Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

The domestic donkey is derived from the African Wild Ass, which used to range across much of northern Africa but now occupies a far more limited range in parts of Eritrea, Ethiopia, Djibouti, and Somalia and is a critically endangered species. Taxonomic treatments vary, but Rubenstein (2011) treats the African Wild Ass and the domestic donkey as two distinct species, Equus africanus and E. asinus, respectively.

  • Rubenstein, D.I. 2011. African Wild Ass (Equus africanus). Pp. 140-141 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

True wild asses are found only in northern Africa and the Arabian peninsula, but domesticated and feral donkeys can now be found in all parts of the world. The native range extends from Morocco to Somalia and Mesopotamia to Oman.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced , Native ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to northeastern Africa. Domesticated worldwide. Introduced and feral in the western U.S.: mainly Arizona, California, and Nevada (Slade and Godfrey 1982). Also feral on island of Hawaii (Tomich 1986) (since mid-1950s), on St. John (Virgin Islands) (Turner 1984), and elsewhere in Africa, Asia, and Australia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Somalia, Sudan, Ethiopia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Donkeys resemble horses and are characterized by their large head, long ears, and cow-like tail. They come in black, white, paint, and all shades of brown and gray, but the most common is a mousy gray color called gray dun. Many donkeys are spotted, speckled, or striped. Most solid-color donkeys have a dark dorsal stripe from mane to tail and a dark stripe across their shoulders. They have an erect mane and lack the forelock of a horse. Their hair can be straight, curly, short and wiry, or long and wooly. Wild asses average 200 cm in body length, 45 cm in tail length, 125 cm at the shoulder, and weight 250 kg. Domestic breed size varies greatly depending on breed. Miniatures, the smallest breed of donkeys, stand less than 36 inches (92 cm) at the shoulder and weigh less than 400 pounds (180 kg). Standard donkeys, the average-sized breed, range from 36 inches to 48 inches (92 cm to 123 cm) and weigh 400 to 500 pounds (180 to 225 kg). Mammoth stock, the largest breed of donkeys, stand at an average height of 56 inches (143 cm) and weigh about 950 pounds (430 kg). Miniature and mammoth stock donkeys have been bred by humans to possess certain characteristics that are more desirable or suitable for specific purposes. For example, miniature donkeys are often preferred as pets because their small size makes them easier to care for, and the larger mammoth stock donkeys are stronger work animals than standard donkeys are. There is generally very little sexual dimorphism in donkeys. Wild asses have the longest and narrowest hooves of any Equus species.

Average mass: 250 kg.

Average length: 200 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 250000 g.

Average basal metabolic rate: 164.92 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Domestic donkeys are widely distributed and can be found almost everywhere in the world. However, true wild asses originated in the hilly, undulating deserts of northern Africa and the Arabian peninsula and are well-adapted for life in the desert. Domestic donkeys prefer warm, dry climates and, if left to become feral, they will return to such a habitat, like the feral burros of Death Valley National Park in California. Deserts are characterized by low, unpredictable rainfall and sparse vegetation.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Other Habitat Features: agricultural

  • Dossenbach, M. 1983. The Noble Horse. Boston: G. K. Hall.
  • Phillips, E., The Wild Burro Rescue and Preservation Project. 1999. "Home Page" (On-line). Accessed October 3, 2000 at http://home.earthlink.net/~emilylee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Survives in harsh environments (e.g., Death Valley). On St. John, Virgin Islands: dry cactus/woodland, beaches, grassy flats (Turner 1984). In Arizona, remained close to permanent water in warmer months (Seegmiller and Ohmart 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Donkeys are grazing herbivores, with large, flat-surfaced teeth adapted for tearing and chewing plant matter. Their primary food is grass, but they also eat other shrubs and desert plants. Like many other grazing animals, they grasp the plant first with their muscular lips, pull it into their mouth, and then tear it off with their teeth.

In a study of feral donkeys in Arizona, they were found to eat 33% forbs and 40% browse.

Plant Foods: leaves; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In western Arizona, annual diet was 22% grasses and sedges, 33% forbs, and 40% browse (Seegmiller and Ohmart 1981); overlapped broadly with bighorn sheep in species eaten; generally selected green and growing vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Wild donkeys impact desert vegetation through their grazing and browsing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Living in groups increases the number of animals keeping an eye out for predators. Most predation probably occurs on foals and elderly animals. Predators on wild donkeys may have included lions and wolves.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Males may maintain small territory during breeding season. Older males tend to be solitary when not with estrous females. Females usually alone with foal or with other females and foals. Home range over 1-2 years: 4-97 sq km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Wild asses use visual displays, smells, physical contact, and vocalizations to communicate. They have keen hearing and good senses of vision and smell.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average life span of a wild donkey is 25 to 30 years, but in captivity they can live to be 40 to 50 years old.

Average lifespan

Status: wild:
25-30 years.

Range lifespan

Status: captivity:
40-50 (high) years.

Typical lifespan

Status: wild:
25 to 30 years.

Average lifespan

Status: captivity:
47.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 47 years (captivity) Observations: When domesticated these animals are called donkeys. In captivity the African wild ass can live up to 28.5 years (Richard Weigl 2005). Donkeys, however, have been reported to live up to 47 years, and females can reproduce for some 20 years (Ronald Nowak 1999). While these reports may be true, anecdotal reports of animals living over 50 years are doubtful.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Smaller herds of wild asses are generally made up of one male and several females. Larger herds have multiple males and females. There don't seem to be any permanent bonds among individuals, herds are highly flexible, breaking up and reforming on an almost daily basis. Dominant male wild asses sometimes defend large territories in which many potential mates are also found. Subordinate males are also tolerated within the dominant male's territory.

Mating System: polygynous

Domesticated donkeys can be bred at any time of year, wild asses generally breed in the wet season. The gestation period is usually 12 months, and foals weigh between 19 and 30 pounds (8.6 to 13.6 kg) at birth. Donkey foals are fully developed at birth and can usually stand and nurse about 30 minutes after birth. The young are weaned from the mother at about 5 months of age. Females reach sexual maturity at 2 years of age and can give birth to one foal each year after that. Males may reach sexual maturity as early as 2 years old but are more likely to become dominant enough to control mating at 3 to 4 years old.

Members of the genus Equus can often interbreed to produce hybrids. Donkeys can be bred with horses and zebras to produce sterile hybrids. A cross between a male donkey (jack) and a female horse (mare) produces a mule. A cross between a female donkey (jennet or jenny) and a male horse (stallion) produces a hinny. A cross between a zebra and a donkey produces a zebrass or a zonkey.

Breeding interval: Wild asses give birth each year.

Breeding season: Breeding generally occurs in the wet season in the wild, although domestic and some feral populations breed year-round.

Average number of offspring: 1.

Average gestation period: 12 months.

Average weaning age: 5 months.

Average age at sexual or reproductive maturity (female): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 30000 g.

Average gestation period: 359 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1005 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
708 days.

Female wild asses nurse and care for their young until they are weaned at about 5 months old. Young wild asses are capable of standing and following their mothers within a few hours of birth.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In southern California, about 2/3 of reproductive age (1.5+ years) females, 1/4 of yearling females, and 60% of lactating females were pregnant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Equus asinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTTTCAACTAACCACAAAGACATCGGCACTCTGTACCTCCTATTCGGCGCTTGAGCTGGAATAGTAGGAACCGCCCTAAGCCTCCTAATCCGTGCTGAATTAGGTCAACCTGGGACCCTGCTGGGAGATGATCAGATCTACAATGTTATTGTAACTGCCCATGCATTCGTAATAATCTTCTTCATAGTCATACCCATCATGATCGGAGGATTTGGGAACTGATTAGTTCCCTTAATAATTGGAGCACCCGATATAGCCTTTCCCCGAATAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTACTTCTTCTTGCTTCCTCAATAATTGAAGCAGGCGCTGGAACAGGCTGAACCGTATATCCTCCCCTAGCTGGAAATCTAGCGCACGCAGGGGCTTCTGTTGACTTAACCATCTTCTCCCTTCACCTAGCTGGTGTATCTTCAATTTTAGGTGCCATCAATTTCATTACCACAATCATCAACATAAAACCACCAGCCCTGTCCCAGTATCAAACCCCTCTATTCGTTTGATCCGTCCTCATTACGGCAGTACTCCTTCTCCTAGCTCTTCCAGTCCTAGCAGCAGGTATTACTATGCTTCTCACAGACCGTAACTTAAACACCACCTTCTTCGATCCTGCAGGGGGAGGGGATCCAATCCTTTACCAACACCTATTCTGATTTTTCGGACACCCTGAAGTCTACATTCTCATTCTGCCAGGCTTTGGTATAATCTCACACATCGTTACATATTATTCAGGTAAAAAAGAACCTTTCGGCTACATGGGTATAGTATGAGCTATAATATCCATTGGCTTCCTAGGCTTCATCGTATGAGCTCACCACATGTTTACAGTAGGTATAGACGTCGATACACGAGCATATTTCACATCAGCTACCATAATCATCGCCATCCCAACCGGTGTAAAAGTATTTAGCTGACTAGCTACCCTGCACGGAGGAAATATCAAATGATCTCCAGCTATACTCTGAGCTCTAGGCTTCATCTTCTTATTCACAGTAGGAGGCCTAACAGGAATCGTCTTGGCTAACTCATCCCTAGATATTGTTCTCCACGATACTTATTATGTAGTAGCACATTTCCACTACGTCCTATCCATAGGAGCAGTCTTCGCCATTATGGGAGGATTTGTTCACTGATTCCCTCTATTCTCAGGATATACACTCAATCAAACCTGAGCAAAAATCCACTTTACAATTATATTCGTAGGGGTCAATATAACTTTCTTCCCACAACACTTCCTTGGCCTCTCAGGAATACCACGACGCTATTCTGACTACCCGGACGCGTATACAACATGAAACACCATCTCATCCATAGGATCTTTTATCTCACTCACAGCAGTAATACTAATAATCTTCATAATTTGAGAAGCATTCGCATCCAAACGAGAAGTGTCTACAGTAGAATTAACCTCAACTAACCTAGAATGACTACATGGATGCCCCCCACCATACCATACATTTGAAGAACCCGCCTACGTAAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Equus asinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Although the future of wild and feral donkeys is uncertain, domestic donkeys are not in danger of extinction in the foreseeable future. However, donkey lovers in the United States and Europe have founded many organizations dedicated to the rescue, preservation, and care of wild, abandoned, or unwanted donkeys. Feral donkeys in Death Valley National Park, California, were under strict population control for many years because they were competing with desert bighorn sheep for very limited resources. Many authorities felt that donkeys were driving the already threatened bighorn sheep to extinction, and about 400 wild donkeys were shot between 1987 and 1995 by National Park Service Rangers as part of their "Direct Reduction" policy.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Equus asinus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: High capacity for population increase; management must be an on-going consideration (Perryman and Muchlinski 1987, but see Jenkins 1989). Study in western Arizona concluded that bighorn sheep population may be limited through resource competition with burro; advocated removal of burros from areas where they are sympatric with bighorn (Seegmiller and Ohmart 1981).

Regulated by Wild Horse and Burro Act of 1971. Most lands with are burros managed by BLM (see Boyles 1986).

Woodward and Sponenberg (1992) recommended that some desert populations be preserved as free-roaming herds for the purpose of maintaining an important store of genetic variation; an area near Marietta, Nevada, is being managed specifically for burros.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pleistocene Re-wilding

 

This species is one of a number which have been included in various “Pleistocene rewilding” plans. Pleistocene rewilding is the proposed practice of restoring ecosystems to their state in the Pleistocene, roughly 10,000 years ago. This contrasts the standard conservation benchmark, particularly in North America, of restoring ecosystems to their pre-Columbian or pre-industrial state. In both Eurasia and North America, the Pleistocene was characterized by much greater diversity and numbers of large herbivores and predators, including proboscidians, equids, camelids, and felidae (Donlan et al 2006; Zimov 2005). The process of restoration would involve the reintroduction of extant species in their historic range, as well as the introduction of ‘proxy organisms’ to replace the ecological functionality of extinct organisms (Donlan et al 2006). 

There are three central theoretical goals to Pleistocene rewilding. In Siberia, a team led by Sergey Zimov is investigating the role of large herbivores as ecosystem engineers. It is thought that herbivory pressure could play a central role in maintaining a grass-dominated plant community, as opposed to either tree- or moss-dominated. Grasslands are known to be more stable carbon sinks than either mossy or forested tundra, due to the rapidity of their biogeochemical cycling (Zimov 2005). In principle, then, reintroducing Pleistocene fauna could have positive climate change mitigation effects. Proposals in North America have focused instead on the preservation of ecological dynamics. Proponents of Pleistocene rewilding argue that due to the strong ecological interactions of megafauna, it is likely that their extinction at the end of the Pleistocene would have caused cascading ecological disruptions lasting until the present time (Donlan et al 2006). Additionally, introduction programs could provide a new lease on life for extant, endangered megafauna species, such as cheetahs and Asian elephants (Rubenstein 2006). 

Pleistocene rewilding, while headline-grabbing, is by no means the standard of modern conservation biology. There are a number of objections to the proposals of Pleistocene rewilders, summarized by Rubenstein et al (2006). The introduction of species which have been locally extinct for thousands of years, and more particularly the introduction of modern relatives of extinct species, carries many risks: the potential for invasive species, catastrophic disruption of existing ecosystems, inadvertent introduction of disease organisms, and unpredictable behavior of introduced species. Additionally, while paleoecology is a growing field, there is still a fair amount of uncertainty about the actual ecosystem functions of the Pleistocene.

Species which Zimov and his colleagues in Siberia are experimenting with bison, musk oxen, Przewalski’s horse, and Siberian tigers (Zimov 2005). Small-scale introductions have already begun in Yakutia. Donlan et al propose introducing Przewalski’s horse, Bolson tortoises, Bactrian camels, cheetahs, lions, and elephants into the Western United States (Donlan et al 2005). While some individuals of these species are present on privately owned land, there are no free-living populations in North America at this time. 

  • Donlan, CJ. 2005. Re-Wilding North America. Nature 436:913-914.
  • Donlan CJ, Berger J, Bock CE, Bock JH, Burney DA, Estes JA, Foreman D, Martin PS, Roemer GW, Smith FA, Soule ME, Greene HW. 2005. Pleistocene Rewilding: An Optimistic Agenda for Twenty-First Century Conservation. The American Naturalist 168:660-681.
  • Rubenstein DR, Rubenstein DI, Sherman PW, Gavin TA. 2006. Pleistocene Park: Does Rewilding North America Represent Sound Conservation for the 21st Century? Biological Conservation 132:232-238.
  • Zimov, SA. 2005. Pleistocene Park: Return of the Mammoth’s Ecosystem. Science 308:796-798.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 1 person

Average rating: 5.0 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The cost of population control of feral donkeys in North America and Europe have been appreciable in some areas. Feral donkeys may contribute to habitat degradation and erosion, particularly in areas where they are not native.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Since donkeys were first domesticated about six thousand years ago, they have been very important in human economies. Egyptian tombs of Dynasty IV (ca. 2675 to 2565 B.C.) indicate that ownership of donkeys was a status symbol, and the elite of society may have owned herds of over a thousand head. Donkeys played a very important role in developing long-distance trade in Egypt, because of their weight-bearing capacity and their adaptation for desert travel. In ancient Egypt, female donkeys were kept as dairy animals. Donkey milk is higher in sugar and protein than cow's milk. The milk was also used for cosmetic and medicinal purposes. Donkey meat was eaten as food by many people. There were domesticated donkeys in Europe by the second millenium B.C. and the first donkeys came to the New World with Christopher Columbus in 1495. Donkeys were introduced to the United States with Mexican explorers. Many of the wild donkeys in the southwestern United States are descendants of escaped or abandoned burros brought by Mexican explorers during the Gold Rush. Throughout history donkeys have been invaluable as beasts of burden. Even today, donkeys are of great economic importance especially in remote areas. They are being used extensively in efforts to boost the economy and alleviate poverty in poorer areas of the world. Miniature donkeys are very popular as companion animals and for show. Mammoth stock are still used as draft animals in small farming businesses around the world.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Under Wild Horse and Burro Act, can be adopted for use in riding or as pet; Act generally prohibits commercial exploitation. Some regard it a pest, citing fouling of water, competition with domestic stock, or displacement of native ungulates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Donkey

The donkey or ass, Equus africanus asinus,[1][2] is a domesticated member of the Equidae or horse family. The wild ancestor of the donkey is the African wild ass, E. africanus. The donkey has been used as a working animal for at least 5000 years. There are more than 40 million donkeys in the world, mostly in underdeveloped countries, where they are used principally as draught or pack animals. Working donkeys are often associated with those living at or below subsistence levels. Small numbers of donkeys are kept for breeding or as pets in developed countries.

A male donkey or ass is called a jack, a female a jenny or jennet;[3][4][5] a young donkey is a foal.[5] Jack donkeys are often used to produce mules.

Asses were first domesticated around 3000 BC,[6] or 4000 BC, probably in Egypt or Mesopotamia,[7] and have spread around the world. They continue to fill important roles in many places today. While domesticated species are increasing in numbers, the African wild ass and another relative, the Onager, are endangered. As beasts of burden and companions, asses and donkeys have worked together with humans for millennia.

Contents

Scientific and common names

Traditionally, the scientific name for the donkey is Equus asinus asinus based on the principle of priority used for scientific names of animals. However, the International Commission on Zoological Nomenclature ruled in 2003 that if the domestic species and the wild species are considered subspecies of each other, the scientific name of the wild species has priority, even when that subspecies was described after the domestic subspecies.[2] This means that the proper scientific name for the donkey is Equus africanus asinus when it is considered a subspecies, and Equus asinus when it is considered a species.

At one time, the synonym ass was the more common term for the donkey, as in jackass, meaning "male donkey". The first recorded use of donkey was in 1784[8][9] or 1785.[10][11] While the word ass has cognates in most other Indo-European languages, donkey is an etymologically obscure word for which no credible cognate has been identified. Hypotheses on its derivation include the following:

  • Perhaps from Spanish, for its don-like gravity; the donkey was also known as "the King of Spain's trumpeter"[11]
  • Perhaps a diminutive of dun (dull grayish-brown), a typical donkey colour.[10][12]
  • Perhaps from the name Duncan.[10][13]
  • Perhaps of imitative origin.[13]

From the 18th century, donkey gradually replaced ass. The change may have come about through a tendency to avoid pejorative terms in speech, and be comparable to the substitution in North American English of rooster for cock, or that of rabbit for coney, which was formerly homophonic with cunny. By the end of the 17th century, changes in pronunciation of both ass and arse had caused them to become homophones. Other words used for the ass in English from this time include cuddy in Scotland, neddy in southwest England and dicky in the southeast;[9] moke is documented in the 19th century, and may be of Welsh or Gypsy origin. In the United States, the Spanish burro is used both specifically for the feral donkeys of Arizona, California and Nevada, and, west of the Mississippi, generically for any small or standard donkey.

Characteristics

Classic British seaside donkeys in Skegness

Donkeys vary considerably in size, depending on breed and management. The height at the withers ranges from 7.3 hands (31 inches, 79 cm) to 15.3 hands (63 inches, 160 cm), and the weight from 80 to 480 kg (180 to 1,060 lb). Working donkeys in the poorest countries have a life expectancy of 12 to 15 years;[14] in more prosperous countries, they may have a lifespan of 30 to 50 years.[5]

Donkeys are adapted to marginal desert lands. Unlike wild and feral horses, wild donkeys in dry areas are solitary and do not form harems. Each adult donkey establishes a home range; breeding over a large area may be dominated by one jack.[15] The loud call or bray of the donkey, which typically lasts for twenty seconds[16][17] and can be heard for over three kilometres, may help keep in contact with other donkeys over the wide spaces of the desert.[citation needed] Donkeys have large ears, which may pick up more distant sounds,[citation needed] and may help cool the donkey's blood. Donkeys can defend themselves by biting, striking with the front hooves or kicking with the hind legs.

Breeding

A 3-week-old donkey

A jennet is normally pregnant for about 12 months, though the gestation period varies from 11 to 14 months,[5] and usually gives birth to a single foal. Births of twins are rare, though less so than in horses.[5] About 1.7 percent of donkey pregnancies result in twins; both foals survive in about 14 percent of those.[citation needed]

Although jennets come into heat within 9 or 10 days of giving birth, their fertility remains low and it is usual to wait one or two further oestrous cycles before rebreeding. Because of this and the longer gestation period, donkey breeders do not expect to obtain a foal every year, as horse breeders often do, but may plan for three foals in four years.[5]

Donkeys can interbreed with other members of the Equidae family, and are commonly interbred with horses. The hybrid between a jack and a mare is a mule, valued as a working and riding animal in many countries. Some large donkey breeds such as the Asino di Martina Franca, the Baudet de Poitou and the Mammoth Jack are raised only for mule production. The hybrid between a stallion and a jennet is a hinny, and is less common. Like other inter-species hybrids, mules and hinnies are usually sterile.[5]

Behaviour

Donkeys have a notorious reputation for stubbornness, but this has been attributed to a much stronger sense of "self preservation" than exhibited by horses.[18] Likely based on a stronger prey instinct and a weaker connection with man, it is considerably more difficult to force or frighten a donkey into doing something it perceives to be dangerous for whatever reason. Once a person has earned their confidence they can be willing and companionable partners and very dependable in work.[citation needed]

Although formal studies of their behaviour and cognition are rather limited, donkeys appear to be quite intelligent, cautious, friendly, playful, and eager to learn.

History

Donkey in an Egyptian painting c. 1298–1235 BC
Lt. Richard Alexander "Dick" Henderson using a donkey to carry a wounded soldier at the Battle of Gallipoli.

The ancestors of the modern donkey are the Nubian and Somalian subspecies of African wild ass.[19][20] Remains of domestic donkeys dating to the fourth millennium BC have been found in Ma'adi in Lower Egypt, and it is believed that the domestication of the donkey was accomplished long after the domestication of cattle, sheep and goats in the seventh and eighth millennia BC. Donkeys were probably first domesticated by pastoral people in Nubia, and they supplanted the ox as the chief pack animal of that culture. The domestication of donkeys served to increase the mobility of pastoral cultures, having the advantage over ruminants of not needing time to chew their cud, and were vital in the development of long-distance trade across Egypt. In the Dynasty IV era of Egypt, between 2675 and 2565 BC, wealthy members of society were known to own over 1,000 donkeys, employed in agriculture, as dairy and meat animals and as pack animals.[21] In 2003, the tomb of either King Narmer or King Hor-Aha (two of the first Egyptian pharaohs) was excavated and the skeletons of ten donkeys were found buried in a manner usually used with high ranking humans. These burials show the importance of donkeys to the early Egyptian state and its ruler.[22]

By the end of the fourth millennium BC, donkey had spread to Southwest Asia, and the main breeding center had shifted to Mesopotamia by 1800 BC. The breeding of large, white riding asses made Damascus famous, while Syrian breeders developed at least three other breeds, including one preferred by women for its easy gait. The Muscat or Yemen ass was developed in Arabia. By the second millennium BC, the donkey was brought to Europe, possibly at the same time as viticulture was introduced, as the donkey is associated with the Syrian god of wine, Dionysus. Greeks spread both of these to many of their colonies, including those in what are now Italy, France and Spain; Romans dispersed them throughout their empire.[21]

The first asses came to the Americas on ships of the Second Voyage of Christopher Columbus, and were landed at Hispaniola in 1495.[23] The first North American donkeys may have been the two taken to Mexico by Juan de Zumárraga, the first bishop of Mexico, who arrived there on 6 December 1528, while the first donkeys to reach what is now the United States may have crossed the Rio Grande with Juan de Oñate in April 1598.[24]

Present status

About 41 million donkeys were reported worldwide in 2006.[25] China has the most with 11 million, followed by Pakistan, Ethiopia and Mexico. Some researchers believe the actual number is somewhat higher since many donkeys go uncounted.[26] The number of breeds and percentage of world population for each of the FAO's world regions was in 2006:[25]

RegionNo. of breeds % of world pop.
Africa2626.9
Asia & Pacific3237.6
Europe & the Caucasus513.7
Latin America & the Caribbean2419.9
Near & Middle East4711.8
North America50.1
World18541 million head

In 1997 the number of donkeys in the world was reported to be continuing to grow, as it had steadily done throughout most of history; factors cited as contributing to this were increasing human population, progress in economic development and social stability in some poorer nations, conversion of forests to farm and range land, rising prices of motor vehicles and fuel, and the popularity of donkeys as pets.[26][27] Since then, the world population of donkeys is reported to be rapidly shrinking, falling from 43.7 million to 43.5 million between 1995 and 2000, and to only 41 million in 2006.[25] The fall in population is pronounced in developed countries; in Europe, the total number of donkeys fell from 3 million in 1944 to just over 1 million in 1994.[28]

The Domestic Animal Diversity Information System (DAD-IS) of the FAO listed 189 breeds of ass in June 2011.[29] In 2000 the number of breeds of donkey recorded worldwide was 97, and in 1995 it was 77. The rapid increase is attributed to attention paid to identification and recognition of donkey breeds by the FAO's Animal Genetic Resources project.[25] The rate of recognition of new breeds has been particularly high in some developed countries. In France, for example, only one breed, the Baudet de Poitou, was recognised prior to the early 1990s; by 2005, a further six donkey breeds had official recognition.[30]

In prosperous countries, the welfare of donkeys both at home and abroad has become a concern, and a number of sanctuaries for retired and rescued donkeys have been set up. The largest is the Donkey Sanctuary of England, which also supports donkey welfare projects in Egypt, Ethiopia, India, Kenya, and Mexico.[31]

Uses

Economic use

Donkeys bring supplies through the jungle to a camp outpost in Tayrona National Natural Park in northern Colombia
On the island of Hydra, because cars are outlawed, donkeys and mules form virtually the sole method of heavy goods transport.

The donkey has been used as a working animal for at least 5000 years. Of the more than 40 million donkeys in the world, about 96% are in underdeveloped countries, where they are used principally as pack animals or for draught work in transport or agriculture. After human labour, the donkey is the cheapest form of agricultural power.[32] They may also be ridden, or used for threshing, raising water, milling and other work. Working donkeys are often associated with those living at or below subsistence levels.[33] Some cultures that prohibit women from working with oxen in agriculture do not extend this taboo to donkeys, allowing them to be used by both sexes.[34]

In developed countries where their use as beasts of burden has disappeared, donkeys are used to sire mules, to guard sheep,[21][35] for donkey rides for children or tourists, and as pets. Donkeys may be pastured or stabled with horses and ponies, and are thought to have a calming effect on nervous horses. If a donkey is introduced to a mare and foal, the foal may turn to the donkey for support after it has been weaned from its mother.[36]

A few donkeys are milked or raised for meat;[26] in Italy, which has the highest consumption of equine meat in Europe and where donkey meat is the main ingredient of several regional dishes, only about 1000 donkeys were slaughtered in 2010, yielding approximately 100 tonnes of meat.[37] Asses' milk may command good prices: the average price in Italy in 2009 was €15 per litre,[38] and a price of €6 per 100 ml was reported from Croatia in 2008; it is used for soaps and cosmetics as well as dietary purposes. The niche markets for both milk and meat are expanding.[25] In the past, donkey skin was used in the production of parchment.[25]

In warfare

During World War I John Simpson Kirkpatrick, a British stretcher bearer serving with the Australian and New Zealand Army Corps, and Richard Alexander "Dick" Henderson of the New Zealand Medical Corps used donkeys to rescue wounded soldiers from the battlefield at Gallipoli.[39][40]

According to British food writer Matthew Fort, donkeys were used in the Italian Army. The Mountain Fusiliers each had a donkey to carry their gear, and in extreme circumstances the animal could be eaten.[41]

Donkeys have also been used to carry explosives in conflicts that include the war in Afghanistan and others.[42][43]

Care

Shoeing

Donkey hooves are more elastic than those of horses, and do not naturally wear down as fast. Regular clipping may be required; neglect can lead to permanent damage.[5] Working donkeys may need to be shod. Donkey shoes are similar to horseshoes, but usually smaller and without toe-clips.

Nutrition

Woolly páramo donkey

In their native arid and semi-arid climates, donkeys spend more than half of each day foraging and feeding, often on poor quality scrub.[44] The donkey has a tough digestive system in which roughage is efficiently broken down by hind gut fermentation, microbial action in the caecum and large intestine.[44] While there is no marked structural difference between the gastro-intestinal tract of a donkey and that of a horse, the digestion of the donkey is more efficient. It needs less food than a horse or pony of comparable height and weight,[45] approximately 1.5 percent of body weight per day in dry matter,[46] compared to the 2–2.5 percent consumption rate possible for a horse.[47] Donkeys are also less prone to colic.[48] The reasons for this difference are not fully understood; the donkey may have different intestinal flora to the horse, or a longer gut retention time.[49]

Donkeys obtain most of their energy from structural carbohydrates. Some suggest that a donkey needs to be fed only straw (preferably barley straw), supplemented with controlled grazing in the summer or hay in the winter,[50] to get all the energy, protein, fat and vitamins it requires; others recommend some grain to be fed, particularly to working animals,[5] and others advise against feeding straw.[51] They do best when allowed to consume small amounts of food over long periods. They can meet their nutritional needs on 6 to 7 hours of grazing per day on average dryland pasture that is not stressed by drought. If they are worked long hours or do not have access to pasture, they require hay or a similar dried forage, with no more than a 1:4 ratio of legumes to grass. They also require salt and mineral supplements, and access to clean, fresh water.[52] In a lush climate, donkeys are prone to obesity and are at risk of laminitis.[53]

Throughout the world, working donkeys are associated with the very poor, with those living at or below subsistence level.[33] Few receive adequate food, and in general donkeys throughout the Third World are under-nourished and over-worked.[54] In temperate climates the forage available is often too abundant and too rich; over-feeding may cause weight gain and obesity, and lead to metabolic disorders such as founder (laminitis) and hyperlipaemia,[50] or to gastric ulcers.[55]

Feral donkeys and wild asses

In some areas domestic donkeys have returned to the wild and established feral populations such as those of the Burro of North America and the Asinara donkey of Sardinia, Italy, both of which have protected status. Feral donkeys can also cause problems, notably in environments that have been evolutionarily free of any form of equid, such as Hawaii.[56] In Australia, where there may be 5 million feral donkeys,[23] they are regarded as an invasive pest and have a serious impact on the environment. They may compete with livestock and native animals for resources, spread weeds and diseases, foul or damage watering holes and cause erosion.[57]

Wild asses, onagers, and kiangs

Few species of ass exist in the wild. The African wild ass, Equus africanus, has two subspecies, the Somali wild ass, Equus africanus somaliensis, and the Nubian wild ass, Equus africanus africanus,[58] the principal ancestor of the domestic donkey.[25] Both are critically endangered.[59] Extinct species include the European ass, Equus hydruntinus, which became extinct during the Neolithic, and the North African wild ass, Equus africanus atlanticus, which became extinct in Roman times.[25]

There are five subspecies of Asiatic wild ass or onager, Equus hemionus, and three subspecies of the kiang, Equus kiang, of the Himalayan upland.

Donkey hybrids

A male donkey (jack) can be crossed with a female horse to produce a mule. A male horse can be crossed with a female donkey to produce a hinny.

Horse-donkey hybrids are almost always sterile because horses have 64 chromosomes whereas donkeys have 62, producing offspring with 63 chromosomes. Mules are much more common than hinnies. This is believed to be caused by two factors, the first being proven in cat hybrids, that when the chromosome count of the male is the higher, fertility rates drop (as in the case of stallion x jennet).[citation needed] The lower progesterone production of the jenny may also lead to early embryonic loss. In addition, there are reasons not directly related to reproductive biology. Due to different mating behavior, jacks are often more willing to cover mares than stallions are to breed jennys. Further, mares are usually larger than jennys and thus have more room for the ensuing foal to grow in the womb, resulting in a larger animal at birth. It is commonly believed that mules are more easily handled and also physically stronger than hinnies, making them more desirable for breeders to produce, and it is unquestioned that mules are more common in total number[citation needed].

The offspring of a zebra-donkey cross is called a zonkey, zebroid, zebrass, or zedonk;[60] zebra mule is an older term, but still used in some regions today. The foregoing terms generally refer to hybrids produced by breeding a male zebra to a female donkey. Zebra hinny, zebret and zebrinny all refer to the cross of a female zebra with a male donkey. Zebrinnies are rarer than zedonkies because female zebras in captivity are most valuable when used to produce full-blooded zebras.[61] There are not enough female zebras breeding in captivity to spare them for hybridizing; there is no such limitation on the number of female donkeys breeding.

Cultural references

A North African donkey in a 1917 issue of National Geographic Magazine

The long history of human donkey use has created a rich store of cultural references:

Religion, myth and folklore

Due to its widespread domestication and use, the donkey is referred to in myth and folklore around the world. In classical and ancient cultures, donkeys had a part. The donkey was the symbol of the Egyptian sun god Ra as well as the Greek god Dionysus.[62]

Donkeys (or asses) are mentioned many times in the Bible, beginning in the first book and continuing through both Old and New Testaments, so they became part of Judeo-Christian tradition. They are portrayed as work animals, used for agricultural purposes, transport and as beasts of burden, and terminology is used to differentiate age and gender. In contrast, horses were represented only in the context of war, ridden by cavalry or pulling chariots. Owners were protected by law from loss caused by the death or injury of a donkey, showing their value in that time period. Narrative turning points in the Bible (and other stories) are often marked through the use of donkeys - for instance, leading, saddling, or mounting/dismounting a donkey are used to show a change in focus or a decision having been made.[63] They are used as a measure of wealth in Genesis 30:43,[64] and in Genesis chapter 34, the prince of Shechem (the modern Nablus) is named Hamor ("donkey" in Hebrew).[65]

According to Old Testament prophesy, the Messiah is said to arrive on a donkey: "Behold, your King is coming to you; He is just and having salvation, Lowly and riding on a donkey, A colt, the foal of a donkey!" (Zechariah 9:9). According to the New Testament, this prophecy was fulfilled when Jesus entered Jerusalem riding on the animal (Matthew 21:4-7, John 12:14-15). Jesus appeared to be secretly aware of this connection (Matthew 21:1-3, John 12:16).

In the Jewish religion, donkeys are not a kosher animal. They are considered avi avot hatuma or the ultimate impure animal, and doubly "impure", as they are both non-ruminants and non-cloven hoofed. However, they are the only impure animal that is falls under the mitzvah (commandment) of firstborn ("bechor") consecration that also applies to humans and pure animals. In Jewish Oral Tradition ( Talmud Bavli), the son of David was prophesied as riding on a donkey if the tribes of Israel are undeserving of redemption.[66]

In contemporary Israel, the term "Messiah's Donkey" (Chamoro Shel Mashiach חמורו של משיח) stands at the center of a controversial religious-political doctrine, under which it was the Heavenly-imposed "task" of secular Zionists to build up a Jewish State, but once the state is established they are fated to give place to the Religious who are ordained to lead the state. The secularists in this analogy are "The Donkey" while the religious who are fated to supplant them are a collective "Messiach". A book on the subject, published in 1998 by the militant secularist Sefi Rechlevsky, aroused a major controversy in the Israeli public opinion.[67]

With the rise of Christianity, some believers came to see the cross-shaped marking present on donkeys' backs and shoulders as a symbol of the animal's bearing Jesus into Jerusalem on Palm Sunday. During the Middle Ages, Europeans used hairs from this cross (or contact with a donkey) as folk remedies to cure illness, including measles and whooping cough.[68] Around 1400 AD, one physician listed riding backwards on a donkey as a cure for scorpion stings.[69]

Donkeys are also referred to repeatedly in the writings and imagery of the Hindu and Islamic religions. In Hinduism, the goddess Kalaratri's vahana (vehicle) is a donkey.[70] Donkeys also appear multiple times in Indian folklore as the subject of stories in both the Hitopadesha[71] and the Panchatantra.[72]

Literature and film

Donkeys hold a significant place in literature, especially in Western cultures. The original representations of donkeys in Western literature come mainly from the Bible and Ancient Greece. Donkeys were represented in a fairly negative form by the Greeks, but perceptions later changed, partially due to donkeys becoming increasingly symbolically connected to Christianity. Donkeys were found in the works of Homer, Aesop and Apuleius, where they were generally portrayed as stupid and stubborn, or servile at best, and generally represented the lower class. They were often contrasted with horses, which were seen as powerful and beautiful. Aesop's The Ass in the Lion's Skin, representational of the almost 20 of his fables that portray donkeys, shows the donkey as a fool. Apuleius's The Golden Ass (160 AD), where the narrator is turned into a donkey, is also notable for its portrayal of donkeys as stubborn, foolish, wicked and lowly. This work had a large influence on the portrayal of donkeys in later cultures, including medieval and renaissance Europe. During this time, donkeys continued to be shown as stupid, clumsy and slow. Shakespeare popularized the use of the word "ass" as an insult meaning stupid or clownish in many of his plays, including Bottom's appearance in A Midsummer Night's Dream (1600). In contrast, a few years later, Cervantes' Don Quixote shows a more positive slant on the donkey, portraying them as steady and loyal companions. This difference is possibly due to donkeys being an important aspect of many Spaniards' lives at this point in time.[73]

In contrast to Grecian works, donkeys were portrayed in Biblical works as symbols of service, suffering, peace and humility, most notably in their inclusion in the New Testament Nativity narrative. Donkeys are also associated with the theme of wisdom in the Old Testament story of Balaam's ass, and are seen in a positive light through the story of Jesus riding into Jerusalem on a donkey. By the 19th century, the donkey was portrayed with more positive attributes by popular authors. William Wordsworth portrayed the donkey as loyal and patient in his 1819 poem Peter Bell:A Tale, using the donkey as a Christian symbol. Robert Louis Stevenson in Travels with a Donkey (1879), portrays the animal as a stubborn beast of burden. Sympathetic portrayals return in Juan Ramon Jimenez's Platero and I. The melancholy Eeyore in Winnie the Pooh (first published in 1926) is arguably the most famous donkey in Western literature.[73]

Donkeys were featured in literature during the 20th century, including in George Orwell's 1951 Animal Farm, where Benjamin the donkey is portrayed as resilient and loyal.[73] Puzzle is a well-meaning but easily manipulated donkey in C. S. Lewis's 1956 The Last Battle.[74] They are portrayed in film beginning with the 1940 Disney film Fantasia, where the donkey is portrayed as a slapstick character who participates in a social faux pas with Bacchus and is punished by Zeus.[75] A donkey is featured as the main figure in the 1966 film Au hasard Balthazar by Robert Bresson, and, is given a life path of Christian symbolism.[73] Donkey, voiced by Eddie Murphy, is featured as a main character in the Shrek franchise of the 2000s.[76]

Colloquialisms, proverbs and insults

Many cultures have colloquialisms and proverbs that include donkeys or asses. British phrases include "to talk the hind legs off a donkey", used to describe someone talking excessively and generally persuasively.[77] Donkeys are the animals featured most often in Greek proverbs, including such statements of fatalistic resignation as "the donkey lets the rain soak him".[78] The French philosopher Jean Buridan constructed the paradox called Buridan's ass, in which a donkey, placed exactly midway between water and food, would die of hunger and thirst because he could not find a reason to choose one of the options over the other, and so would never make a decision.[79] Italy has several phrases regarding donkeys, including "put your money in the ass of a donkey and they'll call him sir" (meaning, if you're rich, you'll get respect) and "women, donkeys and goats all have heads" (meaning, women are as stubborn as donkeys and goats).[80] The United States developed its own expressions, including "better a donkey that carries me than a horse that throws me", "a donkey looks beautiful to a donkey", and "a donkey is but a donkey though laden with gold", among others.[81]

The words "donkey" and "ass" (or translations thereof) have come to have derogatory or insulting meaning in several languages, and are generally used to mean someone who is obstinate, stupid or silly,[82][83][84][85] In football, especially in the United Kingdom, a player who is considered unskilful is often dubbed a "donkey",[82] and the term has a similar connotation in poker.[86] In the US, the slang terms "dumbass" and "jackass" are used to refer to someone considered stupid.[87][88]

Politics

Satirical use of braying in a political cartoon

In keeping with their widespread cultural references, donkeys feature in political systems, symbols and terminology in many areas of the world. A "donkey vote" is a vote that simply writes down preferences in the order of the candidates (1 at the top, then 2, and so on), and is most often seen in countries with ranked voting systems and compulsory voting, such as Australia.[89] The donkey is a common symbol of the Democratic Party of the United States, originating in a cartoon by Thomas Nast of Harper's Weekly in the nineteenth century.[90]

The bray of the donkey may be used as a simile for loud and foolish speech in political mockery.[91][92] For example,[93]

There are braying men in the world as well as braying asses; for what's loud and senseless talking and swearing, any other than braying

The "ruc català" or "burro català" (Catalan donkey) has become a symbol of Catalonia in Spain. In 2003 some friends in Catalonia made bumper stickers featuring the burro català as a reaction against a national advertising campaign for Toro d'Osborne, a brandy. The burro became popular as a nationalist symbol in Catalonia, whose residents wanted to assert their identity to resist Spanish centralism. Renewed attention to the regional burro helped start a breeding campaign for its preservation, and its numbers have increased.[94]

Proshka, an ass owned by Russian populist nationalist liberal democratic politician Vladimir Zhirinovsky, became prominent during the 2012 Russian presidential election campaign, when he was filmed in an election advertisement video. In that controversial ad, Zhirinovsky appeared sitting in a sleigh harnessed with Proshka, then claiming that the "little wretched ass" is the symbol of Russia and that if he would became President a "daring troika" would return as a symbol of Russia instead of the ass; at the end, Zhirinovsky beat Proshka with a whip, made the ass move and had a ride on him through the snow-covered backyard of his dacha.International organisations People for the Ethical Treatment of Animals (PETA) and World Society for the Protection of Animals (WSPA) have accused Zhirinovsky in cruelty to animals. Zhirinovsky replied to the ass-defenders that such kind of treatment is commonplace in the Arab world and that in fact his ass has been treated "better than many people".[95][96]

See also

References

  1. ^ Don E. Wilson & DeeAnn M. Reeder, ed. (2005). "Equus asinus". Mammal Species of the World. A Taxonomic and Geographic Reference (3rd ed.). Johns Hopkins University Press. 
  2. ^ a b International Commission on Zoological Nomenclature (2003). "Usage of 17 specific names based on wild species which are pre-dated by or contemporary with those based on domestic animals (Lepidoptera, Osteichthyes, Mammalia): conserved. Opinion 2027 (Case 3010)". Bull.Zool.Nomencl. 60 (1): 81–84. 
  3. ^ [n.a.] (2005) Oxford American Dictionaries (computer application) Apple Computer. s.v. "Jennet (1)"
  4. ^ Woolf, Henry (ed.)|title= (1980) Webster's New Collegiate Dictionary Springfield MA: Merriam ISBN 0-87779-398-0. s.v. "Jennet (2)"
  5. ^ a b c d e f g h i "The Donkey". Government of Alberta: Agriculture and Rural Development. 1990. Retrieved September 2010. 
  6. ^ Rossel S, Marshall F et al. "Domestication of the donkey: Timing, processes, and indicators." PNAS 105(10):3715-3720. March 11, 2008. Abstract
  7. ^ Nowak, Ronald M. (1999). Walker's Mammals of the World (6th ed.). Baltimore: Johns Hopkins University Press. ISBN 978-0-8018-5789-8. 
  8. ^ *Fairman, Tony (1994). "How the ass became a donkey". English Today 10 (4): 32. doi:10.1017/S0266078400007860. ISSN 0266-0784. , cited in Díaz Vera, Javier E. (2002) A changing world of words: Studies in English historical lexicography, lexicology and semantics Amsterdam: Rodopi. ISBN 978-90-420-1330-8 p.239
  9. ^ a b Díaz Vera, Javier E. (2002) A changing world of words: Studies in English historical lexicography, lexicology and semantics Amsterdam: Rodopi. ISBN 978-90-420-1330-8 p.239
  10. ^ a b c "Donkey" OED Online (subscription required). Retrieved May 2008.
  11. ^ a b Grose, Francis (1785) A Classical Dictionary of the Vulgar Tongue London: For S. Hooper. s.v. "Donkey".
  12. ^ Merriam-Webster Unabridged (MWU). (Online subscription-based reference service of Merriam-Webster, based on Webster's Third New International Dictionary, Unabridged. Merriam-Webster, 2002.) Headword donkey. Retrieved September 2007.
  13. ^ a b Houghton Mifflin (2000). The American Heritage Dictionary of the English Language (4th ed.). Boston and New York: Houghton Mifflin. p. 535. ISBN 978-0-395-82517-4. 
  14. ^ The Donkey - Description and Diagram The Donkey Society of New South Wales. Retrieved February 2012.
  15. ^ French, Jane (1997) "Social Behaviour", in Elisabeth Svendsen (ed.), The professional handbook of the donkey, 3rd edition. London: Whittet Books. ISBN 978-1-873580-37-0. pp.127–165.
  16. ^ EA Canacoo, FK Avornyo (1998). "Daytime activities of donkeys at range in the coastal savanna of Ghana". Applied Animal Behaviour Science. 
  17. ^ G Whitehead, J French, P Ikin (1991). "Welfare and veterinary care of donkeys". In Practice (British Veterinary Association). 
  18. ^ "ABC.net.au". ABC.net.au. Retrieved September 2010. 
  19. ^ J. Clutton-Brook, J. A Natural History of Domesticated Mammals 1999.
  20. ^ Albano Beja-Pereira, "African Origins of the Domestic Donkey", in Science, 2004
  21. ^ a b c Olsen, Sandra L. (1995) Horses through time Boulder, Colorado: Roberts Rinehart Publishers for Carnegie Museum of Natural History. ISBN 978-1-57098-060-2. Cited at Donkey International Museum of the Horse. Retrieved February 2012.
  22. ^ "Egyptian Tomb Holds First Known Domesticated Donkeys". Fox News Network. March 11, 2008. Retrieved November 2011. 
  23. ^ a b Roots, Clive (2007) Domestication Westport: Greenwood Press ISBN 978-0-313-33987-5 p.179
  24. ^ Brookshier, Frank (1974) The Burro Norman: University of Oklahoma Press.
  25. ^ a b c d e f g h Waltraud Kugler, Hans-Peter Grunenfelder, Elli Broxham (2008). Donkey Breeds in Europe: Inventory, Description, Need for Action, Conservation; Report 2007/2008. St. Gallen, Switzerland: Monitoring Institute for Rare Breeds and Seeds in Europe. 
  26. ^ a b c Starkey, P. and M. Starkey. 1997. Regional and World trends in Donkey Populations. Animal Traction Network for Eastern and Southern Africa (ATNESA)
  27. ^ Blench, R. 2000. The History and Spread of Donkeys in Africa. Animal Traction Network for Eastern and Southern Africa (ATNESA)
  28. ^ Starkey, Paul (1997) "Donkey Work", in Elisabeth Svendsen (ed.), The professional handbook of the donkey, 3rd edition. London: Whittet Books. ISBN 978-1-873580-37-0. pp.183–206.
  29. ^ "DAD-IS - Domestic Animal Diversity Information System". Food and Agriculture Organization of the United Nations. Retrieved June 2011. 
  30. ^ Bérard, Laurence; Marie Cegarra; Marcel Djama; Sélim Louafi; Philippe Marchenay; Bernard Roussel; François Verdeaux (2005) Biodiversity and Local Ecological Knowledge in France Institut National de la Recherche Agronomique; Centre de Coopération Internationale en Recherche Agronomique pour le Développement; Institut du Développement Durable et des Relations Internationales; Institut Français de la Biodiversité. ISBN 2-915819-06-8 p.109. Retrieved February 2012.
  31. ^ "Home". The Donkey Sanctuary. Retrieved June 2011. 
  32. ^ Pearson, R.A.; E. Nengomasha; R. Krecek (1999) "The challenges in using donkeys for work in Africa", in P. Starkey; P. Kaumbutho Meeting the challenges of animal traction. Resource book of the Animal Traction Network of Southern Africa, Harare, Zimbabwe. London: Intermediate Technology Publications.
  33. ^ a b Aluja, Aline S. de; Francisco López; Graciela Tapia Pérez (2004) Estimación del peso corporal en burros del Centro de México a partir de la circunferencia torácica (Spanish-language version of A. S. de Aluja, G. Tapia Pérez, F. López and R. A. Pearson "Live Weight Estimation of Donkeys in Central México from Measurement of Thoracic Circumference", Tropical Animal Health and Production, 37, Supplement 1: 159-171, DOI 10.1007/s11250-005-9007-0)
  34. ^ World Bank, Food and Agriculture Organization of the United Nations, International Fund for Agricultural Development (2009). Gender in agriculture sourcebook. World Bank Publications. p. 290. ISBN 0-8213-7587-3. 
  35. ^ Dohner, Janet Vorwald (2007). Livestock Guardians: Using Dogs, Donkeys and Llamas to Protect Your Herd. Storey Publishing. ISBN 1-58017-695-X. 
  36. ^ "Donkeys". Young People's Trust for the Environment. Retrieved June 2011. 
  37. ^ Tavola AMR13 - Bestiame macellato a carni rosse - (Gennaio - Dicembre) - Anno 2010 (in Italian) Istat - Istituto Nazionale di Statistica. Retrieved December 2011. "Table AMR13: Livestock slaughtered for red meat, January–December 2010"
  38. ^ "Il Prezzo Del Latte Di Asina" (in Italian). 2009. Retrieved June 2011. "The price of asses' milk" 
  39. ^ Simpson and his donkey Retrieved January 2012.
  40. ^ Anzac Heirs: A selfless lifetime of service. The New Zealand Herald, 22 April 2010.
  41. ^ Fort, Matthew (June 2005). Eating Up Italy: Voyages on a Vespa. HarperPerennial. ISBN 0-00-721481-2. 
  42. ^ Evans, Michael (April 30, 2009). "Donkey 'suicide' bombing is latest tactic against patrols". The Times. Retrieved July 2011. 
  43. ^ Ganor, Boaz (November 15, 1991). "Syria and Terrorism". Survey of Arab Affairs. Jewish Center for Public Affairs. Retrieved July 2011. 
  44. ^ a b Taylor, Fiona (1997) "Nutrition", in Elisabeth Svendsen (ed.), The professional handbook of the donkey, 3rd edition. London: Whittet Books. ISBN 978-1-873580-37-0. pp.93–105.
  45. ^ Smith, David; Stephanie Wood (2008) "Donkey Nutrition", in Elisabeth Svendsen; James Duncan; David Hadrill The Professional Handbook of the Donkey, 4th edition. Yatesbury: Whittet Books. p.10.
  46. ^ S Wood, D Smith and C Morris. "Seasonal variation of digestible energy requirements of mature donkeys in the UK". Proceedings Equine Nutrition Conference. Hanover, Germany. 1–2 October 2005:p39-40
  47. ^ Hall, Marvin H. and Particia M. Comerford. "Pasture and Hay for Horses - Argonomy facts 32," 1992 University of Pennsylvania, Cooperative Extension Service. Web site accessed February 14, 2007.
  48. ^ Svendsen, Elisabeth (ed.) (1997) The professional handbook of the donkey, 3rd edition. London: Whittet Books. ISBN 978-1-873580-37-0. p.208.
  49. ^ Smith, DG; Pearson, RA (November 2005). "A review of the factors affecting the survival of donkeys in semi-arid regions of sub-Saharan Africa". Trop Anim Health Prod. 37 Suppl 1: 1–19. PMID 16335068. 
  50. ^ a b What should you feed your donkeys? The Donkey Sanctuary, 2010. Retrieved February 2012.
  51. ^ Burro care U.S. Department of the Interior: Bureau of Land Management. Accessed February 2012.
  52. ^ Aganga, A.A., et al. "Feeding donkeys" Livestock Research for Rural Development 12 (2) 2000. Department of Animal Science and Production, Botswana College of Agriculture. Web site accessed July 4, 2009.
  53. ^ "Feeding Your Donkey" Web site accessed July 4, 2009.
  54. ^ Svendsen, Elisabeth (1997) "Donkeys Abroad", in Elisabeth Svendsen (ed.), The professional handbook of the donkey, 3rd edition. London: Whittet Books. ISBN 978-1-873580-37-0. pp.166–182.
  55. ^ Burden, F. A.; Gallagher, J.; Thiemann, A. K.; Trawford, A. F. (2008). "Necropsy survey of gastric ulcers in a population of aged donkeys: prevalence, lesion description and risk factors". Animal 3 (2): 287–293. doi:10.1017/S1751731108003480. 
  56. ^ Lucas-Zenk, Carolyn (August 21, 2011). "When Donkeys Fly". West Hawaii Today. Retrieved August 2011. 
  57. ^ "Feral horse (Equus caballus) and feral donkey (Equus asinus)". Australian Government: Department of Sustainability, Environment, Water, Population and Communities. 2011. Retrieved June 2011. 
  58. ^ Moehlman, P.D.; H. Yohannes; R. Teclai; F. Kebede (2008) Equus africanus, in: IUCN 2008. IUCN Red List of Threatened Species. Retrieved February 2012.
  59. ^ African Wild Ass, Equus africanus IUCN/SSC Equid Specialist Group, 2003. Retrieved February 2012.
  60. ^ "American Donkey and Mule Society: Zebra Hybrids". Lovelongears.com. Retrieved September 2010. 
  61. ^ "All About Zebra Hybrids". Archived from the original on 27 October 2009. Retrieved September 2010. 
  62. ^ Gauding, Madonna (2009). The Signs and Symbols Bible: The Definitive Guide to Mysterious Markings. Sterling Publishing Company, Inc. p. 238. ISBN 1-4027-7004-9. 
  63. ^ Forti, Tova (2008). Animal imagery in the book of Proverbs. Volume 118 of Supplements to Vetus Testamentum. BRILL. pp. 71–72. ISBN 90-04-16287-9. 
  64. ^ "Genesis Chapter 30". King James Bible. King James Bible Online. Retrieved November 2011. 
  65. ^ "Genesis Chapter 34". King James Bible. King James Bible Online. Retrieved November 2011. 
  66. ^ Morrison, Chanan (January 24, 2007). "Parshat Bo: The So Holy Donkey". Israel National News. Retrieved November 2011. 
  67. ^ Wurmser, Meyrav (March 1999). "Can Israel Survive Post-Zionism?". Middle East Quarterly 6 (1): 3–13. 
  68. ^ Oliver, Harry (2010). Black Cats & Four-Leaf Clovers: The Origins of Old Wives' Tales and Superstitions in Our Everyday Lives. Penguin. ISBN 0-399-53609-4. 
  69. ^ "Hundreds of Odd Remedies found in Old Book". Popular Mechanics: 556. October 1923. 
  70. ^ Gaenszle, Martin and Jörg Gengnagel (2006). Visualizing space in Banaras: images, maps, and the practice of representation. Volume 5 of Ethno-Indology: Heidelberg studies in South Asian rituals. Otto Harrassowitz Verlag. p. 49. ISBN 3-447-05187-6. 
  71. ^ Müller, Friedrich Max (1865). The second, third, and fourth books of the Hitopadeśa. Volume 4 of Handbooks for the study of Sanskrit. Longman, Green, Longman, Roberts, & Green. p. Table of Contents. 
  72. ^ Pūrṇabhadra (1908). In Johannes Hertel. The Panchatantra. Volume 11 of Harvard oriental series. Harvard University. pp. xi–xii. 
  73. ^ a b c d Bough, Jill (2011). "The Mirror Has Two Faces: Contradictory Reflections of Donkeys in Western Literature from Lucius to Balthazar". Animals: 56–68. doi:10.3390/ani1010056. Retrieved November 2011. 
  74. ^ Mish, Kathleen (2006). "Philip K. Dick and C.S. Lewis: The Approach to Religion in Science Fiction and Fantasy". L-SAW. Retrieved November 2011. 
  75. ^ Clague, Mark (Spring 2004). "Playing in 'Toon: Walt Disney's "Fantasia" (1940) and the Imagineering of Classical Music". American Music 22 (1): 91–109. Retrieved November 2011. 
  76. ^ Holden, Stephen (May 20, 2010). "Shrek Forever After (2010)". New York Times. Retrieved November 2011. 
  77. ^ Davis, Graeme (2007). Dictionary of Surrey English. Peter Lang. p. 174. ISBN 3-03911-081-0. 
  78. ^ Ehrenberg, Victor. The People of Aristophanes. Taylor & Francis. p. 78. 
  79. ^ Knowles, Elizabeth (2006). "Buridan's Ass". The Oxford Dictionary of Phrase and Fable. Encyclopedia.com. Retrieved November 2011. 
  80. ^ Melfi, Mary. "Folk Sayings - Animals". Italy Revisited. Retrieved November 2011. 
  81. ^ Meider, Wolfgang; Stewart A. Kingsbury, Kelsie B. Harder (1992). A Dictionary of American Proverbs. Oxford University Press. pp. 231–232. ISBN 0-19-505399-0. 
  82. ^ a b "Donkey". Dictionary.com. Retrieved November 2011. 
  83. ^ "Ass". Dictionary.com. Retrieved November 2011. 
  84. ^ Long, Lynne (2005). Translation and religion: holy untranslatable?. Volume 28 of Topics in translation. Multilingual Matters. ISBN 1-85359-816-X. 
  85. ^ "Donkey Monument Destroyed in Azerbaijan". Radio Free Europe/Radio Liberty. July 5, 2011. Retrieved November 2011. 
  86. ^ Bochan, Toby. "Donkey". About.com. Retrieved November 2011. 
  87. ^ "Dumbass". Dictionary.com. Retrieved November 2011. 
  88. ^ "Jackass". Dictionary.com. Retrieved November 2011. 
  89. ^ "Glossary of Election Terms - Donkey Vote". Australian Broadcasting Corporation. Retrieved November 2011. 
  90. ^ "Thomas Nast Portfolio". Ohio State University. Retrieved November 2011. 
  91. ^ To Prevent a Donkey's Braying. The Daily Telegraph. May 30, 1895. 
  92. ^ "This mule brays to order". The New York Times. January 1, 1903. 
  93. ^ Tryon Edwards (2008). A Dictionary of Thoughts. p. 560. ISBN 978-1-4437-3017-4. 
  94. ^ Montgomery, David (July 1, 2007). "All ears: the Catalan donkey". Metropolitan Barcelona. Retrieved November 2011. 
  95. ^ WSPA и PETA обвинили Жириновского в жестоком обращении с ослом
  96. ^ The election advertisement video of Zhirinovsky beating his ass
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

American mammoth donkey

American mammoth redirects here. For the extinct elephant-like animal, see mammoth.

The American mammoth donkey, commonly known as the mammoth jack, American mammoth or American mammoth jack is a landrace of North American donkey, descended from multiple breeds of donkey imported to the United States. Breeds that influenced the mammoth jack include the Maltese donkey, Poitou donkey (itself also sometimes called the mammoth donkey), Andalusian donkey, Majorcan donkey and Catalan donkeys.[1] Males, called jacks, must be at least 14 hands (56 inches, 142 cm) and females, called jennies or jennets must be at least 13.2 hands (54 inches, 137 cm).[2][3]

Purebred and pedigreed specimens of the variety that conform to a published standard of characteristics are considered a formal breed, registered with the American Mammoth Jackstock Registry, commonly called by various names including American Mammoth Jackstock',[4] Mammoth Jack stock and Mammoth Jack. These breed designations may encompass females.

References

  1. ^ "The Mammoth Jack"
  2. ^ "Breeds of Livestock - Mammoth Jack Stock" Oklahoma State University
  3. ^ "Huge donkey welcomed at Lincolnshire animal sancturary". BBC News. 8 August 2012. Retrieved 8 August 2012. 
  4. ^ "Breed Characteristics". AMJR.us. Johnson City, Texas, US: American Mammoth Jackstock Registry. September 24, 2011. http://www.amjr.us/characteristics.htm. Retrieved 2012-03=11.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Castel Morrone donkey


The Castel Morrone donkey or Castel Morrone ass (Italian: asino di Castel Morrone) is an extinct[1] or nearly extinct[2] landrace of donkey from the area of Castel Morrone in the Province of Caserta in the Italian region of Campania. Muscular and broad-backed, the animal was widely used as a means of transport in the stony hills of the district around Castel Morrone, as well as a beast of burden.[2] It is or was characterised by large ears, a large-ish head, long hooves, and a blackish-grey coat with tawny markings around the eyes.[2]

References

  1. ^ ‘Razze Asini: Razze italiane minori’, Agraria.org.
  2. ^ a b c ‘I Biotopi’, Comune di Castel Morrone.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Andalusian donkey


The Andalusian donkey or Cordobes donkey is a formal breed of donkeys native to the province of Córdoba in Andalusia, Spain, and is also called the Lucena donkey because of its alleged origin in the town of Lucena, Córdoba is its origin. It is considered the oldest of the European breeds, at some 3,000 years, and today is rare.

Features

It is a large breed in which males may reach 1.6 metres (5.2 ft) in height at the withers, and females 1.5 metres (4.9 ft). Its head is medium-sized, and sub-convex in profile; the neck is muscular. It has a long loin, with lean, sharp withers. Unlike other breeds of Spain, the coat is short, including that on the ears, and soft to the touch. The coat is predominantly black-gray thrush, sometimes leading to almost white. Given its origin in a semi-arid environment, it is well adapted to heat and lack of water. The Andalusian donkey is strong and sturdy, yet docile and calm. The breed spread from Córdoba to the south and center of the Iberian Peninsula.

Situation

The current state of Andalusian breed is critical. The number of purebred individuals is just over one hundred individuals, which is divided between private owners of donkeys and the conservation of ADEBA associations, which have helped keep up their numbers. Conservation plans include sparing use as work animal in the field and the forest (work which can also be done by horses), and use in rural tourism initiatives that have been followed in some places like Mijas (Málaga).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Balkan donkey

The Balkan donkey or mountain donkey is a landrace of donkey originating in the Balkans.

A herd of about 100 Balkan donkeys in the Zasavica Reserve, Sremska Mitrovica, Serbia are used to make the world's most expensive cheese, pule cheese.[1]

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Catalan donkey

The Catalan donkey (Catalan: ruc català; Eastern Catalan: [ˈruk kətəˈɫa], Western Catalan: [ˈruk kataˈla]; Equus asinus) is the local donkey of Catalonia (North eastern Spain/South eastern France). It is sometimes also called the Catalan ass.

Contents

History

The Catalan donkey is related to the donkey of Mallorca and the zamorano-llionés donkey. The breed is considered to be very old; Pliny the Elder mentioned that there were donkeys on the plain of Vic.[citation needed]

In the past the donkey was very important on farms but due to declining use and numbers the Catalan donkey was in danger of extinction. There once were as many as 50.000, but these days there are only about 500 left, of which more than 100 are outside Catalonia.

After winning several shows and contests, the Catalan donkey is called 'the best donkey in the world', especially for pulling carts and as pack animal.

It is one of the base breeds of the donkey of Mallorca and the North American donkey[1]. Its properties have contributed to improving donkey breeds elsewhere in the world.

Characteristics

  • Height: ca. 1,65 m from feet to head. It is one of the tallest kind of donkeys.
  • Weight: a full grown donkey can weigh up to 500 kg.
  • Coat: in summer short and black hair all over the body up to its mouth, white from the eyes and on the belly. In winter longer chestnut colored hair all over the body.
  • Ears: straight and pointy.
  • Food: grass.
  • Habitat: forests.

Symbolism

Slippers with a symbol of the catalan donkey.

Recently, advocats of Catalan nationalism have adopted the Catalan donkey as a symbol opposite the Toro de Osborne, typical for Castile and Andalusia.

There are also stickers for cars and scooters. A few people also do not regard the catalan donkey as a symbol of Catalonia, but only as a way to try ridicule the Castillian bull.

References

  1. ^ Jones, Diane The Mammoth Jack Windt im Wald Farm. Accessed March 2012
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Asinara donkey

The Asinara donkey or Asinara ass (Italian: asino dell'Asinara), is a rare landrace of feral, and consistently albinistic, donkey indigenous to the island of Asinara, which lies off the north-west coast of Sardinia, Italy, in the province of Sassari.[1] It is one of the seven indigenous donkey "breeds of limited distribution" listed by the AIA, the Italian breeders' association,[2] though it is not a breed in the formal sense. Alternative names include white donkey or albino donkey in English (Italian: asinello bianco or asino albino), and ainu, borricu or molenti in Sardinian.[3] It is given the sub-specific name "var. albina" by some sources,[4] thus Equus africanus asinus var. albina, but this is not recognized by taxonomic authorities.

The habitat of this rare variant of E. a. asinus is restricted to the island of Asinara (declared Asinara National Park in 1997, where the total donkey population is estimated around 90 individuals), and to the natural reserve of Porto Conte in Alghero.

References

  1. ^ "Asino dell'Asinara" (in Italian). Associazione Italiana Allevatori. 2008. Archived from the original on 2008-08-02. http://web.archive.org/web/20080802180909/http://www.aia.it/tecnico/equini/a_asinar.htm. Retrieved 2012-02-11.
  2. ^ "Il Registro Anagrafico delle razze Equine ed Asinine a limitata diffusione" (in Italian). Associazione Italiana Allevatori. n.d.. Archived from the original on 2009-06-24. http://web.archive.org/web/20090624203428/http://www.aia.it/tecnico/equini/a_ra.htm. Retrieved 2012-02-11.
  3. ^ "White Donkey". Sardegna Turismo: Tourism Promotion in Sardinia. Regione autonoma della Sardegna [Sardinian government]. 2011. Archived from the original on 22 July 2011. http://web.archive.org/web/20110722053658/http://www.sardegnaturismo.it/index.php?xsl=87&s=4504&v=2&c=3174&t=1. Retrieved 2012-03-11.
  4. ^ "Asinello bianco" (in Italian). Sardenga Foreste. Ente Foreste Sardegna [Sardinian government]. 2011. "Flora e fauna" section. http://www.sardegnaambiente.it/j/v/159?c=1581&s=15158&t=1&v=2. Retrieved 2012-03-11.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Provence donkey

The Provence donkey is a unique breed of donkey originating from the Basse-Provence, Haute-Provence and Dauphine regions of France. The breed was developed by shepherds in that region to aid them in their sheep tending duties and seasonal migrations between grazing areas.[1]

The breed is also known as the migration donkey, the Aries donkey, the Crau donkey and the Savoie donkey.[2]

Contents

Rarity

Since the invention of automobiles and trains, this breed has declined at an alarming rate. At the end of the 19th century, a census in the Provençal departments recorded 13,000 donkeys.[2] But by 1956 they were down to around 2000 donkeys. In 1993 there were only 330 recorded Provence donkeys left.[1]

Description

Provence donkeys are noted for their solid build, strong bone structure, and calm and patient temperament. Their feet are quite large for a donkey, aiding them in being very sure footed, even on rough terrain. These characteristics make them ideal for use by the shepherds who breed them.

They are gray in color - ranging from very light gray to dark gray, sometimes with pinkish hues. They must have a dark, well defined cross on their back and shoulders, and often have leg garters as well. They typically also have white around their eyes and on their muzzle, and their ears almost always have a red or brown tint.[1][3]

Males stand 120 cm to 135 cm (4714 to 53") tall and females stand 117 cm to 130 cm (46 to 51") tall by the time they are 3 years old.[3]

History

Donkeys have played an important role in the lives of shepherds in the Provence region of France. The oldest written record of these donkeys dates back to the 15th century.[2] Through selective breeding these shepherds developed a breed of donkeys specially suited for their needs. The Provence donkeys played an important role in the seasonal movement of the sheep herds. They carried food, supplies, salt for the sheep, young lambs that were born along the journey, and any other materials the shepherds needed. They were selected for their solid bone structure for carrying heavy loads, their docile temperament and good legs to carry them along the shepherds' migratory paths.[1]

The Provence Donkey Association was formed on December 22, 1992[2] by breeders and enthusiasts who wanted to promote knowledge and use of the Provence donkey, and preserve this unique breed.

On December 18, 1995[2] the French National Stud added the Provence donkey breed to its list of recognized breeds.

References

  1. ^ a b c d Longears Mall Donkey breed and history articles
  2. ^ a b c d e The Professional Handbook of the Donkey by Elisabeth Svendsen
  3. ^ a b Provence Donkey Association (Association de l’âne de Provence)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Karpass donkey

The Karpass donkey is a rare landrace of donkey native to the Karpass Peninsula of Cyprus. In 2008, a group of Greek and Turkish Cypriots organized to save the animal from extinction after several were found shot to death.[1]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ponui donkey

Ponui donkey has two related meanings:

  • A feral herd of donkeys established on Ponui Island, New Zealand. The herd is descended from three individuals released in the 1880s.
  • A formal breed of donkey derived from this herd, also known as New Zealand donkeys.

Ponui donkeys are described as small, sturdy and docile.

See also

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Poitou donkey

Poitou donkey

The Poitou donkey[1] or Poitou ass[2][3] (French: baudet de Poitou), also called the Poitevin donkey,[1] the mammoth donkey[2] or simply the Poitou, is a breed of donkey originating in the Poitou region of France. One of the largest and most distinctive donkey breeds, it is also among the rarest and least-known.[1][4] The "friendly, affectionate and docile" Poitou donkey is "the oldest breed approved in France".[5]

Contents

Rarity

The baudet du Poitou is a breed of donkey with a distinctive cadanette of shaggy, matted hair.

Although a 1977 inventory revealed only 44 baudets de Poitou worldwide, today there are an estimated 400 Poitou, but this includes non-purebred animals.[6] There may be 180 or fewer purebred Poitou in existence.[1] The American Livestock Breeds Conservancy lists the Poitou on its Conservation Priority List.[7]

Description

The baudet de Poitou is "instantly recognizable"[6] for a number of unusual characteristics that distinguish it from other asses. Its shaggy coat, called a cadanette, hangs in long cords when ungroomed because the hair is longer and softer than that of other breeds of donkey. Animals with great cadanettes of matted and tangled hair were most highly valued. Breeders prized the baudet du Poitou's traditional coat so highly that a champion jack who had lost his cadenette was excluded from placement in a class at later shows.[1][6]

The Poitou's coat is always dark brown or black. While lacking the stripes and cross-like markings on the coats of some other breeds of donkey, the Poitou should have a white underbelly, nose and rings around its eyes.[1][6]

A purebred Poitou has a more massive bone structure and a larger foot than a part-bred animal, but the shaggy coat is such a dominant trait that even a 1/8 Poitou Donkey may resemble a pure-bred. In modern times, the Poitou's coat is still considered important but less so than size and measurements. Today, many Poitou Donkeys are shorn for the purpose of hygiene, but some Poitou are allowed to grow their coats out so as to be, in the French-borrowed parlance of their husbandry, "bourailloux".[1][6]

The Poitou is also noted for its large body; the Andalucian donkey[8] is the only other European breed of donkey of comparable size. Breeders selected animals with large ears, heads, and leg joints with the intention of breeding larger and stronger mules. Today the ears of some Poitou Donkeys are so large as to lie horizontal. A standard Poitou should stand between 13.1 hands (53 inches, 135 cm) and 14.3 hands (59 inches, 150 cm) at the withers and have a large, long head on a strong neck. Its withers should be unobtrusive and the back flat and long. The croup of the Poitou should be short and it should have rounded haunches. Its feet are bigger than those of other donkeys and are covered with the same long hair as its legs.[1]

History

The baudet du Poitou "Désiré", born in M. Coulais farm at Langon (Vendée, France), was sold for 10,000 francs at Barnum Circus in 1906. It died on the boat transporting it to the United States.

As with many ancient breeds, the origins of the baudet de Poitou are somewhat obscure. The Roman Empire is said to have introduced the donkey and the practice of mule breeding to the Poitou region of France from which the baudet de Poitou takes its name. Two breeds – the Poitou donkey and a now very rare horse known as the "Mulassière" (mule breeder)[9][10] – may have been developed side-by-side for the purpose of producing mules of superior quality.[1] In the Middle Ages, owning a Poitou donkey may have been a status symbol among the local French nobility. It is not known when the Poitou Donkey's distinctive characteristics were gained but they seem to have been well-developed by 1717 when an advisor to King Louis XV described:[1]

There is found, in northern Poitou, donkeys which are as tall as large mules. They are almost completely covered in hair a half-foot long with legs and joints as large as a those of a carriage horse.

Up until shortly after World War II, the Poitou and the Mulassière were important in supplying mules to France and elsewhere in Europe as the offspring they produced were reputed to be the "finest working mule in the world"[6] and fetched a higher price. At the height of their popularity, the Poitou region produced up to 30,000 mules yearly. As mules and other draft animals were replaced with motor vehicles, there was less reason to breed Poitou donkeys and their numbers swiftly declined.[1][6]

In 2001, scientists in Australia successfully implanted a Poitou donkey embryo created by artificial insemination in the womb of a standard jenny. The procedure was done because the biological mother had joint problems and veterinarians were concerned that she might not be able to complete a pregnancy. A female foal was born strong and healthy and joined her parents as one of only three purebred Poitou in Australia.

La Maison du Baudet du Poitou at Tillauderie in Dampierre-sur-Boutonne, Charente-Maritime carries on the work of preserving and increasing the numbers of these unusual donkeys in France. In Vermont, another breeder pioneers the use of frozen semen.[11] The success of breeding programs in France and the United States has allowed Poitou donkeys to be sold to private owners.[5]

An adult bourailloux Poitou is shown here with a foal on a farm in France.

References

  1. ^ a b c d e f g h i j k Oklahoma State University
  2. ^ a b [1] Animals and Nature at naturspot.de
  3. ^ [2] Long Live the Poitou Ass
  4. ^ [3] The American Donkey and Mule Society
  5. ^ a b Action Wildlife Foundation, Inc.
  6. ^ a b c d e f g The Baudet du Poitou (Poitou Donkey). Geocities.
  7. ^ [4] American Livestock Breeds Conservancy
  8. ^ Andalucian Donkey
  9. ^ "Poitevin". Equine Kingdom. http://www.equinekingdom.com/breeds/heavy_horses/poitevin.htm. Retrieved 18 December 2007. 
  10. ^ [5] Windt im Wald Farm: Trait du Mulassier
  11. ^ [6] Hamilton Rare Breeds Association
  • Mason, I. L., World Dictionary of Livestock Breeds, Third Edition, C.A.B International, 1988.
  • Dowling, Robert and L. Alderson, Rare Breeds - Endangered Farm Animals in Photographs, Bulfinch Press, 1994.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Grubb (in Wilson and Reeder 2005) for a discussion of nomenclature (e.g., E. asinus versus E. africanus).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!