Overview

Brief Summary

Biology

This species is active throughout the 24-hour period, but in areas disturbed by humans they tend to be more active under the cover of darkness (1). They may occur either solitarily, or in single-sex groups where population densities are higher (1), and large herds may gather during autumn and winter (2). Sika deer browse on trees and shrubs, and also feed on grasses, sedges, holly, conifers, fungi, acorns, bark, heather and ivy (2). This species causes a great amount of damage, being a serious pest of woodland and farmland (3). During the breeding season, or 'rut', which occurs between late August and October, males occupy territories and compete for access to females (2). These contests involve vocalisations such as screaming, parallel walking and eventually fighting, which can result in serious injury and even death (1). The successful stags then mate, and hinds (females) give birth, usually to a single calf, in May and June (2). Introduced sika deer crossbreed with native red deer, causing hybridisation where the two species occupy the same range. This poses a threat to the red deer as it dilutes the gene pool (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The sika deer has a greyish-brown coat in winter, which becomes lighter in colour in summer, with light spots and a dark stripe along the back (3). There is a white rump-patch bordered by black. The antlers differ in shape from those of red deer (Cervus elaphus) in that the front spikes point forwards rather than towards each other (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The sika was distributed across east Asia, from central China in the west to Japan and Korea in the east, and from the extreme eastern tip of Russia in the north to southern China and Viet Nam. Specifically, it was originally found in China (formerly from Manchuria south to Guangxi, and Sichuan to Anhui), North and South Korea (including Cheju Island) (but now probably extinct in both countries), Japan, Russia (a few places in Primorsky in the Far East), Taiwan (extinct in 1969, but subsequently re-introduced), and Viet Nam (probably now extinct). Wild populations are now very localized in China. In Japan, the species ranges widely from Hokkaido, Honshu, Shikoku and Kyushu, islands in the Seto Inland Sea (Awaji, Shodo, and others), Goto Islands, Ika, Yakushima, Mageshima, Kuchinoerabu-shima, Tsushima, and the Kerama Islands (introduced) (Okinawa Prefecture) (Abe, 2005).

In China, C. n. mandarinus probably ranged across much of northeastern China, but by the mid-1930s its range had contracted to northeastern Jilin (IUCN 1972, Guo 1992), and is now believed to be extinct (Hu 1998, Smith and Xie 2008). C. n. grassianus ranged throughout western Shanxi Province, China (Ohtaishi and Gao 1990, Guo 1992), and is now believed to be extinct (Hu 1998, Smith and Xie 2008).C. n. kopschi ranged from the Yangtze River Basin eastward to the coast, and south as far as northern Guangdong Province (IUCN 1972); it remains in small numbers in southern China. C. e. taiouanus was widely distributed throughout Taiwan (Green 1989). Free ranging populations were extirpated in 1969, but captive individuals were re-introduced in 1989 (Smith and Xie 2008). C. n. pseudaxis was recorded from Cao Bang, Quang Ninh, Thanh Hoa, Hanoi, and Nghe Tinh provinces in Viet Nam (Dang Huy Huynh et al. 1990), but is probably now extinct in the wild (captive animals remain).

The species has been widely introduced. In the Philippines it was anciently introduced to Solo Island, with questions remaining as to its continued existence there. It was introduced in 17th century to Kerama Islands (Ryukyu Islands, Japan); and introduced in 19th-20th centuries to British Isles, mainland Europe (Armenia, Austria, Azerbaijan, Czech Republic, Denmark, Finland, France, Germany, Lithuania, Poland, western Russia, and Ukraine), New Zealand, USA, and small islands off Japan (Whitehead 1993; Wemmer 1998; Grubb, 2005). It is also widely farmed in Asia, particularly in China (Green et al, 2007; Smith and Xie 2008). Ony the native, extant range is included in the distribution map.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

The original native range of Cervus nippon was described as "the southern Ussuri district of eastern Siberia; China, Formosa, Japan, Korea, Manchuria, Taiwan, and parts of Vietnam" (Feldhamer 1980, Flerov 1952, and Nowak 1991). In addition, numerous introductions have resulted in established populations in Australia, Austria, Denmark, England, France, Ireland, Jolo Island (south of the Philippines), New Zealand, Poland, Scotland, Maryland, Morocco, Oklahoma, Texas, Wisconsin, and Virginia (Feldhamer 1980,   http://www.assateague.com/sika.html 1997, Nowak 1991, and Whitehead 1972).

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced , Native ); oriental (Introduced , Native ); ethiopian (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Native to Ussuri district of Siberia, Manchuria, Korea, eastern and southern China, northern Viet Nam, Japan, Ryukyu Islands, and Taiwan (Nowak 1991). Introduced in Maryland in 1916, has increased dramatically in density and distribution; released on Assateague Island, Maryland, about 1923-1930, moved south and now occurs on Chincoteague NWR, Virginia (Mullan et al. 1988). Introduced also in Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Introduced to British deer parks from Japan in 1860, the sika deer is now widespread in Scotland and occurs more patchily in England and Northern Ireland. It does not occur in Wales (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Cervus nippon is a small to medium-sized deer with a head and body length of approximately 950-1,800 mm, a tail length of about 75-130 mm, and a height (measured at the shoulder) of 640-1090 mm (Feldhamer 1980, Nowak 1991). On average, males grow until they are 7-10 years old, while females stop growing at age 4-6 years (Nowak 1991). This results in the sexual dimorphism of males averaging 8.7% larger than females (Feldhamer 1980 and Nowak 1991). The pelage of C. nippon ranges from chestnut-brown to reddish-olive and exhibits a great deal of variation resulting in colors such as yellow-brown, gray-brown, tan, black, or gray depending on the subspecies (Feldhamer 1980, Flerov 1952, Nowak 1991, Putman 1988, and Whitehead 1972). In addition, the coats of these animals are mottled with white spots arranged in seven or eight rows on the upper sides of the back (Feldhamer 1980,   http://www.assateague.com/sika.html 1997, Nowak 1991). Moreover, the mid-dorsal area of C. nippon is darker than the rest of its coat, and this forms a line from head to rear, terminating at a large, white, erectile rump patch often used as a distinguishing characteristic of these animals (Feldhamer 1980,   http://www.assateague.com/sika.html 1997, Nowak 1991). The metatarsals of these deer are surrounded by tufts of grayish-tan hairs, and the hooves of adult males average 60 mm in length and 40 mm in width (those of females are slightly smaller) (Feldhamer 1980). The winter coat of sika deer is very dense with 50-70 mm long hairs, while its summer pelage is composed of much finer, straighter, and shorter (30 mm) hairs (Feldhamer 1980 and Putman 1988). The chin, throat, and belly of sika deer have an off-white or gray hue (Feldhamer 1980 and Nowak 1991). Finally, both sexes have a shaggy neck mane that darkens in the winter (Feldhamer 1980 and Nowak 1991).

Two molts occur annually in sika deer (Feldhamer 1980). In northern temperate climates the molt into winter pelage takes place over a 2-4 week period beginning in September, while the summer molt requires approximately 3 months and begins in March (Feldhamer 1980). Interestingly and for unknown reasons, it is the older deer that molt first (Feldhamer 1980).

Antlers are only found among the males of this species (Nowak 1991). In the Northern Hemisphere, males are in velvet antlers from May until August, but hard antlers predominate by early September, just in time for intrasexual selection activities like fraying (Feldhamer 1980). The growth phase of antlers is about 130 days beginning immediately in May when they are generally shed (Feldhamer 1980 and Flerov 1952). It should be noted that older males shed their antlers before their younger counterparts (Feldhamer 1980 and Flerov 1952). The antlers of sika deer are narrow, erect, and directed slightly posteriorly (Brown 1983, Feldhamer 1980, and Nowak 1991). Each is fairly short - measuring about 300-660 mm in length depending on the subspecies and local conditions - and has 2-5 tines (prongs) (Brown 1983, Feldhamer 1980, Nowak 1991, and Putman 1988). A 25 mm diameter at the base of each antler is common, while a spread of 400-500 mm is the maximum observed length (Feldhamer 1980). An upswept brow tine arises approximately 25 mm above the coronet (burr), while a bay tine is absent (Brown 1983 and Feldhamer 1980). Also, a forked, or sometimes palmated, tine surmounts the tray tine and faces forward (Brown 1983 and Feldhamer 1980). Finally, experimentation with antler growth and development have revealed that these processes can be entrained in deer previously sensitized to decreasing day lengths by increasing day lengths (Brown 1983 and Feldhamer 1980).

The skull of C. nippon is relatively short, with a rounded frontal-parietal region (Feldhamer 1980). The nasal bone does not extend beyond the maxilla, the lacrimal vacuity is fairly shallow, and the paroccipital processes extend below the occipital condyle (Feldhamer 1980). Overall, the cranial measurements of adult males averaged 8.9% larger than those of females (Feldhamer 1980). The dental formula of this species is 0/3, 1/1, 3/3, and 3/3 (Feldhamer 1980). The upper canines of sika deer protrude from the maxilla anteriorly, while the lower canines are incisiform (Feldhamer 1980). The molariform teeth are hypsodont and selenodont (Feldhamer 1980).

Range mass: 4.5 to 80 kg.

Range length: 950 to 1800 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species prefers woodlands and forest with dense understory, but forages in open grassy areas (Smith and Xie 2008). The main diet includes grass, some browse, and even fruit. The species is crepuscular, but sometimes active by day and night, and forages singly or in small herds, with dominant males with harems. Herds migrate to lower valleys in winter. Adults can live up to 25 years. Typically, mating occurs in autumn and gestation is about 210-223 days with young being born in April and May.

In Tiebu Nature Reserve, Sichuan, sika were reported to forage preferentially in small patches of subalpine shrub and subalpine brush mixed with forest (Guo 2002). Sika fed on a wide variety of plant species in Teibu. In Viet Nam, diet of C. n. pseudaxis was reported to included browse and fruits (Dang Huy Huynh, Tran Van Duc, and Hoang Minh Khien pers. comm.). In Taiwan, C. n. taiouanus inhabited open forests and grasslands of valley bottoms and foothills below 300 m (McCullough 1974; Horng-jye Su, undated). C. n. mandarinus and C. n. grassianus probably occurred in upland forests (IUCN 1972). C. n. keramae favours lowland forests and plains (WWF 1984). In Viet Nam, C. n. pseudaxis group size was 5?30 animals (Dang Huy Huynh, Tran Van Duc, and Hoang Minh Khien pers. comm.). In China, C. e. sichuanicus forms large aggregations during May?August (Sheng Helin and Zhang Endi pers. comm.). In Viet Nam, C. n. pseudaxis was thought to be primarily sedentary, although some seasonal movement took place depending on water availability (Dang Huy Huynh, Tran Van Duc, and Hoang Minh Khien pers. comm.). In China, rut occurs during September?November. Fawning occurs in May-July following a 210?213 day gestation. Single fawns are the rule, but twins are sometimes observed among prime-aged females (Guo and Zheng 2005). Sexual maturity is reached at 1.5 years (Sheng and Ohtaishi 1993).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Cervus nippon is primarily a forest-dwelling deer that particularly prefers forested areas with a dense understory (Nowak 1991). However, these animals are able to adapt quite well to a variety of other habitats such as freshwater marshes (Maryland) and grasslands (New Zealand) (Nowak 1991). In addition to their environmental adaptability, sika deer are found at a variety of elevations from sea level to 1800 m, and populations participate in seasonal altitudinal migrations of up to 700 m depending on such factors as snowfall and its subsequent melt, reproductive periods, and plant defoliation (Feldhamer 1980). The summer ranges of these animals are generally higher and larger than their winter ranges (Nowak 1991).

Range elevation: 0 to 1800 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest ; mountains

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Tends to prefer deciduous and mixed woodlands with dense undergrowth, on damp ground where the soil is acidic (2). They also occur in commercial conifer plantations, gardens and farmland (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

A sika deer's diet can include any of the following: marsh grasses, fallen leaves, trees, brushy vegetation, herbs, fungi, bamboo, ground ferns, poison ivy, soy beans, and corn depending on environmental conditions (Feldhamer 1980). In other words, these animals are highly adaptable and can be either grazers or browsers in response to the situation at hand (Feldhamer 1980,   http://www.assateague.com/sika.html 1997, Nowak 1991).

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Other Foods: fungus

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Sika deer are important as large prey animals for larger predators and in manipulating native vegetation through browsing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sika deer primarily use vigilance to protect themselves from predators. Their antlers and sharp hooves can also be used in defense. Predators on sika deer depends on the population in question, as they have been introduced to many different landscapes worldwide. Native predators include tigers, wolves, and humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Cervus nippon is prey of:
Homo sapiens
Canis lupus
Panthera tigris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Cervus nippon preys on:
fungi

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
adult of Lipoptena cervi ectoparasitises Cervus nippon

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cervus nippon is a highly vocal species, and as of 1991, 10 different sounds have been recorded (Nowak 1991). These noises range from soft whistles used by does to communicate with each other, to "goat-like bleats" from does to fawn, to "soft, horse-like neighs" from fawn to does, to "loud, blood-curdling" screams produced by males, to an alarm call described as either a "sharp scream, a high-pitched whistle followed by a gutteral bark, or a chirp-like sound" (Feldhamer 1980, Nowak 1991, and Whitehead 1972).

Sika deer also usual postures and touch in communication. They use chemical cues to convey information on reproductive status and territorial boundaries (see Behavior, above).

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Captive individuals generally live 15 to 18 years, though one was recorded living 25 years and 5 months.

Range lifespan

Status: captivity:
25 (high) years.

Average lifespan

Status: captivity:
15 to 18 years.

Average lifespan

Status: captivity:
26.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.3 years (captivity) Observations: Growth continues until ages 7-10 in males and ages 4-6 in females (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Cervus nippon is polygamous, and a successful male will gather as many as 12 females on his territory over the course of the mating (rutting) season (Feldhamer 1980, Nowak 1991). In addition, during the rutting season males quickly deplete their fat stores and may lose up to 20-30% of their body weight (Feldhamer 1980, Flerov 1952). Females, however, do not lose weight during the 6 week rutting season and may associate with a number of bucks in order to gain access to a number of feeding locations (Feldhamer 1980).

Mating System: polygynous

Both sexes reach reproductive maturity at 16-18 months (Nowak 1991). Sika deer breed in the fall (September and October), and births of single offspring occur in May and June after a gestation period of approximately 30 weeks (  http://www.assateague.com/sika.html 1997 and Nowak 1991). The newborn young weighs about 4.5-7.0 kg and is nursed from 1 of its mother's 4 mammae for up to 10 months on an increasingly fatty milk (contains approximately 13% fat at the inception of the lactation period and 30% fat at its conclusion) (Feldhamer 1980 and Nowak 1991). The birth of calves usually takes place in forested areas or open fields, but small outlying patches of cover may be used in some cases (Feldhamer 1980).

Some researchers have proposed that interbreeding between Japanese sika deer and red deer has occurred, yielding hybrid animals with an adaptive advantage over their purebred relatives (Putman 1988).

Breeding interval: Breeding occurs once yearly.

Breeding season: Breeding occurs in the fall, from September through October.

Average number of offspring: 1.

Average gestation period: 7 months.

Range time to independence: 10 to 12 months.

Range age at sexual or reproductive maturity (female): 16 to 18 months.

Range age at sexual or reproductive maturity (male): 16 to 18 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 5750 g.

Average gestation period: 210 days.

Average number of offspring: 1.

Female sika deer care for their young for up to a year after birth.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Maryland and Virginia: onset of sexual maturity in females occurs as early as age 6 months, but most females probably first breed as yearlings (study in Japan found parturition only in females 3-12 years old) (Mullan et al. 1988). Seasonally reproductive in Texas (Howery et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cervus nippon

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0705-06|NC_008462|Cervus nippon| AACCGCTGATTATTCTCAACCAATCATAAAGATATCGGTACTCTGTATCTACTATTTGGTGCCTGAGCAGGCATAGTAGGAACAGCCTTA---AGCCTACTGATTCGTGCCGAACTGGGCCAACCCGGTACTCTGCTTGGAGAT---GACCAAATTTATAATGTTATCGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGACTAGTTCCCCTAATA---ATTGGTGCCCCAGACATAGCATTCCCTCGAATAAATAATATAAGCTTTTGACTCCTCCCTCCTTCTTTCTTACTACTTTTAGCATCATCTATAGTTGAAGCTGGCGCAGGAACAGGCTGAACTGTATATCCCCCTCTAGCTGGCAACTTAGCTCACGCAGGGGCTTCAGTAGACCTG---ACCATTTTTTCTTTACACTTAGCAGGTGTCTCCTCAATTCTAGGGGCCATTAACTTTATTACAACAATTATCAATATAAAACCCCCTGCCATATCACAATATCAAACCCCTTTATTCGTGTGATCCGTATTAGTCACTGCTGTACTACTACTTCTCTCACTCCCTGTACTAGCAGCC---GGAATTACAATACTATTAACAGACCGAAACCTAAATACAACCTTTTTTGACCCAGCAGGAGGCGGAGATCCTATTCTATATCAACACTTGTTCTGATTCTTTGGCCACCCTGAAGTATATATCCTTATTCTACCCGGCTTTGGTATTATCTCCCATATCGTAACATACTATTCAGGAAAAAAA---GAACCATTTGGGTACATAGGAATAGTCTGGGCTATAATATCAATCGGATTCTTAGGGTTCATCGTATGAGCCCACCACATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cervus nippon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Species: 18
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Harris, R.B.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s
Duckworth, J.W. & Wang Ying

Justification
Listed as Least Concern because of its abundant, increasing population in Japan, and stable population in Russia. The populations in Taiwan is evidently holding steady. However, all other free-ranging populations are very seriously threatened. In China all populations are small (the largest numbering about 500) and fragmented, and the species appears to be in danger of extirpation in Korea and Viet Nam (possibly already extinct). In terms of applying the Red List Criteria to the species globally, the large population in Japan masks all population trends from elsewhere within its range, leading to a Least Concern listing. However, it is a priority to conduct new assessments of the mainland subspecies as soon as possible.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The following subspecies of C. nippon have been classified as endangered: C. nippon taiouanus of Taiwan, C. nippon keramae of the Ryukyu Islands, C. nippon mandarinus and C. nippon grassianus of northern China, C. nippon kopschi of east-central China, and C. nippon hortulorum of southeastern Siberia, Manchuria, and Korea (Nowak 1991, Whitehead 1972). These animals have been subjected to unregulated hungint for food and commerce, and their forest habitats have been usurped by agriculture (Nowak 1991). In addition, predation by wolves, feral dogs, foxes, and lynx has taken a toll on populations (Feldhamer 1980). Although some sika deer are still present on farms in various locations, the above subspecies may have almost entirely vanished from the wild (except for C. nippon keramae, which still survives on three uninhabited islets) (Nowak 1991). In modern times wild-living populations of sika deer are known to have been established in the British Isles, several countries of mainland Europe, Maryland, Oklahoma, Texas, New Zealand, and Jolo Island (Nowak 1991).

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Locally common and increasing introduced species (2). Under Schedule 9, Section 14 of the Wildlife and Countryside Act 1981, it is illegal to release this species into the wild (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no global population estimates. However, in summary, there is a large and growing population in Japan, and a stable population of 8,500-9,000 in Russia, but the species is in serious trouble in the rest of its range. There are probably fewer than 1,000 left in China, scattered in a few populations across a once vast range. It is extinct in South Korea, and probably extinct in North Korea and Viet Nam. It also became extinct on Taiwan, but has been re-introduced there. More detailed information is provided below:

China: Four subspecies of sika are present in mainland China of which three are threatened and one, C. n. mandarinus, is probably extinct. There are 400?500 C. n. sichuanicus in the extreme north of Sichuan and in southern Gansu Province (Hu 1998), as well in two other areas (Baxi and Beihe) of Sichuan (Guo 2000). C. n. kopschi occurs as five isolated small populations: in the Tianmu Mountains region of northern Zhejiang (less than 30 animals); in southern Anhui (70?100); near the border with Jiangsu, in Pengze, Jiangxi (150 animals); in southern Guangxi; and possibly in northern Guangdong. C. n. grassianus occurred in two separate and declining populations in western Shanxi but has not been reported for some years and may now be extinct (Ohtaishi and Gao 1990; Sheng Helin and Zhang Endi pers. comm., 1990). The total number in China was estimated to be no more than 1,000 animals, with populations fragments (Hu 1998). Sika are believed to be declining in all of their remaining range within China (Hu 1998, Guo 2000), although analyses of survival of C. n. sichuanicus in Tiebu Nature Reserve during the late 1980s suggest a possible reversal of that trend (Guo and Zheng 2005).

Korea: Sika was reportedly common and widespread in north and central Korea but declined severely during the Japanese occupation of the country. After liberation it proved impossible to rebuild populations naturally from the surviving dispersed animals in Hamgyong North province, so the DPRK government initiated a captive breeding programme (Won Hong Koo 1968). The genetic purity of these animals is unclear as is their relationship to the sika held captive in DPRK nowadays. Sika is either very rare or extinct as a wild animal in DPR Korea (J.W. Duckworth in litt. 2008). If it survives in DPR Korea, it will be in the extreme northeastern part of the country (Won and Smith, 1999). It no longer survives in the wild in South Korea (Won and Smith, 1999), including on Cheju Island.

Japan: The species surviives near heavily populated areas of Honshu, and their populations had been severely fragmented and reduced due to human activities (Yuasa et al. 2007). However, the sika deer population has been conspicuously increasing throughout Japan in recent years as hunting has been brought under control. On Hokkaido, for example, sika have increased greatly during the last decades of the 20th century and the early 21st century (Agetsuma et al. 2007), and are now considered an agricultural and forest-plantation pest (Uno and Kaji 2006). Experimental hunting of males began in the 1950s, culling of females in the 1980s and hunting of females in the 1990s (Halley et al. 2006). C. n. keramae was introduced to the Kerama Islands from the Japanese mainland during the 17th century, and is reported to have subsequently developed as an insular form (IUCN 1972).

Russia: According to Kuzyakin (n.d.), there are 8,500-9,000 sika deer in Russia, and the population is stable.

Taiwan: C. n. taiouanus is endemic to Taiwan. It was extirpated by 1969 and re-introduced to Kenting National Park in 1988 (Green 1989).

Viet Nam: The species may now be extinct in the wild in this country. In 1990, two to four animals were reported from the western Nghe Tinh Mountains (Dang Huy Huynh et al. 1990), but it is highly doubtful that they survive there. Captive populations are present in Cuc Phuong National Park and Cat Ba National Park (Dang Huy Huynh et al. 1990).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is threatened by habitat loss and hunting, particularly in Viet Nam, China, and the Koreas. The species is increasing in Japan (where it is hunted and culled to reduce crop and forest depredation), and stable in Russia and probably Taiwan. The subspecies in Viet Nam (C. n. pseudaxi) and Taiwan (C. n. taiouanus) were hunted for meat and antler velvet for use in traditional medicine (Dang Huy Huynh et al. 1990; McCullough 1974). In Viet Nam, velvet from Cervus nippon is traded in Hanoi and Ho Chi Minh City (Dang Huy Huynh, Tran Van Duc, and Hoang Minh Khien pers. comm.). All subspecies of sika have been hunted widely in China during the past 100 years (Ohtaishi and Gao 1990) and in Korea. In Japan, red deer farming used to be very popular, but now animals are being released into the wild raising the risk of hybridisation in the wild with Cervus nippon. Native and introduced populations are threatened by hybridization, with numerous populations are of uncertain provenance or have mixed ancestry (Grubb, 2005). In China, in addition to continued loss of habitat, loss of genetic diversity through anthropogenic population subdivision is also a conservation concern (Lu et al. 2006).

C. n. pseudaxis in Viet Nam, and C. n. mandarinus and C. n. taiouanus in China, were probably extirpated in the wild as a result of hunting and habitat conversion for agriculture (Ratajszczak 1990; Dang Huy Huynh, Tran Van Duc and Hoang Minh Khien pers. comm.; IUCN 1972). The small captive population of C. n. pseudaxis in Cuc Phuong National Park is presently threatened by poaching. In China, C. e. sichuanicus is threatened by poaching outside Tiebu Nature Reserve (Sheng Helin and Zhang Endi pers. comm. 1990), and by encroachment on their habitats (including by deer farms; Hu, 1998). In Japan, C. n. keramae has been almost extirpated by hunting, and remains only on unoccupied islets where competition with feral goats and habitat change constitute serious threats (Anon 1990). Water pollution is a serious problem for the deer (WWF 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This introduced species is not threatened; its populations are managed under the Deer Act of 1991 in England and Wales, and under the Deer (Scotland) Act 1996 in Scotland. Under Schedule 9, Section 14 of the Wildlife and Countryside Act 1981, it is illegal to release this species into the wild (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is heavily depleted in the wild in China, and two of the Chinese subspecies may be extinct (mandarinus, grassianus), and others are threatened. However, large herds exist in captivity in China to meet the demand for velvet antlers used in traditional Asian medicine.

The species occurs in a number of protected areas, including: C. n. sichuanicus in China's Tiebu Nature Reserve (Guo 2000; Guo and Zheng 2005), and Baihe Nature Reserve (Hu 1998); C. n. kopschi in China's Taohonglin Nature Reserve (Hu 1998); C. n. hortulorum in Russia's Dalnevostochny Morskoy, Kedrovaya Pad, Khankaisky, Lazovsky, and Sikhote-Alinsky Nature Reserves; and C. n. taiouanus in Taiwan's Kenting National Park, as a result of The Formosan Deer Restoration Project was initiated in 1984 to re-establish subspecies (Green 1989. Management activities for C. n. keramae have included filling of mine shafts, which posed threats to the deer, as well as the construction of drinking water facilities (IUCN 1972).

C. n. pseudaxis
The Viet Namese Sika Breeding and Conservation Program was initiated in 1991 with a shipment of ten animals to Europe on breeding loan (Ratajszczak and Smielowski, undated).
1. Improve protection of Cuc Phuong National Park, with particular emphasis on control of poaching and development of a conservation education program.

C. n. taiouanus
1. Establish a peripheral hunting zone around Kenting National Park to benefit local people, and to minimize impact of deer encroaching into adjacent agricultural land.
2. Expand the area available to the existing free ranging population.
3. Plan, implement, and develop a fully integrated research program focused on the ecology of the free ranging population. Studies should include impact on vegetation and carrying capacity.
4. Develop a long-term strategy for management of Kenting National Park.
5. Plan the establishment of additional free-ranging populations elsewhere in Taiwan.

C. n. keramae
1. Survey status of present populations and undertake studies of existing habitat to determine extent of habitat degradation. Remove feral goats as an urgent priority.
2. Develop a management plan for habitat restoration.
3. Develop a captive breeding program using animals from surviving populations. Assess possible genetic differences between island populations.
4. Assess attitudes of local people toward conservation, initiate regional conservation education program, and increase law enforcement if necessary.

C. n. mandarinus and C. n. grassianus
1. Carry out surveys to determine whether or not these two subspecies survive. If populations can be found, activities should include field reconnaissance, population censuses, demographic surveys, ecological studies, and investigations into human use of the deer.

C. n. kopschi
1. Secure protected habitat, and encourage community development options to mitigate threats, especially poaching.

C. n. sichuanicus implement management plans in Tiebu and Baihe Nature Reserves, with a particular focus on combatting poaching. In 1990, the management plan for Tiebu was being implemented and protection was adequate (Sheng Helin and Zhang Endi pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

No conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because of their taste for soy beans and corn, sika deer have undoubtedly caused some problems for farmers of these crops (Feldhamer 1980).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sika deer are valued in China for their antlers, which are used in traditional medicine. They are also an important food and game animal.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Regarded as an asset and managed as if it were a native species on Chincoteague NWR (Handley 1991). An estimated 318 were harvested at Chincoteague NWR in 1987 (Handley 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sika deer

The Sika Deer, Cervus nippon, also known as the Spotted Deer or the Japanese Deer, is a species of deer native to much of East Asia and introduced to various other parts of the world. Previously found from northern Vietnam in the south to the Russian Far East in the north,[1] it is now on the brink of extinction in all areas except Japan, where the species is overabundant.[2] Its name comes from shika (鹿?), the Japanese word for "deer".

Contents

Taxonomy

The Sika Deer is a member of the genus Cervus, a group of deer also known as the "true deer".[citation needed] Formerly Sika were grouped together in this genus with nine other species. Now, only the Sika and Red Deer remain, the latter being divided into three separate species European Red Deer, Central Asian Red Deer and American Elk (though this remains controversial[3]) This is because recent DNA evidence indicates that these deer are not as closely related as previously thought resulting in the creation of new species and genera. The genera Rucervus, Rusa, and Przewalskium are where most of the former Cervus species now belong. The ancestor of all Cervus probably originated in Central Asia and resembled Sika Deer.[4] All Cervus species can crossbreed and produce hybrids in areas where they co-exist (for example introduced Sika hybridize with native Red Deer in the Highlands of Scotland were this is a serious threat to the gene pool of the red deer population).

Subspecies

There has been serious genetic pollution in many populations, especially in China. Therefore the status of many subspecies remain unclear.[1] The status of C. n. hortulorum is particularly uncertain and might in fact be of mixed origin, hence it is not listed here.

Description

The Sika deer is one of the few deer species that does not lose its spots upon reaching maturity. Spot patterns vary with region. The mainland subspecies have larger and more obvious spots, in contrast to the Taiwanese and Japanese subspecies, whose spots are nearly invisible. Many introduced populations are from Japan and thus also lack significant spots.

Sika deer in Shiretoko Peninsula, Hokkaido, Japan

The color of the fur ranges from mahogany to black, and white individuals are also known. During winter the coat becomes darker and shaggier and the spots less prominent, and a mane forms on the back of the males' necks.[5] They are medium sized herbivores, 50–95 centimetres (20–37 in) tall at the shoulder and weighing 30–70 kilograms (66–150 lb). Males are noticeably larger than females. All Sikas are compact and dainty-legged with short, trim, wedge-shaped heads and a boisterous disposition. When alarmed, they will often display a distinctive flared rump, much like the American Elk.

Sika stags have stout, upright antlers with an extra buttress up from the brow tine and a very thick wall. A forward-facing intermediate tine breaks the line to the top, which is usually forked. Occasionally sika antlers develop some palmation (flat areas). Females carry a pair of distinctive black bumps on the forehead. Antlers can range from 28 to 45 centimetres (11 to 18 in) to more than 80 centimetres (30 in) depending on the subspecies. Stags also have a distinctive mane during the rut.

Behavior

Manchurian Sika Deer.

The sika deer can be active throughout the day, though in areas with heavy human disturbance they tend to be nocturnal. Seasonal migration is known to occur in mountainous areas such as Japan, with winter ranges being up to 700 metres (2,300 ft) lower than summer ranges.[5] Lifestyles vary between individuals, with some occurring alone while others are found in single-sex groups. Large herds will gather in autumn and winter. The Sika Deer is a highly vocal species, with over 10 individual sounds ranging from soft whistles to loud screams.

Sika males are territorial and keep harems of females during the rut, which peaks from early September through October but may last well into the winter months. Territory size varies with type of habitat and size of the buck; strong, prime bucks may hold up to 2 hectares (5 acres). Territories are marked with a series of shallow pits or scrapes, into which the males urinate and from which emanates a strong, musky odor. Fights between rival males are sometimes fierce and long, and may even be fatal.

In Nara, Japan, the deer are also known as 'bowing deer' as they bow their heads before you feed them. Simply purchase some deer-crackers from the shops in the park and hold one up to the deer (in front and slightly above its head). The deer will then bow its head before taking the cracker from your hand.

Habitat

Sika Deer are found in the temperate and subtropical forests of Eastern Asia, preferring areas with dense understory, and where snowfall does not exceed 10–20 centimetres (4–8 in). They tend to forage in patchy clearings of forests. Introduced populations are found in areas with similar habitats to their native range, including Western and Central Europe, Eastern United States, and New Zealand.

Population

The sika deer inhabits temperate and subtropical woodlands, which often occupy areas suitable for farming and other human exploitation. Its range encompasses some of the most densely populated areas in the world, where forests were cleared hundreds of years ago. The population status of Sika deer varies significantly in different countries. Although the species as a whole is thriving, it is endangered and extinct in many areas.

Japan has by far the largest native Sika population in the world. Though the exact population is uncertain it is likely to be in the hundred thousand range and is still increasing.[citation needed] This is mainly due to recent conservation efforts and the extinction of its main predator, the wolf, over a century ago. Without its main enemy the population of sika exploded and it is now overpopulated in many areas, posing a threat to both forests and farmlands. Efforts are now being made to control its population instead of conserving it. None of its subspecies are endangered except the Kerama Deer (C. n. keramae) in the tiny Kerama Islands.[2]

China used to have the largest population of Sika, but thousands of years of hunting and habitat loss has reduced the population to less than 1,000. Of the five subspecies in China, North China Sika Deer (C. n. mandarinus) is believed to be extinct in the wild since the 1930s, Shanxi Sika Deer (C. n. grassianus) has not been seen in the wild since the 1980s and is also believed to be extinct in the wild. The status of Manchurian Sika Deer in China is unclear, though it is believed to be extinct as well and the sightings there are actually feral populations. South China Sika Deer (C. n. kopschi) and Sichuan Sika Deer (C. n. sichuanicus) are the only remaining subspecies in the wild. The former exists in fragmented populations of around 300 in southeast China while the latter is found in a single population of over 400. The feral population is likely to be much higher than the wild though most of them are descended from domesticated sikas of mixed subspecies. All of the subspecies are present in captivity but a lack of suitable habitats and government efforts prevent reintroduction from happening.

The Formosan Sika Deer (C. n. taioanus) has been extinct for almost two decades before individuals from zoos were introduced to Kenting National Park and the population now numbers 200. Reintroduction programs are also under way in Vietnam, where the Vietnamese Sika Deer (C. n. pseudaxis) is extinct or nearly so.

Russia has a relatively large and stable population of 9,000 individuals of the Manchurian subspecies, but this is limited to a small area in Primorsky Krai. Small populations might exist in North Korea, but the political situation makes investigation impossible. The species is extinct in South Korea with no plans for reintroduction.

Introduced populations

Sika Deer have been introduced into a number of other countries including Australia, Austria, Denmark, Germany, Britain, France, Ireland, Jolo Island (southern Philippines), New Zealand, Poland, Morocco and the United States (Maryland, Texas, Wisconsin, Virginia, and Kansas). In many cases they were originally introduced as ornamental animals in parkland, but have established themselves in the wild. On Spieden Island, located in the San Juan Islands of Washington, they were introduced as a game animal.

In Britain and Ireland several distinct feral populations now exist. Some of these are in isolated areas, for example on the island of Lundy, but others are contiguous with populations of the native Red Deer. Since the two species sometimes hybridise, there is a serious conservation concern.[6] In research which rated the negative impact of introduced mammals in Europe, the Sika Deer was found to be among the most damaging to the environment and economy along with the Brown rat and Muskrat.[7]

In the 1900s, King Edward VII presented a pair of Sika Deer (Cervus nippon) to John, the second Baron Montagu of Beaulieu. This pair escaped into Sowley Wood and were the basis of the Sika to be found in the New Forest today.[citation needed] They were so prolific that culling had to be introduced in the 1930s to control numbers.[8]

Hunting

Sika deer in winter

Across its original range and in many areas to which it has been introduced, the Sika is regarded as a particularly prized and elusive sportsman's quarry. In Britain, Ireland and mainland Europe it has been noted that Sika display very different survival strategies and escape tactics from the indigenous deer. They have a marked tendency to use concealment in circumstances when Red Deer, for example, would flee; and have been seen to squat and lie belly-flat when danger threatens.

Hunters and control cullers[who?] have estimated that the Sika's wariness and "cleverness" makes it three or four times more difficult to bring to bag than a Red or Fallow deer.[citation needed] It has also been said[citation needed] that Sika are much more tenacious of life, and harder to kill with a rifle bullet, than the native deer of Europe and North America. In the British Isles Sika are widely regarded as a serious threat to new and established woodlands, and public and private forestry bodies adopt policies of rigorous year-round culling.

Velvet antler

Tame deer wandering the streets of Miyajima, Japan

Velvet antler (dried immature antlers) is a popular ingredient in traditional Chinese medicine, and Sika in China were domesticated long ago for the antler trade, along with several other species. In Taiwan, both Formosan Sika Deer and Formosan Sambar Deer (Cervus unicolor swinhoei) have been farmed for velvet antlers. Japan is the only country in Eastern Asia where Sika Deer were not farmed for velvet antlers.

Other deer raised for the antler trade were Thorold's Deer (Cervus albirostris), Central Asian Red Deer (Cervus affinis) and Wapiti (Cervus canadensis).

See also

References

  1. ^ a b c Harris, R.B. (2008). Cervus nippon. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 5 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ a b Kaji, Koichi; Takashi Saitoh, Hiroyuki Uno, Hiroyuki Matsuda, and Kohji Yamamura. "Adaptive management of sika deer populations in Hokkaido, Japan: theory and practice" (pdf). http://www.populationecology.org/SpecialIssueArticlePage.aspx?DOI=10.1007/s10144-010-0219-4. Retrieved 19 January 2011. 
  3. ^ Ludt, Christian J.; Wolf Schroeder, Oswald Rottmann, and Ralph Kuehn. "Mitochondrial DNA phylogeography of red deer (Cervus elaphus)" (pdf). Molecular Phylogenetics and Evolution 31 (2004) 1064–1083. Elsevier. Archived from the original on 27 September 2004. http://web.archive.org/web/20040927110031/http://www.wzw.tum.de/wildbio/paper/cerphyl.pdf#search=%22Barbary%20red%20deer%22. Retrieved 6 October 2006. 
  4. ^ Geist, Valerius (1998). Deer of the World: Their Evolution, Behavior, and Ecology. Mechanicsburg, Pa: Stackpole Books. ISBN 0-8117-0496-3. 
  5. ^ a b "Ultimate Ungulate Fact Sheet – Sika Deer". http://www.ultimateungulate.com/artiodactyla/cervus_nippon.html2. [Full citation needed]
  6. ^ "Cross-breeding 'threat' to deer". BBC. 22 January 2009. http://news.bbc.co.uk/1/hi/scotland/edinburgh_and_east/7842458.stm. 
  7. ^ "Rats top invasive mammals table". BBC News. 7 May 2010. http://news.bbc.co.uk/1/hi/science_and_environment/10100907.stm. 
  8. ^ "British Mammals: Sika Deer". BBC. 15 June 2007. http://www.bbc.co.uk/dna/ptop/A23502926. Retrieved 8 October 2009. 

Further reading

O'Brien, D.J., Roodey, S.M. and Hayden, T.J. 2009. A differential vulnerability to hunting between the sexes in Sika-type calves. I. Nat. J. 30: 7- 9.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Grubb (in Wilson and Reeder 2005) for a list of the many subspecies and synonyms.

See Cronin (1991) for a phylogeny of the Cervidae based on mitochondrial-DNA data. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!