, white-tailed deer used openings on the treated sites less than an untreated site with more cover. In contrast, white-tailed deer counts increased following 50% and 70% removal of trees and continued to increase relative to pretreatment counts over the 2-year study. Mean white-tailed deer densities at these sites equaled or surpassed that of the untreated site. In these areas, open patches were used as much as patches providing cover, indicating that white-tailed deer were well-distributed throughout the treated sites. The author noted, however, that treated sites averaged about 309 acres (125 ha) and cautioned that white-tailed deer's response to larger treatments (for example, covering >2,500 acres (1,000 ha)) may be different. The author also commented that the untreated site maintained a relatively dense white-tailed deer population in good physical condition [348].

The size of the burned area may influence its use. At the Kerr Wildlife Management Area, 4 "improved" pastures with scattered Ashe junipers were burned under prescription in January and February. The pasture with the largest area burned (188 acres (76 ha)) and the greatest mortality of Ashe juniper (49%) also had the highest white-tailed deer density (0.38 white-tailed deer/ha) and the highest mean percent browse utilization (3.7%) the 2nd postfire year. These results were attributed to the generally more diverse habitat, higher mortality of Ashe juniper, large area burned, and extensive sprouting of desirable browse species (e.g., flameleaf sumac, Texas live oak, and netleaf hackberry (Celtis reticulata)). However, mean percent browse utilization was higher on all burns than controls (0.5%). White-tailed deer were thought to be using the burned areas to feed in and the unburned areas for cover. The authors noted no detrimental effects on white-tailed deer or their habitats by the prescribed fires [168]. For more information about white-tailed deer use of burns in the Kerr Wildlife Management Area, see Travel patterns.

A 1991 history of grazing on the Kerr Wildlife Management Area reported that during the early 1930s and 1940s, the area was under a continuous grazing regime, and livestock stocking rates were very heavy. Heavy grazing and fire exclusion led to a dramatic shift in the vegetation, from tallgrass prairie to shortgrass prairie with dense stands of Ashe juniper. With the shift in vegetation, white-tailed deer numbers increased substantially. While white-tailed deer appeared to benefit from the establishment of Ashe juniper in prairie habitats, a "very hot" wildfire in the 1970s that killed many Ashe juniper trees also appeared to benefit them by increasing plant diversity and increasing browse, particularly oaks [116].

Post oak: In post oak (Quercus stellata) woodlands in Texas, fire may reduce the height of vegetation, making it more available to white-tailed deer. In addition, fire may increase mast production of mature post oak trees by thinning stands, which provides individual trees more space, water, nutrients, and sunlight. However, burning post oak woodlands too often may decrease mast production [468].

South-central US forests
Oak, pine-oak, and pine: In the Cross Timbers region of Oklahoma, white-tailed deer may prefer burned areas during the growing season but avoid them in winter due to lack of cover. Leslie and others [228] tracked seasonal habitat use by radiocollared male and female white-tailed deer on upland and bottomland forests. Females selected burned areas in spring, summer, and fall, but males selected them only in summer. Herbicides were sometimes used in combination with burning. Plots were burned under prescription annually (3 times in a row) in spring, and white-tailed deer use of plots was examined 2 to 3 years after the last annual burn and 5 to 6 years after herbicide treatment. The authors suggested that females may have benefitted from nutritional gains obtained by consuming plants growing on treated areas during late gestation (spring), lactation (summer), and prior to breeding (fall). Similarly, male deer on treated areas could have benefitted during antler growth in summer and prior to rut. However, treated areas likely lacked winter cover for both sexes [228]. Previous work in this study area suggested that although herbicide treatments alone improved white-tailed deer browse (e.g., blackberry, coralberry (Symphoricarpos orbiculatus), roughleaf dogwood, elm (Ulmus spp.), greenbrier, hackberry (Celtis spp.), and smooth sumac) quality up to 6 years after treatment, herbicide treatment in combination with prescribed burning did not improve browse quality 2 and 3 years after treatment. The authors suggested that any effects of burning might have been too short lived (<2 years) to produce a detectable difference [383]. White-tailed deer doe carcass weights were 4 pounds (2 kg) heavier on treated than untreated areas (P<0.05). However, no differences between treated and untreated areas were detected in any morphological or reproductive parameter examined. Concentrations of total nitrogen, soluble nitrogen, and acid detergent fiber in postmortem feces of animals indicated better diet quality on treated than untreated areas in fall and winter but no such differences in spring, when white-tailed deer shifted from eating mainly browse to eating mainly forbs. The authors suggested that the diverse habitats created by treatments in the study area increased the nutritional quality of year-round white-tailed deer diets and thus improved white-tailed deer body condition [382].

Prescribed burning in mixed oak-pine forests may increase white-tailed deer forage, but white-tailed deer may select areas with abundant cover over areas with abundant food. Eight types of treatments were applied to post oak-shortleaf pine-blackjack oak forest stands on the Pushmataha Wildlife Management Area, Oklahoma, in low-fertility soils of the Ouachita Mountains [261]:
  • "rough reduction" winter prescribed fire at 4-year intervals to reduce fuel loads
  • selective logging of overstory trees plus annual winter prescribed burning
  • selective logging of overstory trees plus thinning of understory hardwoods
  • selective logging of overstory trees, thinning of understory hardwoods, plus winter prescribed burning at 1-, 2-, 3-, or 4-year intervals
  • selective logging of overstory trees, thinning understory hardwoods, and winter prescribed burning at 3-year intervals
  • selective logging of overstory trees, thinning understory hardwoods, and winter prescribed burning at 2-year intervals
  • selective logging of overstory trees, thinning understory hardwoods, and winter prescribed burning annually
  • clearcutting and site preparation treatments: shearing, raking, windrowing of logging debris, a summer prescribed fire, and planting of "genetically improved" loblolly pine seedlings
Treatments were compared with untreated controls. In general, understory winter burning in thinned stands at 1- or 2-year intervals favored grasses and legumes, particularly during the 1st growing season, while understory winter burning at 3- or 4-year intervals favored a mixture of herbs and shrubs. Overall standing crop of white-tailed deer forage was up to 27 times greater on logged, thinned, and burned sites than controls (4,234 kg/ha vs. 156 kg/ha; P=0.0001). Rough reduction fires increased overall forage standing crop 2.4 times compared to untreated controls (405 kg/ha vs. 171 kg/ha). However, the difference was not significant. The authors recommended prescribed burning at 2- to 4-year intervals on harvested sites to increase growth and availability of important white-tailed deer foods [260]. A subsequent study examined the use of the treated sites by white-tailed deer. Pellet group counts for white-tailed deer did not differ among treatments in either 1988 (4 years after the first treatment) or 1994 (10 years after the first treatment) due to high variability among areas (P=0.11). An outbreak of epizootic hemorrhagic disease in 1993 complicated interpretation of results [261].

Some white-tailed deer forage species increase after fire while others decrease or are unaffected. February prescribed burning combined with various herbicides affected standing biomass of species groups differently in oak-hickory stands at the Cookson Hills Wildlife Management Area in northeastern Oklahoma. Legume, vine, woody, and total understory standing biomass was similar on burned and unburned stands. However, forb and graminoid biomass was greater on burned than unburned stands [415]. In loblolly-shortleaf pine stands and in slash pine plantations of eastern Texas, prescribed fires did not affect overall white-tailed deer browse quantity but did reduce mast. The stand understories were 9 to 12 feet (2.7-3.7 m) tall before the fires and 2 to 6 feet (0.6-1.8 m) tall after. There had been no fire for at least 20 years. Prescribed burns occurred either in spring, late summer, or winter. Initially, overall forage quantity was reduced for 2 years after the fires compared to unburned controls, but browse production was similar to unburned controls by the 3rd postfire year. Herbaceous forage increased for at least 3 years after fire. Yaupon, which white-tailed deer use as forage, decreased after fire but other forages (e.g., American beautyberry (Callicarpa americana), viburnum, herbs) increased. The total number of understory plants with fruit on burned plots was 72% less than on unburned plots by the 2nd postfire year. Although the number of dogwood plants with fruit increased 83%, the number of yaupon, American holly (Ilex opaca), sweetleaf (Symplocos tinctoria), and viburnum plants with fruits decreased (P<0.05 for all variables). Fire's net effect on vegetation during the 3 years of the study was considered an improvement [217]. For more information about southern pine forests, see Southeast forests.

Southern Appalachians
Hardwood forests in the Southern Appalachians and elsewhere are important sources of mast. Hard mast is an important food for white-tailed deer throughout its range, including the Southern Appalachians (see Diet). Oaks are fire-adapted: large oaks that provide acorns have thick bark that helps them survive frequent surface fires, and small-diameter oaks sprout after most fires, providing browse. Soft mast is an important component of white-tailed deer diets seasonally (see Diet). Soft mast production generally peaks 2 to 4 years after burning for most of the approximately 20 species in the Southeast that produce soft mast [248]. Blueberries and blueberry browse may be preferred white-tailed deer forage [70]. A stand-replacement fire in pine and hardwood stands in Virginia greatly increased the production of blueberries the 2nd growing season after burning. Production declined by postfire year 5 but remained higher than that on unburned plots (Coggins and Engle 1971 cited in [248]). Blueberry frequency is influenced by season and frequency of burning. Annual and biennial summer fires for 30 years in loblolly pine forests on the Coastal Plain of South Carolina reduced the numbers of blueberry plants, whereas annual winter burning did not [441].

The biomass of understory herbs and shrubs usually increases after fire in oak forests [248]. Two and 3 growing seasons after late winter-early spring prescribed fires in oak forests in West Virginia, frequency of herbaceous vegetation was greater on plots that had been thinned and then burned under prescription than on an untreated control (P<0.05). The order of treatments may be important: The frequency of herbaceous vegetation was not significantly different between plots that had been burned first, then thinned, and control plots [308]. In upland oak-mixed hardwood forest on the William B. Bankhead National Forest, Alabama, the amount of browse available to white-tailed deer was greater on 2- and 4-year-old logged and burned stands than on a 9-year-old logged but unburned stand. Stands were burned under prescription in fall or spring. Herb cover was 48% on the 2-year-old logged and burned stand and 10% on the 9-year-old logged stand [169]. In closed-canopy upland oak-hickory forests in Chuck Swan State Forest and Wildlife Management Area, Tennessee, repeated low-severity prescribed fires at 2- to 4-year intervals increased forage biomass, and canopy reduction (either shelterwood or retention cut) followed by repeated low-severity prescribed fires produced even greater total forage biomass. The 1st growing season after treatments—the worst drought year on record—the carrying capacity for white-tailed deer was similar across treatments, but the 2nd growing season after treatments—a year of average rainfall—carrying capacity was higher in treated than untreated controls (Table 5). The authors attributed differences between carrying capacities to drought-induced stress on plants [216].

Table 5. Available forage biomass (kg/ha) and nutritional carrying capacity (white-tailed deer days/ha) of selected forage species following silvicultural treatments at Chuck Swan Forest and Wildlife Management Area, Tennessee. In 2007, the study area experienced the worst drought on record [216].
Treatment July-September 2007 July-October 2008
Forage biomass* Carrying capacity Forage biomass* Carrying capacity
Untreated control 150 de** 18 e 103 e 67 d
Prescribed fire*** 212 cd 30 e 337 c 217 c
Shelterwood cut**** 274 c 20 e 259 cd 151 c
Shelterwood**** cut followed by prescribed fire*** 496 bc 20 e 651 ab 452 ab
Retention cut***** followed by prescribed fire*** 591 b 79 e 844 a 591 a
*Included 22 plant species identified in the literature and during the study as white-tailed deer forage species.
**Means with the same letters in a column are not significantly different at P<0.05.
***All prescribed fires were conducted in April.
****Shelterwood cuts included a series of cuts where some trees were left in the overstory to shelter developing understory regeneration. All overstory trees were cut 6 to 8 years after initial harvest.
*****Retention cuts involved removing "undesirable" tree species. Undesirable tree species included red maple, sugar maple, sourwood (Oxydendrum arboreum), and yellow-poplar, while desirable trees included white oak, northern red oak, and American beech for hard mast production and black tupelo (Nyssa sylvatica) and black cherry for soft mast production.

Shaw and others [367] recommended thinning or clearcutting to increase sunlight to the forest floor before burning. They detected a significant decrease in nutritional carrying capacity for white-tailed deer the 1st growing season (July and August) following an April low-severity prescribed fire in a closed-canopy white oak-yellow-poplar stand on the Tennessee Coastal Plain (P=0.02). Simultaneously, there was a significant increase in nutritional carrying capacity in a closed-canopy shortleaf pine-oak stand on the Cumberland Plateau (P=0.04; Table 6) [367].

Table 6. Nutritional carrying capacity (white-tailed deer days/acre) of selected forage species in Tennessee [367]
Treatment Carrying capacity
shortleaf pine-oak white oak-yellow-poplar
Untreated control 2.8 6.9
1 year after prescribed fire 4.6 2.1

Thinning and burning may increase mast production and generally increases forage. Thinning oak stands in central Massachusetts maintained acorn production despite fewer acorn producing trees. During 3 years, mean number of sound acorns ranged from 30,000 to 155,000 acorns/ha for unthinned stands and from 58,000 to 220,000 acorns/ha for thinned stands. Codominant and dominant oak trees were retained during thinning, and there were "immediate" increases in herbage, browse, and cover in the understory relative to unthinned controls [154]. In shortleaf pine-oak forest in the Ouachita Mountains in west-central Arkansas, forage production for white-tailed deer was greater 1 to 3 growing seasons after thinning alone or thinning and burning treatments compared with untreated controls. The 1st treatment consisted of thinning midstory hardwood trees and some codominant pine and hardwood trees. The 2nd treatment included thinning and 1 to 4 dormant-season prescribed burns at 3-year intervals. The most important forage categories for white-tailed deer were preferred woody browse, forbs, and panicgrass (Panicum spp.). The fires increased forb and legume production but initially caused declines in panicgrass standing crop, low-preference woody species standing crop, and total woody species standing crop. Although grass standing crop more than doubled in treated stands, the primary grass species, longleaf woodoats (Chasmanthium sessiliflorum), and several bluestems were rarely used in any season by white-tailed deer. Plant groups contributing to white-tailed deer forage (panicgrass, sedge, forb, legume, and preferred woody species) were increased by thinning 6-fold and by thinning and prescribed fire >7-fold over control stands (434-520 kg/ha in treated stands vs. 69 kg/ha in control stands). Although understory hardwoods were removed during thinning treatments, they were generally <8 inches (20 cm) DBH, and oaks below this diameter contribute little mast production for white-tailed deer. Thus, the authors concluded that increases in forage production through thinning and prescribed fire more than offset the loss of limited mast production by midstory hardwoods, at least in the short term. Further, they stated that forage production is more dependable than mast production. However, they acknowledged that midstory thinning of hardwoods may limit potential future mast production [262]. For more information on this and other studies in shortleaf pine habitats, see Southeast forests.

Fire may temporarily increase forage nutritional quality in oak stands. During the 1st growing season after an April, low-severity prescribed surface fire in a 30-year-old mixed-oak forest in central Wisconsin, the concentration of nitrogen, phosphorus, and potassium in the leaves of red maple, black cherry, northern pin oak (Quercus ellipsoidalis), and Allegheny blackberry (Rubus allegheniensis) generally increased. The level of increase in most plants decreased as the growing season progressed [332].

White-tailed deer often prefer young burns. In upland, closed-canopy oak-hickory forests in Missouri, spring prescribed burns ranged from 150 to 598 acres (61-242 ha). White-tailed deer pellet groups were counted at 0 years (burned in the same year as the study), 2 years, 4 to 5 years, and >15 years since fire. Pellet group abundance differed among burn ages (P<0.05) and seemed to decrease with increasing age [5]. For more information on this study, see Fire effects on white-tailed deer diseases and parasites.

Because white-tailed deer often concentrate in burned communities with oaks, heavy white-tailed deer browsing is often associated with a lack of oak regeneration after fires. On south slopes of 2- to 10-year-old burned areas in mixed-oak forest in central Pennsylvania, white-tailed deer browse production peaked 2 years after fire at 160 pounds/acre and declined by about half every 2 years afterward. The decline was attributed to heavy browsing by white-tailed deer and small mammals that concentrated in the burned areas [465]. For more information, see Effects of herbivory on vegetation.

For information on white-tailed deer use of conifer forests in the Southern Appalachians, see Southeast forests.

Southeast
Southeast grasslands
In Shark Slough in Everglades National Park, Florida, white-tailed deer were more numerous in sawgrass (Cladium jamaicense) stands 2 to 3 months after prescribed fires in January and February, when new sawgrass shoots appeared on the burned area, than before the fires [197].

Southeast shrublands
Pocosin: White-tailed deer may leave burned areas immediately after fire but return soon after. Immediately after a severe, large (45,000-acre (18,200 ha)) wildfire in 1986 in pocosin on the Coastal Plain of North Carolina, white-tailed deer track counts were substantially less than before the fire. Direct mortality was "low" (<10%). The authors suggested that white-tailed deer dispersed from the area during the fire and gradually reoccupied the burned area over the next 6 to15 months. By the 2nd postfire year, track counts had returned to the levels of 1985 [184].

White-tailed deer body condition may improve after fire in pocosin. Johnson and others [184] documented subtle, short-term improvements in white-tailed deer body mass and condition in pocosin habitat after the 45,000-acre wildfire on the Coastal Plain of North Carolina. Limited evidence suggested that body mass and body condition of harvested white-tailed deer increased following the fire, especially in young males. Mean condition indices increased from 1.0 the 2 years prior to the fire to 2.8 the 1st postfire year, then declined to 1.7 the 2nd and 3rd postfire years. The authors attributed the initial increase to the increased use of agricultural crops in surrounding areas and supplemental feed supplied for white-tailed deer after the fire, but they did not discount the possibility that increased quality of vegetation in the burned area may have contributed. White-tailed deer diets in burned and unburned areas were similar, except fruits were absent during the 1st postfire fall and peaked at 40% of the aggregate volume during the 3rd postfire fall, when the study ended. Laurelleaf greenbrier (Smilax laurifolia) berries were the predominant fruit consumed. Crude protein content of important white-tailed deer browse species was higher in samples from burned areas than unburned areas the 1st postfire winter for all species, but it was higher only for holly in summer. Differences were still evident in the 2nd postfire winter and 2nd postfire summer only for swamp cyrilla (Cyrilla racemiflora). Phosphorus levels were higher in burned than unburned areas for all browse examined through the 2nd growing season. A similar trend was apparent for calcium. Digestible dry matter of swamp cyrilla, the only species tested, was higher in burned than unburned areas of the pocosin 4 months after the fire (45% in burned areas vs. 38% in unburned areas) but did not differ between burned and unburned areas 9 months after the fire (45% for both areas) [184]. In contrast, after a 94,654-acre (38,305 ha) wildfire in pocosin in the Pocosin Lakes National Wildlife Refuge, North Carolina, relative densities, harvest totals, percent fawns in the harvest, and selected physical characteristics of white-tailed deer following the fire were not different from before fire even though 20% of the white-tailed deer population was killed by the fire and 20% of the survivors were severely injured (see Direct Fire Effects). However, cohort analysis revealed a 16% decline in the number of animals from the 1st postfire fawn class when compared with classes from the previous 5 years [184,304]. The impact of the fire on white-tailed deer habitat varied in relation to soil characteristics and the severity of the ground fire. Where the fire burned deeply, many of the broad-leaved evergreen shrubs were killed, and many of these sites appeared to be revegetating with grasses and sedges, resulting in an overall loss of soft mast. However, the authors speculated that these losses may be offset temporarily by improvements in fruit and browse quality in areas not burned as deeply [304].

Southeast woodlands
Pine rocklands: Prescribed fire is frequently used in pine rocklands as management for Key deer (e.g., [56,57]). Deterioration of habitat quality due to fire exclusion is thought to be a factor in Key deer population declines [57]. Plants in pine rocklands are well-adapted to and require fire for continued existence (i.e., to prevent establishment of and shading by hardwoods) [56]. Succession of pine rocklands to hardwood hammock communities in the absence of fire occurs in 2 to 3 decades on the mainland of southern Florida but may take twice as long on the drier Keys. Taylor (1980 cited in [56]) stated that historical fire intervals may have averaged only about 8 years in southern Florida pine rocklands. See the Fire Regime Table for information on historical FIRE REGIMES associated with pine rocklands.

Key deer browse nutritional content may increase, decrease, or be unchanged by burning of pine rocklands. At the National Key Deer Wildlife Refuge on Big Pine Key, a study examined the nutritive content of Key deer browse on 3 burned sites: 2 burned in August prescribed fires and 1 burned in a July wildfire. All fires were of high severity, with scorch on South Florida slash pines (Pinus elliottii var. densa) >10 feet (3 m) high. Key deer use of several common plants (redgal, Florida Keys blackbead (Pithecellobium keyense), Everglades greenbrier (Smilax coriacea), South Florida slash pine (<6.6 feet (2 m)), and Long Key locustberry (Byrsonima lucida)) were noted during the 1st postfire year. Crude protein of redgal was generally higher in burned than unburned plots in March, May, July, and November of the 1st postfire year, whereas crude protein of Florida Keys blackbead was similar in burned and unburned plots throughout the 4 sampling periods. The authors concluded that while fire probably provides a short-term, within-year increase in nutritive value of some Key deer browse, arresting succession of pine rocklands to hardwood hammocks may be the greatest benefit of burning to Key deer because it favors herbaceous plants important in the Key deer's diet. The authors concluded that a fire periodicity of 5 to 10 years should accomplish that but maintaining diverse stand ages was also important [56].

A Key deer in an area burned under prescription the previous day on the National Key Deer Refuge on Big Pine Key in Florida. Photo courtesy of Josh O'Connor, US Fish and Wildlife Service.

Southeast forests
White-tailed deer frequent shortleaf, longleaf, loblolly, and slash pine forests of the Southeast and elsewhere. These forests often have understories with hardwood browse and forbs. Prescribed fire in southeastern pine forests can benefit white-tailed deer and other wildlife by increasing sprouting browse; providing seedbeds for legumes and herbs; stimulating germination of seed by increasing light on the forest floor; improving understory cover; increasing nutrient contents of browse; and enhancing palatability of forage. However, most of these effects typically last only 1 to 3 years. Furthermore, very frequent prescribed fire can be detrimental to white-tailed deer and other wildlife in southeastern pine forests by simplifying forest structure. Repeated annual summer burning may reduce understory hardwoods, thus eliminating understory mast-producing plants and allowing sites to be dominated by fire-tolerant forbs and grasses [52,185,276,394].

Many, but not all, studies in southeastern forests have reported an increase in browse and forage production after prescribed burning. Furthermore, browse is often more accessible to white-tailed deer because its height is reduced [52,251]. However, fire generally needs to be repeated to maintain high yields of white-tailed deer forage [251]. Maas and others summarize fire effects on many white-tailed deer forage plants in southeastern forests [251]. Forb production in burned southeastern pine forests generally peaks in 2 or 3 years following fire, while browse production peaks in 5 years. Burning every 3 to 4 years is generally recommended for white-tailed deer [276]. In shortleaf pine-white oak-chestnut oak stands in Catoosa Wildlife Management Area, Tennessee, white-tailed deer browse biomass 4 months after fire was less on an area burned under prescription than on an unburned control area. However, browse biomass was 3.5 and 5.4 times greater on burned areas 16 months and 28 months after prescribed fire, respectively, than on the control area (Table 7). The authors concluded that burning increased browse for white-tailed deer by stimulating sprouting from understory plants, but not until the 2nd postfire growing season [97]. Total white-tailed deer forage in August of the 1st postfire growing season was greater on burned plots and burned and thinned plots than on untreated plots in 8- to 9-year-old loblolly pine plantation in Kemper County, Mississippi (P<0.05; Table 8). Plots were burned in February and thinned in March. Total white-tailed deer forage was also greater on burned and thinned plots than on control plots in August of the 1st postfire growing season. In February, however, total white-tailed deer forage was not different among the plots. The authors suggested burning plantations every 2 years to increase and maintain white-tailed deer forage [171]. Burning and thinning 13-year-old loblolly pine plantations in Kemper County, Mississippi, increased total white-tailed deer forage from the prefire average of 26 kg/ha to 326 kg/ha in August, at the end of the 1st growing season after treatment, and to 429 kg/ha in August at the end of the 2nd growing season. Most white-tailed deer forage in the treated areas was forbs, vines, and lianas. The authors recommended burning every 3rd year to maintain abundant white-tailed deer forage [172].

Table 7. Effects of 3 low-severity March prescribed fires on white-tailed deer browse in shortleaf pine-white oak-chestnut oak forests in Catoosa Wildlife Management Area, Tennessee [97]
Time since fire Browse biomass (pounds/acre)
4 months 127.6
16 months

598.4

28 months 930.6
Unburned control 173.1

Table 8. Mean oven-dry weight (kg/ha) of grasses, forbs, vines, and woody plants on burned, burned and thinned, and control plots in an 8- to 9-year old loblolly pine plantation in Kemper County, Mississippi [171]
Time since fire Month sampled Treatment Control
Burned Burned and thinned
6 months after fire August 649 a* 610 a 128 b
18 months after fire 314 ab 498 a 154 b
Combined 481.5 a 553.8 a 140.8 b
1 year after fire February 75.4 a 60.2 a 45.8 a
2 years after fire 37.7 a 45.9 a 6.5 a
Combined 56.6 a 53.0 a 26.1 b
*Different letters in the same row indicate that means are significantly different at P<0.05.

Not all studies found increased white-tailed deer herbaceous forage after fire. In clearcut longleaf pine sites on the Southlands Experiment Forest in Georgia, mean frequencies of herbaceous food plants (legumes, composites, and grasses) on plots that were clearcut and then May slash-burned were not significantly different from untreated clearcut plots 1 to 3 years after treatments. Mean frequencies of herbaceous food plants on clearcut-and-slash-burned plots and those on plots that were clearcut, slash-burned, then burned under prescription 8 months after slash burning, were also not significantly different. Herbaceous food plants on clearcut-and-slash-burned plots were sampled 16 months after treatments and plots that were clearcut, slash-burned, then burned under prescription were sampled 8 months after treatments [47].

The season and frequency of burning greatly affects vegetation response on southeastern pine forests. According to a review, the "vigor" of sprouts is generally greater following dormant-season than growing-season burns in southeastern pine forests [428]. Understory hardwoods can be eliminated by repeated annual summer burning. According to a review, 3 to 10 annual summer burns will eliminate 80% of the hardwood rootstocks, depending on species. Annual winter burning, even if done for decades, will not kill hardwood rootstocks. Occasional burning in southeastern pine forests often increases the density of hardwood stems in the understory because multiple sprouts replace single top-killed stems. Hardwood species composition is unlikely to be changed by burning rotations of 4 to 6 years because no hardwood species are eliminated and most sprout [428]. Twenty years of low-severity annual June burning in loblolly pine forests at the Santee Fire Plots in South Carolina nearly eliminated understory woody plants, which were replaced by grasses and forbs. Sixteen years of biennial June burning reduced understory hardwood stem (<4.9 inches (12.5 cm) DBH) density but did not eliminate hardwoods from the understory. Periodic summer and December burning resulted in similar woody plant stem densities. Periodic burning was conducted at 3- to 7-year-intervals, when 25% of the understory hardwood stems reached 1 inch (2.5 cm) DBH. Stems >4.9 inches DBH were unaffected by all burning treatments [231,440]. For more information about the timing and frequency of burning in southeastern pine forests, see Fire Management Considerations.

While most burning may lead to a reduction in browse and an increase in forbs and grasses, infrequent burning would likely allow a dense midstory to develop out of the reach of white-tailed deer and would ultimately reduce plant growth underneath [251]. Cain and others [52] suggested that without periodic fire or other techniques for controlling the height of understory woody plants in uneven-aged pine stands, white-tailed deer habitat quality would likely diminish. In shortleaf pine habitats, white-tailed deer occur in all stages of succession either in the absence of fire or with frequent surface fire (1- to 5-year intervals). However, their densities tend to be highest in habitats with relatively frequent fire. At about 8 to 10 years after fire, sapling stems become dense, canopies begin to close, and herbaceous vegetation declines. Unless prescribed fire is used on a least a 3-year late-dormant season cycle, white-tailed deer use declines by postfire year 10. Prescribed fire reduces sapling density and maintains the herbaceous understory. In mid- and late-successional stands, white-tailed deer numbers continue to decline as midstory hardwoods develop and the herb layer declines from litter buildup and shading [259].

Although most burning regimes in southeastern pine forests increase sprouting, they may have variable effects on fruit production. Fruit production of gallberry (Ilex glabra), huckleberry, and blueberry was reduced the 1st year after prescribed burning in 16- to 30-year-old slash pine plantations in Georgia, but it increased markedly by the 3rd postfire year. Total fruit production was greatest in 4-year-old stands, and the number of species fruiting was greatest in 6- to 10-year-old stands [185]. Fruit production of woody shrubs was similar on cut and burned (91 kg/ha) and unburned control (89 kg/ha) loblolly pine-shortleaf pine-hardwood forest plantations in eastern Texas 3 years after burning [395]. Legumes often increase in abundance and seed production following fire [428]. Saw-palmetto is an important understory plant in pine flatwoods. White-tailed deer use it for escape cover [404] and sometimes eat the fruits, particularly during drought years [126]. According to a review, saw-palmetto fruit production may be reduced by half the 1st year after a fire but peaks at 5 postfire years. The authors suggested that prescribed burning for white-tailed deer in pine flatwoods every 3 to 5 years [126]. Caution is warranted in regard to fire frequency. A review by Maehr and Larkin [252] suggested that winter prescribed fires at <3-year intervals in southern Florida flatwoods may disrupt the life cycles of native plants and animals that require >3 years to recover from fire [251]. For more information on fruit production following fire, see Southern Appalachians. See also FEIS reviews of species of interest.

Based on a review of 16 studies of fire effects in Southeastern forests, Stransky and Harlow [394] proposed several generalizations about the effects of fire on plant nutrition. They concluded that winter burns in the Southeast increased forage crude protein and phosphorus content of grasses, forbs, and browse; increased palatability of forage; increased number of woody plant stems; increased cover of grasses, forbs, and legumes; and reduced soft mast production. Most of these effects lasted 3 years or less. Infrequent growing-season burns had similar effects, except that woody stems were reduced. However, frequent growing-season burns would eventually eliminate woody stems and lead to domination by grasses and fire-adapted forbs [394]. While this review provides some useful generalizations, fire's effects on forest understories are quite variable and often short-lived. Two months after winter prescribed burning in longleaf pine-pineland threeawn (Aristida stricta) savanna in North Carolina, plants contained more nitrogen, phosphorus, potassium, calcium, and magnesium than on unburned areas. However, these differences disappeared within months after burning [62]. Forage quality was similar in burned and unburned loblolly pine stands on the Francis Marion National Forest, South Carolina. After a single January prescribed fire, nutrient concentrations were higher on burned plots in the 1st postfire growing season but not in the 2nd or 3rd [464]. A study in Florida sandridge habitat found no substantial differences in plant nutrient levels from 3 to 54 years since fire [1]. Chemical analyses of red maple, sourwood, and sassafras (moderately browsed white-tailed deer forage in the area) following a prescribed fire in shortleaf pine-white oak-chestnut oak stands in Catoosa Wildlife Management Area, Tennessee, showed no significant effects of burning on nutritional quality 3, 6, and 10 months after fire [97].

Carrying capacity for white-tailed deer often increases in burned habitats in southeastern pine forests. Thirteen- to 22-year-old loblolly pine plantations in the Upper Coastal Plain and Lower Coastal Plain of Mississippi were thinned, treated with herbicide, and then burned under prescription 1 to 6 winters later. One and 2 years after burning, plantations were sampled in July for production of white-tailed deer. Prior to treatments, Upper Coastal Plain sites had baseline carrying capacities nearly 8 times greater than Lower Coastal Plain sites. White-tailed deer foraging habitat was improved by treatments in both regions by postfire year 2. Treatments reduced midstory hardwood cover from 25% to 1% in the Upper Coastal Plain and from 59% to 4% in the Lower Coastal Plain (Sladek 2006 cited in [280]), increasing sunlight at ground level. Two years after treatments, white-tailed deer carrying capacity was 3 times greater than controls in the Upper Coastal Plain and 19 times greater than controls in the Lower Coastal Plain, largely due to increased forb species richness, cover, and/or biomass [280]. In 18- to 22-year-old pine plantations in Kemper County, Mississippi, prescribed winter burning during 2000, 2003, and 2006 produced no consistent increases in white-tailed deer forage over 9 years (2000-2008). However, carrying capacity was significantly higher in burned than unburned control plots in years 8 (178 white-tailed deer-days/ha in burned vs. 74 white-tailed deer-days/ha in control plots) and 9 (148 white-tailed deer-days/ha in burned vs. 60 white-tailed deer-days/ha in control plots) [174].

White-tailed deer often use recently burned sites. Four male white-tailed deer in a 58-acre (23 ha) pen in a longleaf pine forest in eastern Texas used an area that was burned under prescription in March twice as much as an adjacent unburned area during the 1st and 2nd postfire years. Use of the burned area increased 60% compared to before treatment. Prior to the fire there were 264 to 272 pounds/acre of browse, and during the first 2 postfire years there were 264 to 332 pounds/acre of browse. Both burned and unburned areas had been logged and burned about 25 years prior to the study [219]. For information on related studies, see South-central US forests. On the Florida Panther National Wildlife Refuge, white-tailed deer apparently were attracted to improved forage in recently burned areas. They were marginally more abundant in a South Florida slash pine flatwood burned under prescription 24 months earlier than in a similar area burned under prescription 48 months earlier (P=0.12). Both fires were in January. The 48-month-old site was burned again, and white-tailed deer abundance was determined <6 months later. White-tailed deer used the <6-month-old burned site more than previously (P=0.02) and at levels similar to their use of the now 30-month-old burned site [254].

Intensive site preparation practices that use prescribed fire are common in southeastern pine plantations. Often prescribed fire is combined with mechanical treatments such as shearing, chopping, raking, and disking (e.g., [46,237]). According to Newsom [294], intensively managed pine plantations in the Coastal Plain generally produce lower yields of white-tailed deer food than mixed pine/hardwood forests. For example, in a 6-year-old loblolly pine plantation on the lower Piedmont of Georgia on the Hitchiti Experimental Forest, plots were sheared and raked into windrows, windrows were burned, and the ash and debris were scattered over the plots and disked into the soil. The June following treatments, grass and forb biomass was greater on treated than untreated control sites; however, liana biomass was less on treatments than controls. Because lianas such Japanese honeysuckle (Lonicera japonica) and greenbrier are highly preferred by white-tailed deer and grasses and forbs are less important, the treatments were considered detrimental to white-tailed deer [237]. Harris and others [152] compared residual effects of 3 site preparations in 9-year-old slash pine stands on the Florida Coastal Plain. The "low-intensity" treatment consisted of clearcutting and broadcast burning. The "medium-intensity" treatment consisted of clearcutting, broadcast burning, and blade and harrow scarification, while the "high-intensity" treatment added bedding to the medium-intensity treatment. White-tailed deer seemed to prefer the low-intensity treatments over the medium- and high-intensity treatments. Grasses and forbs were most abundant following the low-intensity treatment [152]. For more information about the role of prescribed fire in intensive site preparation, see Buckner [46].

For information on hardwood forests of the Southeast, see Southern Appalachians. For more information about southern pine forests, see South-central US forests. Reviews are available about the use of prescribed fire in southeastern pine forests (e.g., [40,238,251]). See also FEIS reviews of species of interest.

  • 49. Burgason, Barry N. 1976. Prescribed burning for management of hawthorn and alder. New York Fish and Game Journal. 23(2): 160-169. [14317]
  • 1. Abrahamson, Warren G.; Abrahamson, Christy R. 1989. Nutritional quality of animal dispersed fruits in Florida sandridge habitats. Bulletin of the Torrey Botanical Club. 116(3): 215-228. [21096]
  • 2. Adams, Dwight E.; Anderson, Roger C.; Collins, Scott L. 1982. Differential response of woody and herbaceous species to summer and winter burning in an Oklahoma grassland. The Southwestern Naturalist. 27(1): 55-61. [6282]
  • 5. Allan, Brian F. 2009. Influence of prescribed burns on the abundance of Amblyomma americanum (Acari: Ixodidae) in the Missouri Ozarks. Journal of Medical Entomology. 46(5): 1030-1036. [86313]
  • 9. Anderson, Stanley H. 1982. Effects of the 1976 Seney National Wildlife Refuge wildfire on wildlife and wildlife habitat. Resource Publication 146. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 28 p. [52897]
  • 12. Armstrong, W. E. 1980. Impact of prescribed burning on wildlife. In: White, Larry D., ed. Prescribed range burning in the Edwards Plateau of Texas: Proceedings of a symposium; 1980 October 23; Junction, TX. College Station, TX: The Texas A&M University System, Texas Agricultural Extension Service: 22-26. [11430]
  • 15. Asherin, Duane A. 1975. Changes in elk use and available browse production on north Idaho winter ranges following prescribed burning. In: Hieb, Susan R., ed. Proceedings, elk logging-roads symposium; 1975 December 16-17; Moscow, ID. Moscow, ID: University of Idaho: 122-134. [17049]
  • 16. Bailey, Arthur W. 1978. Prescribed burning as an important tool for Canadian rangelands. In: McAvoy, S. D. A. M.; Gordon, R. C., co-chairs. Fire and range management; 1978 April; Regina, SK. Regina, SK: Saskatchewan Department of Agriculture: 15-27. [18390]
  • 23. Barsch, Bob Knight. 1977. Distribution of the Coues deer in pinyon stands after a wildfire. Tucson, AZ: University of Arizona. 52 p. Thesis. [85060]
  • 31. Berg, William E. 1979. Wildland habitat development study. Minnesota Wildlife Research Quarterly. 39(3): 97-118. [14258]
  • 32. Berg, William E.; Watt, Philip G. 1986. Prescribed burning for wildlife in northwestern Minnesota. In: Koonce, Andrea L., ed. Prescribed burning in the Midwest: state-of-the-art: Proceedings of a symposium; 1986 March 3-6; Stevens Point, WI. Stevens Point, WI: University of Wisconsin, College of Natural Resources, Fire Science Center: 158-162. [16282]
  • 33. Blouch, Ralph I. 1984. Northern Great Lakes States and Ontario forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 391-410. [14297]
  • 35. Box, Thadis W.; Powell, Jeff; Drawe, D. Lynn. 1967. Influence of fire on South Texas chaparral communities. Ecology. 48(6): 955-961. [499]
  • 36. Box, Thadis W.; White, Richard S. 1969. Fall and winter burning of South Texas brush ranges. Journal of Range Management. 22(6): 373-376. [11438]
  • 40. Brockway, Dale G.; Outcalt, Kenneth W.; Tomczak, Donald J.; Johnson, Everett E. 2005. Restoration of longleaf pine ecosystems. Gen. Tech. Rep. SRS-83. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station. 34 p. [64063]
  • 46. Buckner, James L. 1981. Wildlife considerations in prescribing fire on industry owned lands. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings of a symposium; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 57-60. [14809]
  • 47. Buckner, James L.; Landers, J. Larry; Barker, James A.; Perkins, Carroll J. 1979. Wildlife food plants following preparation of longleaf pine sites southwest Georgia. Southern Journal of Applied Forestry. 3(1): 56-59. [30900]
  • 48. Buell, Murray F.; Cantlon, John E. 1953. Effects of prescribed burning on ground cover in the New Jersey pine region. Ecology. 34(3): 520-528. [9262]
  • 51. Cable, Dwight R. 1957. Recovery of chaparral following burning and seeding in central Arizona. Res. Note. No. 28. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 6 p. [6342]
  • 52. Cain, Michael D.; Wigley, T. Bently; Reed, Derik J. 1998. Prescribed fire effects on structure in uneven-aged stands of loblolly and shortleaf pines. Wildlife Society Bulletin. 26(2): 209-218. [30045]
  • 54. Campbell, R. E.; Baker, M. B., Jr.; Ffolliott, P. F.; Larson, F. R.; Avery, C. C. 1977. Wildfire effects on a ponderosa pine ecosystem: an Arizona case study. Res. Pap. RM-191. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 12 p. [4715]
  • 56. Carlson, Peter C.; Tanner, George W.; Wood, John M.; Humphrey, Stephen R. 1993. Fire in Key deer habitat improves browse, prevents succession, and preserves endemic herbs. The Journal of Wildlife Management. 57(4): 914-928. [23003]
  • 57. Carlson, Peter Craig. 1989. Effects of burning in the rockland pine community on the Key Deer National Wildlife Refuge, Florida Keys. Gainesville, FL: University of Florida. 68 p. Thesis. [62057]
  • 62. Christensen, Norman L. 1977. Fire and soil-plant nutrient relations in a pine-wiregrass savanna on the coastal plain of North Carolina. Oecologia. 31(1): 27-44. [10129]
  • 65. Clary, Warren P.; Tiedemann, Arthur R. 1992. Ecology and values of Gambel oak woodlands. In: Ffolliott, Peter F.; Gottfried, Gerald J.; Bennett, Duane A.; Hernandez, Victor Manuel; Ortego-Rubio, Alfredo; Hamre, R. H., tech. coords. Ecology and management of oaks and associated woodlands: perspectives in the southwestern United States and northern Mexico: Proceedings; 1992 April 27-30; Sierra Vista, AZ. Gen. Tech. Rep. RM-218. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 87-95. [19746]
  • 67. Cole, Glen F. 1987. Changes in interacting species with disturbance. Environmental Management. 11(2): 257-264. [86424]
  • 68. Collins, Thomas C. 1980. A report on the Moose Creek Fire of August, 1979. North Fork, ID: U.S. Department of Agriculture, Forest Service, Salmon National Forest, North Fork Range District. Unpublished report on file at: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 27 p. [+ appendices]. [666]
  • 70. Cote, Steeve D. 2011. Impacts on ecosystems. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 379-398. [85217]
  • 73. Crawford, Hewlette S.; Lautenschlager, R. A.; Stokes, Martin R.; Stone, Timothy L. 1993. Effects of forest disturbance and soil depth on digestible energy for moose and white-tailed deer. Res. Pap. NE-682. Radnor, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 13 p. [22806]
  • 74. Cringan, A. T. 1958. Influence of forest fires and fire protection on wildlife. The Forestry Chronicle. 34(1): 25-30. [13636]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 90. DePerno, Christopher S.; Jenks, Jonathan A.; Griffin, Stephen L.; Rice, Leslie A.; Higgins, Kenneth F. 2002. White-tailed deer habitats in the central Black Hills. Journal of Range Management. 55(3): 242-252. [86435]
  • 91. DeWitt, James B.; Derby, James V., Jr. 1955. Changes in nutritive value of browse plants following forest fires. The Journal of Wildlife Management. 19(1): 65-70. [7343]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 97. Dills, Gary G. 1970. Effects of prescribed burning on deer browse. The Journal of Wildlife Management. 34(3): 540-545. [218]
  • 102. Dubreuil, Robert P. 2003. Habitat selection of white-tailed and mule deer in the southern Black Hills, South Dakota. Brookings, SD: South Dakota State University. 212 p. Thesis. [85337]
  • 111. Ffolliott, Peter F.; Chen, Hui; Gottfried, Gerald J.; Stropki, Cody L. 2012. Coues white-tailed deer and desert cottontail in the southwestern oak savannas: their presence before and after burning events. Journal of the Arizona-Nevada Academy of Science. 44(1): 1-5. [86533]
  • 112. Ffolliott, Peter F.; Gottfried, Gerald J.; Chen, Hui; Stropki, Cody L.; Neary, Daniel G. 2012. Fire effects on herbaceous plants and shrubs in the oak savannas of the Southwestern Borderlands. Res. Pap. RMRS-RP-95. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 15 p. [85241]
  • 113. Ffolliott, Peter F.; Guertin, D. Phillip. 1990. Prescribed fire in Arizona ponderosa pine forests: a 24-year case study. In: Krammes, J. S., tech. coord. Effects of fire management of southwestern natural resources: Proceedings of the symposium; 1988 November 15-17; Tucson, AZ. Gen. Tech. Rep. RM-191. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 250-254. [11300]
  • 116. Franklin, Joe; Brand, Rex. 1991. Cattle and fire--important tools benefiting wildlife. Rangelands. 13(4): 177-180. [16114]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 126. Fults, Gene A. 1991. Florida ranchers manage for deer. Rangelands. 13(1): 28-30. [14566]
  • 128. Gavin, Thomas A. 1984. Pacific Northwest. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 487-496. [14304]
  • 133. Gordon, Floyd A. 1976. Spring burning in an aspen-conifer stand for maintenance of moose habitat, West Boulder River, Montana. In: Proceedings, Montana Tall Timbers fire ecology conference and Intermountain Fire Research Council fire and land management symposium; 1974 October 8-10; Missoula, MT. No. 14. Tallahassee, FL: Tall Timbers Research Station: 501-538. [13529]
  • 134. Green, Pat; Talbert, Dennis. 1994. Soil and vegetation response to prescribed burning for winter range enhancement. In: Baumgartner, David M.; Lotan, James E.; Tonn, Jonalea R., compilers. Interior cedar-hemlock-white pine forests: ecology and management: Symposium proceedings; 1993 March 2-4; Spokane, WA. Pullman, WA: Washington State University, Department of Natural Resources: 345-346. [25818]
  • 139. Gullion, Gordon W. 1977. Maintenance of the aspen ecosystem as a primary wildlife habitat. Proceedings, 13th International Congress of Game Biologists. 13: 256-265. [16724]
  • 142. Hallisey, Dennis M.; Wood, Gene W. 1976. Prescribed fire in scrub oak habitat in central Pennsylvania. The Journal of Wildlife Management. 40(3): 507-516. [1066]
  • 145. Hanselka, C. Wayne; Falconer, Lawrence L. 1994. Pricklypear management in south Texas. Rangelands. 16(3): 102-106. [23569]
  • 147. Hansmire, Julie A.; Drawe, D. Lynn; Wester, David B.; Britton, Carlton M. 1988. Effect of winter burns on forbs and grasses of the Texas coastal prairie. The Southwestern Naturalist. 33(3): 333-338. [5613]
  • 152. Harris, Larry D.; White, L. D.; Johnston, J. E.; Milchunas, D. G. 1974. Impact of forest plantations on north Florida wildlife and habitat. In: Rogers, Wilmer A., ed. Proceedings of the 28th annual conference: Southeastern Association of Game and Fish Commissioners; 1974 November 17-20; White Sulphur Springs, WV. [Columbia, SC]: [Southeastern Association of Game and Fish Commissioners]: 659-667. [86770]
  • 154. Healy, William M. 1997. Thinning New England oak stands to enhance acorn production. Northern Journal of Applied Forestry. 14(3): 152-156. [27669]
  • 158. Hibbert, Alden R.; Davis, Edwin A.; Scholl, David G. 1974. Chaparral conversion potential in Arizona. Part I: water yield response and effects on other resources. Res. Pap. RM-126. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 36 p. [1144]
  • 159. Higgins, Kenneth F.; Kruse, Arnold D.; Piehl, James L. 1989. Effects of fire in the Northern Great Plains. Ext. Circ. EC-761. Brookings, SD: South Dakota State University, Cooperative Extension Service; South Dakota Cooperative Fish and Wildlife Research Unit. 47 p. [14749]
  • 161. Hobbs, N. Thompson; Schimel, David S.; Owensby, Clenton E.; Ojima, Dennis S. 1991. Fire and grazing in the tallgrass prairie: contingent effects on nitrogen budgets. Ecology. 72(4): 1374-1382. [16156]
  • 168. Hunter, Neill Louis. 1983. The effects of prescribed burning on the forage utilization patterns and population density of white-tailed deer (Odocoileus virginianus) on the Kerr Wildlife Management Area. San Marcos, TX: Southwest Texas State University. 63 p. Thesis. [85125]
  • 169. Huntley, Jimmy C.; McGee, Charles E. 1981. Timber and wildlife implications of fire in young upland hardwoods. In: Barnett, James P., ed. Proceedings, 1st biennial southern silvicultural research conference; 1980 November 6-7; Atlanta, GA. Gen. Tech. Rep. SO-34. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experiment Station: 56-66. [12080]
  • 171. Hurst, George A.; Campo, Joseph J.; Brooks, Michael B. 1980. Deer forage in a burned and burned-thinned pine plantation. Proceedings, Annual Conference of Southeastern Association of Fish and Wildlife Agencies. 34: 476-481. [8395]
  • 172. Hurst, George A.; Warren, Randy C. 1982. Deer forage in 13-year-old commercially thinned and burned loblolly pine plantation. Proceedings, Annual Conference of Southeastern Association of Fish and Wildlife Agencies. Tallahassee, FL: Southeastern Association of Fish and Wildlife Agencies. 36: 420-426. [62071]
  • 174. Iglay, Raymond B.; Jones, Phillip D.; Miller, Darren A.; Demarais, Stephen; Leopold, Bruce D.; Burger, L. Wes., Jr. 2010. Deer carrying capacity in mid-rotation pine plantations of Mississippi. The Journal of Wildlife Management. 74(5): 1003-1012. [86327]
  • 175. Irwin, Larry L. 1975. Deer-moose relationships on a burn in northeastern Minnesota. The Journal of Wildlife Management. 39(4): 653-662. [13892]
  • 176. Irwin, Larry L. 1976. Effects of intensive silviculture on big game forage sources in northern Idaho. In: Hieb, S., ed. Proceedings, elk-logging roads symposium; [1975 December 16-17]; [Moscow, ID]. Moscow, ID: University of Idaho: 135-142. [16146]
  • 177. Irwin, Larry L. 1985. Foods of moose, Alces alces, and white-tailed deer, Odocoileus virginianus, on a burn in boreal forest. The Canadian Field-Naturalist. 99(2): 240-245. [4513]
  • 180. James, T. D. W.; Smith, D. W. 1977. Short-term effects of surface fire on the biomass and nutrient standing crop of Populus tremuloides in southern Ontario. Canadian Journal of Forest Research. 7(4): 666-679. [6933]
  • 184. Johnson, A. Sydney; Hale, Philip E.; Osborne, J. Scott; Anderson, Owen F.; Ford, William M. 1992. Deer in pocosin habitat after catastrophic wildfire. In: Eversole, Arnold G.; Overacre, Kathi C.; Jones, Edwin; Garman, Greg C.; Hailey, W. F., eds. Proceedings of the 46th annual conference--Southeastern Association of Fish and Wildlife Agencies; 1992 October 25-28; Corpus Christie, TX. [Maggie Valley, NC]: [Southeastern Association of Fish and Wildlife Agencies]: 118-127. [85112]
  • 185. Johnson, A. Sydney; Landers, J. Larry. 1978. Fruit production in slash pine plantations in Georgia. The Journal of Wildlife Management. 42(3): 606-613. [9855]
  • 187. Keay, Jeffrey A.; Peek, James M. 1980. Relationships between fires and winter habitat of deer in Idaho. The Journal of Wildlife Management. 44(2): 372-380. [125]
  • 195. Kirsch, Leo M.; Kruse, Arnold D. 1973. Prairie fires and wildlife. In: Proceedings, annual Tall Timbers fire ecology conference; 1972 June 8-9; Lubbock, TX. No. 12. Tallahassee, FL: Tall Timbers Research Station: 289-303. [8472]
  • 197. Klukas, Richard W. 1973. Control burn activities in Everglades National Park. In: Proceedings, annual Tall Timbers fire ecology conference; 1972 June 8-9; Lubbock, TX. No. 12. Tallahassee, FL: Tall Timbers Research Station: 397-425. [8476]
  • 206. Kruse, William H. 1972. Effects of wildfire on elk and deer use of a ponderosa pine forest. Res. Note RM-226. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 4 p. [5045]
  • 208. Kufeld, Roland C. 1983. Responses of elk, mule deer, cattle, and vegetation to burning, spraying and chaining of Gambel oak rangeland. Tech. Publ. 34. Fort Collins, CO: Colorado Division of Wildlife. 47 p. [253]
  • 210. Kunzler, L. M.; Harper, K. T. 1980. Recovery of Gambel oak after fire in central Utah. The Great Basin Naturalist. 40(2): 127-130. [1389]
  • 216. Lashley, Marcus A.; Harper, Craig A.; Bates, Gary E.; Keyser, Patrick D. 2011. Forage availability for white-tailed deer following silvicultural treatments in hardwood forests. The Journal of Wildlife Management. 75(6): 1467-1476. [86316]
  • 217. Lay, Daniel W. 1956. Effects of prescribed burning on forage and mast production in southern pine forests. Journal of Forestry. 54(9): 582-584. [13828]
  • 219. Lay, Daniel W. 1967. Browse palatability and the effects of prescribed burning in southern pine forests. Journal of Forestry. 65(11): 826-828. [145]
  • 223. Leonhart, John T. 2003. Ecological overlap of female mule deer (Odocoileus hemionus) and white-tailed deer (Odocoileus virginianus) in the Sandhills of Nebraska. Omaha, NE: University of Nebraska at Omaha. 49 p. Thesis. [85127]
  • 224. Leopold, Aldo. 1923. Wild followers of the forest: The effect of forest fires on game and fish--the relation of forests to game conservation. American Forestry. 29(357): 515-510, 568. [250]
  • 226. Leopold, Bruce D.; Krausman, Paul R. 2002. Plant recovery and deer use in the Chisos Mountains, Texas, following wildfire. Proceedings, Annual Conference of the Southeastern Association of Fish and Wildlife Agencies. 56: 352-364. [61559]
  • 228. Leslie, David M., Jr.; Soper, Roderick B.; Lochmiller, Robert L.; Engle, David M. 1996. Habitat use by white-tailed deer on cross timbers rangeland following brush management. Journal of Range Management. 49(5): 401-406. [86509]
  • 231. Lewis, Clifford E.; Harshbarger, Thomas J. 1976. Shrub and herbaceous vegetation after 20 years of prescribed burning in the South Carolina coastal plain. Journal of Range Management. 29(1): 13-18. [7621]
  • 232. Lewis, John S.; Kaiser, Robert D., III; Hewitt, David G.; Synatzske, David R. 2012. Female white-tailed deer body condition and diet after a large spring wildfire. Rangeland Ecology & Management. 65(3): 309-312. [86325]
  • 233. Little, S. 1964. Fire ecology and forest management in the New Jersey pine region. In: Proceedings, 3rd annual Tall Timbers fire ecology conference; 1964 April 9-10; Tallahassee, FL. No. 3. Tallahassee, FL: Tall Timbers Research Station: 35-59. [5893]
  • 234. Little, Silas. 1974. Effects of fire on temperate forests: northeastern United States. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 225-250. [9658]
  • 235. Little, Silas; Moorhead, George R.; Somes, Horace A. 1958. Forestry and deer in the pine region of New Jersey. Stn. Pap. No. 109. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 33 p. [11681]
  • 237. Locascio, Cynthia G.; Lockaby, B. G.; Caulfield, Jon P.; Edwards, M. Boyd; Causey, M. Kieth. 1990. Influence of mechanical site preparation on deer forage in the Georgia Piedmont. Southern Journal of Applied Forestry. 14(2): 77-80. [86314]
  • 238. Long, A. J.; Behm, A.; Cassidy, L.; DiMartino, J.; Doran, D.; Freeman, D.; Helmers, J.; Keefe, K.; Miller, A.; Ranasinghe, S.; Randall, C.; Rasser, M.; Ruth, A.; Shipley, D.; Van Loan, A. 2004. Prescribed fire and slash pine. In: Dickens, E. D.; Barnett, J. P.; Hubbard, W. G.; Jokela, E. J., eds. Slash pine: still growing and growing! Proceedings of the slash pine symposium; 2002 April 23-25; Jekyll Island, GA. Gen. Tech. Rep. SRS-76. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 66-78. [55324]
  • 246. Lyon, L. Jack. 1966. Problems of Habitat management for deer and elk in the northern forests. Res. Pap. INT-24. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 15 p. [8426]
  • 248. Lyon, L. Jack; Hooper, Robert G.; Telfer, Edmund S.; Schreiner, David Scott. 2000. Fire effects on wildlife foods. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 51-58. [44448]
  • 249. Lyon, L. Jack; Huff, Mark H.; Telfer, Edmund S.; Schreiner, David Scott; Smith, Jane Kapler. 2000. Fire effects on animal populations. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 25-34. [44436]
  • 251. Maas, Deborah S.; Musson, Robin L.; Hayden, Timothy J. 2003. Effects of prescribed burning on game species in the southeastern United States, a literature review. ERDC/CERL TR-03-13. Champaign, IL: U.S. Army Corps of Engineers, Engineer Research and Development Center, Construction Engineering Research Laboratory. 71 p. [86560]
  • 252. Maehr, David S.; Larkin, Jeffrey L. 2004. Do prescribed fires in south Florida reduce habitat quality for native carnivores? Natural Areas Journal. 24(3): 188-197. [67706]
  • 254. Main, Martin B.; Richardson, Larry W. 2002. Response of wildlife to prescribed fire in southwest Florida pine flatwoods. Wildlife Society Bulletin. 30(1): 213-221. [41806]
  • 256. Martin, S. Clark. 1983. Responses of semidesert grasses and shrubs to fall burning. Journal of Range Management. 36(5): 604-610. [1539]
  • 257. Martinka, C. J. 1976. Fire and elk in Glacier National Park. In: Proceedings, Tall Timbers fire ecology conference and fire and land management symposium; 1974 October 8-10; Missoula, MT. No. 14. Tallahassee, FL: Tall Timbers Research Station: 377-389. [7523]
  • 259. Masters, Ronald E. 2007. The importance of shortleaf pine for wildlife and diversity in mixed oak-pine forests and in pine-grassland woodlands. In: Kabrick, John M.; Dey, Daniel C.; Gwaze, David, eds. Shortleaf pine restoration and ecology in the Ozarks: proceedings of a symposium; 2006 November 7-9; Springfield, MO. Gen. Tech. Rep. NRS-P-15. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northern Research Station: 35-46. [80664]
  • 260. Masters, Ronald E.; Lochmiller, Robert L.; Engle, David M. 1993. Effects of timber harvest and prescribed fire on white-tailed deer forage production. Wildlife Society Bulletin. 21(4): 401-411. [23422]
  • 261. Masters, Ronald E.; Warde, William D.; Lochmiller, Robert L. 1997. Herbivore response to alternative forest management practices. Proceedings of the annual conference of the Southeastern Association of Fish and Wildlife Agencies. 51: 225-237. [85116]
  • 262. Masters, Ronald E.; Wilson, Christopher W.; Bukenhofer, George A.; Payton, Mark E. 1996. Effects of pine-grassland restoration for red-cockaded woodpeckers on white-tailed deer forage production. Wildlife Society Bulletin. 24(1): 77-84. [86433]
  • 265. Mattfeld, George F. 1984. Eastern hardwood and spruce-fir forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 305-330. [14291]
  • 276. Mengak, Michael T.; Castleberry, Steven B. 2004. Wildlife management issues and opportunities in slash pine forests. In: Dickens, E. D.; Barnett, J. P.; Hubbard, W. G.; Jokela, E. J., eds. Slash pine: still growing and growing! Proceedings of the slash pine symposium; 2002 April 23-25; Jekyll Island, GA. Gen. Tech. Rep. SRS-76. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 79-83. [55325]
  • 278. Miller, Howard A. 1963. Use of fire in wildlife management. In: Proceedings, 2nd annual Tall Timbers fire ecology conference; 1963 March 14-15; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 19-30. [17921]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 280. Mixon, Melinda R.; Demarais, Stephen; Jones, Phillip D.; Rude, Brian J. 2009. Deer forage response to herbicide and fire in mid-rotation plant plantations. The Journal of Wildlife Management. 73(5): 663-668. [81469]
  • 285. Mumaw, David Keener. 1965. Evaluation of prescribed burning in relation to available deer browse. Blacksburg, VA: Virginia Polytechnic Institute. 112 p. Thesis. [86291]
  • 290. Nelson, Jack R. 1976. Forest fire and big game in the Pacific Northwest. In: Proceedings, annual Tall Timbers fire ecology conference: Pacific Northwest; 1974 October 16-17; Portland, OR. No. 15. Tallahassee, FL: Tall Timbers Research Station: 85-102. [6464]
  • 294. Newsom, John D. 1984. Coastal Plain. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 367-380. [14295]
  • 299. Ohmann, Lewis F.; Grigal, David F. 1979. Early revegetation and nutrient dynamics following the 1971 Little Sioux Forest Fire in northeastern Minnesota. Forest Science Monograph 21. Bethesda, MD: Society of American Foresters. 80 p. [6992]
  • 304. Osborne, J. S.; McClanahan, R. D.; Gillis, E. B.; Nettles, V. F.; Florschutz, O. 1986. Effects of wildfires in a North Carolina pocosin on deer populations. [Publisher location unknown]: Southeast Deer Study Group. 1 p. Abstract. Available online: http://www.sedsg.com/index.asp [2013, May 20]. [86772]
  • 305. Owens, M. Keith; Mackley, J. W.; Carroll, C. J. 2002. Vegetation dynamics following seasonal fires in mixed mesquite/acacia savannas. Journal of Range Management. 55(5): 509-516. [42240]
  • 308. Pack, James C.; Igo, William, K.; Taylor, Curtis I. 1988. Use of prescribed burning in conjunction with thinning to increase wild turkey brood range habitat in oak-hickory forests. Transactions of the Northeast Section of the Wildlife Society 45: 37-48. [86876]
  • 309. Pase, Charles P.; Pond, Floyd W. 1964. Vegetation changes following the Mingus Mountain burn. Res. Note RM-18. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 8 p. [5700]
  • 312. Patton, David R.; Jones, John R. 1977. Managing aspen for wildlife in the Southwest. Gen. Tech. Rep. RM-37. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 7 p. [5410]
  • 315. Pearson, H. A.; Davis, J. R.; Schubert, G. H. 1972. Effects of wildfire on timber and forage production in Arizona. Journal of Range Management. 25(4): 250-253. [5664]
  • 316. Peek, James M. 1972. Adaptations to the burn: moose and deer studies. Naturalist. 23(3-4): 8-14. [16747]
  • 317. Peek, James M. 1984. Northern Rocky Mountains. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 497-504. [14305]
  • 319. Pengelly, W. Leslie. 1963. Timberlands and deer in the northern Rockies. Journal of Forestry. 61(10): 734-740. [175]
  • 323. Philleo, Barbara; Cavanagh, John B.; Olson, David P. 1978. Browse utilization by deer in relation to cutting and prescribed burning in southeastern New Hampshire. Transactions of the Northeast Section, the Wildlife Society. 35: 16-26. [86292]
  • 330. Ramirez-Yanez, Luis Enrique; Ortega-S., J. Alfonso; Brennan, Leonard A.; Rasmussen, George A. 2007. Use of prescribed fire and cattle grazing control guineagrass. In: Masters, Ronald E.; Galley, Krista E. M., eds. Fire in grassland and shrubland ecosystems: Proceedings of the 23rd Tall Timbers fire ecology conference; 2005 October 17-20; Bartlesville, OK. Tallahassee, FL: Tall Timbers Research Station: 240-245. [69928]
  • 332. Reich, Peter B.; Abrams, Marc D.; Ellsworth, David S.; Druger, Eric L.; Tabone, Tom J. 1990. Fire affects ecophysiology and community dynamics of central Wisconsin oak forest regeneration. Ecology. 71(6): 2179-2190. [13326]
  • 345. Rogers, James O.; Fulbright, Timothy E.; Ruthven, Donald C., III. 2004. Vegetation and deer response to mechanical shrub clearing and burning. Journal of Range Management. 57(1): 41-48. [47185]
  • 346. Rogers, Lynn L.; Mooty, Jack J.; Dawson, Deanna. 1981. Foods of white-tailed deer in the Upper Great Lakes Region -- a review. General Technical Report NC-65. St. Paul, MN: U.S. Dept. of Agriculture, Forest Service, North Central Forest Experiment Station. 24 p. [86350]
  • 347. Rollins, Dale; Bryant, Fred C. 1986. Floral changes following mechanical brush removal in central Texas. Journal of Range Management. 39(3): 237-240. [10415]
  • 348. Rollins, Dale; Bryant, Fred C.; Waid, Douglas D.; Bradley, Lisa C. 1988. Deer response to brush management in central Texas. Wildlife Society Bulletin. 16(3): 277-284. [9671]
  • 352. Rowe, J. S.; Scotter, G. W. 1973. Fire in the boreal forest. Quaternary Research. 3(3): 444-464. [72]
  • 355. Ruthven, Donald C., III; Braden, Anthony W.; Knutson, Haley J.; Gallagher, James F.; Synatzske, David R. 2003. Woody vegetation response to various burning regimes in South Texas. Journal of Range Management. 56(2): 159-166. [47629]
  • 361. Scifres, C. J.; Hamilton, W. T. 1993. Prescribed burning for brushland management: The South Texas example. College Station, TX: Texas A&M University Press. 246 p. [51017]
  • 363. Severson, Kieth E. 1987. Deer and elk nutrition in Rocky Mountain ponderosa pine forests. In: Fisser, Herbert G., ed. Wyoming shrublands: Proceedings of the 16th Wyoming shrub ecology workshop; 1987 May 26-27; Sundance, WY. Laramie, WY: University of Wyoming, Department of Range Management, Wyoming Shrub Ecology Workshop: 23-27. [13914]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 367. Shaw, Christopher E.; Harper, Craig A.; Black, Michael W.; Houston, Allan E. 2010. Initial effects of prescribed burning and understory fertilization on browse production in closed-canopy hardwood stands. Journal of Fish and Wildlife Management. 1(2): 64-72. [86318]
  • 370. Sieg, Carolyn Hull; Severson, Kieth E. 1996. Managing habitats for white-tailed deer: Black Hills and Bear Lodge Mountains of South Dakota and Wyoming. Gen. Tech. Rep. RM-GTR-274. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 24 p. [86436]
  • 375. Smith, Jane Kapler, compiler. 2011. Research Project Summary: Use of prescribed fire to manage hawthorn and speckled alder in a Pennsylvania floodplain, [Online]. In: Fire Effects Information System. Missoula, MT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory (Producer). Available: http://www.fs.fed.us/database/feis/ [2011, July 18]. [83170]
  • 380. Smith, Winston Paul. 1985. Current geographic distribution and abundance of Columbian white-tailed deer, Odocoileus virginianus Leucurus (Douglas). Northwest Science. 59(4): 243-251. [86870]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 382. Soper, Roderick B.; Lochmiller, Robert L.; Leslie, David M., Jr.; Engle, David M. 1993. Condition and diet quality of white-tailed deer in response to vegetation management in central Oklahoma. Proceedings of the Oklahoma Academy of Science. 73: 53-61. [86872]
  • 383. Soper, Roderick B.; Lochmiller, Robert L.; Leslie, David M., Jr.; Engle, David M. 1993. Nutritional quality of browse after brush management on cross timbers rangeland. Journal of Range Management. 46(5): 399-410. [29365]
  • 385. Springer, Marlin David. 1977. The influence of prescribed burning on nutrition in white-tailed deer on the coastal plain of Texas. College Station, TX: Texas A&M University. 92 p. Dissertation. [86293]
  • 394. Stransky, John J.; Harlow, Richard F. 1981. Effects of fire on deer habitat in the Southeast. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings of a symposium; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 135-142. [14820]
  • 395. Stransky, John J; Halls, Lowell K. 1980. Fruiting of woody plants affected by site preparation and prior land use. The Journal of Wildlife Management. 44(1): 258-263. [10149]
  • 401. Svedarsky, W. Daniel; Buckley, Philip E. 1975. Some interactions of fire, prairie and aspen in northwest Minnesota. In: Wali, Mohan K., ed. Prairie: a multiple view. Grand Forks, ND: University of North Dakota Press: 115-122. [4434]
  • 402. Swank, Wendell G. 1958. The mule deer in Arizona chaparral. Wildlife Bulletin No. 3. Phoenix, AZ: State of Arizona, Game and Fish Department. 109 p. [12327]
  • 404. Tanner, George W.; Mullahey, J. Jeffrey; Maehr, David. 1999. Saw-palmetto: an ecologically and economically important native palm. WEC-109. Gainesville, FL: University of Florida, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, Wildlife Ecology and Conservation Department. 3 p. [86851]
  • 407. Telfer, E. S. 1974. Logging as a factor in wildlife ecology in the boreal forest. The Forestry Chronicle. 50(5): 186-190. [16537]
  • 410. Thilenius, John F. 1968. The Quercus garryana forests of the Willamette Valley, Oregon. Ecology. 49(6): 1124-1133. [8765]
  • 415. Thompson, Margaret W.; Shaw, Michael G.; Umber, Rex W.; Skeen, John E.; Thackston, Reggie E. 1991. Effects of herbicides and burning on overstory defoliation and deer forage production. Wildlife Society Bulletin. 19(2): 165-170. [16341]
  • 418. Throop, Heather L.; Fay, Philip A. 1999. Effects of fire, browsers and gallers on New Jersey tea (Ceanothus herbaceous) growth and reproduction. The American Midland Naturalist. 141(1): 51-58. [30324]
  • 421. Timmermann, H. R. 1991. Ungulates and aspen management. In: Navratil, S.; Chapman, P. B., eds. Aspen management for the 21st century: Proceedings of a symposium; 1990 November 20-21; Edmonton, AB. Edmonton, AB: Forestry Canada, Northwest Region, Northern Forestry Centre; Poplar Council of Canada: 99-110. [18550]
  • 428. Van Lear, David H.; Waldrop, Thomas A. 1991. Prescribed burning for regeneration. In: Duryea, M. L.; Dougherty, P. M., eds. Forest regeneration manual. The Netherlands: Kluwer Academic Publishers: 235-250. [23045]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]
  • 436. Vogl, Richard J. 1967. Controlled burning for wildlife in Wisconsin. In: Proceedings, 6th annual Tall Timbers fire ecology conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 47-96. [18726]
  • 437. Vogl, Richard J.; Beck, Alan M. 1970. Response of white-tailed deer to a Wisconsin wildfire. The American Midland Naturalist. 84(1): 270-273. [92]
  • 438. Wagle, R. F. 1981. Fire: its effects on plant succession and wildlife in the Southwest. Some effects of fire on plant succession and variability in the Southwest from a wildlife management viewpoint. RR 281. Tucson, AZ: University of Arizona. 82 p. [4031]
  • 440. Waldrop, Thomas A.; Lloyd, F. Thomas. 1991. Forty years of prescribed burning on the Santee fire plots: effects on overstory and midstory vegetation. In: Nodvin, Stephen C.; Waldrop, Thomas A., eds. Fire and the environment: ecological and cultural perspectives: Proceedings of an international symposium; 1990 March 20-24; Knoxville, TN. Gen. Tech. Rep. SE-69. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station: 45-50. [16632]
  • 441. Waldrop, Thomas A.; Van Lear, David H.; Lloyd, F. Thomas; Harms, William R. 1987. Long-term studies of prescribed burning in loblolly pine forests of the Southeastern Coastal Plain. Gen. Tech. Rep. SE-45. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station. 23 p. [11596]
  • 445. Walter, W. D.; Zimmerman, T. J.; Leslie, D. M., Jr.; Jenks, J. A. 2009. Dietary response of sympatric deer to fire using stable isotope analysis of liver tissue. Wildlife Biology in Practice. 5(2): 128-135. [84974]
  • 461. Wishart, William D. 1984. Western Canada. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 475-486. [14303]
  • 462. Wolfe, Carl W. 1973. Effects of fire on a sandhills grassland environment. In: Proceedings, annual Tall Timbers fire ecology conference; 1972 June 8-9; Lubbock, TX. No. 12. Tallahassee, FL: Tall Timbers Research Station: 241-255. [8469]
  • 464. Wood, Gene W. 1988. Effects of prescribed fire on deer forage and nutrients. Wildlife Society Bulletin. 16(2): 180-186. [62089]
  • 465. Wood, George W. 1971. Deer feeding capacity reduced by wildfire in central Pennsylvania. Science in Agriculture. 18(4): 10. [34973]
  • 468. Yantis, James H.; Frentress, Carl D.; Daniel, Walton S.; Veteto, George H. 1983. Deer management in the post oak belt. PWD Bulletin 7000-96. Austin, TX: Texas Parks and Wildlife Department, Wildlife Division. 28 p. [86299]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indirect Effects of Fire

More info for the terms: association, cover, fire frequency, frequency, presence, succession

Patton and Gordon [311] described white-tailed deer as a fire-dependent species because of its association with fire-dependent and fire-adapted plant communities and because white-tailed deer populations often decrease when fire frequency in these plant communities decreases. A researcher concluded that white-tailed deer in Michigan are "dependent" upon conditions in "transitory" habitats (Graham 1954 cited in [319]), including those resulting from fire. However, white-tailed deer are generalists and can use a wide variety of habitats to obtain the necessary resources to survive and reproduce [95]. According to a 2006 review, "no study has linked any white-tailed deer population parameter to fire in a conclusive manner". These authors also noted that given white-tailed deer's overabundance in many areas of the East, ample nutrition is available to support large and healthy white-tailed deer populations in the absence of fire [190].

In general, postfire vegetation changes are considered beneficial to white-tailed deer [30,115,234]. The literature indicates that fire sets back plant development and succession, often increasing white-tailed deer forage quality and/or quantity in the short term. Fire also tends to increase habitat patchiness, providing white-tailed deer with abundant edge habitat and diverse vegetation [30,115,234]. However, because white-tailed deer depend on vegetation for forage, snow interception cover, hiding cover, and thermal protection (see Cover and foraging habitats), fire is likely to be detrimental to white-tailed deer in the short term if it removes too much vegetation. White-tailed deer appear most likely to benefit from patchy fires resulting in early-successional habitats that provide forage while leaving interspersed patches of later-successional forests and shrublands. They are least likely to benefit from fires resulting in large expanses of homogeneous vegetation [164,251,319,436]. White-tailed deer use of burned areas is influenced by the habitat and its season of use, postfire white-tailed deer browsing pressure, weather, size and shape of burned areas, prefire travel patterns, and the presence of barriers to movement, among other factors.

  • 30. Bendell, J. F. 1974. Effects of fire on birds and mammals. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 73-138. [16447]
  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 115. Finck, Elmer J. 1993. Effects of fire on animals. Kansas School Naturalist. 39(2): 11-15. [23426]
  • 164. Holechek, Jerry L. 1981. Brush control impacts on rangeland wildlife. Journal of Soil and Water Conservation. 36(5): 265-269. [1182]
  • 190. Keyser, Patrick D.; Ford, W. Mark. 2006. Influence of fire on mammals in eastern oak forests. In: Dickinson, Matthew B., ed. Fire in eastern oak forests: delivering science to land managers: Proceedings of a conference; 2005 November 15-17; Columbus, OH. Gen. Tech. Rep. NRS-P-1. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northern Research Station: 180-190. [66410]
  • 234. Little, Silas. 1974. Effects of fire on temperate forests: northeastern United States. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 225-250. [9658]
  • 251. Maas, Deborah S.; Musson, Robin L.; Hayden, Timothy J. 2003. Effects of prescribed burning on game species in the southeastern United States, a literature review. ERDC/CERL TR-03-13. Champaign, IL: U.S. Army Corps of Engineers, Engineer Research and Development Center, Construction Engineering Research Laboratory. 71 p. [86560]
  • 311. Patton, David R.; Gordon, Janet. 1995. Fire, habitats, and wildlife. Final report. Flagstaff, AZ: U.S. Department of Agriculture, Forest Service, Coconino National Forest. Unpublished report on file at: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 85 p. [61019]
  • 319. Pengelly, W. Leslie. 1963. Timberlands and deer in the northern Rockies. Journal of Forestry. 61(10): 734-740. [175]
  • 436. Vogl, Richard J. 1967. Controlled burning for wildlife in Wisconsin. In: Proceedings, 6th annual Tall Timbers fire ecology conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 47-96. [18726]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Direct Effects of Fire

More info for the terms: backfire, cover, density, direct effects of fire, fuel, ground fire, headfire, marsh, natural, peat, prescribed fire, snag, wildfire

Fire kills white-tailed deer directly (e.g., [184,193]), but fire-caused mortality rates of large mammals are generally low (<1%) [120], and direct fire-caused mortality is thought to have little effect on large mammal populations [120,247]. Vogl [436] stated that the benefits of burning in white-tailed deer habitats far outweigh and offset any direct losses. Large mammal mortality is most likely when fire fronts are wide and fast moving, fires are actively crowning, and thick ground smoke occurs [120].

Large fires may be more likely to result in injury or death of deer than small fires because large fires remove more protective cover and temporarily reduce forage [160,358]. Gabrielson [127] noted that at least 8 deer were killed by the "racing flames" during the "great fires" of September 1902 in Cowlitz and Clark counties, Washington, and eastern Clackamas and Multnomah counties, Oregon. Large, long-duration wildfires in pocosin in North Carolina resulted in high white-tailed deer mortality. An April (1985) 95,000-acre (38,300 ha) wildfire in pocosin on the Pocosin Lakes National Wildlife Refuge, North Carolina, killed 20% of the white-tailed deer population. Approximately 33% of the surviving white-tailed deer appeared to have sustained injuries from ground fire. Many injuries became infected, resulting in high secondary mortality. The authors estimated that about 20% of the survivors were severely injured, with burned feet and legs and chronic secondary infections. A helicopter survey 6 days following containment of the fire found 1.0 dead white-tailed deer/km² in an 11,201-acre (4,533 ha) area, with 4.4 live white-tailed deer/km². Mortality estimates from ground and aerial surveys soon following a May (1981) 17,801-acre (7,204 ha) wildfire in the same area ranged from 1.4 to 10.0 dead white-tailed deer/km². Of 58 dead white-tailed deer, 3% were fawns, 7% were 1-year-old males, 35% were 1-year-old females, 14% were adult males, and 41% were adult females. Both fires were rapidly moving headfires followed by severe ground fires in deep peat [304] that burned slowly and for more than 3 weeks [184]. White-tailed deer carcasses were typically found in smoldering hollows in peat. The authors stated that such high white-tailed deer mortality had not been reported in other southeastern habitats types and "most likely did not occur under natural FIRE REGIMES" (Osborne and others 1986 cited in [213]). In contrast, only 36 white-tailed deer were killed during a severe 45,000-acre (18,200 ha) May (1986) wildfire in pocosin at the Holly Shelter Game Land, North Carolina. Direct mortality was estimated at <10% of the population. The fire burned almost all aboveground vegetation and burned as deep as 3 feet (1 m) into the peat, killing roots of most plants in some areas. Unlike the other 2 fires, this fire was not of long duration and was extinguished by heavy rains in a few days. Most white-tailed deer carcasses were found in an area where a headfire met a backfire set by suppression crews [184]. In Wisconsin, during the summer wildfires of 1930 that burned >120,000 acres (49,000 ha), Kipp [193] observed >80 white-tailed deer carcasses. Of these, 18 were found in an area where the animals had been driven by changing winds from the edge of the forest fire into burning peat marshes.

Mobley and Balmer [281] suggested that prescribed fires are generally not large enough, hot enough, or fast-spreading enough to trap and kill wildlife. As of this writing (2013), no published documents reported white-tailed deer deaths resulting from prescribed fires.

Occasionally, injury suffered during a fire may result in high secondary mortality (e.g., [127,184,193,366], Leopold 1933 cited in [66]). In Wisconsin, more than 20 white-tailed deer carcasses were observed after the summer wildfires of 1930, and 60% of white-tailed deer surviving the fires had badly burned feet. White-tailed deer carcasses were found in and near the burned areas for several months following the fires. Some of the deaths were apparently due to these injuries [193]. Shantz [366] and Gabrielson [127] noted many instances where the feet of deer were burned, thus crippling the animals. Vogl [436] reported a case where a white-tailed deer buck's back was covered with large burns. However, the deer appeared healthy when it was harvested.

As with other ungulates, such as moose and elk, the number of fatalities caused by fire is likely related to season, population density, habitat type, terrain, fuel load, and prevailing winds [61,160,373]. White-tailed deer fawns are probably most vulnerable to fire-caused mortality during the hiding period, when they are relatively immobile [107,127,194]. Does in Arizona upland communities give birth in July and likely lose some newborns to late-season fires (Esque and Schwalbe unpublished data cited in [107]). Gabrielson [127] reported that after the 1902 wildfires in Washington and Oregon, a forester told him of finding a burning fawn beside a log; apparently "the fawn remained hiding even as flames approached until it was too late to escape". In Wisconsin, a ranger reported finding a carcass of a white-tailed deer fawn after a "hot" spring fire. The fawn's mother remained nearby the fawn as the fire blazed "in a futile effort to save her young". The mother was blinded and severely injured during the fire, while the fawn was "burned to a crisp" [194]. Robbins and Meyers [342] stated that it is likely that all but the youngest fawns escape most fires, although fawns separated permanently from their mothers would probably not survive. Because fawns have a long breeding season in Florida, few vulnerable fawns would be present at any one time [342]. Collins [68] commented that young-of-the-year of most mammals, including white-tailed deer and mule deer, would have been able to escape an early August mixed-severity wildfire on the Salmon National Forest, Idaho, partly because considerable escape terrain was available in the form of rock outcrops and slides.

Early researchers noted white-tailed deer's apparent lack of fear of fire (e.g., [25,127,178,199,356]). General observations suggest that white-tailed deer use areas during and soon after fire (e.g., [25,127,199,366]). White-tailed deer respond to an approaching fire by moving away or ahead of it, and by using streambeds or other wet sites as refuges [159,160,178,251,436]. In state parks in Florida, white-tailed deer "often responded to fire without panic by simply moving into a marsh as fire burned all around, or stepping through a break in the flaming front to reach blackened ground" [160]. During an early August, mixed-severity wildfire on the Salmon National Forest, Idaho, deer were occasionally seen in areas while fire was still burning. For example, a doe and fawn were seen standing beneath a burning snag [68]. In Clarke County, Alabama, white-tailed deer were observed feeding within 65 feet (20 m) of an approaching fire "with no apparent alarm", and at no time were they observed running in response to fire [178]. Several radiocollared white-tailed deer remained in grasslands with scattered Ashe juniper at the Kerr Wildlife Management Area, Texas, as the grasslands burned under prescription. In most instances the deer "showed no noticeable fear of the approaching flames" [25]. Komarek [199] observed white-tailed deer nibbling ash soon after a July prescribed fire at the Tall Timbers Research Station, Leo County, Florida, possibly as a source of calcium, potash, and trace minerals. Although direct effects of fire have been assumed to be minimal because white-tailed deer are able to move temporarily to unburned areas [373], fragmentation of rangelands from agriculture, urban development, transportation corridors, and fencing could limit the ability of white-tailed deer to move to unburned areas during and soon after large fires [232].

  • 25. Beechinor, Diane Blanche. 1986. Preburn and postburn activity patterns of the white-tailed deer (Odocoileus virginianus). San Marcos, TX: Southwest Texas State University. 69 p. Thesis. [85122]
  • 61. Child, Kenneth N. 2007. Incidental mortality. In: Franzmann, Albert W.; Schwartz, Charles C.; McCabe, Richard E., eds. Ecology and management of the North American moose. 2nd ed. Boulder, CO: University Press of Colorado: 275-302. [79101]
  • 66. Clepper, Henry E. 1935. Forest fires and game supply. Service Letter. Harrisburg, PA: Pennsylvania Department of Forests and Waters. 6(9): 1-3. [17210]
  • 68. Collins, Thomas C. 1980. A report on the Moose Creek Fire of August, 1979. North Fork, ID: U.S. Department of Agriculture, Forest Service, Salmon National Forest, North Fork Range District. Unpublished report on file at: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 27 p. [+ appendices]. [666]
  • 107. Esque, Todd C.; Schwalbe, Cecil R. 2002. Alien annual grasses and their relationships to fire and biotic change in Sonoran desertscrub. In: Tellman, Barbara, ed. Invasive exotic species in the Sonoran region. Arizona-Sonora Desert Museum studies in natural history. Tucson, AZ: The University of Arizona Press; The Arizona-Sonora Desert Museum: 165-194. [48660]
  • 120. French, Marilynn Gibbs; French, Steven P. 1996. Large mammal mortality in the 1988 Yellowstone fires. In: Greenlee, Jason, ed. The ecological implications of fire in Greater Yellowstone: Proceedings, 2nd biennial conference on the Greater Yellowstone Ecosystem; 1993 September 19-21; Yellowstone National Park, WY. Fairfield, WA: International Association of Wildland Fire: 113-115. [27835]
  • 127. Gabrielson, Ira N. 1928. Forest fire and wildlife: A naturalist tells about the things that happen when the woods are burning. Four L Lumber News. 10(13): 32. [34525]
  • 159. Higgins, Kenneth F.; Kruse, Arnold D.; Piehl, James L. 1989. Effects of fire in the Northern Great Plains. Ext. Circ. EC-761. Brookings, SD: South Dakota State University, Cooperative Extension Service; South Dakota Cooperative Fish and Wildlife Research Unit. 47 p. [14749]
  • 160. Hingtgen, Terry. 2000. Prescribed burning: observations on the interaction of wildlife and fire in state parks of southwestern Florida. In: Moser, W. Keith; Moser, Cynthia F., eds. Fire and forest ecology: innovative silviculture and vegetation management: Proceedings of the 21st Tall Timbers fire ecology conference: an international symposium; 1998 April 14-16; Tallahassee, FL. No. 21. Tallahassee, FL: Tall Timbers Research: 158-162. [37659]
  • 178. Ivey, T. L.; Causey, M. K. 1984. Response of white-tailed deer to prescribed fire. Wildlife Society Bulletin. 12(2): 138-141. [8393]
  • 184. Johnson, A. Sydney; Hale, Philip E.; Osborne, J. Scott; Anderson, Owen F.; Ford, William M. 1992. Deer in pocosin habitat after catastrophic wildfire. In: Eversole, Arnold G.; Overacre, Kathi C.; Jones, Edwin; Garman, Greg C.; Hailey, W. F., eds. Proceedings of the 46th annual conference--Southeastern Association of Fish and Wildlife Agencies; 1992 October 25-28; Corpus Christie, TX. [Maggie Valley, NC]: [Southeastern Association of Fish and Wildlife Agencies]: 118-127. [85112]
  • 193. Kipp, Duane H. 1931. Wild life in a fire. American Forests. 37(6): 323-325. [16774]
  • 194. Kirkpatrick, R. C. 1944. Effect of fires on wildlife. Wisconsin Conservation Bulletin. 6(5): 28-30. [16374]
  • 199. Komarek, E. V., Sr. 1969. Fire and animal behavior. In: Proceedings, annual Tall Timbers fire ecology conference; 1969 April 10-11; Tallahassee, FL. No. 9. Tallahassee, FL: Tall Timbers Research Station: 161-207. [13531]
  • 213. Landers, J. Larry. 1987. Prescribed burning for managing wildlife in southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene, eds. Managing southern forests for wildlife and fish: a proceedings; 1986 October 5-8; Birmingham, AL. Gen. Tech. Rep. SO-65. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experimental Station: 19-27. [Proceedings of the Wildlife and Fish Ecology Technical Session, 1986 Society of American Foresters National Convention]. [25968]
  • 232. Lewis, John S.; Kaiser, Robert D., III; Hewitt, David G.; Synatzske, David R. 2012. Female white-tailed deer body condition and diet after a large spring wildfire. Rangeland Ecology & Management. 65(3): 309-312. [86325]
  • 247. Lyon, L. Jack; Crawford, Hewlette S.; Czuhai, Eugene; Fredriksen, Richard L.; Harlow, Richard F.; Metz, Louis J.; Pearson, Henry A. 1978. Effects of fire on fauna: a state-of-knowledge review--National fire effects workshop; 1978 April 10-14; Denver, CO. Gen. Tech. Rep. WO-6. Washington, DC: U.S. Department of Agriculture, Forest Service. 41 p. [25066]
  • 251. Maas, Deborah S.; Musson, Robin L.; Hayden, Timothy J. 2003. Effects of prescribed burning on game species in the southeastern United States, a literature review. ERDC/CERL TR-03-13. Champaign, IL: U.S. Army Corps of Engineers, Engineer Research and Development Center, Construction Engineering Research Laboratory. 71 p. [86560]
  • 281. Mobley, Hugh E.; Balmer, William E. 1981. Current purposes, extent, and environmental effects of prescribed fire in the South. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings of a symposium; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 15-21. [14803]
  • 304. Osborne, J. S.; McClanahan, R. D.; Gillis, E. B.; Nettles, V. F.; Florschutz, O. 1986. Effects of wildfires in a North Carolina pocosin on deer populations. [Publisher location unknown]: Southeast Deer Study Group. 1 p. Abstract. Available online: http://www.sedsg.com/index.asp [2013, May 20]. [86772]
  • 342. Robbins, Louise E.; Myers, Ronald L. 1992. Seasonal effects of prescribed burning in Florida: a review. Misc. Publ. No. 8. Tallahassee, FL: Tall Timbers Research. 96 p. [21094]
  • 356. Rutledge, Archibald. 1928. Wild life in forest fire. American Forests. 34(416): 451-453. [41660]
  • 358. Sampson, Arthur W. 1944. Plant succession on burned chaparral lands in northern California. Bull. 65. Berkeley, CA: University of California, College of Agriculture, Agricultural Experiment Station. 144 p. [2050]
  • 366. Shantz, H. L. 1947. The use of fire as a tool in the management of the brush ranges of California. Sacramento, CA: State of California, Department of Natural Resources, Division of Forestry. 156 p. [36305]
  • 373. Singer, Francis J.; Schreier, William; Oppenheim, Jill; Garton, Edward O. 1989. Drought, fires, and large mammals. BioScience. 39(10): 716-722. [67678]
  • 436. Vogl, Richard J. 1967. Controlled burning for wildlife in Wisconsin. In: Proceedings, 6th annual Tall Timbers fire ecology conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 47-96. [18726]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indirect Effects of Fire: Other factors

More info for the terms: competition, cover, fire exclusion, forb, liana, natural, parturition, shrubs, tree, vine

Interspecific interactions: White-tailed deer habitat use may be indirectly affected by that of other wildlife. For example, food habits of white-tailed deer and mule deer occasionally overlap [255,365]. With land use changes in the 1900s and early 2000s, white-tailed deer expanded into western regions, increasing interactions with other cervids including mule deer, moose (Alces americanus), and elk (Cervus elaphus) (see Threats). The increased interspecific interactions can lead to a greater risk of disease transmission, competition for resources, and in the case of mule deer, hybridization. According to a review, increased competition for resources between white-tailed deer and mule deer may have contributed in the decline of mule deer populations in the mid- to late 1900s in some regions [430]. Anthony and Smith [11] suggested that factors responsible for increased competition for resources between white-tailed deer and mule deer in southern Arizona were vegetation changes, overgrazing by livestock, and/or range fire exclusion during the early 1900s. For a review of interrelationships between white-tailed deer and other wildlife, see these reviews: [122,182,255,365,381]. See also White-tailed deer, other ungulate, and fire interactions. White-tailed deer habitat use may also be affected by that of livestock. For more information, see Livestock grazing.

Coarse woody debris: White-tailed deer may avoid areas with abundant coarse woody debris. See Logging slash and Physical barriers for more information.

Water: In most of the species' range, water requirements do not usually limit white-tailed deer distribution and abundance, but in arid regions the local distribution of white-tailed deer is influenced by the location of water [121,122,255,341,351,365]. For example, in Arizona, white-tailed deer selected areas <2,600 feet (800 m) from artificial and natural water sources, avoiding areas >3,900 feet (1,200 m) away (Ockenfels and others 1991 cited in [122]). In Texas, 79% of adult male white-tailed deer locations were within 3,300 feet (1,000 m) of a permanent water source, and 89% were within 4,900 feet (1,500 km) of a permanent water source during all seasons [448]. In Arizona, when water becomes scarce in June, white-tailed deer (especially pregnant does) move closer to permanent water but disperse when summer rains start [255]. Availability of drinking water did not appear to be a primary limiting factor for Key deer on Big Pine Key, but it may have limited year-round utilization of the outer Keys [148]. White-tailed deer are reluctant to use a water source lacking adjacent cover [8]. Water requirements for white-tailed deer vary with weather, physiological state and activity of individuals, and moisture content of forage [341]. Water developments appear to have benefited many deer populations in the arid Southwest [365] (see Water management). For reviews of white-tailed deer use of water in the Southwest, see Severson and Medina [365] and Rosenstock and others [351].

Fawning areas: During and soon after parturition, female white-tailed deer prefer areas with concealment cover [279]. Habitats with dense tall shrubs and/or saplings, regardless of habitat type, provide suitable concealment cover for fawns [368]. For example, in the Black Hills, sites chosen by fawns in ponderosa pine forest typically had more vertical and horizontal cover than those found on randomly selected sites [426]. Fulbright and Ortega-S. [121] stated that optimum cover for fawn bed sites in the southwestern and south-central United States consists of an overstory canopy of woody plants with an understory of mid- to tall grasses [121]. In Iowa, fawns chose bed sites with more woody plant cover and less medium- to short-growing forb cover, vine cover, and liana cover than in surrounding areas, with fawns selecting sunny slopes on relatively cool days and shady slopes on relatively warm days [166]. Depressions in pine flatwoods with saw-palmetto (Serenoa repens) provide shelter for fawns in Florida [148].

According to a review, "ideal" fawning cover in Wyoming consists of areas with shrubs or small trees 2 to 6 feet (0.6-1.8 m) tall, an overstory tree canopy cover of approximately 50%, slopes <15%, adequate succulent vegetation (especially in June), and available water within 600 feet (180 m) [302]. In southwestern Oregon, Columbian white-tailed deer fawns did not select or avoid certain habitats, but 74% of concentrated use areas of fawns was within 660 feet (200 m) of streams [338].

Poor concealment cover in fawning areas may result in high fawn mortality [121]. In areas where concealment cover is limited, such as in portions of the Midwest, parturient females may travel long distances to locate suitable fawning habitat [94,279,297], but in areas with abundant cover, such as in the Southeast, cover for fawning is seldom deficient unless disturbances such as fire or clearcuts are very large [143]. Livestock grazing may reduce important concealment cover [379].

  • 8. Anderson, Loren. 1994. Chapter VII - terrestrial wildlife and habitat. In: Miller, Melanie, ed. Fire effects guide. PMS 481/NFES 2394. Boise, ID: National Wildfire Coordinating Group, Prescribed Fire and Fire Effects Working Team: VII: 1-16. [69984]
  • 11. Anthony, Robert G.; Smith, Norman S. 1977. Ecological relationships between mule deer and white-tailed deer in southeastern Arizona. Ecological Monographs. 47(3): 255-277. [9890]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 143. Halls, Lowell K. 1973. Managing deer habitat in loblolly-shortleaf pine forest. Journal of Forestry. 71(21): 752-757. [34498]
  • 148. Hardin, James W.; Klimstra, Willard D.; Silvy, Nova J. 1984. Florida Keys. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 381-390. [14296]
  • 166. Huegel, Craig N.; Dahlgren, Robert B.; Gladfelter, H. Lee. 1986. Bedsite selection by white-tailed deer fawns in Iowa. The Journal of Wildlife Management. 50(3): 474-480. [86809]
  • 182. Jenks, Jonathan A.; Leslie, David M., Jr. 2011. Interactions with other large herbivores. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 287-309. [85228]
  • 255. Marchinton, R. Larry.; Hirth, David H. 1984. Behavior. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 129-168. [86443]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 297. Nixon, Charles M.; Mankin, Philip C.; Etter, Dwayne R.; Hansen, Lonnie P.; Brewer, Paul A.; Chelsvig, James E.; Esker, Terry L. 2007. White-tailed deer dispersal behavior in an agricultural environment. The American Midland Naturalist. 157(1): 212-220. [86379]
  • 302. Olson, Rich. 1992. White-tailed deer habitat requirements and management in Wyoming. B-964. Laramie, WY: University of Wyoming, Cooperative Extension Service. 17 p. [20678]
  • 338. Ricca, Mark A.; Anthony, Robert G.; Jackson, DeWaine H.; Wolfe, Scott A. 2003. Spatial use and habitat associations of Columbian white-tailed deer fawns in southwestern Oregon. Northwest Science. 77(1): 72-80. [65442]
  • 341. Richardson, Calvin; Lionberger, Jim; Miller, Gene. 2008. White-tailed deer management in the Rolling Plains of Texas. Austin, TX: Texas Parks and Wildlife Department. 36 p. [86797]
  • 351. Rosenstock, Steven S.; Ballard, Warren B.; Devos, James C., Jr. 1999. Viewpoint: benefits and impacts of wildlife water developments. Journal of Range Management. 52(4): 302-311. [85536]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 368. Shepperd, Wayne D.; Battaglia, Michael A. 2002. Ecology, silviculture, and management of Black Hills ponderosa pine. Gen. Tech. Rep. RMRS-GTR-97. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 112 p. [44794]
  • 379. Smith, Winston P.; Coblentz, Bruce E. 2010. Cattle or sheep reduce fawning habitat available to Columbian white-tailed deer in western Oregon. Northwest Science. 84(4): 315-326. [82214]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 426. Uresk, Daniel W.; Benzon, Ted A.; Severson, Kieth E.; Benkobi, Lakhdar. 1999. Characteristics of white-tailed deer fawn beds, Black Hills, South Dakota. Great Basin Naturalist. 59(4): 348-354. [86811]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]
  • 448. Webb, Stephen L.; Hewitt, David G.; Hellickson, Mickey W. 2007. Effects of permanent water on home ranges and movements of adult male white-tailed deer in southern Texas. Texas Journal of Science. 59(4): 261-276. [86384]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Home range

More info for the terms: cover, density, mast, mesic, parturition, tree

Adult white-tailed deer establish and traditionally use seasonal or year-round home ranges. According to reviews, mean annual home range sizes for migratory and nonmigratory white-tailed deer vary from 106 to 7,504 acres (43-3,037 ha) [94,279,392]. Home range sizes are influenced by individual sex and age, season, latitude, population density, habitat characteristics, and weather, among other factors [121,255,279,381]. Males tend to have larger home ranges than females [79,94,121,122,255,279,381,392]. Typically, the annual home range size of adult females is about 50% of that of adult males [279,381]. Adult female ranges are smallest around parturition [94,122,255,392]. Home range sizes of mothers and their fawns may increase with fawn age [121]. Adult male ranges are largest during the rut [94,122,255,392]. Yearlings often move farther and more frequently than other age classes [94,122,255,381].

At northern latitudes, white-tailed deer tend to have smaller home ranges during winter than summer due to cold temperatures and deep snow [94,255,392]. In New York, mean winter home ranges (334 acres (135 ha)) were smaller than summer home ranges (556 acres (225 ha)), partly because white-tailed deer congregated in yards during winter [419]. Travel within yards often is confined to small areas and frequently used trails [279]. In transitional forest in southeastern Quebec, where deep snow is common in winter, white-tailed deer occupied very large summer ranges (6,017 acres (2,435 ha)), whereas winter ranges were only 319 acres (129 ha) [227]. In northern regions, white-tailed deer often abandon historical wintering yards for nearby residential areas, where small home ranges result from localized concentrations of resources [392]. Reviews stated that white-tailed deer in northern latitudes have larger and less stable home ranges than those in southern latitudes [255,381].

In agricultural regions, winter ranges may be larger than summer ranges due to seasonal availability of crops. A study in agro-forested regions of Illinois, Michigan, Wisconsin, and Nebraska found that white-tailed deer tended to have larger home ranges during the nongrowing period of agricultural crops than during the growing period. In Nebraska in particular, average white-tailed deer home range size decreased from 677 acres (274 ha) during the nongrowing period to 252 acres (102 ha) during the growing period [446]. In agricultural areas of southwestern Minnesota, mean home range size of winter ranges (1,285 acres (520 ha)) was over twice that of summer ranges (568 acres (230 ha)). The authors suggested that in agricultural regions, summer ranges may be smaller than winter ranges because of abundant cover and nutritious forage throughout the landscape [39]. In other regions, white-tailed deer ranges also vary in response to the availability of seasonal forages. For example, in a mature oak-hickory/dogwood-northern spicebush (Lindera benzoin)) forests in Front Royal, Virginia, females increased their home ranges in fall to incorporate acorn-producing areas during September and October of "good" mast years (P<0.01), but no increase was detected during a poor mast year [269].

White-tailed deer in arid and semiarid regions generally have large home ranges because of widely distributed resources [392]. Home ranges in an area of the western South Texas Plains that received 20 inches (510 mm) of average annual rainfall were twice the size of those in an area in the Gulf Coast Prairies and Marshes region that received 37 inches (930 mm) of average rainfall (Inglis and others 1986 cited in [122]). In arid regions, home ranges tend to expand under mesic conditions and shrink during the dry season because animals remain close to water. In northeastern Mexico, mean home range size of female white-tailed deer during a year of abundant rainfall was larger than that in years of average rainfall (P=0.024), but in males it was similar. The plant community was a xerophilous shrubsteppe composed of tobosa (Pleuraphis mutica), pricklypear, tarbush (Flourensia cernua), honey mesquite, acacia (Acacia spp.), and Texas barometer bush (Leucophyllum frutescens). The authors suggested that when resource availability was high, females spent more time searching for and selecting food that was high in nutrients to support the costs of reproduction [29]. Because of its influence on forage and cover, livestock grazing may affect the use of white-tailed deer home ranges.

A review stated that white-tailed deer in relatively open habitats generally have larger home ranges than those in more densely vegetated areas [79,255,381]. In Florida, white-tailed deer home ranges in open portions of a bombing range were larger than those in wooded areas (Marchinton and Jeter 1967 cited in [255]). Home range size may also be larger in areas where habitats are less diverse [255,381]. Stewart and others [392] hypothesized that repeated disturbances, such as fire, that result in landscape mosaics of different successional stages could improve habitat for white-tailed deer and thereby reduce home range sizes [121,122]. The small home ranges of white-tailed deer on the George Reserve in Michigan (a 1,157-acre (464 ha), predator-free enclosure) were attributed to the high interspersion of habitat types on the reserve [27]. Geist [131] hypothesized that in areas with varied vegetation and terrain and abundant obstacles (e.g., downed wood and boulders), white-tailed deer establish small home ranges, but in areas where there is low habitat diversity and few obstacles, they have large home ranges or do not establish home ranges [131]. On Michigan's Upper Peninsula, white-tailed deer movements in winter were smaller in areas where the terrain was hilly to rugged and supported a wide variety of forests with a mixture of tree species than in areas where the topography was flat to rolling and forests were monotypic [434].

According to reviews, white-tailed deer home range size tends to decrease with increased population density [79,255]. For example, increases in home range size were observed in Florida after a population die-off (Bridges 1968, Smith 1970 cited in [79]). However, in southeastern Quebec, home range sizes were similar in a high-density population and in a low-density population despite greater forage abundance in the area with the high-density population [227].

Although many individuals make occasional excursions outside of seasonal home ranges, migratory adults of both sexes display site fidelity among years. Fidelity to summer home ranges tends to be stronger than fidelity to winter home ranges [94]. Does may also display fidelity to fawning areas. During the rut, adults of both sexes may move outside of their seasonal ranges [94,279]. A review noted instances in which white-tailed deer apparently starved to death rather than leave poor-quality range, even though food was available and accessible in adjacent areas [255]. Fidelity to home ranges can be so great that during a fire, white-tailed deer may not leave their home ranges even as they burn, and if they do leave, they typically return to their home ranges soon after fire. Shantz [366] noted that white-tailed deer and mule deer returned to their home ranges so soon after fire that they burned their feet. For more information, see Travel patterns.

  • 27. Beier, Paul; McCullough, Dale R. 1990. Factors influencing white-tailed deer activity patterns and habitat use. Wildlife Monographs. 109: 3-51. [86786]
  • 29. Bello, Joaquin; Gallina, Sonia; Equihua, Miguel. 2004. Movements of the white-tailed deer and their relationship with precipitation in northeastern Mexico. Interciencia. 29(7): 357-361. [86330]
  • 39. Brinkman, Todd J.; Deperno, Christopher S.; Jenks, Jonathan A.; Haroldson, Brian S.; Osborn, Robert G. 2005. Movement of female white-tailed deer: effects of climate and intensive row-crop agriculture. The Journal of Wildlife Management. 69(3): 1099-1111. [86308]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 227. Lesage, Louis; Crete, Michel; Huot, Jean; Dumont, A.; Ouellet, Jean-Pierre. 2000. Seasonal home range size and philopatry in two northern white-tailed deer populations. Canadian Journal of Zoology. 78(11): 1930-1940. [86381]
  • 255. Marchinton, R. Larry.; Hirth, David H. 1984. Behavior. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 129-168. [86443]
  • 269. McShea, William J.; Schwede, Georg. 1993. Variable acorn crops: responses of white-tailed deer and other mast consumers. Journal of Mammalogy. 74(4): 999-1006. [22615]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 366. Shantz, H. L. 1947. The use of fire as a tool in the management of the brush ranges of California. Sacramento, CA: State of California, Department of Natural Resources, Division of Forestry. 156 p. [36305]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]
  • 419. Tierson, William C.; Mattfeld, George F.; Sage, Richard W., Jr.; Behrend, Donald F. 1985. Seasonal movements and home ranges of white-tailed deer in the Adirondacks. The Journal of Wildlife Management. 49(3): 760-769. [86869]
  • 434. Verme, Louis J. 1973. Movements of white-tailed deer in upper Michigan. The Journal of Wildlife Management. 37(4): 545-552. [86785]
  • 446. Walter, W. David; VerCauteren, Kurt C.; Campa, Henry, III; Clark, William R.; Fisher, Justin W.; Hygnstrom, Scott E.; Mathers, Nancy E.; Nielsen, Clayton K.; Schauber, Eric M.; Van Deelen, Timothy R.; Winterstein, Scott, R. 2009. Regional assessment on influence of landscape configuration and connectivity on range size of white-tailed deer. Landscape Ecology. 24(10): 1405-1420. [81310]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Movements and home range

White-tailed deer may inhabit the same range throughout the year or migrate to separate summer-fall and winter ranges [173,279]. Migratory individuals use transitional ranges in spring and fall as they move between summer and winter ranges [173]. Migratory white-tailed deer are generally found in northern latitudes and in mountainous areas [255,279]. However, a single population may be comprised of migratory and nonmigratory individuals [173]. Individuals generally retain the same ranges from year to year and travel the same routes between ranges [94,173,255,293,381].

  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 173. Hygnstrom, Scott E.; Groepper, Scott R.; VerCauteren, Kurt C.; Frost, Chuck J.; Boner, Justin R.; Kinsell, Travis C.; Clements, Greg M. 2008. Literature review of mule deer and white-tailed deer movements in western and midwestern landscapes. Great Plains Research: A Journal of Natural and Social Sciences. Paper 962: 219-231. [85432]
  • 255. Marchinton, R. Larry.; Hirth, David H. 1984. Behavior. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 129-168. [86443]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 293. Nelson, Michael E.; Mech, L. David. 1999. Twenty-year home-range dynamics of a white-tailed deer matriline. Canadian Journal of Zoology. 77(7): 1128-1135. [85034]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Social behavior

More info for the term: cover

Social structure in white-tailed deer is organized around mixed "family" groups consisting of a maternal doe, her young of the year, and female offspring from previous years [94,255,279,381]. In some cases, not all individuals in family groups are close relatives. Family group size ranges from 2 to 12 individuals [94]. Males >1 year old form loose-knit "bachelor" groups ranging from 2 to 5 individuals [255,279,381]. Sexes are typically segregated throughout the year, except during the rut. However, temporary mixed-sex aggregations occasionally occur when food is scarce [255,279], when feeding in large, open areas [255], or during summer when family groups are split during the fawning period [381]. During the fawning period, pregnant females drive away young females and fawns of the previous year and isolate themselves in fawning areas. Females with fawns remain in fawning areas for 8 to 10 weeks, after which they re-form family groups with their yearling fawns [94,255,279,381]. Yearling males join adult male groups or form temporary associations with other yearling males [381]. Bachelor groups are formed of unrelated individuals [94]. Males are solitary during the rut, except when tending estrous females [94,255,381]. Individual family groups often fuse into larger groups during fall and winter, particularly in northern latitudes, where white-tailed deer aggregate in sheltered areas called yards [94,255,279]. These large winter aggregations typically use traditional wintering areas and migration routes. Small winter aggregations often consist of related individuals [279]. Winter aggregations may be comprised of as many as "several hundred" individuals [94]. The 360-mile² (930 km²) Mead Deer Yard on the Upper Peninsula of Michigan supported an estimated 43,000 white-tailed deer during the winter of 1987 (Ozoga 1995 cited in [94]). Group size may be inversely related to forest cover, with larger groups forming in open areas and smaller groups in forested areas [94,211,255,279]. The oldest females tend to dominate family groups, whereas the largest males tend to dominate bachelor groups. In mixed groups, males tend to be dominant over females [94,279,381]. White-tailed deer are not generally territorial, although they may defend fawning areas [94,121,255,279].
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 211. LaGory, Kirk E. 1986. Habitat, group size, and the behaviour of white-tailed deer. Behaviour. 98(1/4): 168-179. [86380]
  • 255. Marchinton, R. Larry.; Hirth, David H. 1984. Behavior. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 129-168. [86443]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

White-tailed deer have scent glands between the two parts of the hoof on all four feet, outside of each hind leg, and on the inside of each hind leg. Scent from these glands is used to communicate with other deer and secretions become especially strong during the mating season.

White-tailed deer produce several types of vocalizations such as grunts, wheezes, and bleats. These vocalizations, along with other sounds and postures, are used for communication (Smith, 1991). Injured deer utter a startlingly loud "blatt" or bawl. Whistles or snorts of disturbed white-tailed deer are the most commonly heard sounds.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

White-tailed deer have scent glands between the two parts of the hoof on all four feet, outside of each hind leg, and on the inside of each hind leg. Scent from these glands is used to communicate with other deer and secretions become especially strong during the mating season.

White-tailed deer produce several types of vocalizations such as grunts, wheezes, and bleats. These vocalizations, along with other sounds and postures, are used for communication (Smith, 1991). Injured deer utter a startlingly loud "blatt" or bawl. Whistles or snorts of disturbed white-tailed deer are the most commonly heard sounds.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day or night; mainly crepuscular, though daily activity may vary seasonally.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Life span and survival: Malnutrition and weather

More info for the terms: cover, severity

Malnutrition is often the leading cause of white-tailed deer deaths. In southern Llano County, Texas, starvation killed 28% and 54% of a white-tailed population during 2 years when rainfall was less than half the average and rangelands were in poor condition [405]. White-tailed deer die-offs due to food scarcity were reported in portions of the Northeast, Great Lakes, and southern Canada [264]. For example, in the early 1950s, when white-tailed deer populations in the Great Lakes region were "probably at their peak", severe winter weather resulted in 20,000 to 50,000 white-tailed deer deaths [33]. Poor forage in yards coupled with prolonged periods of deep snow can lead to high overwinter mortality. During a severe winter on the Upper Peninsula of Michigan in the mid-1980s, an estimated 11,000 of 43,000 wintering white-tailed deer died in the Mead Deer Yard (Ozoga 1995 cited in [279]).

Inclement weather influences the movement, productivity, and mortality rate of white-tailed deer by reducing growth and seasonal availability of food and by placing an energy stress on animals, making them more vulnerable to predation [124,264,274,279,291]. In the North, deep snow (approximately >16 inches (40 cm)) restricts white-tailed deer movement and forage availability and influences habitat use, all of which affect energy budgets and contribute to overwinter mortality [264,365,381]. A winter severity index that incorporated wind chill, snow depth, and the ability of the snow to support the body weight of white-tailed deer was positively correlated with mortality during 3 winters in the Upper Peninsula of Michigan [432]. Studies of an unhunted population on Huntington Wildlife Forest, New York, reported that white-tailed deer densities fluctuated widely, primarily in response to winter severity. The principal factor driving this fluctuation was the length of time white-tailed deer were confined by deep snow to winter rangelands. Populations grew only when winters were milder than average. During average to severe winters, populations remained constant or declined (Underwood 1990 cited in [357]). In the oak-hickory forest region of the East, harsh winters during years of acorn crop failure can adversely affect white-tailed deer production, especially on overpopulated rangelands [423] (see Diet).

Because survival may be heavily influenced by deep snow, white-tailed deer are potentially affected by large-scale climatic fluctuations, such as the North Atlantic Oscillation (NAO), that influence local temperature and precipitation patterns [326]. Researchers in Minnesota suggested that increased snow depths resulting from the NAO led to high white-tailed deer mortality and low recruitment and ultimately reduced white-tailed deer densities 3 years later [325,326]. Conversely, on Anticosti Island, Quebec, at the northern limit of the white-tailed deer's range, Simard and others [371] did not find negative effects of winter NAO on female survival.

In the Southwest, periodic droughts are common and may result in high white-tailed deer mortality through lowered plant productivity [10,122]. Drought can reduce hiding cover, which may make white-tailed deer fawns more susceptible to predation [19]. In a study in south-central Texas, reduced ground cover and poor nutrition due to severe drought resulted in high fawn mortality, especially due to predators, whereas fawn survival increased during the subsequent year when rainfall was higher and rangelands were improved. This suggested that predation was less if hiding cover was adequate [59]. A severe, year-long drought in desert shrub-desert grassland habitat of southeastern Arizona caused an apparent decline in local white-tailed deer and mule deer populations [10]. Populations of white-tailed deer were affected by severity of drought during early summer and fall in the Sonoran Desert of Arizona. Fawn survival was correlated with the June Palmer Drought Severity Index (PDSI) (r = 0.45, P< 0.05) and the November PDSI (r = 0.56, P< 0.01) from 1948 to 1978. Together, these drought indices accounted for about 34% of the annual variation in fawn survival [41]. In Prairie County, Montana, total amount of precipitation from July through April prior to fawning and percent of fawns in the population in spring were positively correlated (r=0.78, P=0.01) during 12 years [463]. Fawn recruitment was examined over 18 years across a precipitation gradient from western Texas (<15 inches (370 mm) of annual rainfall) to eastern Texas (>51 inches (1,300 mm)). In arid western Texas, recruitment was strongly and positively related to March through July precipitation totals. In eastern Texas, there was a negative relationship between recruitment and precipitation. The positive relationship to precipitation in western Texas was attributed to increased vegetation production. The increased production likely enhanced hiding cover and increased forage abundance. Negative relationships between recruitment and precipitation in the wetter regions of Texas were attributed to possible reduced forage quality due to dilution of forage nutrients and increased prevalence of diseases, parasites, and red imported fire ants (Solenopsis invicta) [132].

  • 10. Anthony, Robert G. 1976. Influence of drought on diets and numbers of desert deer. The Journal of Wildlife Management. 40(1): 140-144. [11558]
  • 19. Ballard, Warren. 2011. Predator-prey relationships. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 251-286. [85227]
  • 33. Blouch, Ralph I. 1984. Northern Great Lakes States and Ontario forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 391-410. [14297]
  • 41. Brown, David E.; Henry, Robert S. 1981. On relict occurrences of white-tailed deer within the Sonoran Desert in Arizona. The Southwestern Naturalist. 26(2): 147-152. [86414]
  • 59. Carroll, Bob K.; Brown, Dennis L. 1977. Factors affecting neonatal fawn survival in southern-central Texas. The Journal of Wildlife Management. 41(1): 63-69. [86810]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 124. Fuller, Todd K. 1991. Effect of snow depth on wolf activity and prey selection in north central Minnesota. Canadian Journal of Zoology. 69(2): 283-287. [86861]
  • 132. Ginnett, Tim F.; Young, E. L. Butch. 2000. Stochastic recruitment in white-tailed deer along an environmental gradient. The Journal of Wildlife Management. 64(3): 713-720. [86410]
  • 264. Matschke, George H.; Fagerstone, Kathleen A.; Harlow, Richard F.; Hayes, Frank A.; Nettles, Victor F.; Parker, Warren; Trainer, Daniel O. 1984. Population influences. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 169-188. [86444]
  • 274. Mech, L. David; Frenzel, L. D., Jr.; Karns, P. D. 1971. The effect of snow conditions on the vulnerability of white-tailed deer to wolf predation. In: Mech, L. David; Frenzel, L. D., Jr., eds. Ecological studies of the timber wolf in northeastern Minnesota. Res. Pap. NC-52. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 51-59. [13890]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 291. Nelson, Michael E.; Mech, L. David. 1986. Relationship between snow depth and gray wolf predation on white-tailed deer. The Journal of Wildlife Management. 50(3): 471-474. [86862]
  • 325. Post, Eric; Stenseth, Nils Christian. 1998. Large-scale climatic fluctuation and population dynamics of moose and white-tailed deer. Journal of Animal Ecology. 67(4): 537-543. [78093]
  • 326. Post, Eric; Stenseth, Nils Christian. 1999. Climatic variability, plant phenology, and northern ungulates. Ecology. 80(4): 1322-1339. [78533]
  • 357. Sage, Richard W., Jr.; Porter, William F.; Underwood, H. Brian. 2003. Windows of opportunity: white-tailed deer and the dynamics of northern hardwood forests of the northeastern United States. Journal for Nature Conservation. 10(4): 213-220. [46092]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 371. Simard, M. Anouk; Coulson, Tim; Gingras, Andres; Cote, Steeve D. 2010. Influence of density and climate on population dynamics of a large herbivore under harsh environmental conditions. The Journal of Wildlife Management. 74(8): 1671-1685. [86406]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 405. Teer, James G. 1984. Lessons form the Llano Basin, Texas. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 261-292. [86445]
  • 423. Torgerson, Oliver; Porath, Wayne R. 1984. Midwestern oak-hickory forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 411-426. [14298]
  • 432. Verme, Louis J. 1968. An index of winter weather severity for northern deer. The Journal of Wildlife Management. 32(3): 566-574. [86789]
  • 463. Wood, Alan K.; Mackie, Richard J.; Hamlin, Kenneth L. 1989. Ecology of sympatric populations of mule deer and white-tailed deer in a prairie environment. Bozeman, MT: Montana Department of Fish, Wildlife, and Parks, Wildlife Division. 97 p. [84933]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life span and survival: Predators

Principal predators of white-tailed deer include mountain lions (Puma concolor), bobcats (Lynx rufus), coyotes (Canis latrans), gray wolves (C. lupus), American black bears (Ursus americanus), and humans [19,79,122,271,279,381,430]. Predators may kill white-tailed deer of all sexes and ages and in all physical conditions, although fawns are particularly susceptible [19,170,209,255,279,328,381,430]. For more information, see Predation risk. For a review of white-tailed deer-predator relationships, see Ballard [19].
  • 19. Ballard, Warren. 2011. Predator-prey relationships. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 251-286. [85227]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 170. Huot, Jean; Potvin, Francois; Belanger, Michel. 1984. Southeastern Canada. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 293-304. [86446]
  • 209. Kunkel, Kyran; Pletscher, Daniel H. 1999. Species-specific population dynamics of cervids in a multipredator ecosystem. The Journal of Wildlife Management. 63(4): 1082-1093. [78159]
  • 255. Marchinton, R. Larry.; Hirth, David H. 1984. Behavior. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 129-168. [86443]
  • 271. Mech, L. David. 1984. Predators and predation. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 184-200. [14288]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 328. Poulle, M. L.; Crete, M.; Hout, J.; Lemieux, R. 1993. Predation exercee par le coyote, Canis latrans, sur le Cerf de Virginia, Odocoileus virginianus, dans un ravage en declin de l'est du Quebec. The Canadian Field-Naturalist. 107(2): 177-185. [24106]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life span and survival

According to reviews, white-tailed deer may live 20 years or more, but few live more than 10 years [79,381]. Another review stated that white-tailed deer have an average life span of 8 years, but most do not live past 4 or 5 years [264]. The life span of females is typically longer than that of males [279]. The average life expectancy of white-tailed deer in heavily hunted populations in Pennsylvania was 2 years for males and 3 years for females (Forbes and others 1979 cited in [79]). The maximum age for a female Key deer was 19 years (mean: 6.2 years), whereas the maximum age of a male Key deer was only 11 years (mean: 3.0 years) (Lopez and others 2000 cited in [279]).

  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 264. Matschke, George H.; Fagerstone, Kathleen A.; Harlow, Richard F.; Hayes, Frank A.; Nettles, Victor F.; Parker, Warren; Trainer, Daniel O. 1984. Population influences. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 169-188. [86444]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Most white-tailed deer live about 2 to 3 years. Maximum life span in the wild is 20 years but few live past 10 years old.

Typical lifespan

Status: wild:
10.0 (high) years.

Average lifespan

Status: wild:
2.0 years.

Average lifespan

Status: captivity:
16.0 years.

Average lifespan

Status: captivity:
23.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Most white-tailed deer live about 2 to 3 years. Maximum life span in the wild is 20 years but few live past 10 years old.

Typical lifespan

Status: wild:
10.0 (high) years.

Average lifespan

Status: wild:
2.0 years.

Average lifespan

Status: captivity:
16.0 years.

Average lifespan

Status: captivity:
23.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.6 years (captivity) Observations: In the wild, few animals live more than 5-10 years. One pregnant female was about 19-23 years of age (Ronald Nowak 1999). Record longevity, however, belongs to one wild born female who still alive at about 21.6 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding occurs from late October to mid-December; with a peak in November. Female receptive period lasts 1-2 days; if not impregnated, a female becomes receptive again in 3-4 weeks. Gestation varies among populations from 187 to 222 days. Litter of usually 1-2 (sometimes 3 in optimal habitat) is born in May-June. Young initially stay hidden for 1-2 weeks and are weaned usually by 10 weeks postpartum (by fall). Females first breed sometimes at 6-7 months or more typically at 1.5 years; males are sexually mature at about 18 months. Few live more than 10 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction and development

More info for the terms: density, litter, parturition

Gestation ranges from 187 to 213 days [98,279]. Like the breeding season, fawning periods vary regionally. Fawning tends to occur during a short period in summer in the North, whereas fawning periods are more variable and longer in the South (see Courtship and mating).

Growth: As parturition approaches, pregnant does move to fawning areas. Does with fawns may remain in these areas for 8 to 10 weeks [279]. At birth, males tend to be larger than females [98,279]; male fawns weigh 4.4 to 14.6 pounds (2.0-6.6 kg), and female fawns weigh 3.5 to 8.6 pounds (1.6-3.9 kg) [131]. Singletons generally are larger than fawns from larger litters [98,279].

After parturition, fawns grow rapidly. Neonates gain 0.4 pound (0.2 kg)/day on average, doubling their weight by about 2 weeks and tripling their weight within 1 month [381]. At about 6 months of age, females have reached about 50% of their maximum body mass, whereas males have obtained only about 35% of their maximum body mass. Generally, female body mass stabilizes at 3 to 4 years old and male body mass stabilizes at 4 to 5 years old, although females may stabilize as early as 2 years old and males as late as 7 years old [94,98,279]. In addition to gender, birth mass and growth rate to reproductive maturity are influenced by many variables, including maternal nutrition, habitat conditions, population density, and weather [221,279,282,381]. For more information on white-tailed deer growth, see the review by Ditchkoff [98].

Most white-tailed deer attain sexual maturity and can breed as yearlings [94,279]. However, yearling males are likely prevented from mating by older males. Fawns may become pregnant in areas with good forage conditions, although they tend to breed 1 to 1.5 months later than older does [279]. Fall weight largely determines whether or not female fawns breed [92,346]. In severely malnourished populations, the age at first parturition may be ≥2.5 years old [279].

Pregnancy rates and recruitment: Adult white-tailed deer usually give birth to twins. If they reproduce, fawns and yearlings usually produce singletons [79]. White-tailed deer can have as many as 5 fawns in a litter, although this is rare. Litter size and birth weight are associated positively with female age. Fawns and yearlings tend to have smaller litter sizes and have fawns with lower birth weights than prime-aged does. Nutrient demands of growth in young does compete with lactation, slowing growth during lactation. Reproduction can negatively influence the nutritional condition of a doe and result in reduced productivity the following year. According to a review, reproductive senescence generally occurs by 10 years old [98]. However, in north-central Minnesota, DelGiudice and others [88] found no measurable reduction in the number of young produced in white-tailed deer females up to 15 years old. Similarly, does >10 years old in the central Adirondack Mountains, New York, exhibited little reproductive senescence (Masters and Mathews 1990 cited in [98]). However, most white-tailed deer likely do not live to see reproductive senescence because very few animals live past 10 years old [98] (see Life span and survival).

White-tailed deer have large reproductive potential [92]. Adult does in the Northeast generally have pregnancy rates of 85% to 96% [265]. Pregnancy and ovulation rates of fawns reported in reviews ranged from 0% to 77% [79,279]. Pregnancy rates are influenced by local environmental conditions and nutritional status of does [279]. In white-tailed deer and cervids generally, body mass and condition of maternal does as they enter the breeding season directly affect conception and neonatal development and subsequent fawn development, body mass, and survival [108,381]. According to studies conducted on captive white-tailed deer by Verme and others [431,433], does fed a low plane of nutrition (similar to what might be expected during a severe northern winter) had longer gestational periods, lower fawn birth masses, and fewer incidences of twinning. In the southern Appalachian Mountains, changes in acorn abundance among years influenced reproductive output (Wentworth and others 1990a cited in [449]). The spring diet of pregnant does may be especially crucial to the survival of their fawns. Fawn mortality was <33% when captive white-tailed deer that were undernourished in winter were well-nourished in spring. However, when mothers were undernourished in both winter and spring, fawn mortality was 90% (Verme 1962 cited in [346]). On Anticosti Island, Quebec, where forage and winter browse were scarce and population density was high, female reproductive success was more influenced by spring and fall weather than by winter weather [371]. Severe winter weather can negatively influence resources available to does and result in low birth weights [272]. For information on the effects of weather on white-tailed deer recruitment, see Malnutrition and weather and the review by Ditchkoff [98].

  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 88. DelGiudice, Glenn D.; Lenarz, Mark S.; Powell, Michelle Carstensen. 2007. Age-specific fertility and fecundity in northern free-ranging white-tailed deer: evidence for reproductive senescence? Journal of Mammalogy. 88(2): 427-435. [86863]
  • 92. DeYoung, Charles A. 2011. Population dynamics. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 147-180. [85224]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 98. Ditchkoff, Stephen S. 2011. Anatomy and physiology. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 43-73. [85221]
  • 108. Feldhamer, George A. 2002. Acorns and white-tailed deer. Interrelationships in forest ecosystems. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 215-223. [43532]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 221. Leberg, Paul L.; Smith, Michael H. 1993. Influence of density on growth of white-tailed deer. Journal of Mammalogy. 74(3): 723-731. [86297]
  • 265. Mattfeld, George F. 1984. Eastern hardwood and spruce-fir forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 305-330. [14291]
  • 272. Mech, L. David.; Nelson, Michael E.; McRoberts, Ronald E. 1991. Effects of maternal and grandmaternal nutrition on deer mass and vulnerability to wolf predation. Journal of Mammalogy. 72(1): 146-151. [86404]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 282. Monteith, Kevin L.; Schmitz, Lowell E.; Jenks, Jonathan A.; Delger, Joshua A.; Bowyer, R. Terry. 2009. Growth of male white-tailed deer: consequences of maternal effects. Journal of Mammalogy. 90(3): 651-660. [86405]
  • 346. Rogers, Lynn L.; Mooty, Jack J.; Dawson, Deanna. 1981. Foods of white-tailed deer in the Upper Great Lakes Region -- a review. General Technical Report NC-65. St. Paul, MN: U.S. Dept. of Agriculture, Forest Service, North Central Forest Experiment Station. 24 p. [86350]
  • 371. Simard, M. Anouk; Coulson, Tim; Gingras, Andres; Cote, Steeve D. 2010. Influence of density and climate on population dynamics of a large herbivore under harsh environmental conditions. The Journal of Wildlife Management. 74(8): 1671-1685. [86406]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 431. Verme, Louis J. 1965. Reproduction studies on penned white-tailed deer. The Journal of Wildlife Management. 29(1): 74-79. [86864]
  • 433. Verme, Louis J. 1969. Reproductive patterns of white-tailed deer related to nutritional plane. The Journal of Wildlife Management. 33(4): 881-887. [86865]
  • 449. Wentworth, James M.; Johnson, A. Sydney; Hale, Philip E.; Kammermeyer, Kent E. 1992. Relationships of acorn abundance and deer herd characteristics in the southern Appalachians. Southern Journal of Applied Forestry. 16(1): 5-8. [18136]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Courtship and mating

White-tailed deer exhibit a tending-bond mating system where bucks pursue, defend, and court individual does [94,279]. Timing of the white-tailed deer's breeding season is linked to photoperiod [94,95,98,279], with a general continuum in breeding season timing associated with latitude. In the United States, white-tailed deer in northern regions tend to breed in November, whereas the breeding season in southern regions may be as late as January or February [98]. Breeding tends to occur in a discrete, synchronous period in northern populations, usually lasting about a month. It tends to be more protracted farther south, especially in Texas, Louisiana, Mississippi, Alabama, Florida, Georgia, and South Carolina, where peak breeding ranges from summer through late winter [95,279]. For example, peak breeding of white-tailed deer in portions of South Carolina occurs in September, in Georgia it occurs in November, and in portions of Alabama and Mississippi it occurs in December and January. Florida has the greatest range in breeding dates in the United States, from March in northwestern Florida to July in southern Florida [95]. White-tailed deer near the equator breed year-round [131,279]. Age and condition of individuals and possibly adult sex ratios may affect the timing of breeding. Adult does breed early in the rut, whereas fawns (0.5 year old) and yearlings (1.5 years old) breed later [94]. See Miller and others [279] and DeYoung and Miller [94] for more information on courtship and mating.

The interval between estrous periods ranges from 21 to 30 days [279,381]. True estrus lasts about 24 to 48 hours [94,381]. As many as 7 consecutive estrous periods may occur when does repeatedly fail to conceive [279,381]. Does may mate with >1 buck during a single estrous period, so twins may have different sires [94]

  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 98. Ditchkoff, Stephen S. 2011. Anatomy and physiology. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 43-73. [85221]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: polygynous

Most white-tailed deer mate in their second year, though some females occasionally mate as young as seven months. Mating occurs between October and December and females are pregnant for 6 and 1/2 months. In her first pregnancy, a female will usually only have one baby (fawn), but after that she may give birth to 2 or 3. Fawns are able to walk at birth. They are nursed several times a day until they are 8 weeks old, after which they begin to add vegetation to their diet. Fawns are weaned by 10 weeks old.

Breeding interval: White-tailed deer breed once yearly.

Breeding season: Breeding occurs from October to December, fawns are born in the spring.

Range number of offspring: 1.0 to 3.0.

Average gestation period: 6.5 months.

Range weaning age: 8.0 to 10.0 weeks.

Average age at sexual or reproductive maturity (female): 2.0 years.

Average age at sexual or reproductive maturity (male): 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 3000 g.

Average gestation period: 198 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
417 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
309 days.

White-tailed females are very protective of their babies. When looking for food, females leave their offspring in a hiding place for about four hours at a time. While waiting for their mother to return, fawns lay flat on the ground with their necks outstretched, well camouflaged against the forest floor. Fawns begin to follow their mother on her foraging trips once they are about 4 weeks old and are fully ruminant at two months old. White-tailed deer fawns are nursed for 8 to 10 weeks before they are weaned. Young males leave their mother after one year but young females often stay with their mother for two years.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: polygynous

Most whitetail deer (particularly males) mate in their second year, although some females occasionally mate as young as seven months. Bucks are polygamous although they may form an attachment and stay with a single doe for several days or even weeks until she reaches oestrus. Does are seasonally polyestrous and usually come into heat in November for a short twenty-four hour period. If a doe is not mated, a second estrus occurs approximately 28 days later. Mating occurs from October to December and gestation is approximately 6 and a half months. In her first year of breeding, a female generally has one fawn, but 2 per litter (occasionally 3 or 4) are born in subsequent years. Fawns are able to walk at birth and nibble on vegetation only a few days later.

Breeding interval: White-tailed deer breed once yearly.

Breeding season: Breeding occurs from October to December, fawns are born in the spring.

Range number of offspring: 1.0 to 3.0.

Average gestation period: 6.5 months.

Range weaning age: 8.0 to 10.0 weeks.

Average age at sexual or reproductive maturity (female): 2.0 years.

Average age at sexual or reproductive maturity (male): 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 3000 g.

Average gestation period: 198 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
417 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
309 days.

White-tailed females are very protective of their babies. When looking for food, females leave their offspring in a hiding place for about four hours at a time. While waiting for their mother to return, fawns lay flat on the ground with their necks outstretched, well camouflaged against the forest floor. Fawns begin to follow their mother on her foraging trips once they are about 4 weeks old and are fully ruminant at two months old. White-tailed deer fawns are nursed for 8 to 10 weeks before they are weaned. Young males leave their mother after one year but young females often stay with their mother for two years.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Odocoileus virginianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCATAAAGATATTGGCACCCTATATTTRCTATTTGGTGCTTGAGCAGGTATAGTAGGAACTGCCTTAAGCCTACTAATCCGTGCTGAACTGGGTCAACCTGGGACTCTACTCGGAGATGATCAAATTTATAACGTAATTGTTACCGCACATGCATTCGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGCAATTGACTTGTTCCATTAATAATTGGTGCTCCAGATATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTTCTCCCTCCCTCTTTTTTATTACTTCTAGCATCATCTATAGTTGAAGCCGGAGCAGGGACAGGCTGAACTGTTTATCCCCCTCTAGCTGGCAATCTAGCTCACGCAGGAGCTTCAGTAGACCTAACTATTTTTTCTCTACACTTGGCGGGTGTCTCCTCGATTTTAGGAGCTATTAACTTTATTACAACAATTATTAACATAAAACCCCCTGCTATATCACAATATCAAACTCCTTTATTTGTATGATCTGTATTAATTACTGCCGTACTGCTACTTCTCTCACTCCCTGTATTAGCAGCTGGAATTACAATACTATTAACAGACCGAAATTTAAACACAACCTTTTTCGATCCAGCAGGAGGCGGAGACCCCATCCTATATCAACACCTGTTCTGATTTTTCGGACATCCCGAAGTATATATTTTAATTTTACCTGGCTTTGGTATAATTTCCCATATTGTAACTTACTACTCGGGAAAAAAAGAACCATTTGGGTATATGGGAATAGTCTGAGCTATAATATCAATTGGATTTTTAGGGTTTATTGTATGAGCCCACCACATGTTTACAGTTGGAATAGACGTTGACACACGAGCCTATTTTACATCAGCCACTATAATTATTGCTATTCCAACAGGAGTAAAGGTCTTTAGTTGACTAGCAACACTTCATGGAGGCAACATTAAATGATCACCTGCTATAATATGAGCTCTAGGCTTTATTTTCCTTTTTACAGTTGGAGGACTAACCGGAATCGTCCTTGCTAATTCTTCTCTTGATATTGTTCTTCACGATACTTACTACGTAGTTGCACATTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATTATAGGTGGGTTTGTCCACTGATTTCCACTATTTTCAGGCTATACCCTTAATGATACATGAGCTAAAATCCATTTTGTAATTATATTCGTAGGCGTAAACATAACCTTTTTTCCACAACACTTCCTAGGACTTTCTGGCATACCACGACGATACTCTGATTACCCAGACGCATACACAATGTGAAATACAATCTCTTCTATAGGCTCATTTATTTCTCTAACAGCAGTTATACTAATAATTTTTATTATCTGAGAAGCATTTGCATCCAAGCGAGAAGTCTCAACCGTAGAATTAACAACRACAAATTTAGAGTGACTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCTACATACGTTAACTTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Odocoileus virginianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gallina, S. & Lopez Arevalo, H.

Reviewer/s
Black, P. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is considered to be Least Concern in light of its adaptability to a wide range of human dominated and natural habitats, occurrence in large populations, occurrence in many protected areas, and populations are currently stable. In some portions of the range the species has been increasing for almost a century (especially where large predators have been extirpated) while in other areas populations are small and in decline.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and common in many areas throughout the Americas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White-tailed deer are common throughout their habitats. Exact counts of their numbers have not been made, but there are probably somewhere between 8 and 15 million on this continent. Although they were in danger of extinction at the turn of they century due to overhunting, they have recently reached their highest numbers.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whitetail deer are extremely common throughout their ranges and are the most numerous of the large North American mammals. Precise estimates of their numbers have not been made, but there are probably somewhere between 8 and 15 million on this continent. Although their populations were decimated to the point of extinction in many areas at the turn of the century (due to overhunting), they have recently reached their highest numbers due to the improvement of their habitat by the cutting of climax forests, providing them with a greater amount of brush and shrubs on which to forage.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Key deer, Odocoileus virginianus clavium, is an Endangered subspecies and the Columbian white-tailed deer, Odocoileus virginianus leucurus, is Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Historically probably not as abundant as at the present time in northern populations. Range has expanded northward farther into Canada as a result of habitat changes caused by humans. White-tailed deer population estimated in the United States must be over 11,000,000 of which a third will be in the State of Texas. In Canada the estimation is a half of million deer (Whitehead 1993). Deer herds in Canada and mainly in the United states are overabundant, but in Mexico, Central America and South America most of the populations are declining, and most of the subspecies status are unknown.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
These threats are only considered for the subspecies of Central and South America: feral dogs may be a nuisance to deer in some areas (Causey and Cude 1980). Some populations in Venezuela are threatened by overhunting and habitat loss (Moscarella et al. 2003). Poaching is the other cause of local population extinction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feral dogs may be a nuisance to deer in some areas (Causey and Cude 1980). Some populations in Venezuela are threatened by overhunting and habitat loss (Moscarella et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations: Threats

More info for the terms: cover, fire exclusion, fire frequency, fire occurrence, frequency, fuel, shrub, shrubs, succession, tree, xeric

Adams and Hamilton [3] described the history of white-tailed populations as follows: periods of American Indian exploitation (before 1800), moderate recovery (1800-1850), European-American exploitation (1850-1900), protection and recovery (1900-1975), and in contemporary times (after 1975), a period of managing "quality" white-tailed deer populations and curbing overabundance in many areas. Before European settlement, white-tailed deer were likely abundant over much of their range [392]. Extensive land clearing and agricultural development over much of the white-tailed deer's range came with European settlement, resulting in expansion of white-tailed deer populations [381,392], but then numbers were reduced as a result of overhunting [381]. Subsequently, in the late 19th and early 20th centuries, large agricultural lands in the East were abandoned, resulting in extensive reforestation [392]. Populations recovered after World War II, partly due to reforestation but also due to hunting restrictions and successful reintroductions in many areas [381]. Since the mid-1900s there has been a pronounced decline in the extent of early-successional forest across much of the eastern United States because of forest succession, development, and fire exclusion [3,33,181,225,392,424].

Successional changes since European-American exploitation, and particularly during the 1900s, may have benefitted white-tailed deer in the Great Plains and Southwest. On many rangelands in these regions, cover and forage increased due to encroachment of woody plants onto areas formerly dominated by grasses due to historical livestock grazing practices, alterations of fire patterns, and possibly climatic shifts [121,138,365,430]. Arno and others [13] concluded that after 1900, understory shrubs and fir saplings in western larch, ponderosa pine, and Douglas-fir forests in the Swan Valley, Montana, increased as a result of fire exclusion, which enhanced forage and cover for white-tailed deer on both summer and winter rangelands. The authors stated that predator control and hunting regulations may have further contributed to increased white-tailed deer populations in the early 1900s. The white-tailed deer population peaked in the mid-1950s. Populations then declined as forests canopies closed and understory shrubs declined. Heavy timber harvesting started in the 1950s. Although resulting in seral shrub communities generally favorable to white-tailed deer, it also reduced winter rangelands for decades [13]. Irrigation may have encouraged the extension of white-tailed deer rangelands into western Texas and other arid regions of the Southwest [381]. Historically, white-tailed deer occurred in only the southern parts of a few Canadian provinces, but logging and forest fires, fire exclusion from prairies, and increased agriculture have contributed to extension of their range farther north into Canada [279,381].

Urban development (habitat loss) and its associated risks (e.g., motor vehicle collisions and human interactions) are considered the greatest threat to Key deer populations [242]. Key deer are also at risk from large-scale environmental changes such as those caused by hurricanes [240].

Nonnative invasive plants: Spread of nonnative invasive plants may be harmful, neutral, or beneficial to white-tailed deer. Taber and Murphy [403] considered nonnative cheatgrass (Bromus tectorum) of "little benefit to deer". One source suggested that carrying capacity of rangelands for white-tailed deer may not be affected by nonnative invasive plants. Along the Selway River in Idaho, where population densities ranged from 0.01 to 0.05 white-tailed deer/ha during winter, spotted knapweed (Centaurea stoebe subsp. micranthos) infestation of xeric south and west-facing slopes on winter range did not appear to affect white-tailed deer carrying capacity in winter when compared with bluebunch wheatgrass-sedge sites [466]. Other researchers show that white-tailed deer commonly consume nonnative invasive plants and may benefit from them [103,245,398,400,454,466]. For example, Canada thistle (Cirsium arvense) provided cover for Columbian white-tailed deer in Washington in summer, allowing them to use previously unused areas [400]. Along the Selway River in Idaho, spotted knapweed was a major food item in white-tailed deer diets. White-tailed deer and mule deer ate spotted knapweed seed heads, particularly when snow was on the ground and seed heads were easily obtainable above the snow. In fact, the seed heads were one of the few foods readily available to deer in open areas when snow was >12 inches (30 cm) deep. White-tailed deer also ate large amounts of spotted knapweed rosettes, particularly in spring after snowmelt [466]. Roche and others [343] suggested that diffuse knapweed (C. diffusa) and spotted knapweed may be important forage for white-tailed deer in the Kootenay Ranges of British Columbia. Stromayer and others [398] suggested that Chinese privet (Ligustrum sinense) be managed as an important winter forage for white-tailed deer in northwestern Georgia. Williams [454] suggested that nonnative invasive shrubs may offer important cover for white-tailed deer in some areas of the eastern and midwestern United States.

White-tailed deer may contribute to the spread of nonnative invasive plants by ingesting, transporting, and disseminating viable seeds of species such as spotted knapweed, leafy spurge (Euphorbia esula), purple loosestrife (Lythrum salicaria), and Morrow's honeysuckle (Lonicera morrowii) in their feces [222,287,300,429,439,455,456]. In addition, preferential foraging on native herbs and creation of open patches by white-tailed deer may facilitate invasions [106,198].

The spread of some nonnative invasive plants such as cheatgrass, red brome (B. rubens), Mediterranean grass (Schismus spp.), and medusahead (Taeniatherum caput-medusae) may indirectly effect white-tailed deer, mule deer, and other wildlife by increasing fuel loads and fire frequency, which may alter the structure and composition of native plant communities [339,340].

Climate change: During the 21st century, it is predicted that average surface temperatures will increase 4.5 to 7.2 °F (2.5-4.0 °C) throughout the range of the white-tailed deer in eastern North America (Intergovernmental Panel on Climate Change 2007 cited in [95]). Furthermore, in more northern latitudes, precipitation is predicted to increase 10% to 20%, occur less frequently, and occur with greater intensity [326]. The effect of climate warming on white-tailed deer is unresolved and predictions are conflicting. A review stated that forest vegetation changes as a result of climate change are unlikely to have major effects on white-tailed deer populations because white-tailed deer are generalists and occupy all forest types. However, the review also noted that predicted changes in the distribution of some key midwinter cover and forage species could have adverse effects on white-tailed deer. Eastern hemlock, for example, provides thermal and snow-interception cover and is predicted to be substantially reduced in most of the United States as a result of climate change [95]. In northern latitudes, more frequent fires and insect outbreaks (predicted to occur with climate warming) may shift forest age structure to younger age classes that would provide abundant forage for white-tailed deer [95]. Thompson and others [414] predicted that the combination of temperature rise and greater than average fire occurrence may reduce boreal forest in northern and eastern Ontario, leading to increased white-tailed deer abundance [414]. Computer simulations by Johnston and Schmitz [186] indicated that altered thermal conditions in the continental United States alone were unlikely to affect white-tailed deer's distribution because their physiological tolerance to heat would allow them to survive. Analyses of the effects of vegetation change indicated that the species should retain its distribution in most areas and may expand in some areas [186]. In the southwestern United States, climate is predicted to become warmer and drier during the 21st century, which could negatively affect white-tailed deer distribution and abundance by reducing free water and converting some preferred woodlands to desert plant communities [95,122]. In Florida, rising sea levels that may result from global warming would be detrimental to Key deer due to loss of already limited habitat [283].

Climate warming may increase the prevalence of diseases and parasites that could negatively impact white-tailed deer populations. In eastern Canada, for example, blacklegged ticks (Ixodes scapularis), the main vector of Lyme disease in North America, are predicted to spread through the region in 10 to 20 years, and white-tailed deer are an important overwinter host for blacklegged ticks [95]. Climate warming could also potentially result in increased reproduction and survival of biting midges (Culicoides spp.) that transmit epizootic hemorrhagic disease [95], a disease potentially fatal to white-tailed deer [55]. Predicted increases in fire occurrence could have interacting effects with disease prevalence and climate warming (see Fire effects on white-tailed deer diseases and parasites).

In the Boundary Waters Canoe Area Wilderness, Minnesota, warm-wet scenarios of global climate change predicted that northern whitecedar, eastern white pine, northern red oak, and yellow birch populations would be reduced by predicted high white-tailed deer populations. Establishment of 7 other tree species into the area is predicted to be reduced by the high white-tailed deer populations [119].

  • 3. Adams, Kip P.; Hamilton, R. Joseph. 2011. Management history. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 355-377. [85230]
  • 13. Arno, Stephen F.; Gruell, George E.; Mundinger, John G.; Schmidt, Wyman C. 1987. Developing silvicultural prescriptions to provide both deer winter habitat and timber. Western Wildlands. 12(4): 19-24. [344]
  • 33. Blouch, Ralph I. 1984. Northern Great Lakes States and Ontario forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 391-410. [14297]
  • 55. Campbell, Tyler A.; VerCauteren, Kurt C. 2011. Diseases and parasites. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 219-249. [85226]
  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 103. Duncan, Celestine A. 2005. Diffuse knapweed--Centaurea diffusa Lam. In: Duncan, Celestine L.; Clark, Janet K., eds. Invasive plants of range and wildlands and their environmental, economic, and societal impacts. WSSA Special Publication. Lawrence, KS: Weed Science Society of America: 26-35. [60229]
  • 106. Eschtruth, Anne K.; Battles, John J. 2009. Acceleration of exotic plant invasion in a forested ecosystem by a generalist herbivore. Conservation Biology. 23(2): 388-399. [74165]
  • 119. Frelich, Lee E.; Reich, Peter B. 2009. Wilderness conservation in an era of global warming and invasive species: a case study from Minnesota's Boundary Waters Canoe Area Wilderness. Natural Areas Journal. 29(4): 385-393. [77775]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 138. Gruell, George E. 1982. Fires' influence on vegetative succession--wildlife habitat implications and management opportunities. In: Eustace, C. D., compiler. Proceedings, Montana Chapter of the Wildlife Society. Billings, MT: The Wildlife Society: 43-50. [47049]
  • 181. Jenkins, B. C. 1946. What about controlled burning? Michigan Conservationist. 15(4): 12-14. [16763]
  • 186. Johnston, Kevin M.; Schmitz, Oswald J. 1997. Wildlife and climate change: assessing the sensitivity of selected species to simulated doubling of atmospheric CO2. Global Change Biology. 3(6): 531-544. [83234]
  • 198. Knight, Tiffany M.; Dunn, Jessica L.; Smith, Lisa A.; Davis, JoAnn; Kalisz, Susan. 2009. Deer facilitate invasive plant success in a Pennsylvania forest understory. Natural Areas Journal. 29(2): 110-150. [80573]
  • 222. Lefcort, H.; Pettoello, C. L. 2012. White-tailed deer trails are associated with the spread of exotic forbs. Natural Areas Journal. 32(2): 159-165. [86382]
  • 225. Leopold, Aldo; Sowls, Lyle K.; Spencer, David L. 1947. A survey of over-populated deer ranges in the United States. The Journal of Wildlife Management. 11(2): 163-177. [16799]
  • 240. Lopez, Roel R.; Silvy, Nova J.; Labisky, Ronald F.; Frank, Philip A. 2003. Hurricane impacts on Key deer in the Florida Keys. The Journal of Wildlife Management. 67(2): 280-288. [86355]
  • 242. Lopez, Roel R.; Vieira, Mark E. P.; Silvy, Nova J.; Frank, Philip A.; Whisenant, Shane W.; Jones, Dustin A. 2003. Survival, mortality, and life expectancy of Florida Key deer. The Journal of Wildlife Management. 67(1): 34-45. [86357]
  • 245. Lym, Rodney G.; Duncan, Celestine A. 2005. Canada thistle--Cirsium arvense (L.) Scop. In: Duncan, Celestine L.; Clark, Janet K., eds. Invasive plants of range and wildlands and their environmental, economic, and societal impacts. WSSA Special Publication. Lawrence, KS: Weed Science Society of America: 69-83. [60234]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 283. Monzon, Javier; Moyer-Horner, Lucas; Palamar, Maria Baron. 2011. Climate change and species range dynamics in protected areas. BioScience. 61(10): 752-761. [86834]
  • 287. Myers, Jonathan A.; Vellend, Mark; Gardescu, Sana; Marks, P. L. 2004. Seed dispersal by white-tailed deer: implications for long-distance dispersal, invasion, and migration of plants in eastern North America. Oecologia. 139(1): 35-44. [48524]
  • 300. Olson, Bret E. 1999. Grazing and weeds. In: Sheley, Roger L.; Petroff, Janet K., eds. Biology and management of noxious rangeland weeds. Corvallis, OR: Oregon State University Press: 85-96. [35714]
  • 326. Post, Eric; Stenseth, Nils Christian. 1999. Climatic variability, plant phenology, and northern ungulates. Ecology. 80(4): 1322-1339. [78533]
  • 339. Rice, Peter M. 2005. Downy brome--Bromus tectorum L. In: Duncan, Celestine L.; Clark, Janet K., eds. Invasive plants of range and wildlands and their environmental, economic, and societal impacts. WSSA Special Publication. Lawrence, KS: Weed Science Society of America: 147-170. [60251]
  • 340. Rice, Peter M. 2005. Medusahead--Taeniatherum caput-medusae (L.) Nevski. In: Duncan, Celestine L.; Clark, Janet K., eds. Invasive plants of range and wildlands and their environmental, economic, and societal impacts. WSSA Special Publication. Lawrence, KS: Weed Science Society of America: 171-178. [60252]
  • 343. Roche, Ben F., Jr.; Roche, Cindy Talbott. 1999. Diffuse knapweed. In: Sheley, Roger L.; Petroff, Janet K., eds. Biology and management of noxious rangeland weeds. Corvallis, OR: Oregon State University Press: 217-230. [35725]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]
  • 398. Stromayer, Karl A. K.; Warren, Robert J.; Harrington, Timothy B. 1998. Managing Chinese privet for white-tailed deer. Southern Journal of Applied Forestry. 22(4): 227-230. [43438]
  • 400. Suring, Lowell H.; Vohs, Paul A., Jr. 1979. Habitat use by Columbian white-tailed deer. The Journal of Wildlife Management. 43(3): 610-619. [37245]
  • 403. Taber, Richard D.; Murphy, James L. 1971. Controlled fire in the management of North American deer. In: The scientific management of animal and plant communities for conservation: Proceedings, 11th symposium of the British Ecological Society; 1970 July 7-9; Norwich, Great Britian. Oxford: Blackwell Scientific Publications: 425-435. [16732]
  • 414. Thompson, Ian D.; Flannigan, Michael D.; Wotton, B. Michael; Suffling, Roger. 1998. The effects of climate change on landscape diversity: an example in Ontario forests. Environmental Monitoring and Assessment. 49(2-3): 213-233. [86408]
  • 424. Troester, Herbert G. 1970. Managed prairie burning for wildlife. North Dakota Outdoors. 32(11): 7-9. [14898]
  • 429. Vellend, Mark. 2002. A pest and an invader: white-tailed deer (Odocoileus virginianus Zimm.) as a seed dispersal agent for honeysuckle shrubs (Lonicera L.). Natural Areas Journal. 22(3): 230-234. [43284]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]
  • 439. Wald, Eric J.; Kronberg, Scott L.; Larson, Gary E.; Johnson, W. Carter. 2005. Dispersal of leafy spurge (Euphorbia esula L.) seeds in the feces of wildlife. The American Midland Naturalist. 154(2): 342-357. [60036]
  • 454. Williams, Charles E. 1997. Potential valuable ecological functions of nonindigenous plants. In: Luken, James O.; Thieret, John W., eds. Assessment and management of plant invasions. Springer Series on Environmental Management. New York: Springer-Verlag: 26-34. [41202]
  • 455. Williams, Scott C.; Ward, Jeffrey S. 2006. Exotic seed dispersal by white-tailed deer in southern Connecticut. Natural Areas Journal. 26(4): 383-390. [65075]
  • 456. Williams, Scott C.; Ward, Jeffrey S.; Ramakrishnan, Uma. 2008. Endozoochory by white-tailed deer (Odocoileus virginianus) across a suburban/woodland interface. Forest Ecology and Management. 255(3-4): 940-947. [70535]
  • 466. Wright, Anthony L.; Kelsey, Rick G. 1997. Effects of spotted knapweed on a cervid winter-spring range in Idaho. Journal of Range Management. 50(5): 487-496. [27926]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The main problem in USA and Canada is overabundance, and the consequences are the problems caused to humans, as pests, accidents, and one of the most serious are epidemiology and diseases like Lyme disease and others. So policies are needed to reduce populations. Meanwhile the southern populations have problems to survive and some are threatened by different causes. The species occurs in several protected areas across its range.
The populations of Guatemala are listed on CITES Appendix III (as Odocoileus virginianus mayensis).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: See Wood and Wolfe (1988) for discussion of viability of intercept feeding to reduce collisions.

Chemical repellents are largely ineffective in protecting agricultural, nursery, and landscaping plants from deer browsing (most effective product is "Big Game Repellent").

See Girard et al. (1993) for information on managing conflicts with animal activists on nature preserves.

See Halls (1984), Williamson (n.d.), Hygnstrom and Craven (1988), and Cypher and Cypher (1988) for management information. See Ellingwood and Caturano (1988) for wildlife bureau perspective on deer management.

See Jones and Whitham (1990) for information on post-translocation survival and movements of metropolitan deer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations: Population management

More info for the term: density

White-tailed deer are hunted by humans throughout their range [121,264,279]. Hunting can alter population density, sex ratios, behavior, movements, and life span [94,264]. Historically, overhunting has reduced white-tailed deer populations (see Threats). See these reviews for information on harvest and management of white-tailed deer populations [3,121,146,179,264,430].
  • 3. Adams, Kip P.; Hamilton, R. Joseph. 2011. Management history. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 355-377. [85230]
  • 94. DeYoung, Randy W.; Miller, Karl V. 2011. White-tailed deer behavior. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 311-351. [85229]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 146. Hansen, Lonnie. 2011. Extensive management. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 409-451. [85233]
  • 179. Jacobson, Harry A.; DeYoung, Charles A.; DeYoung, Randy W.; Fulbright, Timothy E.; Hewitt, David G. 2011. Management on private property. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 453-479. [85234]
  • 264. Matschke, George H.; Fagerstone, Kathleen A.; Harlow, Richard F.; Hayes, Frank A.; Nettles, Victor F.; Parker, Warren; Trainer, Daniel O. 1984. Population influences. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 169-188. [86444]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 430. VerCauteren, Kurt C.; Hygnstrom, Scott E. 2011. Managing white-tailed deer: midwest North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 501-535. [85236]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations: Habitat management

More info for the terms: competition, cover, density, dispersion, fire management, forb, forbs, mast, prescribed fire, presence, shrubs, succession

Disturbance can produce high-quality habitat for white-tailed deer by favoring forage growth and by creating ecotones between areas of dense cover and more open feeding areas. Conversely, loss of cover over large areas can be detrimental to white-tailed deer [79,95]. Several researchers suggested that resource managers consider proximity of food, cover, and water before implementing actions that may impact white-tailed deer habitats (e.g., [33,95,121,143,310]). Stewart and others [392] suggested that because male and female white-tailed deer often use different habitats (see Age and sex), they should be managed as if they were separate species.

Prescribed fire: For information on the use of prescribed fire in white-tailed deer habitats, see Fire Management Considerations.

Logging: White-tailed deer generally benefit from early-successional vegetation that establishes after logging and other disturbances [79]. Logging may benefit white-tailed deer because early-seral habitats often contain a greater variety, quantity, and quality of white-tailed deer forage than mature forests (e.g., [313]). A lack of food and cover immediately after clearcutting may be detrimental to white-tailed deer. In the long term, food may be scarce over a large area as the forest matures to midsuccession [56,143]. The duration of logging benefits to white-tailed deer varies with forest type, soils, climate, and other factors. A study in the western redcedar-western hemlock zone of northern Idaho concluded that clearcuts produce maximal quantities of browse from about 15 years after logging [319]. In ponderosa pine forest on the Kaibab National Forest in northern Arizona, herbage production peaked at 6 years after logging and then declined. After 15 to 20 years, it was about the same as on uncut areas [334]. In the eastern mixed forest region, DeGarmo and Gill (1958 cited in [20]) reported that clearcuts supply abundant forage for up to 10 years. Thereafter, browse plants grow out of reach and form dense thickets that white-tailed deer are reluctant to enter. DeGraaf and Yamasaki [87] recommended group-selection cutting or patch cutting approximately every 10 to 15 years to benefit white-tailed deer in the Northeast. In southeastern loblolly pine-shortleaf pine-hardwood forests, herb production typically peaks 2 to 3 years after thinning and then declines. Browse production typically peaks in about 5 to 8 years [143]. Use of prescribed fire, herbicides, soil scarification, planting of seeds and seedlings, and other site preparation may shorten or lengthen the time white-tailed deer use a logged site [95]. In addition, succession following clearcutting may be affected by heavy white-tailed deer browsing (see White-tailed deer foraging effects). White-tailed deer use of logged areas is modified by opening size, logging slash, weather, particularly snow depth, and other factors. A review stated that managing for a mix of forest ages (early-successional, midsuccessional, and mature) is most likely to benefit white-tailed deer. Early-successional forests provide food for white-tailed deer in the form of woody browse, forbs, and soft mast, while midsuccessional and mature forests provide less browse and forbs, but more hard mast [33,95] (see Successional status).

Size and shape of openings: The size and distribution of clearcuts in space and time are important to white-tailed deer, which is also likely true of burned sites (see Size and shape of burned areas). In boreal forest in western Alberta, the size and dispersion of 2- to 9-year-old clearcut blocks and type of treatment best explained white-tailed deer and mule deer use of clearcuts (R²=0.21, P<0.01). Deer showed a strong preference for clearcut blocks that were <40 acres (16 ha) and because they preferred areas within clearcuts that were <330 feet (100 m) from cover, they favored configurations that provided a high degree of edge per unit area. They also preferred clearcuts that were either scarified or scarified then burned under prescription compared with untreated clearcuts. The authors suggested that such treatments may have led to greater abundance of preferred herbaceous species and reduced logging slash, which benefited deer. Clearcut blocks in clumped patterns appeared unfavorable [422]. A review stated that several studies found that deer likely benefitted from the creation of small openings in dense ponderosa pine stands [64]. In Wisconsin, white-tailed deer made greater use of clearings <5 acres (2 ha) or <330 feet (100 m) wide than they made of larger or wider ones (McCaffery and Creed 1969 cited in [407]). Estimates of optimum size of a clearcut vary from <25 acres to <320 acres (10-130 ha), but according to a review, small clearcuts (25-50 acres (10-20 ha)) are most beneficial to white-tailed deer. The authors recommended that the distance across clearcuts be no more than twice the distance a white-tailed deer generally moves from the forest edge, approximately 600 to 800 feet (183-244 m) [267]. Reviews and Habitat management guidelines recommend approximately 40% to 60% of the landscape provide openings for foraging, with the remainder providing cover [45,302]. However, Cypher and Cypher [79] suggested that distribution of openings in a landscape is more important than the amount of area that is open. They recommended that openings occur in areas accessible to white-tailed deer (i.e., within their home range) and not be "too large" [79] (see Edge habitat). Halls [143] suggested that clearcuts in southeastern loblolly pine-shortleaf pine-hardwood forests be 20 to 100 acres (8-40 ha) because smaller areas are likely to be overbrowsed and larger areas may reduce habitat diversity. Patton [310] recommended small, irregular clearcuts in ponderosa pine/Gambel oak (Quercus gambelii) forest on the Apache National Forest be placed adjacent to stands of saplings, pole timber, and sawtimber to increase habitat diversity and grass, forb, and browse production beneficial to white-tailed deer.

Logging slash: Depending upon its density, logging slash may be detrimental or beneficial to white-tailed deer. A review stated that abundant logging slash generally impedes white-tailed deer and mule deer movements and may act as a barrier to deer use of an area [53]. In quaking aspen stands on the Apache and Coconino National Forests, deer use was lower in thinned stands with abundant slash than unthinned stands despite greater density of perennial grasses, forbs, and quaking aspen sprouts in thinned stands. Apparently, the amount of woody debris in thinned stands reduced use by deer [336]. Conversely, some logging slash provides cover for white-tailed deer. In a selectively cut ponderosa pine forest in Arizona, deer pellet groups were more numerous where slash was undisturbed after logging. Slash abundance was 1.7 times greater on sites where slash was undisturbed than on sites where it was piled and burned, but forbs were more abundant where slash was piled and burned. The author suggested that slash may have provided protective cover [335]. In Arizona, Neff (1980 cited in [64]) found that deer showed no preference for either the presence or absence of slash in small (1-10 acres (0.4-4.0 ha)) openings in ponderosa pine stands. Slash burning often favors establishment of seral shrubs, many of which are preferred white-tailed deer browse species [319]. For information about effects of postfire debris accumulations, see Physical barriers.

Weather and use of clearcuts: Similar to their use of burned areas (see Weather and use of burned areas), white-tailed deer may not use clearcuts because of deeper snow than in mature forests [101]. For example, in white spruce forest near Hinton, Alberta, white-tailed deer and other ungulates used strip clearcuts almost exclusively in summer during a 5-year study but used the clearcuts "very little" in winter [390].

Livestock grazing: Influences of livestock grazing on white-tailed deer can be detrimental, neutral, or beneficial [60,121,122,365]. Grazing, as well as the physical presence of cattle (Bos taurus), domestic sheep (Ovis aries), domestic goats (Capra hircus), and other livestock can reduce forage and also cause behavioral changes and altered activity budgets that make foraging less productive [60,121,122,365]. On rotationally burned longleaf pine-bluestem (Andropogon spp.) winter rangelands in Louisiana that were continuously grazed by livestock, tame white-tailed deer selected more herbs and less browse than white-tailed deer on rotationally burned rangelands that were not grazed by livestock, suggesting that white-tailed deer diets changed as a result of livestock grazing [411]. Along the Yellowstone River in eastern Montana, only 5% of daytime white-tailed deer locations over all seasons were in areas where cattle occurred. Locations of white-tailed deer indicated an "immediate exodus" of white-tailed deer from areas after cattle were introduced. White-tailed deer resumed use of the areas after cattle were removed [69].

A review stated that white-tailed deer are better adapted to browsing and select plants with higher nutritional quality than cattle, which have better ability to digest low-quality grasses, thus making forage competition minimal [60]. However, white-tailed deer and cattle diets overlap somewhat (range: 15%-60%) depending upon location, duration and type of grazing (continuous vs. rotational), and time of year [60]. Overlap may increase as forage becomes less available, typically in winter and early spring [44,60,121]. Domestic sheep and domestic goats compete more directly with white-tailed deer for forage than cattle because their diets overlap more [44,121]. A review stated that competition between livestock and white-tailed deer is particularly severe in habitats that are overgrazed [121].

Fawn survival may be lower in areas with livestock grazing due to removal of hiding cover and reduced forage [121]. During a drought year on Texas rangelands, a November helicopter survey showed no fawns with any of 65 females sighted in a short-duration grazed area, whereas fawns were sighted at a ratio of 0.27 fawn:female for 164 females sighted in an adjacent continuously grazed area. During 2 other years, when rainfall was greater, fawns were sighted at similar ratios in both areas. The author speculated that coyote predation on fawns might have been higher in the short-duration grazed area during the drought year because the area had less hiding cover compared to the continuously grazed area (Hyde 1987 cited in [140]). During the drought year, female white-tailed deer harvested quarterly on the short-duration grazed and continuously grazed areas were similar in field-dressed weight, kidney fat index, and fawns in utero (Kohl and others 1987 unpublished data cited in [140]). High, continuous cattle, domestic sheep, and domestic goat grazing in 96-acre (39 ha) fenced pastures was associated with lower weights and reduced fat content in stocked female white-tailed deer, reduced recruitment, and decreased adult white-tailed deer survival. The study sites were in a live oak-shinoak (Quercus virginiana-Q. sinuata var. breviloba) savanna at the Kerr Wildlife Management Area, Texas [268]. For more information, see these reviews: [60,121,122,365].

Water management: A review stated that water developments have likely benefitted white-tailed deer populations in the Southwest [351]. Another review noted that while white-tailed deer commonly use water developments for livestock, there is no documentation that livestock watering facilities increased white-tailed deer populations or productivity in Oklahoma, Texas, or northern Mexico [121]. For specific development and management ideas to consider, see the review by Olson [302].

  • 20. Barber, Harold L. 1984. Eastern mixed forest. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 345-354. [14293]
  • 33. Blouch, Ralph I. 1984. Northern Great Lakes States and Ontario forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 391-410. [14297]
  • 44. Bryant, F. C.; Kothmann, M. M.; Merrill, L. B. 1981. Diets of sheep, angora goats, Spanish goats, and white-tailed deer under excellent range conditions. Journal of Range Management. 32(6): 412-417. [82629]
  • 45. Bryant, Fred C.; Demarais, Steve. 1991. Habitat management guidelines for white-tailed deer in south and west Texas. In: Lutz, R. Scott; Wester, David B., eds. Research highlights--1991: Noxious brush and weed control; range and wildlife management. Volume 22. Lubbock, TX: Texas Tech University, College of Agricultural Sciences: 9-13. [18350]
  • 53. Campbell, Dan L. 1982. Influence of site preparation on animal use and animal damage to tree seedlings. In: Baumgartner, David M., compiler. Site preparation and fuels management on steep terrain: Proceedings of a symposium; 1982 February 15-17; Spokane, WA. Pullman, WA: Washington State University, Cooperative Extension: 93-101. [18536]
  • 56. Carlson, Peter C.; Tanner, George W.; Wood, John M.; Humphrey, Stephen R. 1993. Fire in Key deer habitat improves browse, prevents succession, and preserves endemic herbs. The Journal of Wildlife Management. 57(4): 914-928. [23003]
  • 60. Chaikina, Natalia A.; Ruckstuhl, Kathreen E. 2006. The effect of cattle grazing on native ungulates: the good, the bad, and the ugly. Rangelands. 28(3): 8-14. [63224]
  • 64. Clary, Warren P. 1987. Overview of ponderosa pine bunchgrass ecology and wildlife habitat enhancement with emphasis on southwestern United States. In: Fisser, Herbert G., ed. Wyoming shrublands: Proceedings, 16th Wyoming shrub ecology workshop; 1987 May 26-27; Sundance, WY. Laramie, WY: University of Wyoming, Department of Range Management, Wyoming Shrub Ecology Workshop: 11-21. [13913]
  • 69. Compton, Bradley B.; Mackie, Richard J.; Dusek, Gary L. 1988. Factors influencing distribution of white-tailed deer in riparian habitats. The Journal of Wildlife Management. 52(3): 544-548. [86775]
  • 79. Cypher, Brian L.; Cypher, Ellen A. 1988. Ecology and management of white-tailed deer in northeastern coastal habitats: a synthesis of the literature pertinent to National Wildlife Refuges from Maine to Virginia. U.S. Fish and Wildlife Service Biological Report 88(15). Washington, DC: U.S. Fish and Wildlife Service. 52 p. [85101]
  • 87. DeGraaf, Richard M.; Yamasaki, Mariko. 2003. Options for managing early-successional forest and shrubland bird habitats in the northeastern United States. Forest Ecology and Management. 185(1-2): 179-191. [48395]
  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 101. Drolet, C. -A. 1978. Use of forest clear-cuts by white-tailed deer in southern New Brunswick and central Nova Scotia. The Canadian Field-Naturalist. 92(3): 275-282. [85141]
  • 121. Fulbright Timothy Edward; Ortega-S., J. Alfonso. 2006. White-tailed deer habitat: ecology and management on rangelands. College Station, TX: Texas A&M University Press. 241 p. [85137]
  • 122. Fulbright, Timothy E. 2011. Managing white-tailed deer: western North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 537-563. [85237]
  • 140. Guthery, Fred S.; DeYoung, Charles A.; Bryant, Fred C.; Drawe, D. Lynn. 1990. Using short duration grazing to accomplish wildlife habitat objectives. In: Severson, Kieth E., tech. coord. Can livestock be used as a tool to enhance wildlife habitat? 43rd annual meeting of the Society for Range Management; 1990 February 13; Reno, NV. Gen. Tech. Rep. RM-194. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 41-55. [85213]
  • 143. Halls, Lowell K. 1973. Managing deer habitat in loblolly-shortleaf pine forest. Journal of Forestry. 71(21): 752-757. [34498]
  • 267. McGinnes, Burd S. 1969. How size and distribution of cutting units affect food and cover of deer. In: White-tailed deer in the southern forest habitat, proceedings of a symposium; 1969 March 25-26; Nacogdoches, TX. U.S. Department of Agriculture, Forest Service, Southern Forest Experiment Station: 66-70. In cooperation with: Forest Game Committee of the Southeastern Section of the Wildlife Society and Stephen F. Austin State University, School of Forestry. [86427]
  • 268. McMahan, Craig A.; Ramsey, Charles W. 1965. Response of deer and livestock to controlled grazing in central Texas. Journal of Range Management. 18(1): 1-7. [86845]
  • 302. Olson, Rich. 1992. White-tailed deer habitat requirements and management in Wyoming. B-964. Laramie, WY: University of Wyoming, Cooperative Extension Service. 17 p. [20678]
  • 310. Patton, David R. 1974. Patch cutting increases deer and elk use of pine forests in Arizona. Journal of Forestry. 72(12): 764-766. [86866]
  • 313. Patton, David R.; McGinnes, Burd S. 1964. Deer browse relative to age and intensity of timber harvest. The Journal of Wildlife Management. 28(3): 458-463. [16397]
  • 319. Pengelly, W. Leslie. 1963. Timberlands and deer in the northern Rockies. Journal of Forestry. 61(10): 734-740. [175]
  • 334. Reynolds, Hudson G. 1962. Effect of logging on understory vegetation and deer use in a ponderosa pine forest of Arizona. Res. Notes No. 80. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 7 p. [52690]
  • 335. Reynolds, Hudson G. 1966. Slash cleanup in a ponderosa pine forest affects use by deer and cattle. Research Note RM-64. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 3 p. [39274]
  • 336. Reynolds, Hudson G. 1969. Aspen grove use by deer, elk, and cattle in southwestern coniferous forests. Res. Note RM-138. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 3 p. [16745]
  • 351. Rosenstock, Steven S.; Ballard, Warren B.; Devos, James C., Jr. 1999. Viewpoint: benefits and impacts of wildlife water developments. Journal of Range Management. 52(4): 302-311. [85536]
  • 365. Severson, Kieth E.; Medina, Alvin L. 1983. Deer and elk Habitat management in the Southwest. Journal of Range Management. Monograph No. 2. Denver, CO: Society for Range Management. 64 p. [2110]
  • 390. Stelfox, John G. 1962. Effects on big game of harvesting coniferous forests in western Alberta. The Forestry Chronicle. 38(1): 94-107. [83264]
  • 392. Stewart, Kelley M.; Bowyer, R. Terry; Weisberg, Peter J. 2011. Spatial use of landscapes. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 181-217. [85225]
  • 407. Telfer, E. S. 1974. Logging as a factor in wildlife ecology in the boreal forest. The Forestry Chronicle. 50(5): 186-190. [16537]
  • 411. Thill, Ronald E.; Martin, Alton, Jr. 1986. Deer and cattle diet overlap on Louisiana pine-bluestem range. The Journal of Wildlife Management. 50(4): 707-713. [86438]
  • 422. Tomm, H. O.; Beck, J. A., Jr.; Hudson, R. J. 1981. Response of wild ungulates to logging practices in Alberta. Canadian Journal of Forest Research. 11(3): 606-614. [85750]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

Federal legal status: As of this writing (2013), a Columbian white-tailed deer population in Clark, Cowliz, Pacific, Skamania, and Wahkiakum counties, Washington, and Clatsop, Columbia, and Multnomah counties, Oregon, is Endangered. One population in Douglas County, Oregon, became a Delisted Taxon in 2003 due to recovery. The Key deer is Endangered throughout its range [425].

Other status: Information on state- and province-level protection status of animals in the United States and Canada is available at NatureServe, although recent changes in status may not be included.

Other management information:

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Causes damage when browsing in winter on agricultural and nursery crops and on ornamental plants around homes. Also may inhibit forest regeneration in certain situations (Tilghman 1989).

Deer-vehicle collisions (exceeding 20,000-30,000 per year in Michigan, New York, and Pennsylvania) often result when deer are attracted to sodium-rich roadsides that result from use of deicing salt.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

White-tailed deer will eat and destroy crops, vegetable gardens and fruit trees if they come into contact with them. When their numbers become too high, white-tailed deer can cause serious damage to forest vegetation because there are so many deer eating the plants. They are also involved in accidents with cars, often resulting in serious injury to the human occupants of the vehicles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

White-tailed deer are commonly hunted for meat and sport. Early settlers and Native Americans also used deer hides to make buckskin leather. White-tailed heads are also commonly mounted on the walls of lodges and other places of outdoor recreation.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Whitetail deer are destructive to crops, vegetable gardens, fruit trees, and ornamental plants where their ranges overlap with human habitation. When their numbers become too high, whitetail deer can cause serious damage to forest vegetation through overbrowsing. They are involved in accidents with cars, often resulting in serious injury to the human occupants of the vehicles.

Whitetail deer are important as vectors disease because they serve as hosts to the ticks which carry the bacteria responsible Lyme disease. This has become an increasingly common disease in certain parts of the United States, especially the northeastern states.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Whitetail deer are commonly hunted for meat and sport. Early settlers and Native Americans also utilized whitetail deer hides to make buckskin leather. Whitetail heads are also commonly mounted on the walls of lodges and other places of outdoor recreation.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-tailed deer

The white-tailed deer (Odocoileus virginianus), also known as the whitetail, is a medium-sized deer native to the United States, Canada, Mexico, Central America, and South America as far south as Peru and Bolivia.[2] It has also been introduced to New Zealand and some countries in Europe, such as Finland, the Czech Republic, and Serbia. In the Americas, it is the most widely distributed wild ungulate.

In North America, the species is widely distributed east of the Rocky Mountains, but elsewhere, it is mostly replaced by the black-tailed or mule deer (Odocoileus hemionus). In western North America, it is found in aspen parklands and deciduous river bottomlands within the central and northern Great Plains, and in mixed deciduous riparian corridors, river valley bottomlands, and lower foothills of the northern Rocky Mountain regions from South Dakota and Wyoming to southeastern British Columbia, including the Montana Valley and Foothill grasslands.

The conversion of land adjacent to the northern Rockies into agriculture use and partial clear-cutting of coniferous trees (resulting in widespread deciduous vegetation) has been favorable to the white-tailed deer and has pushed its distribution to as far north as Prince George, British Columbia. Populations of deer around the Great Lakes have also expanded their range northwards, due to conversion of land to agricultural uses favoring more deciduous vegetation, and local caribou and moose populations. The westernmost population of the species, known as the Columbian white-tailed deer, once was widespread in the mixed forests along the Willamette and Cowlitz River valleys of western Oregon and southwestern Washington, but today its numbers have been considerably reduced, and it is classified as near-threatened.

Taxonomy[edit]

Fawn waving its white tail

Until recently,[when?] some taxonomists have attempted to separate white-tailed deer into a host of subspecies, based largely in morphological differences. Genetic studies,[clarification needed] however, suggest that there are fewer subspecies within the animal's range, as compared to the 30 to 40 subspecies that some scientists described in the last century. The Florida Key deer, O. virginianus clavium, and the Columbian white-tailed deer, O. virginianus leucurus, are both listed as endangered under the U.S. Endangered Species Act. In the United States, the Virginia white-tail, O. virginianus virginianus, is among the most widespread subspecies. The white-tailed deer species has tremendous genetic variation and is adaptable to several environments. Several local deer populations, especially in the southern states, are descended from white-tailed deer transplanted from various localities east of the Continental Divide. Some of these deer may have been from as far north as the Great Lakes region to as far west as Texas, yet are also quite at home in the Appalachian and Piedmont regions of the south. These deer over time have intermixed with the local indigenous deer (virginianus and/or macrourus) populations.

Male white-tail in Kansas

Central and South America have a complex number of white-tailed deer subspecies that range from Guatemala as far south as Peru. This list of subspecies of deer is more exhaustive than the list of North American subspecies, and the number of subspecies is also questionable. However, the white-tailed deer populations in these areas are difficult to study, due to over-hunting many parts and lack of protection. Some areas no longer carry deer, so it is difficult to assess the genetic difference of these animals.

Subspecies[edit]

O. v. truei, female, Costa Rica
Three O. v. borealis, New Hampshire

Some subspecies names, ordered alphabetically except first entry:[3][4]

North America[edit]

  • O. v. virginianus – Virginia Whitetailed deer or Southern white-tailed deer
  • O. v. acapulcensis – Acapulco white-tailed deer (southern Mexico)
  • O. v. borealis – Northern (woodland) white-tailed deer (the largest and darkest white-tailed deer)
  • O. v. carminis – Carmen Mountains Jorge deer (Texas-Mexico border)
  • O. v. clavium – Key Deer or Florida Keys white-tailed deer (found in the Florida Keys an example of Island Dwarfism)
  • O. v. couesi – Coues white-tailed deer, Arizona white-tailed deer, or fantail deer
  • O. v. dakotensis – Dakota white-tailed deer or Northern plains white-tailed deer (most northerly distribution, rivals the Northern white-tailed deer in size)
  • O. v. hiltonensis – Hilton Head Island white-tailed deer
  • O. v. idahoensis – White-tailed deer (western Canada, Idaho, eastern Washington)[5]
  • O. v. leucurus – Columbian white-tailed deer (Oregon and western coastal area)
  • O. v. macrourus – Kansas white-tailed deer
  • O. v. mcilhennyi – Avery Island white-tailed deer
  • O. v. mexicanus – Mexican white-tailed deer (central Mexico)
  • O. v. miquihuanensis – Miquihuan white-tailed deer (central Mexico)
  • O. v. nelsoni – Chiapas white-tailed deer (southern Mexico and Guatemala)
  • O. v. nemoralis – (Central America, round the Gulf of Mexico to Surinam further restricted to from Honduras to Panama)
  • O. v. nigribarbis – Blackbeard Island white-tailed deer
  • O. v. oaxacensis – Oaxaca white-tailed deer (southern Mexico)
  • O. v. ochrourus – (Tawny) Northwest white-tailed deer or Northern Rocky Mountains white-tailed deer
  • O. v. osceola – Florida coastal white-tailed deer
  • O. v. seminolus – Florida white-tailed deer
  • O. v. sinaloae – Sinaloa white-tailed deer (mid-western Mexico)
  • O. v. taurinsulae – Bulls Island white-tailed deer (Bulls Island, South Carolina)
  • O. v. texanus – Texas white-tailed deer
  • O. v. thomasi – Mexican Lowland white-tailed deer
  • O. v. toltecus – Rain Forest white-tailed deer (southern Mexico)
  • O. v. venatorius – Hunting Island white-tailed deer (Hunting Island, South Carolina)
  • O. v. veraecrucis – Northern Vera Cruz white-tailed deer
  • O. v. yucatanensis – Yucatán white-tailed deer


South America[edit]


Range map of subspecies
North America
Central and South America

Description[edit]

Female with tail in alarm posture

The deer's coat is a reddish-brown in the spring and summer and turns to a grey-brown throughout the fall and winter. The deer can be recognized by the characteristic white underside to its tail. The deer will raise its tail when it is alarmed to flag the other deer. There is a population of white-tailed deer in the state of New York that is entirely white (except for areas like their noses and toes)—not albino—in color. The former Seneca Army Depot in Romulus, New York, has the largest known concentration of white deer. Strong conservation efforts have allowed white deer to thrive within the confines of the depot. White-tailed deer's horizontally slit pupil allows for good night time vision and color vision during the day.

Size and weight[edit]

The white-tailed deer is highly variable in size, generally following Bergmann's rule that the average size is larger further away from the Equator. North American male deer (also known as a buck or stag) usually weighs 60 to 130 kg (130 to 290 lb) but, in rare cases, bucks in excess of 159 kg (351 lb) have been recorded. Mature bucks over 400 pounds are recorded in the northernmost reaches of their native range, specifically, Minnesota and Ontario. In 1926, Carl J. Lenander, Jr. took a white-tailed buck near Tofte, MN, that weighed 183 kg (403 lb) after it was field-dressed (internal organs removed) and was estimated at 232 kg (511 lb) when alive.[6] The female (doe) in North America usually weighs from 40 to 90 kg (88 to 198 lb). White-tailed deer from the tropics and the Florida Keys are markedly smaller-bodied than temperate populations, averaging 35 to 50 kg (77 to 110 lb), with an occasional adult female as small as 25.5 kg (56 lb).[7] White-tailed deer from the Andes are larger than other tropical deer of this species and have thick, slightly woolly-looking fur. Length ranges from 95 to 220 cm (37 to 87 in), including a tail of 10 to 36.5 cm (3.9 to 14.4 in), and the shoulder height is 53 to 120 cm (21 to 47 in).[8][9] Including all races, the average summer weight of adult males is 68 kg (150 lb) and is 45.3 kg (100 lb) in adult females.[10]

Deer have dichromatic (two-color) vision with blue and yellow primaries;[11] humans have trichromatic vision. Thus deer poorly distinguish the oranges and reds that stand out so well to humans.[12] This makes it very convenient to use deer-hunter orange as a safety color on caps and clothing to avoid accidental shootings during hunting seasons.

Antlers[edit]

Male white-tailed deer

Males re-grow their antlers every year. About 1 in 10,000 females also have antlers, although this is usually associated with hermaphroditism.[13] Bucks without branching antlers are often termed "Spikehorn", "spiked bucks", "spike bucks" or simply "spike". The spikes can be quite long or very short. Length and branching of antlers is determined by nutrition, age, and genetics. Rack growth tends to be very important from late spring until about a month before velvet sheds. During this time frame damage that may be done to the racks tends to be permanent. Healthy deer in some areas that are well fed can have eight-point branching antlers as yearlings (one and a half years old).[14] The number of points, the length or thickness of the antlers are a general indication of age but cannot be relied upon for positive aging. A better indication of age is the length of the snout and the color of the coat, with older deer tending to have longer snouts and grayer coats. Some say that deer that have spiked antlers should be culled from the population to produce larger branching antler genetics (antler size does not indicate overall health), and some bucks' antlers never will be wall trophies. Where antler growth nutritional needs are met (good mineral sources, i.e., calcium) and good genetics combine it can produce wall trophies in some of their range.[15] Spiked bucks are different from "button bucks" or "nubbin' bucks", that are male fawns and are generally about six to nine months of age during their first winter. They have skin covered nobs on their heads. They can have bony protrusions up to a half inch in length, but that is very rare, and they are not the same as spikes.

White-tailed bucks with antlers still in velvet, August 2011

Antlers begin to grow in late spring, covered with a highly vascularised tissue known as velvet. Bucks either have a typical or non-typical antler arrangement. Typical antlers are symmetrical and the points grow straight up off the main beam. Non-typical antlers are asymmetrical and the points may project at any angle from the main beam. These descriptions are not the only limitations for typical and non-typical antler arrangement. The Boone and Crockett or Pope & Young scoring systems also define relative degrees of typicality and atypicality by procedures to measure what proportion of the antlers are asymmetrical. Therefore, bucks with only slight asymmetry will often be scored as "typical". A buck's inside spread can be anywhere from 3–25 in (8–64 cm). Bucks shed their antlers when all females have been bred, from late December to February.

Ecology[edit]

White-tailed deer are generalists and can adapt to a wide variety of habitats.[16] The largest deer occur in the temperate regions of Canada and United States. The Northern white-tailed deer (borealis), Dakota white-tailed deer (dacotensis), and Northwest white-tailed deer (ochrourus) are some of the largest animals, with large antlers. The smallest deer occur in the Florida Keys and in partially wooded lowlands in the neotropics.

Although most often thought of as forest animals depending on relatively small openings and edges, white-tailed deer can equally adapt themselves to life in more open prairie, savanna woodlands, and sage communities as in the Southwestern United States and northern Mexico. These savanna-adapted deer have relatively large antlers in proportion to their body size and large tails. Also, there is a noticeable difference in size between male and female deer of the savannas. The Texas white-tailed deer (texanus), of the prairies and oak savannas of Texas and parts of Mexico, are the largest savanna-adapted deer in the Southwest, with impressive antlers that might rival deer found in Canada and the northern United States. There are also populations of Arizona (couesi) and Carmen Mountains (carminis) white-tailed deer that inhabit montane mixed oak and pine woodland communities.[17] The Arizona and Carmen Mountains deer are smaller but may also have impressive antlers, considering their size. The white-tailed deer of the Llanos region of Colombia and Venezuela (apurensis and gymnotis) have antler dimensions that are similar to the Arizona white-tailed deer.

White-tailed deer during late winter

In western regions of the United States and Canada, the white-tailed deer range overlaps with those of the black-tailed deer and mule deer. White-tail incursions in the Trans-Pecos region of Texas has resulted in some hybrids. In the extreme north of the range, their habitat is also used by moose in some areas. White-tailed deer may occur in areas that are also exploited by elk (wapiti) such as in mixed deciduous river valley bottomlands and formerly in the mixed deciduous forest of eastern United States. In places such as Glacier National Park in Montana and several national parks in the Columbian Mountains (Mount Revelstoke National Park) and Canadian Rocky Mountains, as well as in the Yukon Territory ( Yoho National Park and Kootenay National Park), white-tailed deer are shy and more reclusive than the coexisting mule deer, elk, and moose.

Central American white-tailed deer prefer tropical and subtropical dry broadleaf forests, seasonal mixed deciduous forests, savanna, and adjacent wetland habitats over dense tropical and subtropical moist broadleaf forests. South American subspecies of white-tailed deer live in two types of environments. The first type, similar to the Central American deer, consists of savannas, dry deciduous forests, and riparian corridors that cover much of Venezuela and eastern Colombia.[18] The other type is the higher elevation mountain grassland/mixed forest ecozones in the Andes Mountains, from Venezuela to Peru. The Andean white-tailed deer seem to retain gray coats due to the colder weather at high altitudes, whereas the lowland savanna forms retain the reddish brown coats. South American white-tailed deer, like those in Central America, also generally avoid dense moist broadleaf forests.

Since the second half of the nineteenth century, white-tailed deer have been introduced to Europe.[19] A population of white-tailed deer in the Brdy area remains stable today.[20] In 1935, white-tailed deer were introduced to Finland. The introduction was successful, and the deer have recently begun spreading through northern Scandinavia and southern Karelia, competing with, and sometimes displacing, native fauna. The current population of some 30,000 deer originate from four animals provided by Finnish Americans from Minnesota.

Diet[edit]

Whitetail deer eat large varieties of food, commonly eating legumes and foraging on other plants, including shoots, leaves, cacti, and grasses. They also eat acorns, fruit, and corn. Their special stomach allows them to eat some things that humans cannot, such as mushrooms and poison ivy. Their diet varies by season according to availability of food sources. They will also eat hay, grass, white clover, and other food that they can find in a farm yard. Though almost entirely herbivorous, white-tailed deer have been known to opportunistically feed on nesting songbirds, field mice, and birds trapped in Mist nets.[21]

The white-tailed deer is a ruminant, which means it has a four-chambered stomach. Each chamber has a different and specific function that allows the deer to quickly eat a variety of different food, digesting it at a later time in a safe area of cover. The Whitetail stomach hosts a complex set of bacteria that change as the deer's diet changes through the seasons. If the bacteria necessary for digestion of a particular food (e.g., hay) are absent it will not be digested.[22]

Predators[edit]

There are several natural predators of white-tailed deer. Wolves, cougars, American alligators, and (in the tropics) jaguars are the more effective natural predators of white-tailed deer. These predators frequently pick out easily caught young or infirm deer (which is believed to incidentally improve the genetic stock of a population) but can and do take healthy adults of any size. Bobcats, lynxes, bears, wolverines, and packs of coyotes usually will prey mainly on deer fawns. Bears may sometimes attack adult deer while lynxes, coyotes, wolverines and bobcats are most likely to take adult deer when the ungulates are weakened by harsh winter weather.[8] Many scavengers rely on deer as carrion, including New World vultures, raptors, foxes, and corvids. Few wild predators can afford to be picky and any will readily consume deer as carrion. There are records of American Crows attempting to predate white-tailed deer fawns by pecking around their face and eyes, though there are no accounts of successful predation.[23] Occasionally, both Golden and Bald Eagles may capture deer fawns with their talons.[24] In one case, a Golden Eagle was filmed in Illinois unsuccessfully trying to predate a large mature white-tailed deer.[25]

White-tailed deer typically respond to the presence of potential predators by breathing very heavily (also called blowing) and running away. When they blow the sound alerts all of the other deer in the area. As they run, the flash of their white tails warns other deer (especially in mothers with young) of their alarm.[26] Most natural predators of white-tailed deer hunt by surprising them, engaging in a stealthy ambush, although canids like wolves and coyotes may chase and ambush them over a long period, hoping to exhaust the prey. Felid predators typically try to suffocate the deer by biting them on the throat. In cougars and jaguars, they initially knock the deer off-balance with their own powerful forelegs, whereas in small bobcats and lynxes, they attempt to jump onto the deer to give them a killing bite. In the case of canids and wolverines, the predators try to bite at their limbs and flanks, hobbling them, until they can reach vital organs and the deer can be bled out. Bears, who usually target fawns, will often simply knock down the prey and then start eating it while it is still alive.[27][28] Alligators snatch deer as the ungulates try to drink from or cross around water, grabbing them with their powerful jaws and dragging them into the water to be drowned.[29]

Most primary natural predators of white-tailed deer have been basically extirpated in eastern North America, with a very small number of reintroduced red wolves, which are nearly extinct, around North Carolina and a small remnant population of Florida panthers, a subspecies of the cougar. Gray wolves, the leading cause of deer mortality where they overlap, co-occur with white-tails in northern Minnesota, Wisconsin, Michigan, and parts of Canada.[26] This almost certainly plays a factor in the overpopulation issues with this species.[26] Coyotes, widespread and with a rapidly expanding population, are often the only major non-human predator of the species, besides an occasional domestic dog.[26] In some areas, American black bears are also significant predators.[27][28] In northcentral Pennsylvania, black bears were found be nearly as common predators of fawns as coyotes.[30] Bobcats, still somewhat widely found, usually only exploit deer as prey when smaller prey is scarce.[31] There have been discussions regarding the possible reintroduction of gray wolves and cougars to sections of the eastern United States, largely because of the apparent controlling effect they have through deer predation on local ecosystems, as has been illustrated in the reintroduction of wolves to Yellowstone National Park and their controlling effect on previously overpopulated elk.[32] However, due to the heavy urban development in much of the East and fear for livestock and human lives, such ideas have ultimately been rejected by local communities and/or by government services and have not been carried through.[33][34][35][36]

In areas where they are heavily hunted by humans, deer run almost immediately away from people and are quite wary even where not heavily hunted. The deer of Virginia can run faster than their predators and have been recorded at speed 75 km/h (47 mph),[37] this ranks them amongst the fastest of all cervids, alongside the Eurasian roe deer. They can also make jumps 2.7 m (8.9 ft) meters high and up to 10 m (33 ft) in length. When shot at, the white-tailed deer will run at high speeds with its tail down and between its legs. If frightened the deer will hop in a zig-zag with its tail straight up. If the deer feels extremely threatened however it may charge the person or predator that is causing the threat, using its antlers or in the case of a female just the head to fight off the threat.

Forest alteration[edit]

In parts of the eastern United States, high deer densities have caused large reductions in plant biomass, including the density and heights of certain forest wildflowers, tree seedlings, and shrubs.[38][39] At the same time increases in browse tolerant grasses and sedges and unpalatable ferns have often accompanied intensive deer herbivory.[40] Changes to the structure of forest understories have, in turn, altered the composition and abundance of forest bird communities in some areas.[41] Deer activity has also been shown to increase herbaceous plant diversity, particularly in disturbed areas, by reducing competitively dominant plants;[42] and to increase the growth rates of important canopy trees, perhaps by increased nutrient inputs into the soil.[43] In northeastern hardwood forests, high-density deer populations affect plant succession, particularly following clear-cuts and patch cuts. In succession without deer, annual herbs and woody plants are followed by commercially-valuable, shade-tolerant oak and maple. The shade-tolerant trees prevent the invasion of less commercial cherry and American beech, which are stronger nutrient competitors but not as shade tolerant. Although deer eat shade-tolerant plants and acorns, this is not the only way deer can shift the balance in favor of nutrient competitors. When deer consume earlier-succession plants, this allows in enough light for nutrient competitors to invade. Since slow growing oaks need several decades to develop root systems sufficient to compete with faster growing species, removal of the canopy prior to that point amplifies the effect of deer on succession. It is even possible that high density deer populations could browse eastern hemlock seedlings out of existence in northern hardwood forests;[44] however, this scenario seems unlikely, given that deer browsing is not considered the critical factor preventing hemlock re-establishment at large scales.[45] Ecologists have also expressed concern over the facilitative effect high deer populations have on invasions of exotic plant species. In a study of eastern hemlock forests, browsing by white-tailed deer caused populations of three exotic plants to rise faster than they do in the areas which are absent of deer. Seedlings of the three invading species rose exponentially with deer density, while the most common native species fell exponentially with deer density, because deer were preferentially eating the native species. The effects of deer on the invasive and native plants were magnified in cases of canopy disturbance.[46]

Behavior[edit]

These bucks were pursuing a pair of does across the Loxahatchee River in Florida—the does lost them by entering a Mangrove thicket too dense for the bucks' antlers.

Males compete for the opportunity of breeding females. Sparring among males determines a dominance hierarchy.[47] Bucks will attempt to copulate with as many females as possible, losing physical condition since they rarely eat or rest during the rut. The general geographical trend is for the rut to be shorter in duration at increased latitude. There are many factors as to how intense the "rutting season" will be. Air temperature is one major factor of this intensity. Any time the temperature rises above 40 °F (4 °C), the males will do much less traveling looking for females, or they will be subject to overheating or dehydrating. Another factor for the strength in rutting activity is competition. If there are numerous males in a particular area, then they will compete more for the females. If there are fewer males or more females, then the selection process will not need to be as competitive.

Reproduction[edit]

Fawn lying on grass

Females enter estrus, colloquially called the rut, in the autumn, normally in late October or early November, triggered mainly by the declining photoperiod. Sexual maturation of females depends on population density as well as availability of food.[48] Young females will often flee from an area heavily populated with males. Females can mature in their first year,[citation needed] although this is unusual and would occur only at very low population levels. Most females mature at 1–2 years of age. Most are not able to reproduce until six months after they mature.[citation needed] Copulation consists of an ejaculatory thrust[49] which takes place during a brief copulatory jump.[50]

Females give birth to 1–3 spotted young, known as fawns, in mid to late spring, generally in May or June. Fawns lose their spots during the first summer and will weigh from 44 to 77 pounds (20 to 35 kg) by the first winter. Male fawns tend to be slightly larger and heavier than females. For the first four weeks, fawns mostly lie still and hide in vegetation while their mothers forage. They are then able to follow their mothers on foraging trips. They are supposedly weaned after 8–10 weeks, but cases have been seen where mothers have continued to allow nursing long after the fawns have lost their spots (for several months, or until the end of fall) as seen by rehabilitators and other studies. Males will leave their mothers after a year and females leave after two.

Bucks are generally sexually mature at 1.5 years old and will begin to breed even in populations stacked with older bucks.

Communication[edit]

White-tailed deer communicate in many different ways using sounds, scent, body language, and marking. In addition to the aforementioned blowing in the presence of danger, all white-tailed deer are capable of producing audible noises unique to each animal. Fawns release a high-pitched squeal, known as a bleat, to call out to their mothers.[51] This bleat deepens as the fawn grows until it becomes the grunt of the mature deer-a guttural sound that will attract the attention of any other deer in the area. A doe will make maternal grunts when searching for her bedded fawns.[51] Bucks for their part also grunt, at a pitch lower than that of the doe; this grunt deepens as the buck matures. In addition to grunting, both does and bucks also snort, a sound that often signals an imminent threat. Mature bucks also produce a grunt-snort-wheeze pattern, unique to each animal, that asserts its dominance, aggression and hostility.[51] Another way white-tailed deer communicate is through the use of their white tail. When spooked, it will raise its tail to warn the other deer in the immediate area.

Marking[edit]

White-tailed deer possess many glands that allow them to produce scents, some of which are so potent they can be detected by the human nose. Four major glands are the pre-orbital, forehead, tarsal, and metatarsal glands. It was originally thought that secretions from the preorbital glands (in front of the eye) were rubbed on tree branches; recent[when?] research suggests this is not so. It has been found that scent from the forehead or sudoriferous glands (found on the head, between the antlers and eyes) is used to deposit scent on branches that overhang "scrapes" (areas scraped by the deer's front hooves prior to rub-urination). The tarsal glands are found on the upper inside of the hock (middle joint) on each hind leg. Scent is deposited from these glands when deer walk through and rub against vegetation. These scrapes are used by bucks as a sort of "sign-post" by which bucks know which other bucks are in the area, and to let does know that a buck is regularly passing through the area—for breeding purposes. The scent from the metatarsal glands, found on the outside of each hind leg, between the ankle and hooves, may be used as an alarm scent. The scent from the Interdigital glands, which are located in between the hooves of each foot, emit a yellow waxy substance with an offensive odor. Deer can be seen stomping their hooves if they sense danger through sight, sound, or smell, this action leaves an excessive amount of odor for the purpose of warning other deer of possible danger.

Throughout the year deer will rub-urinate, a process during which a deer squats while urinating so that urine will run down the insides of the deer's legs, over the tarsal glands, and onto the hair covering these glands. Bucks rub-urinate more frequently during the breeding season.[52] Secretions from the tarsal gland mix with the urine and bacteria to produce a strong smelling odor. During the breeding season does release hormones and pheromones that tell bucks that a doe is in heat and able to breed. Bucks also rub trees and shrubs with their antlers and head during the breeding season, possibly transferring scent from the forehead glands to the tree, leaving a scent other deer can detect.[53]

Sign-post marking (scrapes and rubs) are a very obvious way that white-tailed deer communicate.[53] Although bucks do most of the marking, does visit these locations often. To make a rub, a buck will use its antlers to strip the bark off of small diameter trees, helping to mark his territory and polish his antlers. To mark areas they regularly pass through bucks will make scrapes. Often occurring in patterns known as scrape lines, scrapes are areas where a buck has used its front hooves to expose bare earth. They often rub-urinate into these scrapes, which are often found under twigs that have been marked with scent from the forehead glands.

Human interactions[edit]

Rescued fawn being kept as a pet in a farm near Cumaral, Colombia
Deer spotted in a suburban development outside Montpelier, Vermont

By the early 20th century, commercial exploitation and unregulated hunting had severely depressed deer populations in much of their range.[54] For example, by about 1930, the U.S. population was thought to number about 300,000.[55] After an outcry by hunters and other conservation ecologists, commercial exploitation of deer became illegal and conservation programs along with regulated hunting were introduced. The Associated Press reported in 2005 that estimates put the deer population in the United States at around 30 million.[56] Conservation practices have proved so successful that, in parts of their range, the white-tailed deer populations currently far exceed their cultural carrying capacity and the animal may be considered a nuisance.[57][58] A reduction in natural predators (which normally cull young, sick or infirm specimens) has undoubtedly contributed to locally abundant populations.

White-tailed deer hunted in Accomack, Virginia
Car that suffered major damage after striking a white-tailed deer in Wisconsin

At high population densities, farmers can suffer economic damage by deer depredation of cash crops, especially in corn and orchards. It has become nearly impossible to grow some crops in some areas unless very burdensome deer-deterring measures are taken. Deer are excellent fence-jumpers, and their fear of motion and sounds meant to scare them away is soon dulled. Timber harvesting and forest clearance have historically resulted in increased deer population densities,[59][60] which in turn have slowed the rate of reforestation following logging in some areas. High densities of deer can have severe impacts on native plants and animals in parks and natural areas; however, deer browsing can also promote plant and animal diversity in some areas.[61][62] Deer can also cause substantial damage to landscape plants in suburban areas, leading to limited hunting or trapping to relocate or sterilize them. In parts of the Eastern US with high deer populations and fragmented woodlands, deer often wander into suburban and urban habitats that are less than ideal for the species. Motor vehicle collisions with deer are a serious problem in many parts of the animal's range, especially at night and during rutting season, causing injuries and fatalities among both deer and humans. Vehicular damage can be substantial in some cases.[63] Deer are also the primary host and vector for the adult black-legged tick, which transmits the Lyme disease bacterium to humans.[64]

In the U.S., the species is the state animal of Arkansas, Illinois, Michigan, Mississippi, Nebraska, New Hampshire, Ohio, Pennsylvania, and South Carolina, the wildlife symbol of Wisconsin, and game animal of Oklahoma. The profile of a white-tailed deer buck caps the coat of arms of Vermont and can be seen in the flag of Vermont and in stained glass at the Vermont State House. It is the national animal of Honduras, and the provincial animal of Canadian Saskatchewan and Finnish Pirkanmaa. Texas is home to the most white-tailed deer of any U.S. state or Canadian province, with an estimated population of over four million. Notably high populations of white-tailed deer occur in the Edwards Plateau of Central Texas. Michigan, Minnesota, Iowa, Mississippi, Missouri, New Jersey, Illinois, Wisconsin, Maryland, New York, North Dakota, Pennsylvania, and Indiana also boast high deer densities. In 1884, one of the first hunts of white-tailed deer in Europe was conducted in Opočno and Dobříš (Brdy mountains area), in what is now the Czech Republic.

See also[edit]

References[edit]

  1. ^ Gallina, S. & Lopez Arevalo, H. (2008). Odocoileus virginianus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 8 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ http://maps.iucnredlist.org/map.html?id=42394
  3. ^ White-tailed deer, Mammals Species of the World. 3rd. ed.
  4. ^ Cervidae, Deer's Life
  5. ^ http://wdfw.wa.gov/living/deer.html#species.  Missing or empty |title= (help)
  6. ^ "The Outdoor Life Book of World Records". Outdoor Life. Retrieved 2011-02-20. 
  7. ^ "White-tailed deer and red brocket deer of Costa Rican Fauna". 1-costaricalink.com. Retrieved 2011-02-20. 
  8. ^ a b "ADW: Odocoileus virginianus: Information". Animaldiversity.ummz.umich.edu. 2011-02-13. Retrieved 2011-02-20. 
  9. ^ Boitani, Luigi, Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books (1984), ISBN 978-0-671-42805-1
  10. ^ [1] (2011).
  11. ^ "VerCauteren, Kurt C. and Michael J. Pipas. 2003. A review of color vision in white-tailed deer. Wildlife Society Bulletin 2003, 31(3):684-691.". Retrieved 2013-09-20. 
  12. ^ FWC, Deer colorblind to orange, but if you glow ..., Wakulla.com, February 23, 2009. This is a report of
    G. H. Jacobs, J. F. Deegan, J. Neitz, B. P. Murphy, K. V. Miller and R. L. Marchinton, "Electrophysiological measurements of spectral mechanisms in the retinas of two cervids: white-tailed deer (Odocoileus virginianus) and fallow deer (Dama dama)", Journal of Comparative Physiology A, volume 174, number 5, pages 551-557, 1994.
  13. ^ Wislocki G.B. (1954). Antlers in Female Deer, with a Report of Three Cases in Odocoileus. Journal of Mammalogy 35(4):486-495.
  14. ^ "Understanding Spike Buck Harvest". Texas Parks and Wildlife Department. Retrieved 2011-02-20. 
  15. ^ "The Management of Spike Bucks in a White-Tailed Deer Population". Texas Parks and Wildlife Department. Retrieved 2011-02-20. 
  16. ^ Christian Alejandro Delfin Alfonso (2010). Comparison of geographic distribution models of white-tailed deer Odocoileus virginianus (Zimmermann, 1780) subspecies in Mexico: biological and management implications. Therya 1(1):41-68
  17. ^ Ffolliott, P. F. and Gallina, S. (eds). (1981). Deer biology, habitat requirements and Management in Western North America. Instituto de Ecología, A. C., México, D.F
  18. ^ Brokx, P. A. (1984). White-tailed deer of South America. In: L.K. Halls (ed.), Ecology and Management of the White-Tailed Deer, pp. 525-546. Stackpole Company, Harrisburg, PA.
  19. ^ Erhardová-Kotrlá, B. (1971). The occurrence of Fascioloides magna (Bassi, 1875) in Czechoslovakia. Academia, Prague, 155 pp.
  20. ^ "Biolib-Czech Republic, Odocoileus virginianus;". Biolib.cz. Retrieved 2011-02-20. 
  21. ^ "White-tailed Deer (Odocoileus virginianus) Predation on Grassland Songbird Nestlings". The American Midland Naturalist. 2000. Retrieved 2011-02-20. 
  22. ^ Nelson, Richard. Heart and Blood, Living With Deer In America, Chap. 1
  23. ^ Kilham, Lawrence (1990). The American Crow and Common Raven Texas A&M University Press. ISBN 0890964661
  24. ^ Ferguson-Lees, J.; Christie, D. (2001). Raptors of the World. London: Christopher Helm. ISBN 0-7136-8026-1. 
  25. ^ "Golden Eagle attacks White-tailed Deer at Nachusa Grasslands!". Ilbirds.com. Retrieved 2013-09-20. 
  26. ^ a b c d http://www.science.smith.edu/msi/pdf/i0076-3519-388-01-0001.pdf
  27. ^ a b Mathews, N. E.; Porter, W. F. (1988). Black bear predation on white-tailed deer neonates in the central Adirondacks. Canadian Journal of Zoology 66(5):1241–1242.
  28. ^ a b Ozoga, J. J., and Clute, R.K. (1988). Mortality rates of marked and unmarked fawns. Journal of Wildlife Management 52(3): 549–551.
  29. ^ "Conservationreport.com". Conservationreport.com. Retrieved 2013-09-20. 
  30. ^ Survival Rates, Cause-specific Mortailty, and Landscape Influence on Survival of White-tailed Deer Fawns in Northcentral PA
  31. ^ Labisky, Ronald F.; Margaret C. Boulay (April 1998). Behaviors of Bobcats Preying on White-tailed Deer in the Everglades. The American Midland Naturalist 139(2):275–281.
  32. ^ "Wolves of Yellowstone - Yellowstone National Park (U.S. National Park Service)". Nps.gov. Retrieved 2013-09-20. 
  33. ^ "Reintroduction of Wolves". Apnmag.com. Retrieved 2013-09-20. 
  34. ^ "Northeast Region, U.S. Fish and Wildlife Service - Gray Wolf". Fws.gov. Retrieved 2013-09-20. 
  35. ^ http://www.change.org/petitions/reintroduce-the-cougar-to-the-eastern-us
  36. ^ "Big Cat Tales - NYS Dept. of Environmental Conservation". Dec.ny.gov. Retrieved 2013-09-20. 
  37. ^ "Animaux.org/Cerf de Virginie". Animaux.org. Retrieved 2013-09-20. 
  38. ^ Augustine DJ & Frelich LE (1998). Effects of White-Tailed Deer on Populations of an Understory Forb in Fragmented Deciduous Forests. Conservation Biology 12(5): 995–1004. publié en ligne : 2001-12-25, DOI:10.1046/j.1523-1739.1998.97248.x
  39. ^ Cote, S.D., T.P. Rooney, J. Tremblay, C. Dussault, and D.M. Waller. (2004). Ecological impacts of deer overabundance. Annual Review of Ecology Evolution, and Systematics 35:113-47
  40. ^ Rooney, T.P. (2009). High white-tailed deer densities benefit graminoids and contribute to biotic homogenization of forest ground-layer vegetation. Plant Ecology 202: 103-111
  41. ^ McShea W.J. & Rappole J.H. (2000). Managing the abundance and diversity of breeding bird populations through manipulation of deer populations. Conservation Biology 14:1161-1170
  42. ^ Royo, Alejandro A.; Collins, Rachel; Adams, Mary Beth; Kirschbaum, Chad; Carson, Walter P. (2010). Pervasive interactions between ungulate browsers and disturbance regimes promote temperate forest herbaceous diversity. Ecology. 91:93-105
  43. ^ Richard W. Lucas, Roberto Salguero-Gómez, David B. Cobb, Bonnie G. Waring, Frank Anderson, William J. McShea, and Brenda B. Casper (2013). White-tailed deer (Odocoileus virginianus) positively affect the growth of mature northern red oak (Quercus rubra) trees. Ecosphere 4:art84. http://dx.doi.org/10.1890/ES13-00036.1
  44. ^ McShea, W.J. (1997). The Science of Overabundance: Deer Ecology and Population Management. Washington, DC: Smithsonian Institution Press. pp. 201–223, 249–279. ISBN 1-58834-062-7. 
  45. ^ Mladenoff, D.J. and F. Stearns (1993). Easter hemlock regeneration and deer browsing in the northern great lakes region: a re-examination and model simulation. Conservation Biology 7:889-900.
  46. ^ Eschtruth, E.C.; J.J. Battles (2008). "Acceleration of exotic plant invasion in a forested ecosystem by a generalist herbivore". Conservation Biology 23: 388–399. doi:10.1111/j.1523-1739.2008.01122.x. 
  47. ^ Ditchkoff, S. S., Lochmiller, Robert L., Masters, Ronald E., Hoofer, Steven R., Van Den Bussche, Ronald A. (2001). Major-Histocompatibility-Complex-Associated Variation In Secondary Sexual Traits Of White-Tailed Deer (Odocoileus virginianus): Evidence For Good-Genes Advertisement. Evolution 55(3): 616–625.
  48. ^ "Forest Foods Deer Eat," Department of Natural Resources website". Department of Natural Resources — State of Michigan. 2008. Retrieved 2011-02-18. 
  49. ^ Warren, R. J., et al. (1978). Reproductive behaviour of captive white-tailed deer. Animal Behaviour 26: 179-183.
  50. ^ Hoofed Mammals of British Columbia - David M. Shackleton - Google Boeken. Books.google.com. Retrieved 2013-09-20. 
  51. ^ a b c Thomas D. Atkeson, R. Larry Marchinton and Karl V. Miller (1988). Vocalizations of White-tailed Deer. American Midland Naturalist 120(1): 194-200.
  52. ^ Karen J. Alexy, Jonathan W. Gassett, David A. Osborn and Karl V. Miller (2001). White-Tailed Deer Rubs and Scrapes: Spatial, Temporal and Physical Characteristics and Social Role. Wildlife Society Bulletin 29(3):873-878.
  53. ^ a b Terry L. Kile and R. Larry Marchinton (1977). White-Tailed Deer Rubs and Scrapes: Spatial, Temporal and Physical Characteristics and Social Role. American Midland Naturalist 97(2): 257-266.
  54. ^ Richard E. McCabe and Thomas R. McCabe (1984). Of Slings and Arrows: An Historical Retrospective. In Lowell K. Halls (ed.), White-tailed Deer Ecology and Management (Washington: Wildlife Management Institute).
  55. ^ Joel M. Lerner, “Right plants (and fences) can keep deer at bay,” The Columbus Dispatch, July 21, 2009. Accessed December 27, 2012.
  56. ^ Mark Johnson, Deer eating away at forests nationwide, The Associated Press, January 18, 2005. Accessed December 27, 2012.
  57. ^ Sinclair, A. R. E. (1997). Carrying capacity and the overabundance of deer: a framework for management.
  58. ^ Mcshea, W. J., Underwood, H. B. , Rappole, J. H. (1997). The Science Of Overabundance: Deer Ecology and Population Management. WA: Smithsonian Institution Press. pp.380-394.
  59. ^ Mattfeld, George F. (1984). Northeastern hardwood and spruce-fir forests. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 305-330.
  60. ^ Whitney, G.G. (1990). The history and status of the hemlock-northern hardwood forests of the Allegheny Plateau. Journal of Ecology 78:443–458
  61. ^ Côté, SD, TP Rooney, JP Tremblay, C Dussault, and DM Waller. (2004). Ecological impacts of deer overabundance. Annual Review of Ecology Evolution and Systematics 35: 113-147
  62. ^ KR Greenwald, LJ Petit, TA Waite (2008). Indirect effects of a keystone herbivore elevate local animal diversity. The Journal of Wildlife Management 72:1318-1321
  63. ^ Warning to Motorists: Fall Is Peak Season for Deer-Vehicle Collisions, Insurance Information Institute, October 1, 2009
  64. ^ Tackling Ticks That Spread Lyme Disease, Agricultural Research magazine, March 1998

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Thirty-eight subspecies have been recognized, eight of which occur in South America (Hall 1981, Smith 1991). This deer exhibits a relatively large amount of genetic variation, but electrophoretic studies of subspecies nigrabarbis, texanus, borealis, osceola, seminolus, and virginianus did not reveal significant genetic differentiation among these subspecies (Halls 1984). Cronin (1992) found considerable intraspecific variation in mtDNA in O. virginianus; geographic differentiation was evident, but nominal subspecies were not discernable as distinct mtDNA assemblages, perhaps in part due to tranlocations of deer into different populations.

Ellsworth et al. (1994) examined mtDNA variation in populations in the southeastern United States. A phylogenetic analysis of these data revealed three primary groups of haplotypes: (1) southern Florida and the Florida Keys, (2) the remainder of peninsular Florida northward to South Carolina, and (3) the Florida panhandle westward to Mississippi. Despite potentially high vagility in deer and human intervention via translocations, the pattern of variation was concordant spatially with patterns observed in unrelated taxa, suggesting the common influence of past biogeographical events.

Most authorities regard the Key deer (subspecies clavium) as a subspecies of O. virginianus, though a few regard it as a distinct species. Subspecies leucurus (Columbian white-tail) may not be subspecifically distinct from subspecies ochrourus (Gavin and May 1988).

Molina and Molinari (1999) examined variation in skulls and mandibles in North American and Venezuelan forms and proposed that Venezuelan and other Neotropical Odocoileus are not conspecific with O. virginianus. Based on mtDNA data, Moscarella et al. (2003) concluded that Venezuelan white-tailed deer do not warrant recognition as separate species, but some populations deserve recognition as distinctive evolutionary units worthy of conservation attention. Grubb (in Wilson and Reeder 2005) did not recognize the Neotropical taxa as distinct species.

Hybridization between white-tailed deer and mule deer has occurred in British Columbia, Alberta, Texas, southwestern Washington, and other areas (Gavin and May 1988, Cronin et al. 1988, Carr and Hughes 1993). See Cronin (1991) for information on the restricted gene flow that occurs among extant populations of white-tailed deer (O. virginianus), mule deer (O. h. hemionus), and black-tailed deer (O. h. columbianus and O. h. sitkensis); there is a low level of introgressive hybridization of mtDNA from mule deer and black-tailed deer into white-tailed deer populations in a few areas in western North America. MtDNA and serum albumin data indicate that gene flow between white-tailed deer and mule deer in Montana is not extensive (Cronin et al. 1988). See Hughes and Carr (1993, Can. J. Zool. 71:524-530) for information on hybridization between white-tailed and mule deer in western Canada.

In most areas of sympatry between O. virginianus and O. hemionus in the southwestern U.S., there is little evidence of nuclear gene introgression, though electrophoretic data do indicate hybridization in some localities (Derr 1991). Carr and Hughes (1993) documented recent mtDNA gene flow between mule deer and white-tailed deer in western Texas. Carr and Hughes (1993) found that some populations of mule deer are genetically more closely related to white-tailed deer than to other populations of mule deer; see Carr and Hughes for possible interpretations.

This species was included in the genus Dama by Hall (1981), in Odocoileus by Jones et al. (1992) and Grubb (in Wilson and Reeder 1993).

See Cronin (1991) for a phylogeny of the Cervidae based on mitochondrial-DNA data. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The scientific name of white-tailed deer is Odocoileus virginianus (Zimmerman) (Cervidae) [458]. There are 38 subspecies in the world. Seventeen of these occur in North America [131,155,279,381,458]:

Odocoileus virginianus (Zimmerman) virginianus [279,381,458], Virginia white-tailed deer

Odocoileus virginianus (Zimmerman) borealis (Miller) [155,279,381,458], northern white-tailed deer

Odocoileus virginianus (Zimmerman) carminis Goldman and Kellogg [131,155,279,381], Carmen Mountains white-tailed deer

Odocoileus virginianus (Zimmerman) clavium Barbour and Allen [131,155,279,381,458], Key deer

Odocoileus virginianus (Zimmerman) couesi (Coues and Yarrow) [131,155,279,381], Coues white-tailed deer

Odocoileus virginianus (Zimmerman) dacotensis Goldman and Kellogg [155,279,381,458], Dakota white-tailed deer

Odocoileus virginianus (Zimmerman) hiltonensis Goldman and Kellogg [155,279,381,458], Hilton Head Island white-tailed deer

Odocoileus virginianus (Zimmerman) leucurus (Douglas) [131,279,381], Columbian white-tailed deer

Odocoileus virginianus (Zimmerman) macrourus (Rafinesque) [155,279,381,458], Kansas white-tailed deer

Odocoileus virginianus (Zimmerman) mcilhennyi F. W. Miller [131,155,279,381], Avery Island white-tailed deer

Odocoileus virginianus (Zimmerman) nigribarbis Goldman and Kellogg [155,279,381,458], Blackbeard Island white-tailed deer

Odocoileus virginianus (Zimmerman) ochrourus Bailey [131,155,279,458], northwestern white-tailed deer

Odocoileus virginianus (Zimmerman) osceola (Bangs) [155,279,381,458], Florida coastal white-tailed deer

Odocoileus virginianus (Zimmerman) seminolus Goldman and Kellogg [155,279,381,458], Florida white-tailed deer

Odocoileus virginianus (Zimmerman) taurinsulae Goldman and Kellogg [155,279,381,458], Bull Island white-tailed deer

Odocoileus virginianus (Zimmerman) texanus (Mearns) [131,155,279,381], Texas white-tailed deer

Odocoileus virginianus (Zimmerman) venatorius Goldman and Kellogg [131,155,279,458], Hunting Island white-tailed deer
Subspecies are distinguished by body size, pelage color, skull form and dentition, size and shape of antlers, and geographical distribution [18,131,279]. However, morphometric characteristics can be influenced by habitat characteristics [279], and the distinction of North American subspecies has been brought into question by genetic analyses. Cronin [76] found no variation in mitochondrial DNA among white-tailed deer subspecies. Gavin and May [129] concluded that the genetic distance of Columbian white-tailed deer based upon allelic frequencies may not be sufficiently different from that of the northwestern white-tailed deer to warrant subspecific designation. Early genetic work with allozymes found no significant genetic differentiation among 6 subspecies covering the northern, Blackbeard Island, Florida, Texas, and Virginia white-tailed deer [377]. A review stated that the subspecific status of Key deer is "unquestionable, being geographically, phenotypically, and genetically differentiated" [155]. Other studies found some regional differentiation among white-tailed deer subspecies in the Southeast, but the genetic division did not match described subspecies ranges (e.g., [93,104,220]). Preliminary investigations into the genetic uniqueness of Coues white-tailed deer suggests it may warrant subspecific designation (Paetkau unpublished data cited in [155]).
Translocations have led to intermixing of subspecies in some areas [76,131,155], and subspecies may interbreed where they coexist [77]. Leberg and Ellsworth [220] concluded that translocations have had substantial and persistent effects on the genetic composition of white-tailed deer populations in the Southeast based upon mitochondrial DNA and allozyme variation.
White-tailed deer and mule deer (O. hemionus) may hybridize where their ranges overlap [75,76,77,129,167,399], although hybrids appear to be rare in the wild [131]. The survival of hybrids in captivity [7] and in the wild [131] is poor. For more information about white-tailed deer and mule deer hybridization, see Geist [131].
This review synthesizes information about white-tailed deer at the species level, except for Key deer and the Columbian white-tailed deer, which due to their past or present status as federally listed endangered species in all or parts of their ranges [95,155], are mentioned by their common subspecies names when possible. In some publications the term "deer" was used to describe white-tailed deer and mule deer in combination. In those cases, this review does the same.
SYNONYMS:

Dama virginiana (Rafinesque) [141]
  • 7. Anderson, Allen E.; Wallmo, Olof C. 1984. Odocoileus hemionus. Mammalian Species. 219: 1-9. [84978]
  • 18. Baker, Rollin A. 1984. Origin, classification, and distribution. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 1-18. [14289]
  • 75. Cronin, Matthew A. 1991. Mitochondrial and nuclear genetic relationships of deer (Odocoileus spp.) in western North America. Canadian Journal of Zoology. 69(5): 1270-1279. [84928]
  • 76. Cronin, Matthew A. 1992. Intraspecific variation in mitochondrial DNA of North American cervids. Journal of Mammalogy. 73(1): 70-82. [78057]
  • 77. Cronin, Matthew A.; Vyse, Ernest R.; Cameron, David G. 1988. Genetic relationships between mule deer and white-tailed deer in Montana. The Journal of Wildlife Management. 52(2): 320-328. [84925]
  • 93. DeYoung, Randy W.; Demarais, Stephen; Honeycutt, Rodney L.; Rooney, Alejandro P.; Gonzales, Robert A.; Gee, Kenneth L. 2003. Genetic consequences of white-tailed deer (Odocoileus virginianus) restoration in Mississippi. Molecular Ecology. 12(12): 3237-3252. [86773]
  • 95. Diefenbach, Duane R.; Shea, Stephen M. 2011. Managing white-tailed deer: eastern North America. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 481-500. [85235]
  • 104. Ellsworth, Darrell L.; Honeycutt, Rodney L.; Silvy, Nova J.; Bickham, John W.; Klimstra, W. D. 1994. Historical biogeography and contemporary patterns of mitochondrial DNA variation in white-tailed deer from the southeastern United States. Evolution. 48(1): 122-136. [86774]
  • 129. Gavin, Thomas A.; May, Bernie. 1988. Taxonomic status and genetic purity of Columbian white-tailed deer. The Journal of Wildlife Management. 52(1): 1-10. [86295]
  • 131. Geist, Valerius. 1998. White-tailed deer and mule deer. In: Deer of the world: Their evolution, behaviour, and ecology. Mechanicsburg, PA: Stackpole Books: 255-414. [85316]
  • 141. Hall, E. Raymond. 1981. Dama virginiana: White-tailed deer. In: The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley & Sons: 1091-1097. [86307]
  • 155. Heffelfinger, James R. 2011. Taxonomy, evolutionary history, and distribution. In: Hewitt, David G., ed. Biology and management of white-tailed deer. Boca Raton, FL: CRC Press: 3-39. [85220]
  • 167. Hughes, Glenys A.; Carr, Steven M. 1993. Reciprocal hybridization between white-tailed deer (Odocoileus virginianus) and mule deer (O. hemionus) in western Canada: evidence from serum albumin and mtDNA sequences. Canadian Journal of Zoology. 71(3): 524-530. [84927]
  • 220. Leberg, Paul L.; Ellsworth, Darrell L. 1999. Further evaluation of the genetic consequences of translocations on southeastern white-tailed deer populations. The Journal of Wildlife Management. 63(1): 327-334. [86294]
  • 279. Miller, Karl V.; Muller, Lisa I.; Demarais, Stephen. 2003. White-tailed deer (Odocoileus virginianus). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: Johns Hopkins University Press: 906-930. [82122]
  • 377. Smith, Michael H.; Baccus, Ramone; Hillestad, Hillburn O.; Manlove, Michael N. 1984. Population genetics. In: Halls, Lowell K., ed. White-tailed deer: ecology and management. Harrisburg, PA: Stackpole Books: 119-128. [86447]
  • 381. Smith, Winston Paul. 1991. Odocoileus virginianus. Mammalian Species. 388(6): 1-13. [20011]
  • 399. Stubblefield, Suzy S.; Warren, Robert J.; Murphy, Brian R. 1986. Hybridization of free-ranging white-tailed and mule deer in Texas. The Journal of Wildlife Management. 50(4): 688-690. [84926]
  • 458. Wilson, Don E.; Reeder, DeeAnn M., eds. 2005. Mammal species of the world: A taxonomic and geographic reference, [Online]. 3rd ed. Baltimore, MD: Johns Hopkins University Press. 2,142 p. Washington, DC: Smithsonian National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals; American Society of Mammalogists (Producers). Available: http://www.vertebrates.si.edu/msw/mswcfapp/msw/index.cfm [69038]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

white-tailed deer

whitetailed deer

whitetail

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!