Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Spanish (11) (learn more)

Overview

Brief Summary

Equus caballus caballus, the modern horse, in the Equidae family of the Perissodactyls (odd-toed ungulates) evolved from three primitive ancestors in Eurasia by the end of the last Ice Age, roughly 10,000 years ago. From their early uses in carrying vehicles and pulling loads, horses have been selected into hundreds of specialized breeds used around the world for transportation (either ridden or harnessed to convey wheeled vehicles), agriculture (to pull equipment and ride after cattle), and war (for carrying troops into battle and carting equipment), as well as in numerous competition and show disciplines, ranging from racing to Olympic sports (dressage, jumping, and eventing—a 3-part competition that includes dressage, cross-country, and show jumping) to various Western and rodeo events, including reining, barrel-racing, and team penning, as well as in therapy work. Most horses are domesticated, but there are some feral populations in isolated pockets around the world.

Horses are medium to large mammals, with long heads and necks with a mane. Their legs are slender and end in a single toe, protected by a horny hoof. They have long, slender tails, either ending in a tuft, or entirely covered in flowing hair. They are adapted to generally open terrain, from plains and savannas, to mountains or deserts. Equines are one of only two mammals (the other is the human) capable of producing copious sweat perspiration for thermoregulatory cooling, enabling fast running over long distances.

Horses are herbivores, and feed predominantly on tough, fibrous food, such as grasses and sedges. When in need, they will also eat other vegetable matter, such as leaves, fruits, or bark, but are normally grazers, not browsers. Unlike ruminants, with their complex stomachs, equines break down cellulose in the "hindgut" or caecum, a part of the colon.

Equus caballus sylvaticus, the Forest or Diluvian Horse, appears to be the ancestor of the modern draft and heavyweight breeds; these horses were slow-moving and stoutly built, with coarse, thick coats, manes, and tails. Equus caballus gmelini Antonius, the Tarpan horse, from eastern Europe and the steppes of southern Russia, had a smaller, lighter build, but was hardy, strong and speedy; many pony and light horse breeds are believed to have evolved from this lineage. Equus caballus przewalskii prsewalskii Poliakov, the Asiatic horse, was discovered in the wild in Mongolia in 1879, and a few populations still live in the wild in eastern Asia, as well as in zoos. Although the Asiatic horse, which is hardy, cold-resistant and dun with darker mane and tail, is considered to be ancestral to many breeds, it has a different chromosome number (33, vs. the 32 found in modern horse breeds). Differing lineages or combinations of the three original subspecies in turn yielded four general types of ponies and horses from which all modern breeds derive.

The horse was first domesticated 5,000 to 6,000 years ago, perhaps earlier. Horses appear to have been domesticated in conjunction with the evolution of agriculture. From this start, horse breeds were developed and used in warfare and for transportation.

(McBane 2005, Wikipedia 2012.)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Jacqueline Courteau

Supplier: Jacqueline Courteau

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Original populations were once found in the steppe zone from Poland to Mongolia. Now domesticated, horses occur throughout the world and in feral populations in some areas.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced , Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to Eurasia. Domesticated worldwide. Feral in Portugal, Spain, France, Greece, Iran, Sri Lanka, Australia, New Zealand, Colombia, Hispaniola, Canada, U.S., Galapagos, and probably other oceanic islands. Feral in many western U.S. states, mostly in the Great Basin (Nevada, and portions of Oregon, California, and Utah), with large numbers also in the Red Desert of southwestern Wyoming, and smaller populations elsewhere in Wyoming and in Arizona, Colorado, Idaho, Montana, and New Mexico. Free-ranging feral horses occur also on some Atlantic coast barrier islands (Assateague Island, Virginia and Maryland; Shackleford Banks, North Carolina; Carrot Island, North Carolina; Cumberland Island, Georgia). Feral horses on Ocracoke Island, North Carolina are maintained in an enclosure. Formerly feral in Hawaii (see Tomich 1986 and Kramer 1971 for history of horse in Hawaii).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Horses have been so strongly bred by humans that there is extensive variability in their size and weight. The general body pattern is that of long limbs, barrel shaped body, and a long neck supporting a large head. Vision and hearing are key senses for these animals, as suggested by their large eyes and ears. Coloration is also hightly variable due to breeding, and individuals range from pure white, tan, brown or black to patches of oranges and browns on white. The tail is relatively short but has long hairs coming off it that frequently reach the ground. The tail is often used as an "extra hand" to swat insects. There is also long hair along the neck and forehead (the mane and forelock).

Range mass: 300 to 2000 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Ecology

Habitat

Most horses today are domesticated, but there are some feral populations that live in diverse habitats. Along the coastline of France and Spain, the barrier islands of Virginia and North Carolina, the Great Basin of the western United States, and in different areas of Australia, for example.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In West, shrubby sagebrush plains and mountains, juniper woodland; ranges include grazing area, shelter, water, and shade (Slade and Godfrey 1982). Often on ridgetops.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Horses are natural grazers of grasslands, but often have domestic diets with grain and hay. Horses graze while walking slowly, pulling off a mouthful every few steps.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Grasses and grass-like plants comprise bulk of diet; also browses on shrubs in winter. In the West, generally visits water hole once per day; may dig to water in dry river bed. (Slade and Godfrey 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Plant / resting place / within
larva of Angiometopa ruralis may be found in superficial wound of Equus caballus

Animal / dung/debris feeder
larva of Aphodius conspurcatus feeds on dung/debris dung of Equus caballus
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius contaminatus feeds on dung/debris dung of Equus caballus
Other: major host/prey

Plant / resting place / within
imago of Aphodius erraticus may be found in dung of Equus caballus
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius haemorrhoidalis feeds on dung/debris dung of Equus caballus
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius ictericus feeds on dung/debris slightly dry dung of Equus caballus
Other: major host/prey

Plant / resting place / within
imago of Aphodius lividus may be found in dung of Equus caballus

Animal / dung/debris feeder
larva of Aphodius luridus feeds on dung/debris dung of Equus caballus

Plant / resting place / within
imago of Aphodius obliteratus may be found in dung of Equus caballus
Other: major host/prey

Plant / resting place / within
imago of Aphodius putridus may be found in dung of Equus caballus

Animal / dung/debris feeder
larva of Aphodius scrofa feeds on dung/debris dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Arnium caballinum is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
perithecium of Arnium hirtum is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
perithecium of Arnium macrotheca is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
perithecium of Arnium mendax is saprobic in/on dung or excretions of dung of Equus caballus
Other: minor host/prey

Animal / dung saprobe
perithecium of Arnium olerum is saprobic in/on dung or excretions of dung of Equus caballus

In Great Britain and/or Ireland:
Animal / dung associate
Arthrobotrys anamorph of Arthrobotrys oligospora inhabits dung of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus albidus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus boudieri is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus elegans is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
sessile apothecium of Ascobolus equinus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus immersus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus mancus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus perplexans is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus roseopurpurascens is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus stercorarius is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Ascobolus stictoideus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
basally immersed, mostly densely clustered perithecium of Cercophora coprophila is saprobic in/on dung or excretions of dung of Equus caballus
Other: minor host/prey

Animal / dung saprobe
basally immersed, scattered or in small groups perithecium of Cercophora mirabilis is saprobic in/on dung or excretions of dung of Equus caballus
Other: minor host/prey

Animal / associate
sporangiophore of Chaetocladium brefeldii is associated with dung of Equus caballus

Animal / dung saprobe
perithecium of Chaetomium aureum is saprobic in/on dung or excretions of dung of Equus caballus
Other: unusual host/prey

Animal / dung saprobe
solitary or gregarious, sessile apothecium of Cheilymenia fimicola is saprobic in/on dung or excretions of dung of Equus caballus
Other: minor host/prey

Animal / dung saprobe
fruitbody of Conocybe candida is saprobic in/on dung or excretions of decayed, fermenting dung of Equus caballus

Animal / dung saprobe
fruitbody of Conocybe farinacea is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Conocybe fimetaria is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Conocybe lenticulospora is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Conocybe murinacea is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Conocybe percincta is saprobic in/on dung or excretions of decayed stable waste of Equus caballus

Animal / dung saprobe
fruitbody of Conocybe siennophylla is saprobic in/on dung or excretions of decayed stable waste of Equus caballus

Animal / dung/debris feeder
fruitbody of Conocybe watlingii feeds on dung/debris weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Coprinellus curtus is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Coprinopsis luteocephala is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Coprinopsis nivea is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinopsis trispora is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Coprinopsis vermiculifer is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinus ephemeroides is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Coprinus radiatus is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinus sterquilinus is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinus tuberosus is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
sessile apothecium of Coprotus lacteus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
sessile apothecium of Coprotus niveus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
sessile apothecium of Coprotus sexdecimsporus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
fruitbody of Cristinia coprophila is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
sporangiophore of Cunninghamella echinulata is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
pseudothecium of Delitschia chaetomoides is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
pseudothecium of Delitschia didyma is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
pseudothecium of Delitschia niesslii is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
pseudothecium of Delitschia patagonica is saprobic in/on dung or excretions of dung of Equus caballus

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Equus caballus

Animal / dung saprobe
apothecium of Fimaria equina is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung/debris feeder
larva of Geotrupes mutator feeds on dung/debris buried dung of Equus caballus
Other: major host/prey

Animal / dung/debris feeder
larva of Geotrupes stercorarius feeds on dung/debris buried dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
effuse colony of Gilmaniella dematiaceous anamorph of Gilmaniella humicola is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
synnema of Graphium dematiaceous anamorph of Graphium putredinis is saprobic in/on dung or excretions of old dung of Equus caballus
Remarks: captive: in captivity, culture, or experimentally induced
Other: unusual host/prey

Animal / parasite / ectoparasite
adult of Hippobosca equina ectoparasitises Equus caballus
Other: major host/prey

Animal / dung saprobe
superficial, gregarious perithecium of Hydropisphaera suffulta is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
immersed perithecium of Hypocopra stephanophora is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
immersed perithecium of Hypocopra stercoraria is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
sporangiophore of Kickxella alabastrina is saprobic in/on dung or excretions of dung of Equus caballus

Animal / associate
Lyctocoris campestris is associated with stable of Equus caballus

Animal / dung saprobe
fruitbody of Lysurus cruciatus is saprobic in/on dung or excretions of decayed, strawy manure of Equus caballus

Animal / dung saprobe
long-stalked apothecium of Martininia panamaensis is saprobic in/on dung or excretions of dung of Equus caballus

Animal / pathogen
Microsporum anamorph of Microsporum equinum infects Equus caballus

Animal / dung associate
sporangiophore of Mortierella bainieri inhabits dung of dung of Equus caballus

Animal / dung saprobe
sporangiophore of Mucor mucedo is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung associate
larva of Musca autumnalis inhabits dung of Equus caballus

Animal / dung/debris feeder
larva of Onthophagus joannae feeds on dung/debris buried dung of Equus caballus

Animal / dung/debris feeder
larva of Onthophagus similis feeds on dung/debris buried dung of Equus caballus

Animal / dung/debris feeder
larva of Onthophagus vacca feeds on dung/debris buried dung of Equus caballus

Animal / dung saprobe
fruitbody of Panaeolus papilionaceus var. parvisporus is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Panaeolus semiovatus var. phalaenarum is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Panaeolus semiovatus var. semiovatus is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Panaeolus subfirmus is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
sessile apothecium of Peziza bovina is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
colony of Oedocephalum anamorph of Peziza vesiculosa is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
solitary or clustered, sessile apothecium of Pezizella albula is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
sporangiophore of Pilaira anomala is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
sporangiophore of Pilaira moreaui is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
sporangiophore of Pilobolus crystallinus var. crystallinus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
sporangiophore of Pilobolus crystallinus var. kleinii is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung/debris feeder
Podops inuncta feeds on dung/debris dung of Equus caballus
Remarks: Other: uncertain

Animal / dung saprobe
superficial perithecium of Podospora appendiculata is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
partly immersed perithecium of Podospora communis is saprobic in/on dung or excretions of dung of Equus caballus
Other: minor host/prey

Animal / dung saprobe
perithecium of Podospora conica is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
immersed, neck protruding perithecium of Podospora curvicolla is saprobic in/on dung or excretions of dung of Equus caballus
Other: minor host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora decipiens is saprobic in/on dung or excretions of dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora ellisiana is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
partly immersed perithecium of Podospora fimiseda is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
partly immersed perithecium of Podospora intestinacea is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly crowded,partly immersed apothecium of Podospora myriospora is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
partly immersed perithecium of Podospora pauciseta is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
partly immersed perithecium of Podospora perplexens is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
partly immersed perithecium of Podospora pleiospora is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
partly immersed perithecium of Podospora pyriformis is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
partly immersed perithecium of Podospora setosa is saprobic in/on dung or excretions of dung of Equus caballus

Plant / resting place / within
ovum of Polietes steinii may be found in absolutely fresh dung of Equus caballus
Other: sole host/prey

Animal / dung saprobe
stalked stroma of Poronia punctata is saprobic in/on dung or excretions of dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Psathyrella coprophila is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
solitary, scattered or gregarious fruitbody of Psathyrella hirta is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Psathyrella scatophila is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
fruitbody of Psathyrella sphaerocystis is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
fruitbody of Psathyrella stercoraria is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
solitary, gregarious to subcaespitose fruitbody of Psathyrella tenuicola is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
fruitbody of Psilocybe fimetaria is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Psilocybe merdicola is saprobic in/on dung or excretions of weathered dung of Equus caballus
Other: major host/prey

Animal / dung saprobe
fruitbody of Psilocybe subcoprophila is saprobic in/on dung or excretions of weathered dung of Equus caballus

Animal / dung saprobe
perithecium of Pyxidiophora grovei is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
gregarious, partly immersed apothecium of Ryparobius pachyascus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
solitary or gregarious, superficial, sessile apothecium of Saccobolus citrinus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus depauperatus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus dilutellus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
solitary or gregarious, superficial, sessile apothecium of Saccobolus glaber is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
scattered, superficial, sessile apothecium of Saccobolus globuliferellus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus versicolor is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
perithecium of Schizothecium glutinans is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
perithecium of Schizothecium hispidulum is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
perithecium of Schizothecium pilosum is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
perithecium of Schizothecium vesticola is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
stromatic perithecium of Selinia pulchra is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
gregarious perithecium of Sordaria fimicola is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly grouped perithecium of Sordaria humana is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly grouped perithecium of Sordaria lappae is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
grouped perithecium of Sordaria macrospora is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella antarctica is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella australis is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella grandispora is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella lageniformis is saprobic in/on dung or excretions of old dung of Equus caballus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella leporina is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella megalospora is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella minima is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Thecotheus keithii is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Thecotheus pelletieri is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
gregarious, sometimes confluent apothecium of Thelebolus crustaceus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
scattered or gregarious, sessile apothecium of Thelebolus polysporus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
apothecium of Thelebolus stercoreus is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung associate
fruitbody of Tomentellopsis echinospora inhabits dung of weathered dung of Equus caballus
Other: unusual host/prey

Animal / associate
imago of Typhaeus typhoeus is associated with dung of Equus caballus

Animal / dung saprobe
scattered, superficial cleistothecium of Zopfiella erostrata is saprobic in/on dung or excretions of dung of Equus caballus

Animal / dung saprobe
perithecium of Zygospermella striata is saprobic in/on dung or excretions of dung of Equus caballus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Equus caballus (horses) preys on:
shrubs
grass
herbs

Based on studies in:
USA: Arizona (Forest, Montane)

This list may not be complete but is based on published studies.
  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Equus caballus (horses) is prey of:
Puma concolor

Based on studies in:
USA: Arizona (Forest, Montane)

This list may not be complete but is based on published studies.
  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: As of the early 1980s, there were about 40,000-60,000 wild horses in the western U.S.; largest number in Nevada (Slade and Godfrey 1982); estimate was 40,000 in 1988.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Common social group: several females led by dominant male; females usually do not change group membership; young males are expelled from group at 1-3 years, form bachelor groups.

Annual home range usually is less than 25 sq km (but up to 300 sq km in Wyoming).

In Montana, annual survival usually was high (93-99%), sometimes as low as 50%; population growth was 18% annually in population maintained by removal at 120-150 (Garrot and Taylor 1990).

In the western U.S., females tend to have greater survivorship than do males early in life, but males tend to be more frequent than are females in the oldest age classes (>10 years) (Garrott 1991).

In the southern Great Basin of Nevada, mountain lion predation on the young was believed to be a major population limiting factor (Greger and Romney 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
50.0 years.

Average lifespan

Status: wild:
62.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 57 years (captivity) Observations: Horses suffer from a form of mechanical senescence in their teeth that limits their longevity. As in dogs (*Canis familiaris*), dwarf or miniature horses appear to live longer (Miller and Austad 2006). One Icelandic miniature horse named "Tulle" is reported to have lived 57 years (Richard Miller, pers. comm.). Anecdotal evidence tells of a horse, called "Old Billy," that lived for 62 years in England, but that record is unverified.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Horses are seasonal breeders, but during the breeding season come into estrus monthly until impregnated. Birth, usually of one foal occurs after an 11 month gestation period. In about 15-25 minutes the foal is able to follow its mother around, and it stays close to her side for the first few days of life. Weaning occurs after approximately 7 months, but if the female doesn't become pregnant yearlings have been observed to occasionally nurse off their mothers.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 79200 g.

Average gestation period: 337 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
973 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
914 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

On Assateague Island, breeding activity peaks in May and June, foaling peaks in April and May; weaning occurs at age 1 year (or 2-3 years if the female does not foal in consecutive years) (Kirkpatrick and Turner 1991). Gestation averages about 340 days. Postpartum estrus occurs 7-11 days after birth. In general, first reproduction by females occurs at age 2 years, and the highest foaling rates occur among females 6-15 years old (Garrott et al. 1991). In Idaho, 36% of the 2-year-olds were pregnant, 85% of 6-15-year-olds; no yearlings were pregnant; at least 50% of the eligible mares were pregnant in consecutive years (Seal and Plotka 1983). In Nevada, Oregon, and Wyoming, about 60-80% of the females two years of age or older were pregnant, as were some yearling females. In Montana, females did not reproduce until 3 years old; annual foaling rate of adult females was 36-56% (Garrot and Taylor 1990). See also Bowling and Touchberry (1990) for information on reproduction of Great Basin horses. Foaling rate was 33% and 63% in two separate herds on Assateague Island, Maryland and Virginia (Kirkpatrick and Turner 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Hooves resist cracking: horse
 

The hooves of horses resist cracking by having braided filaments of keratin in horizontal sheets punctuated vertically by thin, hollow tubes.

   
  "Horse hooves are among the most crack-resistant substances in the natural world, about twenty times tougher than bone. As such, they may provide clues to researchers hoping to develop stronger materials for human use. Horse hooves, like human fingernails, are composed of cells housing braided filaments of keratin. From cell to cell, the braids run in the same direction. In hooves, these cells are glued together into horizontal sheets. The sheets are punctuated vertically with thin, hollow tubes, each of which is surrounded by several sleeves of cells. Although cracks may travel horizontally along the sheets, they are generally stopped by the tubes." (Courtesy of the Biomimicry Guild)

  Learn more about this functional adaptation.
  • Kasapi, MA; Gosline, JM. 1997. Design complexity and fracture control in the equine hoof wall. Journal of Experimental Biology. 200: 1639-1659.
  • Kasapi, MA; Gosline, JM. 1999. Micromechanics of the equine hoof wall: optimizing crack control and material stiffness through modulation of the properties of keratin. Journal of Experimental Biology. 202: 377-391.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Equus caballus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 158 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGACTATTTTCAACTAACCACAAAGACATCGGCACTCTGTACCTCCTATTCGGCGCTTGAGCTGGAATAGTAGGAACTGCCCTAAGCCTCCTAATCCGTGCTGAATTAGGCCAACCTGGGACCTTACTAGGAGATGATCAGATCTACAATGTCATTGTAACCGCCCATGCATTCGTAATAATTTTCTTTATGGTCATACCCATTATAATCGGAGGATTCGGAAACTGATTAGTCCCCCTGATAATTGGAGCACCTGATATAGCTTTCCCCCGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTACTTCTTCTCGCTTCCTCAATAATTGAAGCAGGTGCCGGAACAGGCTGAACCGTATATCCTCCTCTAGCTGGAAATCTGGCGCATGCAGGAGCCTCTGTTGACTTAACCATTTTCTCTCTCCACCTAGCTGGGGTGTCCTCAATTTTAGGTGCCATCAACTTTATTACCACAATCATTAACATAAAACCACCGGCTCTATCCCAATATCAAACCCCCCTATTCGTTTGATCTGTCCTTATTACGGCAGTACTCCTTCTCCTAGCCCTCCCGGTCCTAGCAGCAGGCATTACCATGCTTCTCACAGACCGTAACCTAAACACTACTTTCTTCGACCCCGCAGGAGGAGGGGATCCAATCCTTTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTCTATATTCTTATCCTACCAGGCTTCGGTATAATCTCACACATCGTCACATACTACTCAGGTAAAAAGGAACCTTTTGGCTACATGGGTATAGTGTGAGCTATAATATCCATTGGCTTTCTAGGCTTCATCGTATGGGCTCACCACATGTTTACAGTAGGGATAGACGTTGACACACGAGCATACTTCACATCAGCTACCATAATCATCGCTATCCCTACCGGTGTAAAAGTATTCAGCTGACTAGCCACCCTGCACGGAGGAAATATCAAATGATCTCCAGCTATACTCTGAGCTCTAGGCTTCATCTTCTTATTCACAGTAGGAGGTCTAACAGGAATCGTCCTAGCTAACTCATCCCTAGATATTGTTCTCCACGATACTTATTATGTAGTAGCACATTTCCATTATGTCCTGTCTATAGGAGCAGTCTTCGCCATTATGGGGGGATTTGTACACTGATTCCCTCTATTCTCAGGATACACACTCAACCAAACCTGAGCAAAAATCCACTTTACAATTATATTCGTAGGGGTAAATATAACCTTCTTCCCACAACATTTCCTTGGCCTCTCAGGAATGCCACGACGCTATTCTGATTACCCAGACGCATATACAACATGAAATACCATCTCATCCATAGGATCTTTTATCTCACTTACAGCAGTGATACTAATAATTTTCATAATTTGAGAAGCATTCGCATCCAAACGAGAAGTGTCTACAGTAGAATTAACCTCAACTAATCTGGAATGACTACACGGATGCCCCCCACCATACCACACATTTGAAGAACCCACCTACGTAAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Equus caballus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 165
Specimens with Barcodes: 181
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Domestic horse breeds are numerous and plentiful. Feral populations are mostly small in number and threatened by human encroachment. The one true wild horse Przewalski's horse is considered extinct in the wild by some, and at best is alive only through captive breeding programs.

US ESA -Endangered, IUCN - Extinct?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNA - Not Applicable

Other Considerations: Woodward and Sponenberg (1992) identifed horses from Pryor Mountain (and any other populations with Spanish ancestry) as important stores of genetic variation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Regulated by Wild Horse and Burro Act of 1971. Most lands having wild horses are managed by BLM, which periodically gathers horses from herd management units and places them in captivity; as of the early 1990s, horses that were not disposed of through the "Adopt-A-Horse" program were maintained in captivity (they could not be sold or destroyed).

Major management problem is keeping populations down to levels that avoid overgrazing or competition with other species (Slade and Godfrey 1982). Garrott et al. (1991) concluded that many populations in the western U.S. currently are being maintained at levels below which density-dependent responses operate and are increasing at or near their biological maximum.

Studies in Great Basin indicated that sterilization of dominant males will reduce but not eliminate foal production; female contraceptive implants could be effectively targeted to specific age classes (e.g. females 6-8 years old were much more likely to reproduce than older or younger females) (Bowling and Touchberry 1990). See Kirkpatrick et al. (1990) for information on a remotely delivered immunocontraception technique. See Garrott (1991) and Turner and Kirkpatrick (1991) for additional discussion of the potential and limitations of fertility control.

Goodloe et al. (1991) noted that local historic and economic values might require maintenance of feral horse populations on some eastern U.S. barrier islands; however, ecological and genetic criteria justify reducing the size of these populations; recommended minimum population sizes were 72 on Assateague Island National Seashore, Maryland; 155 on Chincoteague National Wildlife Refuge, Virginia; and 122 on Cumberland Island, Georgia. Annual removal of foals from the Chincoteague NWR herd results in higher foaling rates relative to the population on Assateague Island National Seashore, where management is minimal (Kirkpatrick and Turner 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pleistocene Re-wilding

 

This species is one of a number which have been included in various “Pleistocene rewilding” plans. Pleistocene rewilding is the proposed practice of restoring ecosystems to their state in the Pleistocene, roughly 10,000 years ago. This contrasts the standard conservation benchmark, particularly in North America, of restoring ecosystems to their pre-Columbian or pre-industrial state. In both Eurasia and North America, the Pleistocene was characterized by much greater diversity and numbers of large herbivores and predators, including proboscidians, equids, camelids, and felidae (Donlan et al 2006; Zimov 2005). The process of restoration would involve the reintroduction of extant species in their historic range, as well as the introduction of ‘proxy organisms’ to replace the ecological functionality of extinct organisms (Donlan et al 2006). 

There are three central theoretical goals to Pleistocene rewilding. In Siberia, a team led by Sergey Zimov is investigating the role of large herbivores as ecosystem engineers. It is thought that herbivory pressure could play a central role in maintaining a grass-dominated plant community, as opposed to either tree- or moss-dominated. Grasslands are known to be more stable carbon sinks than either mossy or forested tundra, due to the rapidity of their biogeochemical cycling (Zimov 2005). In principle, then, reintroducing Pleistocene fauna could have positive climate change mitigation effects. Proposals in North America have focused instead on the preservation of ecological dynamics. Proponents of Pleistocene rewilding argue that due to the strong ecological interactions of megafauna, it is likely that their extinction at the end of the Pleistocene would have caused cascading ecological disruptions lasting until the present time (Donlan et al 2006). Additionally, introduction programs could provide a new lease on life for extant, endangered megafauna species, such as cheetahs and Asian elephants (Rubenstein 2006). 

Pleistocene rewilding, while headline-grabbing, is by no means the standard of modern conservation biology. There are a number of objections to the proposals of Pleistocene rewilders, summarized by Rubenstein et al (2006). The introduction of species which have been locally extinct for thousands of years, and more particularly the introduction of modern relatives of extinct species, carries many risks: the potential for invasive species, catastrophic disruption of existing ecosystems, inadvertent introduction of disease organisms, and unpredictable behavior of introduced species. Additionally, while paleoecology is a growing field, there is still a fair amount of uncertainty about the actual ecosystem functions of the Pleistocene.

Species which Zimov and his colleagues in Siberia are experimenting with bison, musk oxen, Przewalski’s horse, and Siberian tigers (Zimov 2005). Small-scale introductions have already begun in Yakutia. Donlan et al propose introducing Przewalski’s horse, Bolson tortoises, Bactrian camels, cheetahs, lions, and elephants into the Western United States (Donlan et al 2005). While some individuals of these species are present on privately owned land, there are no free-living populations in North America at this time. 

  • Donlan CJ, Berger J, Bock CE, Bock JH, Burney DA, Estes JA, Foreman D, Martin PS, Roemer GW, Smith FA, Soule ME, Greene HW. 2005. Pleistocene Rewilding: An Optimistic Agenda for Twenty-First Century Conservation. The American Naturalist 168:660-681.
  • Donlan, CJ. 2005. Re-Wilding North America. Nature 436:913-914.
  • Rubenstein DR, Rubenstein DI, Sherman PW, Gavin TA. 2006. Pleistocene Park: Does Rewilding North America Represent Sound Conservation for the 21st Century? Biological Conservation 132:232-238.
  • Zimov, SA. 2005. Pleistocene Park: Return of the Mammoth’s Ecosystem. Science 308:796-798.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 2 people

Average rating: 2.14286 of 5

Relevance to Humans and Ecosystems

Benefits

Domestic horses are arguably the most important animal that has been domesticated. Long been used as a means of transportation, pleasure, work, and even war horses have been involved in much of human history.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Economic Uses

Comments: Some regard it as pest, citing fouling of water, competition with domestic stock, or displacement of native ungulates (pronghorn, bighorn sheep).

Under Wild Horse and Burro Act, can be adopted for use in riding or as pet; Act generally prohibits commercial exploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Horse

For other uses, see Horse (disambiguation).

The horse (Equus ferus caballus)[2][3] is one of two extant subspecies of Equus ferus. It is an odd-toed ungulate mammal belonging to the taxonomic family Equidae. The horse has evolved over the past 45 to 55 million years from a small multi-toed creature into the large, single-toed animal of today. Humans began to domesticate horses around 4000 BC, and their domestication is believed to have been widespread by 3000 BC. Horses in the subspecies caballus are domesticated, although some domesticated populations live in the wild as feral horses. These feral populations are not true wild horses, as this term is used to describe horses that have never been domesticated, such as the endangered Przewalski's horse, a separate subspecies, and the only remaining true wild horse. There is an extensive, specialized vocabulary used to describe equine-related concepts, covering everything from anatomy to life stages, size, colors, markings, breeds, locomotion, and behavior.

Horses' anatomy enables them to make use of speed to escape predators and they have a well-developed sense of balance and a strong fight-or-flight response. Related to this need to flee from predators in the wild is an unusual trait: horses are able to sleep both standing up and lying down. Female horses, called mares, carry their young for approximately 11 months, and a young horse, called a foal, can stand and run shortly following birth. Most domesticated horses begin training under saddle or in harness between the ages of two and four. They reach full adult development by age five, and have an average lifespan of between 25 and 30 years.

Horse breeds are loosely divided into three categories based on general temperament: spirited "hot bloods" with speed and endurance; "cold bloods", such as draft horses and some ponies, suitable for slow, heavy work; and "warmbloods", developed from crosses between hot bloods and cold bloods, often focusing on creating breeds for specific riding purposes, particularly in Europe. There are more than 300 breeds of horse in the world today, developed for many different uses.

Horses and humans interact in a wide variety of sport competitions and non-competitive recreational pursuits, as well as in working activities such as police work, agriculture, entertainment, and therapy. Horses were historically used in warfare, from which a wide variety of riding and driving techniques developed, using many different styles of equipment and methods of control. Many products are derived from horses, including meat, milk, hide, hair, bone, and pharmaceuticals extracted from the urine of pregnant mares. Humans provide domesticated horses with food, water and shelter, as well as attention from specialists such as veterinarians and farriers.

Biology[edit]

Main article: Equine anatomy
Diagram of a horse with some parts labeled.
Points of a horse[4][5]

Specific terms and specialized language are used to describe equine anatomy, different life stages, colors and breeds.

Lifespan and life stages[edit]

Depending on breed, management and environment, the modern domestic horse has a life expectancy of 25 to 30 years.[6] Uncommonly, a few animals live into their 40s and, occasionally, beyond.[7] The oldest verifiable record was "Old Billy", a 19th-century horse that lived to the age of 62.[6] In modern times, Sugar Puff, who had been listed in Guinness World Records as the world's oldest living pony, died in 2007 at age 56.[8]

Regardless of a horse or pony's actual birth date, for most competition purposes a year is added to its age each January 1 of each year in the Northern Hemisphere[6][9] and each August 1 in the Southern Hemisphere.[10] The exception is in endurance riding, where the minimum age to compete is based on the animal's actual calendar age.[11]

The following terminology is used to describe horses of various ages:

  • Colt: a male horse under the age of four.[12] A common terminology error is to call any young horse a "colt", when the term actually only refers to young male horses.[13]
  • Filly: a female horse under the age of four.[14]
  • Foal: a horse of either sex less than one year old. A nursing foal is sometimes called a suckling and a foal that has been weaned is called a weanling.[14] Most domesticated foals are weaned at five to seven months of age, although foals can be weaned at four months with no adverse physical effects.[15]
  • Gelding: a castrated male horse of any age.[14]
  • Mare: a female horse four years old and older.[16]
  • Stallion: a non-castrated male horse four years old and older.[17] The term "horse" is sometimes used colloquially to refer specifically to a stallion.[18]
  • Yearling: a horse of either sex that is between one and two years old.[19]

In horse racing, these definitions may differ: For example, in the British Isles, Thoroughbred horse racing defines colts and fillies as less than five years old.[20] However, Australian Thoroughbred racing defines colts and fillies as less than four years old.[21]

Size and measurement[edit]

The height of horses is measured at the highest point of the withers, where the neck meets the back.[22] This point is used because it is a stable point of the anatomy, unlike the head or neck, which move up and down in relation to the body of the horse.

The English-speaking world measures the height of horses in hands and inches: one hand is equal to 4 inches (101.6 mm). The height is expressed as the number of full hands, followed by a point, then the number of additional inches, and ending with the abbreviation "h" or "hh" (for "hands high"). Thus, a horse described as "15.2 h" is 15 hands plus 2 inches, for a total of 62 inches (157.5 cm) in height.[23]

A large brown horse is chasing a small horse in a pasture.
Size varies greatly among horse breeds, as with this full-sized horse and a miniature horse.

The size of horses varies by breed, but also is influenced by nutrition. Light riding horses usually range in height from 14 to 16 hands (56 to 64 inches, 142 to 163 cm) and can weigh from 380 to 550 kilograms (840 to 1,210 lb).[24] Larger riding horses usually start at about 15.2 hands (62 inches, 157 cm) and often are as tall as 17 hands (68 inches, 173 cm), weighing from 500 to 600 kilograms (1,100 to 1,320 lb).[25] Heavy or draft horses are usually at least 16 hands (64 inches, 163 cm) high and can be as tall as 18 hands (72 inches, 183 cm) high. They can weigh from about 700 to 1,000 kilograms (1,540 to 2,200 lb).[26]

The largest horse in recorded history was probably a Shire horse named Mammoth, who was born in 1848. He stood 21.2 12 hands (86.5 inches, 220 cm) high and his peak weight was estimated at 1,500 kilograms (3,300 lb).[27] The current record holder for the world's smallest horse is Thumbelina, a fully mature miniature horse affected by dwarfism. She is 17 in (43 cm) tall and weighs 57 lb (26 kg).[28]

Ponies[edit]

Main article: Pony

Ponies are taxonomically the same animals as horses. The distinction between a horse and pony is commonly drawn on the basis of height, especially for competition purposes. However, height alone is not dispositive; the difference between horses and ponies may also include aspects of phenotype, including conformation and temperament.

The traditional standard for height of a horse or a pony at maturity is 14.2 hands (58 inches, 147 cm). An animal 14.2 h or over is usually considered to be a horse and one less than 14.2 h a pony,[29] but there are many exceptions to the traditional standard. In Australia, ponies are considered to be those under 14 hands (56 inches, 142 cm),[30] For competition in the Western division of the United States Equestrian Federation, the cutoff is 14.1 hands (57 inches, 145 cm)[31] The International Federation for Equestrian Sports, the world governing body for horse sport, uses metric measurements and defines a pony as being any horse measuring less than 148 centimetres (58.27 in) at the withers without shoes, which is just over 14.2 h, and 149 centimetres (58.66 in), or just over 14.2½ h, with shoes.[32]

Height is not the sole criterion for distinguishing horses from ponies. Breed registries for horses that typically produce individuals both under and over 14.2 h consider all animals of that breed to be horses regardless of their height.[33] Conversely, some pony breeds may have features in common with horses, and individual animals may occasionally mature at over 14.2 h, but are still considered to be ponies.[34]

Ponies often exhibit thicker manes, tails, and overall coat. They also have proportionally shorter legs, wider barrels, heavier bone, shorter and thicker necks, and short heads with broad foreheads. They may have calmer temperaments than horses and also a high level of equine intelligence that may or may not be used to cooperate with human handlers.[29] Small size, by itself, is not an exclusive determinant. For example, the Shetland pony which averages 10 hands (40 inches, 102 cm), is considered a pony.[35] Conversely, breeds such as the Falabella and other miniature horses, which can be no taller than 30 inches (76 cm), are classified by their registries as very small horses, not ponies.[36]

Genetics[edit]

Horses have 64 chromosomes.[37] The horse genome was sequenced in 2007. It contains 2.7 billion DNA base pairs,[38] which is larger than the dog genome, but smaller than the human genome or the bovine genome.[39] The map is available to researchers.[40]

Colors and markings[edit]

Two horses in a field. The one on the left is a dark brown with black mane and tail. The one on the right is a light red all over.
Bay (left) and chestnut (sometimes called "sorrel") are two of the most common coat colors, seen in almost all breeds.

Horses exhibit a diverse array of coat colors and distinctive markings, described by a specialized vocabulary. Often, a horse is classified first by its coat color, before breed or sex.[41] Horses of the same color may be distinguished from one another by white markings,[42] which, along with various spotting patterns, are inherited separately from coat color.[43]

Many genes that create horse coat colors and patterns have been identified. Current genetic tests can identify at least 13 different alleles influencing coat color,[44] and research continues to discover new genes linked to specific traits. The basic coat colors of chestnut and black are determined by the gene controlled by the Melanocortin 1 receptor,[45] also known as the "extension gene" or "red factor,"[44] as its recessive form is "red" (chestnut) and its dominant form is black.[46] Additional genes control suppression of black color to point coloration that results in a bay, spotting patterns such as pinto or leopard, dilution genes such as palomino or dun, as well as graying, and all the other factors that create the many possible coat colors found in horses.[44]

Horses which have a white coat color are often mislabeled; a horse that looks "white" is usually a middle-aged or older gray. Grays are born a darker shade, get lighter as they age, but usually keep black skin underneath their white hair coat (with the exception of pink skin under white markings). The only horses properly called white are born with a predominantly white hair coat and pink skin, a fairly rare occurrence.[46] Different and unrelated genetic factors can produce white coat colors in horses, including several different alleles of dominant white and the sabino-1 gene.[47] However, there are no "albino" horses, defined as having both pink skin and red eyes.[48]

Reproduction and development[edit]

Main article: Horse breeding

Gestation lasts approximately 340 days, with an average range 320–370 days,[49] and usually results in one foal; twins are rare.[50] Horses are a precocial species, and foals are capable of standing and running within a short time following birth.[51] Foals are usually born in the spring. The estrous cycle of a mare occurs roughly every 19–22 days and occurs from early spring into autumn. Most mares enter an anestrus period during the winter and thus do not cycle in this period.[52] Foals are generally weaned from their mothers between four and six months of age.[53]

Horses, particularly colts, sometimes are physically capable of reproduction at about 18 months, but domesticated horses are rarely allowed to breed before the age of three, especially females.[54] Horses four years old are considered mature, although the skeleton normally continues to develop until the age of six; maturation also depends on the horse's size, breed, sex, and quality of care. Larger horses have larger bones; therefore, not only do the bones take longer to form bone tissue, but the epiphyseal plates are larger and take longer to convert from cartilage to bone. These plates convert after the other parts of the bones, and are crucial to development.[55]

Depending on maturity, breed, and work expected, horses are usually put under saddle and trained to be ridden between the ages of two and four.[56] Although Thoroughbred race horses are put on the track as young as the age of two in some countries,[57] horses specifically bred for sports such as dressage are generally not put under saddle until they are three or four years old, because their bones and muscles are not solidly developed.[58] For endurance riding competition, horses are not deemed mature enough to compete until they are a full 60 calendar months (five years) old.[11]

Anatomy[edit]

Skeletal system[edit]

Diagram of a horse skeleton with major parts labeled.
The skeletal system of a modern horse

The horse skeleton averages 205 bones.[59] A significant difference between the horse skeleton and that of a human is the lack of a collarbone—the horse's forelimbs are attached to the spinal column by a powerful set of muscles, tendons, and ligaments that attach the shoulder blade to the torso. The horse's legs and hooves are also unique structures. Their leg bones are proportioned differently from those of a human. For example, the body part that is called a horse's "knee" is actually made up of the carpal bones that correspond to the human wrist. Similarly, the hock contains bones equivalent to those in the human ankle and heel. The lower leg bones of a horse correspond to the bones of the human hand or foot, and the fetlock (incorrectly called the "ankle") is actually the proximal sesamoid bones between the cannon bones (a single equivalent to the human metacarpal or metatarsal bones) and the proximal phalanges, located where one finds the "knuckles" of a human. A horse also has no muscles in its legs below the knees and hocks, only skin, hair, bone, tendons, ligaments, cartilage, and the assorted specialized tissues that make up the hoof.[60]

Hooves[edit]

Main articles: Horse hoof, Horseshoe and Farrier

The critical importance of the feet and legs is summed up by the traditional adage, "no foot, no horse".[61] The horse hoof begins with the distal phalanges, the equivalent of the human fingertip or tip of the toe, surrounded by cartilage and other specialized, blood-rich soft tissues such as the laminae. The exterior hoof wall and horn of the sole is made of essentially the same material as a human fingernail.[62] The end result is that a horse, weighing on average 500 kilograms (1,100 lb),[63] travels on the same bones as would a human on tiptoe.[64] For the protection of the hoof under certain conditions, some horses have horseshoes placed on their feet by a professional farrier. The hoof continually grows, and in most domesticated horses needs to be trimmed (and horseshoes reset, if used) every five to eight weeks,[65] though the hooves of horses in the wild wear down and regrow at a rate suitable for their terrain.

Teeth[edit]

Main article: Horse teeth

Horses are adapted to grazing. In an adult horse, there are 12 incisors at the front of the mouth, adapted to biting off the grass or other vegetation. There are 24 teeth adapted for chewing, the premolars and molars, at the back of the mouth. Stallions and geldings have four additional teeth just behind the incisors, a type of canine teeth called "tushes". Some horses, both male and female, will also develop one to four very small vestigial teeth in front of the molars, known as "wolf" teeth, which are generally removed because they can interfere with the bit. There is an empty interdental space between the incisors and the molars where the bit rests directly on the gums, or "bars" of the horse's mouth when the horse is bridled.[66]

An estimate of a horse's age can be made from looking at its teeth. The teeth continue to erupt throughout life and are worn down by grazing. Therefore, the incisors show changes as the horse ages; they develop a distinct wear pattern, changes in tooth shape, and changes in the angle at which the chewing surfaces meet. This allows a very rough estimate of a horse's age, although diet and veterinary care can also affect the rate of tooth wear.[6]

Digestion[edit]

Horses are herbivores with a digestive system adapted to a forage diet of grasses and other plant material, consumed steadily throughout the day. Therefore, compared to humans, they have a relatively small stomach but very long intestines to facilitate a steady flow of nutrients. A 450-kilogram (990 lb) horse will eat 7 to 11 kilograms (15 to 24 lb) of food per day and, under normal use, drink 38 to 45 litres (8.4 to 9.9 imp gal; 10 to 12 US gal) of water. Horses are not ruminants, so they have only one stomach, like humans, but unlike humans, they can digest cellulose, a major component of grass. Cellulose digestion occurs in the cecum, or "water gut", which food goes through before reaching the large intestine. Horses cannot vomit, so digestion problems can quickly cause colic, a leading cause of death.[67]

Senses[edit]

Close up of a horse eye, with is dark brown with lashes on the top eyelid
A horse's eye
See also: Equine vision

The horses' senses are based on their status as prey animals, where they must be aware of their surroundings at all times.[68] They have the largest eyes of any land mammal,[69] and are lateral-eyed, meaning that their eyes are positioned on the sides of their heads.[70] This means that horses have a range of vision of more than 350°, with approximately 65° of this being binocular vision and the remaining 285° monocular vision.[69] Horses have excellent day and night vision, but they have two-color, or dichromatic vision; their color vision is somewhat like red-green color blindness in humans, where certain colors, especially red and related colors, appear as a shade of green.[71]

Their sense of smell, while much better than that of humans, is not quite as good as that of a dog. It is believed to play a key role in the social interactions of horses as well as detecting other key scents in the environment. Horses have two olfactory centers. The first system is in the nostrils and nasal cavity, which analyze a wide range of odors. The second, located under the nasal cavity, are the Vomeronasal organs, also called Jacobson's organs. These have a separate nerve pathway to the brain and appear to primarily analyze pheromones.[72]

A horse's hearing is good,[68] and the pinna of each ear can rotate up to 180°, giving the potential for 360° hearing without having to move the head.[73] Noise impacts the behavior of horses and certain kinds of noise may contribute to stress: A 2013 study in the UK indicated that stabled horses were calmest in a quiet setting, or if listening to country or classical music, but displayed signs of nervousness when listening to jazz or rock music. This study also recommended keeping music under a volume of 21 decibels.[74] An Australian study found that stabled racehorses listening to talk radio had a higher rate of gastric ulcers than horses listening to music, and racehorses stabled where a radio was played had a higher overall rate of ulceration than horses stabled where there was no radio playing.[75]

Horses have a great sense of balance, due partly to their ability to feel their footing and partly to highly developed proprioception—the unconscious sense of where the body and limbs are at all times.[76] A horse's sense of touch is well developed. The most sensitive areas are around the eyes, ears, and nose.[77] Horses are able to sense contact as subtle as an insect landing anywhere on the body.[78]

Horses have an advanced sense of taste, which allows them to sort through fodder and choose what they would most like to eat,[79] and their prehensile lips can easily sort even small grains. Horses generally will not eat poisonous plants, however, there are exceptions; horses will occasionally eat toxic amounts of poisonous plants even when there is adequate healthy food.[80]

Movement[edit]

Film showing a horse running.
The gallop

All horses move naturally with four basic gaits: the four-beat walk, which averages 6.4 kilometres per hour (4.0 mph); the two-beat trot or jog at 13 to 19 kilometres per hour (8.1 to 11.8 mph) (faster for harness racing horses); the canter or lope, a three-beat gait that is 19 to 24 kilometres per hour (12 to 15 mph); and the gallop.[81] The gallop averages 40 to 48 kilometres per hour (25 to 30 mph),[82] but the world record for a horse galloping over a short, sprint distance is 88 kilometres per hour (55 mph).[83] Besides these basic gaits, some horses perform a two-beat pace, instead of the trot.[84] There also are several four-beat "ambling" gaits that are approximately the speed of a trot or pace, though smoother to ride. These include the lateral rack, running walk, and tölt as well as the diagonal fox trot.[85] Ambling gaits are often genetic in some breeds, known collectively as gaited horses.[86] Often, gaited horses replace the trot with one of the ambling gaits.[87]

Behavior[edit]

Main articles: Horse behavior and Stable vices

Horses are prey animals with a strong fight-or-flight response. Their first reaction to threat is to startle and usually flee, although they will stand their ground and defend themselves when flight is impossible or if their young are threatened.[88] They also tend to be curious; when startled, they will often hesitate an instant to ascertain the cause of their fright, and may not always flee from something that they perceive as non-threatening. Most light horse riding breeds were developed for speed, agility, alertness and endurance; natural qualities that extend from their wild ancestors. However, through selective breeding, some breeds of horses are quite docile, particularly certain draft horses.[89]

Horses are herd animals, with a clear hierarchy of rank, led by a dominant individual, usually a mare. They are also social creatures that are able to form companionship attachments to their own species and to other animals, including humans. They communicate in various ways, including vocalizations such as nickering or whinnying, mutual grooming, and body language. Many horses will become difficult to manage if they are isolated, but with training, horses can learn to accept a human as a companion, and thus be comfortable away from other horses.[90] However, when confined with insufficient companionship, exercise, or stimulation, individuals may develop stable vices, an assortment of bad habits, mostly stereotypies of psychological origin, that include wood chewing, wall kicking, "weaving" (rocking back and forth), and other problems.[91]

Intelligence and learning[edit]

Studies have indicated that horses perform a number of cognitive tasks on a daily basis, meeting mental challenges that include food procurement and identification of individuals within a social system. They also have good spatial discrimination abilities.[92] Studies have assessed equine intelligence in areas such as problem solving, speed of learning, and memory. Horses excel at simple learning, but also are able to use more advanced cognitive abilities that involve categorization and concept learning. They can learn using habituation, desensitization, classical conditioning, and operant conditioning, and positive and negative reinforcement.[92] One study has indicated that horses can differentiate between "more or less" if the quantity involved is less than four.[93]

Domesticated horses may face greater mental challenges than wild horses, because they live in artificial environments that prevent instinctive behavior whilst also learning tasks that are not natural.[92] Horses are animals of habit that respond well to regimentation, and respond best when the same routines and techniques are used consistently. One trainer believes that "intelligent" horses are reflections of intelligent trainers who effectively use response conditioning techniques and positive reinforcement to train in the style that best fits with an individual animal's natural inclinations.[94]

Temperament[edit]

Horses are mammals, and as such are warm-blooded, or endothermic creatures, as opposed to cold-blooded, or poikilothermic animals. However, these words have developed a separate meaning in the context of equine terminology, used to describe temperament, not body temperature. For example, the "hot-bloods", such as many race horses, exhibit more sensitivity and energy,[95] while the "cold-bloods", such as most draft breeds, are quieter and calmer.[96] Sometimes "hot-bloods" are classified as "light horses" or "riding horses",[97] with the "cold-bloods" classified as "draft horses" or "work horses".[98]

a sepia-toned engraving from an old book, showing 11 horses of different breeds and sizes in nine different illustrations
Illustration of assorted breeds; slim, light hotbloods, medium-sized warmbloods and draft and pony-type coldblood breeds

"Hot blooded" breeds include "oriental horses" such as the Akhal-Teke, Arabian horse, Barb and now-extinct Turkoman horse, as well as the Thoroughbred, a breed developed in England from the older oriental breeds.[95] Hot bloods tend to be spirited, bold, and learn quickly. They are bred for agility and speed.[99] They tend to be physically refined—thin-skinned, slim, and long-legged.[100] The original oriental breeds were brought to Europe from the Middle East and North Africa when European breeders wished to infuse these traits into racing and light cavalry horses.[101][102]

Muscular, heavy draft horses are known as "cold bloods", as they are bred not only for strength, but also to have the calm, patient temperament needed to pull a plow or a heavy carriage full of people.[96] They are sometimes nicknamed "gentle giants".[103] Well-known draft breeds include the Belgian and the Clydesdale.[103] Some, like the Percheron, are lighter and livelier, developed to pull carriages or to plow large fields in drier climates.[104] Others, such as the Shire, are slower and more powerful, bred to plow fields with heavy, clay-based soils.[105] The cold-blooded group also includes some pony breeds.[106]

"Warmblood" breeds, such as the Trakehner or Hanoverian, developed when European carriage and war horses were crossed with Arabians or Thoroughbreds, producing a riding horse with more refinement than a draft horse, but greater size and milder temperament than a lighter breed.[107] Certain pony breeds with warmblood characteristics have been developed for smaller riders.[108] Warmbloods are considered a "light horse" or "riding horse".[97]

Today, the term "Warmblood" refers to a specific subset of sport horse breeds that are used for competition in dressage and show jumping.[109] Strictly speaking, the term "warm blood" refers to any cross between cold-blooded and hot-blooded breeds.[110] Examples include breeds such as the Irish Draught or the Cleveland Bay. The term was once used to refer to breeds of light riding horse other than Thoroughbreds or Arabians, such as the Morgan horse.[99]

Sleep patterns[edit]

Two horses in a pasture, one is standing beside the other that is laying down.
When horses lie down to sleep, others in the herd remain standing, awake or in a light doze, keeping watch.

Horses are able to sleep both standing up and lying down. In an adaptation from life in the wild, horses are able to enter light sleep by using a "stay apparatus" in their legs, allowing them to doze without collapsing.[111] Horses sleep better when in groups because some animals will sleep while others stand guard to watch for predators. A horse kept alone will not sleep well because its instincts are to keep a constant eye out for danger.[112]

Unlike humans, horses do not sleep in a solid, unbroken period of time, but take many short periods of rest. Horses spend four to fifteen hours a day in standing rest, and from a few minutes to several hours lying down. Total sleep time in a 24-hour period may range from several minutes to a couple of hours,[112] mostly in short intervals of about 15 minutes each.[113] The average sleep time of a domestic horse is said to be 2.9 hours per day.[114]

Horses must lie down to reach REM sleep. They only have to lie down for an hour or two every few days to meet their minimum REM sleep requirements.[112] However, if a horse is never allowed to lie down, after several days it will become sleep-deprived, and in rare cases may suddenly collapse as it involuntarily slips into REM sleep while still standing.[115] This condition differs from narcolepsy, although horses may also suffer from that disorder.[116]

Taxonomy and evolution[edit]

From left to right: Size development, biometrical changes in the cranium, reduction of toes (left forefoot)

The horse adapted to survive in areas of wide-open terrain with sparse vegetation, surviving in an ecosystem where other large grazing animals, especially ruminants, could not.[117] Horses and other equids are odd-toed ungulates of the order Perissodactyla, a group of mammals that was dominant during the Tertiary period. In the past, this order contained 14 families, but only three—Equidae (the horse and related species), the tapir, and the rhinoceros—have survived to the present day.[118]

The earliest known member of the Equidae family was the Hyracotherium, which lived between 45 and 55 million years ago, during the Eocene period. It had 4 toes on each front foot, and 3 toes on each back foot.[119] The extra toe on the front feet soon disappeared with the Mesohippus, which lived 32 to 37 million years ago.[120] Over time, the extra side toes shrank in size until they vanished. All that remains of them in modern horses is a set of small vestigial bones on the leg below the knee,[121] known informally as splint bones.[122] Their legs also lengthened as their toes disappeared until they were a hooved animal capable of running at great speed.[121] By about 5 million years ago, the modern Equus had evolved.[123] Equid teeth also evolved from browsing on soft, tropical plants to adapt to browsing of drier plant material, then to grazing of tougher plains grasses. Thus proto-horses changed from leaf-eating forest-dwellers to grass-eating inhabitants of semi-arid regions worldwide, including the steppes of Eurasia and the Great Plains of North America.

By about 15,000 years ago, Equus ferus was a widespread holarctic species. Horse bones from this time period, the late Pleistocene, are found in Europe, Eurasia, Beringia, and North America.[124] Yet between 10,000 and 7,600 years ago, the horse became extinct in North America and rare elsewhere.[125][126][127] The reasons for this extinction are not fully known, but one theory notes that extinction in North America paralleled human arrival.[128] Another theory points to climate change, noting that approximately 12,500 years ago, the grasses characteristic of a steppe ecosystem gave way to shrub tundra, which was covered with unpalatable plants.[129]

Wild species surviving into modern times[edit]

Three tan colored horses with upright manes. Two horses nip and paw at each other, while the third moves towards the camera. They stand in open, rocky grassland, with forests in the distance.
A small herd of Przewalski's Horses
Main article: Wild horse

A truly wild horse is a species or subspecies with no ancestors that were ever domesticated. Therefore, most "wild" horses today are actually feral horses, animals that escaped or were turned loose from domestic herds and the descendants of those animals.[130] Only two never-domesticated subspecies, the Tarpan and the Przewalski's Horse, survived into recorded history and only the latter survives today.

The Przewalski's Horse (Equus ferus przewalskii), named after the Russian explorer Nikolai Przhevalsky, is a rare Asian animal. It is also known as the Mongolian Wild Horse; Mongolian people know it as the taki, and the Kyrgyz people call it a kirtag. The subspecies was presumed extinct in the wild between 1969 and 1992, while a small breeding population survived in zoos around the world. In 1992, it was reestablished in the wild due to the conservation efforts of numerous zoos.[131] Today, a small wild breeding population exists in Mongolia.[132][133] There are additional animals still maintained at zoos throughout the world.

The Tarpan or European Wild Horse (Equus ferus ferus) was found in Europe and much of Asia. It survived into the historical era, but became extinct in 1909, when the last captive died in a Russian zoo.[134] Thus, the genetic line was lost. Attempts have been made to recreate the Tarpan,[134][135][136] which resulted in horses with outward physical similarities, but nonetheless descended from domesticated ancestors and not true wild horses.

Periodically, populations of horses in isolated areas are speculated to be relict populations of wild horses, but generally have been proven to be feral or domestic. For example, the Riwoche horse of Tibet was proposed as such,[133] but testing did not reveal genetic differences from domesticated horses.[137] Similarly, the Sorraia of Portugal was proposed as a direct descendant of the Tarpan based on shared characteristics,[138][139] but genetic studies have shown that the Sorraia is more closely related to other horse breeds and that the outward similarity is an unreliable measure of relatedness.[138][140]

Other modern equids[edit]

Main article: Equus (genus)

Besides the horse, there are seven other species of genus Equus in the Equidae family. These are the ass or donkey, Equus asinus; the mountain zebra, Equus zebra; plains zebra, Equus quagga; Grévy's zebra, Equus grevyi; the kiang, Equus kiang; and the onager, Equus hemionus.[141]

Horses can crossbreed with other members of their genus. The most common hybrid is the mule, a cross between a "jack" (male donkey) and a mare. A related hybrid, a hinny, is a cross between a stallion and a jenny (female donkey).[142] Other hybrids include the zorse, a cross between a zebra and a horse.[143] With rare exceptions, most hybrids are sterile and cannot reproduce.[144]

Domestication[edit]

Bhimbetka rock painting showing man riding on horse, India

Domestication of the horse most likely took place in central Asia prior to 3500 BC. Two major sources of information are used to determine where and when the horse was first domesticated and how the domesticated horse spread around the world. The first source is based on palaeological and archaeological discoveries; the second source is a comparison of DNA obtained from modern horses to that from bones and teeth of ancient horse remains.

The earliest archaeological evidence for the domestication of the horse comes from sites in Ukraine and Kazakhstan, dating to approximately 3500–4000 BC.[145][146] By 3000 BC, the horse was completely domesticated and by 2000 BC there was a sharp increase in the number of horse bones found in human settlements in northwestern Europe, indicating the spread of domesticated horses throughout the continent.[147] The most recent, but most irrefutable evidence of domestication comes from sites where horse remains were interred with chariots in graves of the Sintashta and Petrovka cultures c. 2100 BC.[148]

Domestication is also studied by using the genetic material of present day horses and comparing it with the genetic material present in the bones and teeth of horse remains found in archaeological and palaeological excavations. The variation in the genetic material shows that very few wild stallions contributed to the domestic horse,[149][150] while many mares were part of early domesticated herds.[140][151][152] This is reflected in the difference in genetic variation between the DNA that is passed on along the paternal, or sire line (Y-chromosome) versus that passed on along the maternal, or dam line (mitochondrial DNA). There are very low levels of Y-chromosome variability,[149][150] but a great deal of genetic variation in mitochondrial DNA.[140][151][152] There is also regional variation in mitochondrial DNA due to the inclusion of wild mares in domestic herds.[140][151][152][153] Another characteristic of domestication is an increase in coat color variation.[154] In horses, this increased dramatically between 5000 and 3000 BC.[155]

Before the availability of DNA techniques to resolve the questions related to the domestication of the horse, various hypotheses were proposed. One classification was based on body types and conformation, suggesting the presence of four basic prototypes that had adapted to their environment prior to domestication.[106] Another hypothesis held that the four prototypes originated from a single wild species and that all different body types were entirely a result of selective breeding after domestication.[156] However, the lack of a detectable substructure in the horse has resulted in a rejection of both hypotheses.

Feral populations[edit]

Main article: Feral horse

Feral horses are born and live in the wild, but are descended from domesticated animals.[130] Many populations of feral horses exist throughout the world.[157][158] Studies of feral herds have provided useful insights into the behavior of prehistoric horses,[159] as well as greater understanding of the instincts and behaviors that drive horses that live in domesticated conditions.[160]

There are also semi-feral horses in many parts of the world, such as Dartmoor and the New Forest in the UK, where the animals are all privately owned but live for significant amounts of time in "wild" conditions on undeveloped, often public, lands. Owners of such animals often pay a fee for grazing rights.[161][162]

Breeds[edit]

The concept of purebred bloodstock and a controlled, written breed registry has come to be particularly significant and important in modern times. Sometimes purebred horses are incorrectly or inaccurately called "thoroughbreds". Thoroughbred is a specific breed of horse, while a "purebred" is a horse (or any other animal) with a defined pedigree recognized by a breed registry.[163] Horse breeds are groups of horses with distinctive characteristics that are transmitted consistently to their offspring, such as conformation, color, performance ability, or disposition. These inherited traits result from a combination of natural crosses and artificial selection methods. Horses have been selectively bred since their domestication. An early example of people who practiced selective horse breeding were the Bedouin, who had a reputation for careful practices, keeping extensive pedigrees of their Arabian horses and placing great value upon pure bloodlines.[164] These pedigrees were originally transmitted via an oral tradition.[165] In the 14th century, Carthusian monks of southern Spain kept meticulous pedigrees of bloodstock lineages still found today in the Andalusian horse.[166]

Breeds developed due to a need for "form to function", the necessity to develop certain characteristics in order to perform a particular type of work.[167] Thus, a powerful but refined breed such as the Andalusian developed as riding horses with an aptitude for dressage.[167] Heavy draft horses developed out of a need to perform demanding farm work and pull heavy wagons.[168] Other horse breeds developed specifically for light agricultural work, carriage and road work, various sport disciplines, or simply as pets.[169] Some breeds developed through centuries of crossing other breeds, while others descended from a single foundation sire, or other limited or restricted foundation bloodstock. One of the earliest formal registries was General Stud Book for Thoroughbreds, which began in 1791 and traced back to the foundation bloodstock for the breed.[170] There are more than 300 horse breeds in the world today.[171]

Interaction with humans[edit]

Worldwide, horses play a role within human cultures and have done so for millennia. Horses are used for leisure activities, sports, and working purposes. The Food and Agriculture Organization (FAO) estimates that in 2008, there were almost 59,000,000 horses in the world, with around 33,500,000 in the Americas, 13,800,000 in Asia and 6,300,000 in Europe and smaller portions in Africa and Oceania. There are estimated to be 9,500,000 horses in the United States alone.[172] The American Horse Council estimates that horse-related activities have a direct impact on the economy of the United States of over $39 billion, and when indirect spending is considered, the impact is over $102 billion.[173] In a 2004 "poll" conducted by Animal Planet, more than 50,000 viewers from 73 countries voted for the horse as the world's 4th favorite animal.[174]

Communication between human and horse is paramount in any equestrian activity;[175] to aid this process horses are usually ridden with a saddle on their backs to assist the rider with balance and positioning, and a bridle or related headgear to assist the rider in maintaining control.[176] Sometimes horses are ridden without a saddle,[177] and occasionally, horses are trained to perform without a bridle or other headgear.[178] Many horses are also driven, which requires a harness, bridle, and some type of vehicle.[179]

Sport[edit]

A chestnut (reddish-brown) horse being ridden by a rider in a black coat and top hat. They are stopped in a riding arena with the rider tipping his hat.
A horse and rider in dressage competition at the Olympics

Historically, equestrians honed their skills through games and races. Equestrian sports provided entertainment for crowds and honed the excellent horsemanship that was needed in battle. Many sports, such as dressage, eventing and show jumping, have origins in military training, which were focused on control and balance of both horse and rider. Other sports, such as rodeo, developed from practical skills such as those needed on working ranches and stations. Sport hunting from horseback evolved from earlier practical hunting techniques.[175] Horse racing of all types evolved from impromptu competitions between riders or drivers. All forms of competition, requiring demanding and specialized skills from both horse and rider, resulted in the systematic development of specialized breeds and equipment for each sport. The popularity of equestrian sports through the centuries has resulted in the preservation of skills that would otherwise have disappeared after horses stopped being used in combat.[180]

Horses are trained to be ridden or driven in a variety of sporting competitions. Examples include show jumping, dressage, three-day eventing, competitive driving, endurance riding, gymkhana, rodeos, and fox hunting.[181] Horse shows, which have their origins in medieval European fairs, are held around the world. They host a huge range of classes, covering all of the mounted and harness disciplines, as well as "In-hand" classes where the horses are led, rather than ridden, to be evaluated on their conformation. The method of judging varies with the discipline, but winning usually depends on style and ability of both horse and rider.[182] Sports such as polo do not judge the horse itself, but rather use the horse as a partner for human competitors as a necessary part of the game. Although the horse requires specialized training to participate, the details of its performance are not judged, only the result of the rider's actions—be it getting a ball through a goal or some other task.[183] Examples of these sports of partnership between human and horse include jousting, in which the main goal is for one rider to unseat the other,[184] and buzkashi, a team game played throughout Central Asia, the aim being to capture a goat carcass while on horseback.[183]

Horse racing is an equestrian sport and major international industry, watched in almost every nation of the world. There are three types: "flat" racing; steeplechasing, i.e. racing over jumps; and harness racing, where horses trot or pace while pulling a driver in a small, light cart known as a sulky.[185] A major part of horse racing's economic importance lies in the gambling associated with it.[186]

Work[edit]

A mounted man in a blue uniform on a dark brown horse
A mounted police officer in Poland

There are certain jobs that horses do very well, and no technology has yet developed to fully replace them. For example, mounted police horses are still effective for certain types of patrol duties and crowd control.[187] Cattle ranches still require riders on horseback to round up cattle that are scattered across remote, rugged terrain.[188] Search and rescue organizations in some countries depend upon mounted teams to locate people, particularly hikers and children, and to provide disaster relief assistance.[189] Horses can also be used in areas where it is necessary to avoid vehicular disruption to delicate soil, such as nature reserves. They may also be the only form of transport allowed in wilderness areas. Horses are quieter than motorized vehicles. Law enforcement officers such as park rangers or game wardens may use horses for patrols, and horses or mules may also be used for clearing trails or other work in areas of rough terrain where vehicles are less effective.[190]

Although machinery has replaced horses in many parts of the world, an estimated 100 million horses, donkeys and mules are still used for agriculture and transportation in less developed areas. This number includes around 27 million working animals in Africa alone.[191] Some land management practices such as cultivating and logging can be efficiently performed with horses. In agriculture, less fossil fuel is used and increased environmental conservation occurs over time with the use of draft animals such as horses.[192][193] Logging with horses can result in reduced damage to soil structure and less damage to trees due to more selective logging.[194]

Entertainment and culture[edit]

Modern horses are often used to reenact many of their historical work purposes. Horses are used, complete with equipment that is authentic or a meticulously recreated replica, in various live action historical reenactments of specific periods of history, especially recreations of famous battles.[195] Horses are also used to preserve cultural traditions and for ceremonial purposes. Countries such as the United Kingdom still use horse-drawn carriages to convey royalty and other VIPs to and from certain culturally significant events.[196] Public exhibitions are another example, such as the Budweiser Clydesdales, seen in parades and other public settings, a team of draft horses that pull a beer wagon similar to that used before the invention of the modern motorized truck.[197]

Horses are frequently seen in television, films and literature. They are sometimes featured as a major character in films about particular animals, but also used as visual elements that assure the accuracy of historical stories.[198] Both live horses and iconic images of horses are used in advertising to promote a variety of products.[199] The horse frequently appears in coats of arms in heraldry, in a variety of poses and equipment.[200] The mythologies of many cultures, including Greco-Roman, Hindu, Islamic, and Norse, include references to both normal horses and those with wings or additional limbs, and multiple myths also call upon the horse to draw the chariots of the Moon and Sun.[201] The horse also appears in the 12-year cycle of animals in the Chinese zodiac related to the Chinese calendar.[202]

Therapeutic use[edit]

People of all ages with physical and mental disabilities obtain beneficial results from association with horses. Therapeutic riding is used to mentally and physically stimulate disabled persons and help them improve their lives through improved balance and coordination, increased self-confidence, and a greater feeling of freedom and independence.[203] The benefits of equestrian activity for people with disabilities has also been recognized with the addition of equestrian events to the Paralympic Games and recognition of para-equestrian events by the International Federation for Equestrian Sports (FEI).[204] Hippotherapy and therapeutic horseback riding are names for different physical, occupational, and speech therapy treatment strategies that utilize equine movement. In hippotherapy, a therapist uses the horse's movement to improve their patient's cognitive, coordination, balance, and fine motor skills, whereas therapeutic horseback riding uses specific riding skills.[205]

Horses also provide psychological benefits to people whether they actually ride or not. "Equine-assisted" or "equine-facilitated" therapy is a form of experiential psychotherapy that uses horses as companion animals to assist people with mental illness, including anxiety disorders, psychotic disorders, mood disorders, behavioral difficulties, and those who are going through major life changes.[206] There are also experimental programs using horses in prison settings. Exposure to horses appears to improve the behavior of inmates and help reduce recidivism when they leave.[207]

Warfare[edit]

Main article: Horses in warfare
Black and white photo of mounted soldiers with middle eastern headwraps, carrying rifles, walking down a road away from the camera
Turkish cavalry, 1917

Horses have been used in warfare for most of recorded history. The first archaeological evidence of horses used in warfare dates to between 4000 to 3000 BC,[208] and the use of horses in warfare was widespread by the end of the Bronze Age.[209][210] Although mechanization has largely replaced the horse as a weapon of war, horses are still seen today in limited military uses, mostly for ceremonial purposes, or for reconnaissance and transport activities in areas of rough terrain where motorized vehicles are ineffective. Horses have been used in the 21st century by the Janjaweed militias in the War in Darfur.[211]

Products[edit]

Horses are raw material for many products made by humans throughout history, including byproducts from the slaughter of horses as well as materials collected from living horses.

Products collected from living horses include mare's milk, used by people with large horse herds, such as the Mongols, who let it ferment to produce kumis.[212] Horse blood was once used as food by the Mongols and other nomadic tribes, who found it a convenient source of nutrition when traveling. Drinking their own horses' blood allowed the Mongols to ride for extended periods of time without stopping to eat.[212] The drug Premarin is a mixture of estrogens extracted from the urine of pregnant mares (pregnant mares' urine), and was previously a widely used drug for hormone replacement therapy.[213] The tail hair of horses can be used for making bows for string instruments such as the violin, viola, cello, and double bass.[214]

Horse meat has been used as food for humans and carnivorous animals throughout the ages. It is eaten in many parts of the world, though consumption is taboo in some cultures,[215] and a subject of political controversy in others.[216] Horsehide leather has been used for boots, gloves, jackets,[217] baseballs,[218] and baseball gloves. Horse hooves can also be used to produce animal glue.[219] Horse bones can be used to make implements.[220] Specifically, in Italian cuisine, the horse tibia is sharpened into a probe called a spinto, which is used to test the readiness of a (pig) ham as it cures.[221] In Asia, the saba is a horsehide vessel used in the production of kumis.[222]

Care[edit]

Main article: Horse care
A young man in US military clothing examines the teeth of a bay (dark brown) horse, while another person in military work clothing, partially obscured, holds the horse. Several other people are partially visible in the background.
Checking teeth and other physical examinations are an important part of horse care.

Horses are grazing animals, and their major source of nutrients is good-quality forage from hay or pasture.[223] They can consume approximately 2% to 2.5% of their body weight in dry feed each day. Therefore, a 450-kilogram (990 lb) adult horse could eat up to 11 kilograms (24 lb) of food.[224] Sometimes, concentrated feed such as grain is fed in addition to pasture or hay, especially when the animal is very active.[225] When grain is fed, equine nutritionists recommend that 50% or more of the animal's diet by weight should still be forage.[226]

Horses require a plentiful supply of clean water, a minimum of 10 US gallons (38 L) to 12 US gallons (45 L) per day.[227] Although horses are adapted to live outside, they require shelter from the wind and precipitation, which can range from a simple shed or shelter to an elaborate stable.[228]

Horses require routine hoof care from a farrier, as well as vaccinations to protect against various diseases, and dental examinations from a veterinarian or a specialized equine dentist.[229] If horses are kept inside in a barn, they require regular daily exercise for their physical health and mental well-being.[230] When turned outside, they require well-maintained, sturdy fences to be safely contained.[231] Regular grooming is also helpful to help the horse maintain good health of the hair coat and underlying skin.[232]

See also[edit]

References[edit]

  1. ^ Linnaeus, Carolus (1758). Systema naturae per regna tria naturae :secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. 1 (10th ed.). Holmiae (Laurentii Salvii). p. 73. Retrieved 2008-09-08. 
  2. ^ a b Grubb, P. (2005). "Order Perissodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 630–631. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ International Commission on Zoological Nomenclature (2003). "Usage of 17 specific names based on wild species which are pre-dated by or contemporary with those based on domestic animals (Lepidoptera, Osteichthyes, Mammalia): conserved. Opinion 2027 (Case 3010)". Bull.Zool.Nomencl. 60 (1): 81–84. Archived from the original on 2007-08-21. 
  4. ^ Goody, John (2000). Horse Anatomy (2nd ed.). J A Allen. ISBN 0-85131-769-3. 
  5. ^ Pavord, Tony; Pavord, Marcy (2007). Complete Equine Veterinary Manual. David & Charles. ISBN 0-7153-1883-7. 
  6. ^ a b c d Ensminger Horses and Horsemanship pp. 46–50
  7. ^ Wright, B. (March 29, 1999). "The Age of a Horse". Ministry of Agriculture, Food and Rural Affairs. Government of Ontario. Retrieved 2009-10-21. 
  8. ^ Ryder, Erin. "World's Oldest Living Pony Dies at 56". TheHorse.com. The Horse. Retrieved 2007-05-31. 
  9. ^ British Horse Society The Manual of Horsemanship of the British Horse Society p. 255
  10. ^ "Rules of the Australian Stud Book" (PDF). Australian Jockey Club. 2007. p. 7. Retrieved 2008-07-09. 
  11. ^ a b "Equine Age Requirements for AERC Rides". American Endurance Riding Conference. Retrieved 2011-07-25. 
  12. ^ Ensminger Horses and Horsemanship p. 415
  13. ^ Becker, et al. Why Do Horses Sleep Standing Up? p. 23
  14. ^ a b c Ensminger Horses and Horsemanship p. 418
  15. ^ Giffen, et al. Horse Owner's Veterinary Handbook p. 431
  16. ^ Ensminger Horses and Horsemanship p. 422
  17. ^ Ensminger Horses and Horsemanship p. 427
  18. ^ Ensminger Horses and Horsemanship p. 420
  19. ^ Ensminger Horses and Horsemanship p. 430
  20. ^ "Glossary of Horse Racing Terms". Equibase.com. Equibase Company, LLC. Retrieved 2008-04-03. 
  21. ^ "Rules of the Australian Stud Book". Australian Jockey Club Ltd and Victoria Racing Club Ltd. July 2008. p. 9. Retrieved 2010-02-05. 
  22. ^ Whitaker and Whitelaw The Horse p. 77
  23. ^ Ensminger Horses and Horsemanship p. 51
  24. ^ Bongianni Simon & Schuster's Guide to Horses & Ponies of the World entry 1,68,69
  25. ^ Bongianni Simon & Schuster's Guide to Horses & Ponies of the World entry 12,30,31,32,75
  26. ^ Bongianni Simon & Schuster's Guide to Horses & Ponies of the World entry 86, 96, 97
  27. ^ Whitaker and Whitelaw The Horse p. 60
  28. ^ Martin, Arthur (2006-10-08). "Meet Thumbelina, the World's Smallest Horse". Daily Mail (London). Retrieved 2006-10-08. 
  29. ^ a b Ensminger Horses and Tack pp. 11–12
  30. ^ Howlett Ponies in Australia p. 14
  31. ^ "2012 United States Equestrian Federation, Inc. Rule Book". United States Equestrian Federation. p. Rule WS 101. 
  32. ^ "Annex XVII: Extracts from Rules for Pony Riders and Children, 9th edition". Fédération Equestre Internationale. 2009. Retrieved 2010-03-07. 
  33. ^ For example, the Missouri Fox Trotter, or the Arabian horse. See McBane The Illustrated Encyclopedia of Horse Breeds pp. 192, 218
  34. ^ For example, the Welsh Pony. See McBane The Illustrated Encyclopedia of Horse Breeds pp. 52–63
  35. ^ Ensminger Horses and Tack p. 12
  36. ^ McBane The Illustrated Encyclopedia of Horse Breeds p. 200
  37. ^ "Chromosome Numbers in Different Species". Vivo.colostate.edu. 1998-01-30. Retrieved 2013-04-17. 
  38. ^ "Sequenced horse genome expands understanding of equine, human diseases". Cornell University College of Veterinary Medicine. 2012-08-21. Retrieved 2013-04-01. 
  39. ^ "Domestic Horse Genome Sequenced". ScienceDaily, LLC. 2009-11-05. doi:10.1126/science.1178158. Retrieved 2013-04-01. 
  40. ^ "Ensembl genome browser 71: Equus caballus - Description". Uswest.ensembl.org. Retrieved 2013-04-17. 
  41. ^ Vogel The Complete Horse Care Manual p. 14
  42. ^ Mills, et al. A Basic Guide to Horse Care and Management pp. 72–73
  43. ^ Corum, Stephanie J. (May 1, 2003). "A Horse of a Different Color" (Registration required). The Horse. Retrieved 2010-02-11. 
  44. ^ a b c "Horse Coat Color Tests". Veterinary Genetics Laboratory. University of California. Retrieved 2008-05-01. 
  45. ^ Marklund, L.; M. Johansson Moller; K. Sandberg; L. Andersson (1996). "A missense mutation in the gene for melanocyte-stimulating hormone receptor (MC1R) is associated with the chestnut coat color in horses". Mammalian Genome 7 (12): 895–899. doi:10.1007/s003359900264. PMID 8995760. 
  46. ^ a b "Introduction to Coat Color Genetics". Veterinary Genetics Laboratory. University of California. Retrieved 2008-05-01. 
  47. ^ Haase B, Brooks SA, Schlumbaum A et al. (2007). "Allelic Heterogeneity at the Equine KIT Locus in Dominant White (W) Horses". PLoS Genetics 3 (11): e195. doi:10.1371/journal.pgen.0030195. PMC 2065884. PMID 17997609. 
  48. ^ Mau, C., Poncet, P. A., Bucher, B., Stranzinger, G. & Rieder, S. (2004). "Genetic mapping of dominant white (W), a homozygous lethal condition in the horse (Equus caballus) (2004)". Journal of Animal Breeding and Genetics 121 (6): 374–383. doi:10.1111/j.1439-0388.2004.00481.x. Retrieved 9 January 2009. 
  49. ^ Ensminger, Horses and Horsemanship p. 156
  50. ^ Johnson, Tom. "Rare Twin Foals Born at Vet Hospital: Twin Birth Occurrences Number One in Ten Thousand". Communications Services, Oklahoma State University. Oklahoma State University. Retrieved 2008-09-23. 
  51. ^ Miller Revolution pp. 102–103
  52. ^ Ensminger, M. E. Horses and Horsemanship", p. 150
  53. ^ Kline, Kevin H. (2010-10-07). "Reducing weaning stress in foals". Montana State University eXtension. Retrieved 2012-04-03. 
  54. ^ Ensminger, Horses and Tack, p. 129
  55. ^ McIlwraith, C.W. "Developmental Orthopaedic Disease: Problems of Limbs in young Horses". Orthopaedic Research Center. Colorado State University. Retrieved 2008-04-20. 
  56. ^ Thomas Storey's Guide to Training Horses p. 163
  57. ^ "2-Year-Old Racing (US and Canada)". Online Fact Book. Jockey Club. Retrieved 2008-04-28. 
  58. ^ Bryant The USDF Guide to Dressage pp. 271–272
  59. ^ Evans The Horse p. 90
  60. ^ Ensminger Horses and Horsemanship pp. 21–25
  61. ^ Ensminger Horses and Horsemanship p. 367
  62. ^ Giffin Horse Owner's Veterinary Handbook p. 304
  63. ^ Giffin Horse Owner's Veterinary Handbook p. 457
  64. ^ Fuess, Ph.D., Theresa A. "Yes, The Shin Bone Is Connected to the Ankle Bone". Pet Column. University of Illinois. Archived from the original on September 9, 2006. Retrieved 2008-04-05. 
  65. ^ Giffin Horse Owner's Veterinary Handbook pp. 310–312
  66. ^ Kreling Horses' Teeth and Their Problems pp. 12–13
  67. ^ Giffin Horse Owner's Veterinary Handbook p. 175
  68. ^ a b Ensminger Horses and Horsemanship pp. 309–310
  69. ^ a b Sellnow Happy Trails p. 46
  70. ^ <Please add first missing authors to populate metadata.> (March 7, 2010). "Eye Position and Animal Agility Study Published". The Horse. Retrieved 2010-03-11. 
  71. ^ McDonnell, Sue (June 1, 2007). "In Living Color" (registration required). The Horse (The Horse, Inc.). Retrieved 2007-07-27. 
  72. ^ Briggs, Karen (2013-12-11). "Equine Sense of Smell". The Horse. Retrieved 2013-12-15. 
  73. ^ Myers Horse Safe p.7
  74. ^ Lesté-Lasserre, Christa (January 18, 2013). "Music Genre's Effect on Horse Behavior Evaluated". The Horse. Blood Horse Publications. Retrieved 23 January 2013. 
  75. ^ Kentucky Equine Research Staff (February 15, 2010). "Radios Causing Gastric Ulcers". EquiNews. Kentucky Equine Research. Retrieved 23 January 2013. 
  76. ^ Thomas, Heather Smith. "True Horse Sense". Thoroughbred Times. Thoroughbred Times Company. Retrieved 2008-07-08. 
  77. ^ Cirelli, Al Jr. and Brenda Cloud. "Horse Handling and Riding Guidelines Part 1: Equine Senses" (PDF). Cooperative Extension. University of Nevada. p. 4. Retrieved 2008-07-09. 
  78. ^ Hairston, et al. The Essentials of Horsekeeping p. 77
  79. ^ Miller Understanding the Ancient Secrets of the Horse's Mind p. 28
  80. ^ Gustavson, Carrie. "Horse Pasture is No Place for Poisonous Plants". Pet Column July 24, 2000. University of Illinois. Archived from the original on August 9, 2007. Retrieved 2008-07-09. 
  81. ^ Harris Horse Gaits, Balance and Movement p. 32
  82. ^ Harris Horse Gaits, Balance and Movement pp. 47–49
  83. ^ "2011 New Orders Guide". American Quarter Horse Association. Retrieved 2013-08-14. 
  84. ^ Harris Horse Gaits, Balance and Movement p. 50
  85. ^ Lieberman, Bobbie (2007). "Easy Gaited Horses". Equus (359): 47–51. 
  86. ^ Equus Staff (2007). "Breeds that Gait". Equus (359): 52–54. 
  87. ^ Harris Horse Gaits, Balance and Movement pp. 50–55
  88. ^ "Horse Fight vs Flight Instinct". eXtension. 2009-09-24. Retrieved 2013-04-17. 
  89. ^ McBane A Natural Approach to Horse Management pp. 226–228
  90. ^ Ensminger Horses and Horsemanship pp. 305–309
  91. ^ Prince Basic Horsemanship pp. 214–223
  92. ^ a b c Clarkson, Neil (2007-04-16). "Understanding horse intelligence". Horsetalk 2007. Horsetalk. Retrieved 2008-09-16. 
  93. ^ Lesté-Lasserre, Christa. "Horses Demonstrate Ability to Count in New Study". The Horse, Online Edition. Blood-Horse Publications. Retrieved 2009-12-06. 
  94. ^ Coarse, Jim (2008-06-17). "What Big Brown Couldn't Tell You and Mr. Ed Kept to Himself (part 1)". The BloodHorse. Blood-Horse Publications. Retrieved 2008-09-16. 
  95. ^ a b Belknap Horsewords p. 255
  96. ^ a b Belknap Horsewords p. 112
  97. ^ a b Ensminger Horses and Horsemanship pp. 71–73
  98. ^ Ensminger Horses and Horsemanship p. 84
  99. ^ a b Price, et al. Whole Horse Catalog p. 18
  100. ^ DeFilippis The Everything Horse Care Book p. 4
  101. ^ Whitaker and Whitelaw The Horse p. 43
  102. ^ Whitaker and Whitelaw The Horse pp. 194–197
  103. ^ a b Price Whole Horse Catalog p. 15
  104. ^ Bongianni Simon & Schuster's Guide to Horses & Ponies of the World entry 87
  105. ^ Ensminger Horses and Horsemanship pp. 124–125
  106. ^ a b Bennett Conquerors p. 7
  107. ^ Edwards The Encyclopedia of the Horse pp. 122–123
  108. ^ Examples are the Australian Riding Pony and the Connemara, see Edwards The Encyclopedia of the Horse pp. 178–179, 208–209
  109. ^ Price et al. Lyons Press Horseman's Dictionary p. 231
  110. ^ Belknap Horsewords p. 523
  111. ^ Pascoe, Elaine. "How Horses Sleep". Equisearch.com. EquiSearch. Retrieved 2007-03-23. 
  112. ^ a b c Pascoe, Elaine. "How Horses Sleep, Pt. 2 – Power Naps". Equisearch.com. EquiSearch. Retrieved 2007-03-23. 
  113. ^ Ensminger Horses and Horsemanship p. 310.
  114. ^ Holland, Jennifer S. (July 2011). "40 Winks?". National Geographic 220 (1). 
  115. ^ EQUUS Magazine Editors. "Equine Sleep Disorder Videos". Equisearch.com. EquiSearch. Retrieved 2007-03-23. 
  116. ^ Smith Large Animal Internal Medicine pp. 1086–1087
  117. ^ Budiansky The Nature of Horses p. 31
  118. ^ Myers, Phil. "Order Perissodactyla". Animal Diversity Web. University of Michigan. Retrieved 2008-07-09. 
  119. ^ "Hyracotherium". Fossil Horses in Cyberspace. Florida Museum of Natural History. Retrieved 2008-07-09. 
  120. ^ "Mesohippus". Fossil Horses in Cyberspace. Florida Museum of Natural History. Retrieved 2008-07-09. 
  121. ^ a b "The Evolution of Horses". The Horse. American Museum of Natural History. Retrieved 2008-07-09. 
  122. ^ Miller Understanding the Ancient Secrets of the Horse's Mind p. 20
  123. ^ "Equus". Fossil Horses in Cyberspace. Florida Museum of Natural History. Retrieved 2008-07-09. 
  124. ^ Weinstock, J. et al. (2005). "Evolution, Systematics, and Phylogeography of Pleistocene Horses in the New World: A Molecular Perspective". PLoS Biology 3 (8): e241. doi:10.1371/journal.pbio.0030241. PMC 1159165. PMID 15974804. 
  125. ^ Vila, C.; et al. (2001). "Widespread Origins of Domestic Horse Lineages" (PDF). Science 291 (5503): 474–7. doi:10.1126/science.291.5503.474. PMID 11161199. 
  126. ^ Luís, Cristina; et al. (2006). "Iberian Origins of New World Horse Breeds". Quaternary Science Reviews 97 (2): 107–113. doi:10.1093/jhered/esj020. PMID 16489143. 
  127. ^ Haile, James et al. (2009). "Ancient DNA reveals late survival of mammoth and horse in interior Alaska". PNAS 106 (52): 22352–22357. doi:10.1073/pnas.0912510106. PMC 2795395. PMID 20018740. 
  128. ^ Buck, Caitlin E.; Bard, Edouard (2007). "A calendar chronology for Pleistocene mammoth and horse extinction in North America based on Bayesian radiocarbon calibration". Quaternary Science Reviews 26 (17–18): 2031. doi:10.1016/j.quascirev.2007.06.013. 
  129. ^ LeQuire, Elise (2004-01-04). "No Grass, No Horse" (registration required). The Horse, online edition. Retrieved 2009-06-08. 
  130. ^ a b Olsen "Horse Hunters of the Ice Age" Horses Through Time p. 46
  131. ^ "An extraordinary return from the brink of extinction for worlds last wild horse". ZSL Press Releases. Zoological Society of London. 2005-12-19. Retrieved 2012-06-06. 
  132. ^ "Home". The Foundation for the Preservation and Protection of the Przewalski Horse. Retrieved 2008-04-03. 
  133. ^ a b Dohner "Equines: Natural History" Encyclopedia of Historic Livestock and Poultry Breeds pp. 298–299
  134. ^ a b Dohner "Equines: Natural History" Encyclopedia of Historic Livestock and Poultry Breeds p. 300
  135. ^ "Tarpan". Breeds of Livestock. Oklahoma State University. Archived from the original on 2009-01-16. Retrieved 2009-01-13. 
  136. ^ <Please add first missing authors to populate metadata.> (June 21, 2002). "Ponies from the past?: Oregon couple revives prehistoric Tarpan horses". The Daily Courier. Retrieved 2009-10-21. 
  137. ^ Peissel Tibet p. 36
  138. ^ a b Royo, L.J., I. Álvarez, A. Beja-Pereira, A. Molina, I. Fernández, J. Jordana, E. Gómez, J. P. Gutiérrez, and F. Goyache (2005). "The Origins of Iberian Horses Assessed via Mitochondrial DNA". Journal of Heredity 96 (6): 663–669. doi:10.1093/jhered/esi116. PMID 16251517. Retrieved 2008-12-15. 
  139. ^ Edwards The Encyclopedia of the Horse pp. 104–105
  140. ^ a b c d Lira, Jaime, et al. (2010). "Ancient DNA reveals traces of Iberian Neolithic and Bronze Age lineages in modern Iberian horses". Molecular Ecology 19 (1): 64–78. doi:10.1111/j.1365-294X.2009.04430.x. PMID 19943892. 
  141. ^ Pallas (1775). "Equus hemionus". Wilson & Reeder's mammal species of the world. Bucknell University. Retrieved September 1, 2010. 
  142. ^ "Mule Information". BMS Website. British Mule Society. Retrieved 2008-07-10. 
  143. ^ "Zebra hybrid is cute surprise". BBC News. June 26, 2001. Retrieved 2010-02-06. 
  144. ^ "Befuddling Birth: The Case of the Mule's Foal". All Things Considered. National Public Radio. Retrieved 2008-08-16. 
  145. ^ Outram, A.K., Stear, N.A., Bendrey, R., Olsen, S., Kasparov, A., Zaibert, V., Thorpe, N. and Evershed, R.P. 2009 The Earliest Horse Harnessing and Milking Science. 323(5919): 1332–1335
  146. ^ Matossian Shaping World History p. 43 See also: "Horsey-aeology, Binary Black Holes, Tracking Red Tides, Fish Re-evolution, Walk Like a Man, Fact or Fiction". Quirks and Quarks Podcast with Bob Macdonald (CBC Radio). 2009-03-07. Retrieved 2010-09-18. 
  147. ^ Evans Horse Breeding and Management p.56
  148. ^ Kuznetsov, P. F. (2006). "The emergence of Bronze Age chariots in eastern Europe". Antiquity 80: 638–645. 
  149. ^ a b Lau, A. N., Peng, L., Goto, H., Chemnick, L., Ryder, O. A. & Makova, K. D. (2009). "Horse Domestication and Conservation Genetics of Przewalski's Horse Inferred from Sex Chromosomal and Autosomal Sequences". Molecular Biology and Evolution 26 (1): 199–208. doi:10.1093/molbev/msn239. PMID 18931383. 
  150. ^ a b Lindgren, Gabriella; Niclas Backström, June Swinburne, Linda Hellborg, Annika Einarsson, Kaj Sandberg, Gus Cothran, Carles Vilà, Matthew Binns & Hans Ellegren (2004). "Limited number of patrilines in horse domestication". Nature Genetics 36 (4): 335–336. doi:10.1038/ng1326. PMID 15034578. 
  151. ^ a b c Vilà, C. et al. (2001). "Widespread origins of domestic horse lineages". Science 291 (5503): 474–477. doi:10.1126/science.291.5503.474. PMID 11161199. 
  152. ^ a b c Cai, D. W.; Tang, Z. W.; Han, L.; Speller, C. F.; Yang, D. Y. Y.; Ma, X. L.; Cao, J. E.; Zhu, H.; Zhou, H. et al. (2009). "Ancient DNA provides new insights into the origin of the Chinese domestic horse". Journal of Archaeological Science 36 (3): 835–842. doi:10.1016/j.jas.2008.11.006. Retrieved 17 January 2011. 
  153. ^ Olsen, Sandra L. (2006). "Early Horse Domestication: Weighing the Evidence". In Olsen, Sandra L; Grant, Susan; Choyke, Alice M.; Bartosiewicz, Laszlo. Horses & Humans: The Evolution of Human-Equine Relationships. Oxford, UK: Archaeopress. pp. 81–113. ISBN 1-84171-990-0. 
  154. ^ Epstein, H. 1955 Domestication Features in Animals as Functions of Human Society Agricultural History Society. 29(4): 137–146
  155. ^ Ludwig, A.; Pruvost, M.; Reissmann, M.; Benecke, N.; Brockmann, G.A.; Castanos, P.; Cieslak, M.; Lippold, S.; Llorente, L. et al. (2009). "Coat Color Variation at the Beginning of Horse Domestication". Science 324 (5926): 485–485. doi:10.1126/science.1172750. PMID 19390039. 
  156. ^ Edwards, G. The Arabian pp 1, 3
  157. ^ Edwards The Encyclopedia of the Horse p. 291
  158. ^ Anthony "Bridling Horse Power: The Domestication of the Horse" Horses Through Time pp. 66–67
  159. ^ Olsen, Sandra L. "Horses in Prehistory". Anthropology Research. Carnegie Museum of Natural History. Archived from the original on May 25, 2008. Retrieved 2008-08-16. 
  160. ^ Lesté-Lasserre, Christa (October 7, 2009). "Mares' Social Bonds Might Enhance Reproductive Success" (Registration required). The Horse. Retrieved 2009-10-21. 
  161. ^ "Animals on the Moor". Dartmoor Commoners' Council. Retrieved 2012-03-29. 
  162. ^ Fear New Forest Drift p. 75
  163. ^ Ensminger Horses and Horsemanship p. 424
  164. ^ Edwards The Arabian pp. 22–23
  165. ^ "Is Purity the Issue?". WAHO Publication Number 21 January 1998. World Arabian Horse Organization. Retrieved 2008-04-29. 
  166. ^ "Andalusian". Breeds of Livestock. Oklahoma State University. Archived from the original on 2008-03-12. Retrieved 2008-04-29. 
  167. ^ a b Sponenberg "The Proliferation of Horse Breeds" Horses Through Time p. 155
  168. ^ Sponenberg "The Proliferation of Horse Breeds" Horses Through Time pp. 156–57
  169. ^ Sponenberg "The Proliferation of Horse Breeds" Horses Through Time p. 162
  170. ^ "History of Thoroughbreds". Britishhorseracing.com. British Horseracing Authority. Retrieved 2008-04-03. 
  171. ^ Hedge Horse Conformation pp. 307–308
  172. ^ "FAO Stat — Live Animals". Food and Agriculture Organization. December 16, 2009. Retrieved 2010-02-05. 
  173. ^ "Most Comprehensive Horse Study Ever Reveals A Nearly $40 Billion Impact On The U.S. Economy" (PDF). American Horse Council Press Release. American Horse Council. Archived from the original on June 25, 2006. Retrieved 2005-06-20. 
  174. ^ "Tiger tops dog as world's favourite animal". Independent Online. Independent. Retrieved 2011-06-01. 
  175. ^ a b Olsen "In the Winner's Circle" Horses Through Time pp. 105, 111–113, 121
  176. ^ Edwards Horses pp. 32–34
  177. ^ Self Riding Simplified p. 55
  178. ^ Thorson "Rugged Lark" Legends 7 p. 218
  179. ^ Mettler Horse Sense pp. 47–54
  180. ^ Olsen "In the Winner's Circle" Horses Through Time p. 105
  181. ^ Edwards The Encyclopedia of the Horse pp. 346–356, 366–371
  182. ^ Edwards The Encyclopedia of the Horse pp. 376–377
  183. ^ a b Edwards The Encyclopedia of the Horse p. 360
  184. ^ Collins Encyclopedia of Traditional British Rural Sports pp. 173–174
  185. ^ Edwards The Encyclopedia of the Horse pp. 332–337
  186. ^ Campbell National Gambling Impact Study Commission Final Report p. 111
  187. ^ "Horse Mounted Unit". United States Park Police. National Park Service. Retrieved 2008-04-07. 
  188. ^ Edwards The Encyclopedia of the Horse pp. 226–227
  189. ^ "Volunteer Mounted Search and Rescue Unit". Employment. San Benito County Sheriff's Office. Retrieved 2008-07-08. 
  190. ^ US Forest Service (May 2003). "Success Stories" (PDF). US Department of Agriculture. p. 4. Retrieved 2008-04-20.  |chapter= ignored (help)
  191. ^ Brown, Kimberly S. (June 1, 2006). "At Work in Morocco" (Registration required). The Horse. Retrieved 2009-10-21. 
  192. ^ Gifford "Working Draught Horses as Singles and Pairs" The Working Horse Manual p. 85
  193. ^ Miller Work Horse Handbook p. 13
  194. ^ Gifford "Working Horses in Forestry" The Working Horse Manual p. 145
  195. ^ Stoddard, Samuel. "Unit Activities". Co H, 4th Virginia Cavalry. Washington Webworks, LLC. Retrieved 2008-04-29. 
  196. ^ "Transport". British Monarchy. Retrieved 2009-08-30. 
  197. ^ McWilliams, Jeremiah (December 3, 2008). "Anheuser-Busch gives face time to Budweiser Clydesdales". St. Louis Post-Dispatch. Retrieved 2010-09-18. 
  198. ^ Sellnow, Les (March 1, 2006). "Hollywood Horses" (Registration required). The Horse. Retrieved 2009-10-21. 
  199. ^ "Trademark Horse – Horses as advertising mediums". Westfälische Pferdemuseum (Westphalian Horse Museum). Retrieved 2008-08-16. 
  200. ^ Fox-Davies A Complete Guide to Heraldry p. 201
  201. ^ Tozer The Horse in History pp. 94, 98–100
  202. ^ "Year of the Horse". Chinese Culture Center of San Francisco. Archived from the original on 2011-07-16. Retrieved 2007-07-22. 
  203. ^ Bush, et al. The Principles of Teaching Riding p. 58
  204. ^ "About Para Equestrian Dressage". Federation Equestre Internationale. Retrieved 2010-03-07. 
  205. ^ "Frequently Asked Questions About Hippotherapy" (PDF). FAQ – AHA, April 2005. American Hippotherapy Association. Archived from the original on September 19, 2007. Retrieved 2008-07-08. 
  206. ^ "Equine Facilitated Psychotherapy (EFP) Fact Sheet". Equine Facilitated Mental Health Association. Archived from the original on April 30, 2008. Retrieved 2008-07-08. 
  207. ^ Wise, Mike (2003-08-10). "Partners, Horse and Man, in Prison Pasture". New York Times. Retrieved 2008-07-08. 
  208. ^ Newby, Jonica, Jared Diamond and David Anthony (1999-11-13). "The Horse in History". The Science Show. Radio National. Retrieved 2012-01-04. 
  209. ^ Anthony, David W. and Dorcas R. Brown. "The Earliest Horseback Riding and its Relation to Chariotry and Warfare". Harnessing Horsepower. Institute for Ancient Equestrian Studies. Retrieved 2007-10-09. 
  210. ^ Whitaker and Whitelaw The Horse pp. 30–31
  211. ^ Lacey, Marc (2004-05-04). "In Sudan, Militiamen on Horses Uproot a Million". The New York Times. Retrieved 2011-01-04. 
  212. ^ a b Frazier, Ian. "Invaders: Destroying Baghdad". The New Yorker (CondeNet). Retrieved 2008-04-03. 
  213. ^ Ballard, Pepper (August 19, 2001). "A Good Life for Horses at the Duchess Sanctuary". The Humane Society of the United States. Retrieved 2011-06-01. 
  214. ^ McCutcheon, Marc (2000). Descriptionary: A Thematic Dictionary (Second ed.). New York: Checkmark Books (Facts On File imprint). p. 285. ISBN 0-8160-4105-9. 
  215. ^ "U.S.D.A. Promotes Horse & Goat Meat". I.G.H.A./HorseAid's U.S.D.A. Report. U.S. Department of Agriculture. Retrieved 2008-04-03. 
  216. ^ Coile, Zachary (2006-09-08). "House votes to outlaw slaughter of horses for human consumption". SF Gate (San Francisco Chronicle). Retrieved 2008-04-03. 
  217. ^ Ockerman Animal By-product Processing & Utilization p. 129
  218. ^ "Inside a Modern Baseball". Baseball Fever. Baseball Almanac. Retrieved 2008-04-03. 
  219. ^ Bartlett Keeping House pp. 34–35
  220. ^ MacGregor Bone, Antler, Ivory and Horn p. 31
  221. ^ Fort Eating Up Italy p. 171
  222. ^ Hurd Diseases of the Stomach and Intestines p. 29
  223. ^ Kellon, Eleanor (2008). "Focus on Feed Costs". Horse Journal 16 (6): 11–12. 
  224. ^ Hall, Marvin H. and Patricia M. Comerford (1992). "Pasture and Hay for Horses – Agronomy Facts 32" (PDF). Cooperative Extension Service. University of Pennsylvania. Retrieved 2007-02-14. 
  225. ^ Giffin Horse Owner's Veterinary Handbook pp. 476–477
  226. ^ "Feeding Factors". Horse Nutrition. Ohio State University. Retrieved 2007-02-09. 
  227. ^ Giffin Horse Owner's Veterinary Handbook p. 455
  228. ^ Giffin Horse Owner's Veterinary Handbook p. 482
  229. ^ Giffin Horse Owner's Veterinary Handbook pp. 62,168,310
  230. ^ Harris The United States Pony Club Manual of Horsemanship pp. 160–161
  231. ^ Wheeler Horse Stable and Riding Arena Design p. 215
  232. ^ Giffin Horse Owner's Veterinary Handbook p. 90

Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Riwoche horse

Location of Riwoqê County within Tibet, where the horses were found.

The Riwoche horse is a dun-colored, pony-sized horse indigenous to northeastern Tibet. It came to international attention in 1995, at which time its primitive appearance and small size led to speculation that it might be an evolutionary link between the prehistoric wild horse and the modern domestic horse. Subsequent analysis, however, demonstrated that it is genetically indistinguishable from modern horses.

Nomenclature[edit]

The horse was named by European explorers after its home region in Kham, northeastern Tibet. Riwoche is pronounced "Ree-woe-chay" (IPA /ˈrw/).

Discovery[edit]

The breed was first observed by non-Tibetans in October, 1995 in an isolated, 27 kilometres (17 mi) long valley reached only by crossing a 5,000 metres (16,000 ft) mountain pass, by a team of six explorers led by the French ethnologist Michel Peissel.[1] While on an expedition to study another horse breed that Peissel had previously observed in 1993, the Nangchen horse,[2] his team came upon a number of small horses in an isolated valley in the Riwoche region of Tibet.

Peissel told The New York Times, "They looked completely archaic, like the horses in prehistoric cave paintings. We thought it was just a freak, then we saw they were all alike."[3] He added to Time magazine, "The beige coat, black and bristly mane and the stripes on its back legs and back are similar to [features of] the most ancient breeds we know. The angular shape of the body, and the head in particular, is like that of the horses found in the Stone Age cave paintings."[1]

He told CNN's Peter Humi, "It took me two years to get permission to go to that area, and it will be very difficult to get permission to go back and export them. As you know, Tibet is occupied by the Chinese and they're not very keen on foreigners visiting these remote areas."[4]

The horses were unknown to the rest of the world, but familiar to and used by the local Bon-po people.[1] These pre-Buddhist farmers would catch the horses with a lasso when they wanted to ride them or pack them, then set the horses free until they were needed again.

Peissel and his crew obtained blood samples from the herd for DNA testing;[1] the samples were given to Steven Harrison, a geneticist at the Royal Agricultural College in Cirencester, England.[3] Before doing the tests, Harrison told Time, "It would be premature to say these horses are a new species. Without tests you cannot tell whether it's a population of wild horses that have evolved in isolation or a feral population that was once domesticated and has gone wild. The Chinese, of course, were great horsemen even before we had horses in Europe."

A British equine psychologist accompanying the expedition, Dr. Ignasi Casas, of the Royal Animal Health Trust at Newmarket, Suffolk, England, theorized that the Riwoche horse was a relict population of wild horses due to living in near-complete isolation from other breeds for a very long time.[2][5] Pointing out that the breed's isolation preserved its characteristics, Casas said, "It looks very primitive and very tough. Horses in the adjacent areas are very different." One explanation for their archaic form, he said, is that the valley where they were found is closed off on both sides by very tall passes. "Horses would not roam through those passes easily because at that altitude there is no grass, no food to survive."[3]

Other hypotheses suggested that it might be an evolutionary link between the prehistoric horse and the domesticated horse,[6] but testing did not reveal genetic divergence from other horses,[7] which was in line with news reports that the horses were domesticated, used as pack and riding animals by the local residents.[4] Peissel noted the phenotypical resemblance of the Riwoche horse to the Przewalski's horse, but expressed a strong belief that the two are not closely related.[1]

Casas said, "It's an exciting find because horses have bred and mixed and traveled all over the world, but this one so far seems unique."[3]

Characteristics[edit]

Riwoche horses are pony sized, standing only 12 hands (48 inches, 122 cm) tall. They are dun in color, with angular bodies, upright manes and primitive markings including a dorsal stripe down their spine and striping on the back of their legs. These features are similar to those of some other modern horse breeds thought to have ancient roots.[1] They also have small ears, rough coats,[2] small jaws, straight, flat foreheads, and unique, narrow "duck-bill" nostrils.[8]

Their unusual appearance led Peissel to speculate that they could be "living fossils." He noted that they strongly resembled horses in prehistoric cave art, a "number two" horse distinct from but often pictured alongside horses with a body type resembling the Przewalski's Horse.[8]

Status[edit]

This taxon has not yet been assessed for the IUCN Red List.

Subsequent discoveries[edit]

On the same expedition, Peissel also observed other isolated and unique species of megafauna, including a rare white-lipped deer, as well as what is believed to be the source of the Mekong river.[1] Near the upper Salween River, the caravan of six Europeans saw large forests, which did not appear on any maps, of enormous, untouched conifers, willows, birches and other trees. Peissel said, "It was very peculiar because this was a very bleak, icy and grassy high plateau and suddenly there were these forests in the middle of the tundra. They could be remnants of the ancient forests that once covered much of Tibet. Because access is so difficult and there are no bridges, the forests have survived the axes of the Chinese, who are logging Tibet intensively."[3]

In popular culture[edit]

In an essay originally appearing on the website for the Nova television series episode The Beast of Loch Ness (aired January 12, 1999), Peter Tyson, an online producer for the program, discussed the "discoveries" of various animals, including okapis, elephant birds, Komodo dragons, Giant pandas and others, as well as the Riwoche horse.[9]

See also[edit]

References[edit]

  1. ^ a b c d e f g Dam, Julie K. L.; Crumley, Bruce; Gibson, Helen (November 27, 1995). "Ancient Hoofbeats: In Tibet, A Missing Link in Equine Evolution?". Time (New York City: Time Inc.) 146 (22). Retrieved September 10, 2009. 
  2. ^ a b c Lowry, Susan. "Explorer backs Tibetan dark horse in the history stakes." Fortean Times (reprinted) Accessed September 10, 2009
  3. ^ a b c d e Simons, Marlise (November 12, 1995). "A Stone-Age Horse Still Roams a Tibetan Plateau". The New York Times (The New York Times Company). Retrieved December 30, 2012. 
  4. ^ a b Humi, Peter (17 November 1995). "Tibetan discovery is 'horse of a different color'". CNN. Retrieved 2009-09-09. 
  5. ^ Dohner, Janet Vorwald (2001). "Equines: Natural History". In Dohner, Janet Vorwald. Historic and Endangered Livestock and Poultry Breeds. Topeka, KS: Yale University Press. pp. 400–401. ISBN 978-0-300-08880-9. 
  6. ^ "Resurrecting the dead" Down to Earth February 14, 1996
  7. ^ Peissel, Michel (2002). Tibet: The Secret Continent. Macmillan. p. 36. ISBN 0-312-30953-8. 
  8. ^ a b Peissel, Michel (April 1999). "Reserve on the Roof of the World". Geographical (London: Royal Geographical Society) 71 (4). Retrieved September 10, 2009. 
  9. ^ Tyson, Peter (January 12, 1999). "Fantastic Creatures". WGBH-TV. Retrieved December 30, 2012. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Equus przewalskii has been included in E. caballus by most recent authors. Some authors have proposed that the specific name be changed to ferus because the name caballus was based on domestic animals. Jones et al. (1992) and Grubb (in Wilson and Reeder 1993, 2005) continued to use the name E. caballus (see Grubb, in Wilson and Reeder 2005, for discussion of nomenclature).

Electrophoretic and immunologic analyses indicate the feral herds from 4 eastern U.S. barrier islands apparently are not genetically unique (Goodloe et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!