Articles on this page are available in 1 other language: Spanish (24) (learn more)

Overview

Brief Summary

Description

West Indian manatees are big, slow-moving, gentle vegetarians. They live in warm, shallow water in coastal rivers, estuaries, and lagoons. In winter, large groups of manatees sometimes congregate where warm water is being discharged from factories. Manatees feed on underwater vegetation, including algae, and sometimes graze on plants growing on shore that hang within their reach, but they never haul themselves out of the water. When they are active, they surface every few minutes to breathe, but when they are resting they can stay submerged for almost half an hour. Females produce a calf (occasionally twins) every two or three years. The calf stays very close to its mother until it is weaned, which can be as long as two years. Mother and calf communicate with squeaks and grunts.

Adaptation: "Like the maneuverable head end of upright vacuum cleaners, the ""bent"" shape of the snout and mandible of this Manatee, Trichechus manatus, is probably an adaptation to position the mouth in a way that makes lip-feeding efficient while the body behind it is more or less vertical. These animals hover buoyantly above the sea grass in their typical foraging-feeding posture, with the head tilted down and tail up."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the West Indian manatee  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. p. 34, Tenth Edition, 2 vols, Holmiae: impensis direct. Laurentii Salvii, vol. 1, 532 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

These aquatic animals may live for over 50 years and exhibit a slow reproduction rate; they reach sexual maturity at three to five years old and at most they produce a single calf every two years. Pregnancy lasts for 11 to 14 months and the calf remains dependent on its mother for up to two years (5) (9). There is no distinct breeding season but when a female is receptive, many males may surround her in a mating herd and she will often mate with more than one male (6). Manatees mainly feed on aquatic vegetation and can consume ten to fifteen percent of their body weight a day (6). Manatees in North America carry out seasonal migrations. They move to natural and industrial warm water sources in central and southern Florida in the winter, but can be found as far north as Virginia and the Carolinas when temperatures increase in the summer (6). Sirenians (manatees and dugongs) produce a large volume of gas, which is given off during the digestion of plant material and this makes them particularly buoyant, so much so that their bones are dense in order to compensate (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

The West Indian manatee (Trichechus manatus) — sometimes called the sea cow—is found along the coast of Florida and in the Caribbean. Most adult manatees are about 10 feet long and weigh 800 to 1,200 pounds, although some larger than 12 feet and weighing as much as 3,500 pounds have been recorded. These “gentle giants” have tough, wrinkled brown-to-gray skin that is continuously being sloughed off. Hair is distributed sparsely over the body. With stiff whiskers around its mouth, the manatee’s face looks like a walrus without tusks.

Christopher Columbus was the first European to report seeing a manatee in the New World. To Columbus, and other sailors who had been at sea for a long time, manatees were reminiscent of mermaids—the mythical half-fish, half-woman creatures of the ocean. Manatees are not fish, however, but marine mammals.

The manatee maneuvers through the water moving its paddle-like tail up and down and steering with its flippers. It is very agile for such a large animal, sometimes somersaulting and doing barrel rolls in the water.

The manatee often rests suspended just below the water’s surface with only the snout above water. It feeds underwater, but must surface periodically to breathe. Although the manatee can remain underwater for as long as 12 minutes, the average time is 4-1/2 minutes.

Manatees are herbivores, a term that means they eat only plants. They consume 4 to 9 percent of their body weight each day—that’s 32 pounds of plants for an 800-pound animal! To do this, manatees spend 5 to 8 hours a day eating—typically non-native water hyacinths and hydrilla, along with native aquatic plants such as Vallisneria or eelgrass.

Manatees move between fresh- water, brackish, and saltwater environments. They prefer large, slow-moving rivers, river mouths, and shallow coastal areas such as coves and bays. The animals may travel great distances as they migrate between winter and summer grounds. During the winter, manatees congregate around warm springs and around power plants that discharge warm water. During summer months, they have occasionally been seen as far north as Virginia and Maryland.

Manatees reach breeding maturity between 3 and 10 years of age. The gestation period is approximately
13 months. Calves may be born at any time during the year. Usually a single calf is born, but twins do occur. An adult manatee will usually give birth to a calf every 2 to 5 years. The low reproductive rate makes the species less capable of rebounding from threats to its survival. Newborn calves weigh 60 to 70 pounds and are 4 to 4-1/2 feet long. They nurse underwater for about three minutes at a time from a nipple located behind their mother’s forelimb. Born with teeth, calves begin eating plants within a few weeks but remain
with their mother for up to 2 years. Manatees may live for several decades.

Manatees communicate with each other by emitting underwater sounds that are audible to humans. The vocalizations, which sound like squeaks and squeals, are especially important for maintaining contact between mother and calf. One field report described a mother and her calf, separated by a flood gate, calling to each other for three hours without interruption until they were reunited.

Manatees face many threats to their survival throughout their range. Historically, they were hunted for their flesh, bones, and hide. Manatee fat was used for lamp oil, bones were used for medicinal purposes, and hides were used for leather. Hunting is thought to be largely responsible for the initial decline of the species; however, hunting is no longer allowed in countries where manatees are protected.

Today, the greatest threats to manatee survival are collisions with boats and, in Florida, loss of warm water habitat.
  • U.S. Fish and Wildlife Service, http://www.fws.gov/endangered/esa-library/pdf/manatee.pdf, accessed 21 March 2012
Public Domain

 

Supplier: Bob Corrigan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Trichechus manatus latirostris, like all Sirenians, are non-ruminant herbivores that live in loosely associated social groups (Hartman 1979). The body is massive and fusiform, resembling that of a seal. Body color is generally light to dark gray or brown. Calves are somewhat darker at birth, but lighten gradually within the first month. Adults may reach an average of 3 m (9.8 ft.) in length and 1000 kg (2,200 lbs). The largest adults grow to 4.6 m (15 ft.) and 1,620 kg (3,570 lbs) (Rathbun et al. 1990). Females tend to be larger than males of the same age. Hair is sparse, but distributed all over the entire body surface, with stiff whiskers around the face and muzzle. The upper lip is flexible and lined with bristles on both the upper and lower lip pads. The tail is large, rounded and horizontally flattened. No hind limbs are present but forelimbs are rounded and paddle-like. Females have 2 mammary glands at the axilla of each forelimb. The head is bulbous, with the small eyes set widely apart. Eyes close by contraction of a sphincter muscle around the eye. Orbits are lined with oil glands that bathe the corneas and a nictitating membrane is present. Nostrils are located on the dorsal surface of the snout. Ear openings are small, located immediately behind the eyes, and lack pinnae (USFWS 2001).Bones are massive and heavy, with the ribs and long bones of the limbs lacking marrow cavities (O'Dell 1982). A layer of blubber underlies the skin, and fat deposits are found around the intestines and muscles. Molars designed for crushing are grown continuously in the posterior portion of the jaw and move forward as old teeth wear down (Domning and Hayek 1986). Analysis of ear structure suggests that manatee hearing is not acute, and they may have difficulty in localizing sound that occurs outside of a narrow, low frequency range (Ketten et al. 1992). The brain is small in comparison to other similarly sized mammals.
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Possibly mistaken for mermaids by Christopher Columbus on a voyage to America, the West Indian manatee is a large, rotund, aquatic mammal. The tough skin is grey-brown with sparse hairs covering the body and many bristles on the muzzle (5). The front limbs are short flippers and the body tapers to a flat, paddle-shaped tail that distinguishes this species from the related dugong (Dugong dugon), which posses a fluke-like tail (6). Two subspecies of the West Indian manatee exist; the Florida manatee (Trichechus manatus latirostris) is usually larger in size than the Antillean manatee (T. m. manatus) (7). A unique feature (amongst mammals) of the manatee is the constant replacement of molar teeth; new teeth enter at the back of the jaw and replace old and worn teeth at the front (5). Recent evidence suggests that manatees may possess a unique sixth sense that enables them to detect pressure changes through sensory hairs (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Florida manatees (T. m. latirostris) are found only in the United States, although a few vagrants have been known to reach the Bahamas. Their year-round distribution is restricted to peninsular Florida because they need warm water to survive the winter. During the non-winter months (March to November), some manatees disperse to adjoining states. Along the Atlantic coast these states include Georgia (highest manatee use outside of Florida), South Carolina, North Carolina, and Virginia; one satellite-tagged manatee traveled as far north as Rhode Island (Deutsch et al. 2003), and another manatee was observed in New York (Long Island). Along the Gulf coast west of Florida, manatees are occasionally sighted in Alabama, Mississippi, Louisiana, and Texas. The source (Florida or Mexico) of the Texas manatees is not always clear, but the weight of recent genetic and other evidence suggests most are from the Florida subspecies. Major freshwater bodies utilized by manatees in Florida include Lake Okeechobee, St. Johns River, Suwannee River, Caloosahatchee River, among others.

During the warm season (March or April through October or November, depending on latitude and year), manatees disperse throughout the coastal waters, estuaries, and major rivers of Florida and some migrate to neighboring states, particularly south-eastern Georgia. Their range constricts dramatically in the winter season (December to February) when manatees seek shelter from the cold at a limited number of warm-water sites or areas in the southern two-thirds of Florida. These sites include 10 principal power plant thermal outfalls (seven on the Atlantic coast, three on the Gulf coast) and four major artesian springs (Blue Spring, springs at the head of Crystal River, Homosassa Spring, and Warm Mineral Spring) that are frequented by a large proportion of the manatee population during winter.

The Antillean Manatee (T. m. manatus) inhabits riverine and coastal systems in the tropical and subtropical Western Atlantic Coastal Zone from the Bahamas to Brazil, including the Caribbean Sea and Gulf of Mexico. Although at least one individual in the Bahamas is a known migrant from Florida (Reid 2000, 2001), the Bahamas is detailed in this T. m. manatus assessment rather than the T. m. latirostris assessment. During the past decade, populations have been confirmed in the coastal waters and/or rivers of at least 19 of the 37 countries with historical records (Table 1); a population may be extant in Haiti (Ottenwalder 1995), although in very reduced numbers if at all. Rare sightings, categorized as vagrants, have been documented in five additional countries (Debrot Gore pers. comm).

Follow the link below for Table 1: Summary of reported data by country for extant manatee populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The West Indian manatee or sea cow (Trichechus manatus) is commonly found in shallow coastal areas, but can also be found in shallow rivers, estuaries, and canals. In the United States this species is concentrated around Florida in the winter months and migrates as far north as Virginia and as far west as Louisiana in summer months. The range of this species extends through the Caribbean, along the eastern coast of Central America and the northern coast of South America as far as northeastern Brazil.

Biogeographic Regions: nearctic (Native ); neotropical (Native ); antarctica (Native ); atlantic ocean (Native )

  • FPL. 1989. "The West Indian Manatee in Florida" (On-line). Accessed November 18, 1999 at http://www.fpl.com/html/kid_manateebook.html.
  • Rathbun, G. 1990. Manatees. Pp. 525-528 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals, Vol. 4. NJ: McGraw-Hill Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Caribbean Sea, Gulf of Mexico, North East South America, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) Range encompasses rivers, estuaries, and coastal areas of subtropical and tropical areas of northern South America, West Indies/Caribbean region (but apparently never very abundant in the Greater Antilles, except perhaps Cuba, Lefebvre 1989), Gulf of Mexico (now mainly western and southwestern portions), and southeastern North America (mainly Florida).

Present range limits are similar to those known historically, but the distribution is fragmented due to areas of local extirpation (O'Shea and Ludlow 1992). Area of occupancy and abundance are apparently greatly reduced in Central and South America compared to the historical situation. Small numbers exist in the Greater Antilles but the species has not been documented in the Lesser Antilles south of the Virgin Islands since the 1700s. Sightings are rare in the Bahamas. Manatees remain relatively abundant in Belize (compared to elsewhere in Central America) and in Guyana, and they are still reasonably abundant in some areas of Mexico and on both coasts of Florida (Lefebvre et al. 1989). In Puerto Rico, manatees are most often observed in coastal areas from San Juan eastward to the east coast, (and including Vieques Island) and then south and west, past Jobos Bay, to the west coast, and about as far to the northwest as Rincon; they are concentrated in several areas, including Ceiba, Vieques Island, Jobos Bay, and Boquerón Bay, and are less abundant along the north coast, between Rincón and Dorado (USFWS 2007). Manatees are very rare (transient) in the U.S. Virgin Islands (USFWS 2007). See Fairbairn and Haynes (1982) and Hurst (1986) for information on status and distribution in Jamaica. See Lefebvre et al. (1989) for a fairly detailed overview of country by country status.

U.S. populations occur primarily in Florida (e.g., see Van Meter 1987), where they are effectively isolated from other populations by the cooler waters of the northern Gulf of Mexico and the deeper waters of the Straits of Florida (Domning and Hayek 1986). In the southeastern United States, manatees are more or less retricted to the vicinity of warm-water sites in peninsular Florida during the winter, although a few may remain year-round in Cumberland Sound, southeastern Georgia, where factory warm-water outfalls allow survival of colder winter months (Reeves et al. 1992). Occasional manatees occur in summer from Texas to North Carolina (e.g., see Schwartz 1995, Brimleyana 22:53-60, for North Carolina records). Those in Texas may be wanderers from Mexican population, but DNA analysis of an individual captured linked it to the Florida population (T. Ettel, pers. comm.). Manatees range along most of the Gulf coast of Florida but infrequently occur north of the Suwannee River and between the Chassahowitzka River and Tampa Bay. They inhabit the Atlantic coast of Florida from the Georgia coast to Biscayne Bay and the Florida Keys, including the St. Johns River, the Indian River lagoon system, and various other waterways (O'Shea and Ludlow 1992). In Florida, the most well-used wintering areas are at Crystal River, Homosassa River, Tampa Bay, Ft. Myers, Port Everglades, Riviera Beach, near Titusville, and Blue Spring (O'Shea and Ludlow 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Caribbean basin region

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Based on highest minimum counts of the manatee population in the United States, the Florida manatee (Trichechus manatus latirostris), found only in the southeastern U.S., constitutes the largest known group of West Indian manatees anywhere within the species' range (USFWS 2001). In contrast, the Antillean manatee (T. manatus manatus), which occurs in the Greater Antilles, eastern Mexico, Central America, north and northeastern South America and Trinidad (Lefebvre et al 2001) has a wider distribution area, but significantly smaller population sizes. It is suggested that Antillean manatees do not achieve larger population sizes because they are subject to poaching, incidental take in gillnets, and severe habitat loss in many areas within the range (USFWS 2001). Florida manatees are found only in the southeastern U.S., though a few have been documented in the Bahamas (Lefebvre et al 2001). When waters are warm, from approximately March - late November, some manatees travel along the east coast into Georgia, North and South Carolina, Virginia, and occasionally further north into New York and even Rhode Island (Deutsch et al. 2003). On Florida's west coast, some manatees move into Alabama, Mississippi, Louisiana and Texas during the spring and summer months (Powell and Rathbun 1984). During winter months (December - February), manatees are temperature-restricted to peninsular Florida, and their geographic range constricts to approximately the 20°C isotherm, including many warm-water refuge areas around artesian springs, power plants, and other industrial sites where thermal effluents occur. Natural refuges include Blue Spring, Crystal River, Homasassa Spring, and Warm Mineral Spring. Ten major thermal refuges around power plants have also been identified, 3 on the west coast, and 7 on the east coast (Reynolds and Wilcox 1986, 1994). The northern extent of the Florida manatee was believed to be south Florida; however, loss of habitat in south Florida, coupled with expansion of human population with consequent construction of power plants and other industrial sites that discharge warm effluents, have caused manatees to expand their wintering grounds into previously unsuitable areas.The historical ranges of T. m. latirostris and T. m. manatus may overlap along the Gulf coast of Texas where strays from Mexico and Florida sometimes co-occur (USFWS 2001). Manatees are distributed throughout the India River Lagoon. Historical accounts of manatee occurrence and movement suggest that manatees are likely to be as geographically widespread as they are at present, but are less abundant in many regions (USFWS 2001; Lefebvre et al. 2001), including the India River Lagoon.
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The West Indian manatee has a wide distribution, from the mid-Atlantic region of the United States, throughout the Caribbean Sea and Gulf of Mexico, south to coastal parts of northeastern and central-eastern South America. The Florida manatee subspecies occurs from eastern Texas to Virginia in the summer, but occupies waters of Florida and southeastern Georgia all year-round. The Antillean manatee occupies the remainder of the species range, from southwestern Texas to South America, but does not have a continuous distribution (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The average body length of an adult West Indian manatee is approximately 3 meters but some individuals can reach a length of 4.5 meters including the tail. The average weight of these manatees ranges between 200 and 600 kg, however the largest individuals can weigh up to 1,500 kg. These upper figures are unusual in manatees and females generally reach greater lengths and weights than the males of the species. Newborns measure between 1.2 and 1.4 meters and weigh approximately 30 kg. The adults are grey or brown whereas newborns are darker, a coloration they lose at about one month.

Manatees are somewhat seal-shaped with forelimbs (flippers) adapted for a completely aquatic life and no hind limbs. Lungs extend the length of the animal's body, which is important in controlling position in the water column. Hair is distributed sparsely over the body and the surface layer of skin is continually sloughing off. This is believed to reduce the build-up of algae on their skin.

(FPL 1989, Rathbun 1990)

Range mass: 200 to 1500 kg.

Average mass: 400 kg.

Range length: 4.5 (high) m.

Average length: 3 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Average basal metabolic rate: 70.0056 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 350 cm

Weight: 400000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Manatees may live as long as 60 years based on analysis of growth layers in the ear bones (Marmontel et al. 1996). Perinatal survival are rates low, with half of all carcasses recovered in Florida between 1976 - 1991 aged from 0 - 2 years of age (Marmontel et al. 1997). Survival rates increase steadily to Age 4, then remain constant (89.9%) from approximately Age 4-25 years of age (Marmontel et al. 1997).Newborns average 1.2 - 1.4 m in length (4 - 4.5 ft.) and 30 kg (66 lbs.) (O'Dell 1981). Maximum adult size is approximately 4.6 m (15 ft.) and 1,620 kg (3,570 lbs.), with females tending to grow larger than males of the same age (Rathbun et al. 1990).
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Females are larger than males.

Length:
Range: 2.8-3.5 m

Weight:
Range: 500-1,650 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Trichechus manatus differs from T. inunguis of the Amazon Basin in larger size (maximum total length of inunguis is about 280 cm), less slender proportions, wrinkled skin rather than smooth skin, less elongate flippers, and presence of nails on the flippers (nails usually are lacking in inunguis) (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Trichechus manatus latirostris
The following text was excerpted directly from the Florida Manatee Recovery Plan (USFWS 2001), with some minor revisions, condensation, and updates from the assessors.

Manatees undertake extensive seasonal migrations with seasonal distribution determined by water temperature. When ambient water temperatures drop below 20°C (68°F) in autumn and winter, manatees aggregate at natural and artificial warm-water refuges or move to southern Florida (Lefebvre et al. 2001, Weigle et al. 2001, Deutsch et al. 2003). Most artificial refuges are created by warm-water outfalls from power plants. The largest winter aggregations (maximum count of 100 or more animals) are at refuges in central and southern Florida. The northernmost natural warm-water refuges used regularly by manatees are at Crystal River on the west coast and at Blue Spring in the St. Johns River on the east coast. Most manatees return to the same warm-water refuges each year; however, some use different refuges in different years and others use two or more refuges in the same winter (Rathbun et al. 1990, Reid et al. 1991, Deutsch 2000, Deutsch et al. 2003). Many minor aggregation sites are used as temporary thermal refuges. Most of these refuges are deeper canals or boat basins where warmer water temperatures persist as temperatures in adjacent bays and rivers decline. Manatees using thermal refuges move to nearby grassbeds to feed (generally within 30 km), and may even return to a more distant warm season range during mild periods in mid-winter (Deutsch et al. 2003).

As water temperatures rise manatees disperse from winter aggregation areas. While some remain near their winter refuges, most undertake extensive travels along the coast and some move far up rivers and canals. On the east coast, summer sightings drop off rapidly north of Georgia (Lefebvre et al. 2001) and are rare north of Cape Hatteras (Rathbun et al. 1982, Schwartz 1995); the northernmost published sighting is from Rhode Island (Reid 1996, Deutsch et al. 2003). On the west coast, sightings drop off sharply west of the Suwannee River in Florida (Marine Mammal Commission 1986), although a small number of manatees are seen each summer in the Wakulla River at the base of the Florida Panhandle. Rare sightings also have been made in the Dry Tortugas (Reynolds and Ferguson 1984) and the Bahamas (Lefebvre et al. 2001; Odell et al. 1978; Reid 2000, 2001). As in winter, manatees show strong site fidelity to the same summer habitats year after year (Reid et al. 1991, Koelsch 1997, Deutsch et al. 2003).

In recent years, the most important spring habitat along the east coast of Florida has been the northern Banana River and Indian River Lagoon and their associated waters in Brevard County; more than 300 to 500 manatees have been counted in this area shortly before dispersing in late spring (Provancha and Provancha 1988, FWC unpubl.). A comparable spring aggregation area does not appear to exist on the west coast, although Charlotte Harbor was visited in the spring by almost half of the 35 manatees radio-tagged at the Fort Myers power plant in Lee County (Lefebvre and Frohlich 1986). During summer, manatees may be commonly found almost anywhere in Florida where water depths and access channels are greater than 1 m (O’Shea 1988). Manatees can be found in very shallow water. Hartman (1979) observed manatees utilizing waters as shallow as 0.4 m with their backs out of the water. In warm seasons they usually occur alone or in pairs, although interacting groups of five to ten animals are not unusual.

Migration corridors and responses by individual animals have been elaborated by long-term telemetry studies (Weigle et al. 2001, Deutsch et al. 2003). Scientists have demonstrated site-fidelity in manatees, but have also noted that individual animals adjust their behaviours to take advantage of protected areas or changes in availability of resources. For example, Buckingham et al. (1999) confirmed increased manatee use of selected sanctuary areas during times when surrounding disturbance by boats was high.

Shallow grass beds with ready access to deep channels are preferred feeding areas in coastal and riverine habitats. Manatees often use secluded canals, creeks, embayments, and lagoons, particularly near the mouths of coastal rivers and sloughs, for feeding, resting, cavorting, mating, and calving. In estuarine and brackish areas, natural and artificial fresh water sources are sought by manatees. Although manatees can tolerate a wide range of salinities (Ortiz et al. 1998), they prefer habitats where osmotic stress is minimal or where fresh water is periodically available (O’Shea and Kochman 1990). Ortiz et al. (1998) report that “manatees may be susceptible to dehydration after an extended period if freshwater is not available”.

Manatees are herbivores that feed opportunistically on a wide variety of submerged, floating, and emergent vegetation. Because of their broad distribution and migratory patterns, Florida manatees utilize a wider diversity of food items and are possibly less specialized in their feeding strategies than manatees in tropical regions (Lefebvre et al. 2000). Seagrasses appear to be a staple of the manatee diet in coastal areas (Smith 1990, Provancha and Hall 1991, Lefebvre et al. 2000). Packard (1984) noted two feeding methods in coastal seagrass beds: (1) rooting, where virtually the entire plant is consumed; and (2) grazing, where exposed grass blades are eaten without disturbing the roots or sediment. Manatees may return to specific seagrass beds to graze on new growth (Koelsch 1997, Lefebvre et al. 2000). In the upper Banana River, Provancha and Hall (1991) found spring concentrations of manatees grazing in beds dominated by manatee grass (Syringodium filiforme). They also reported an apparent preference for manatee grass and shoalgrass (Halodule wrightii) over the macroalga Caulerpa spp. Along the Florida-Georgia border, manatees feed in salt marshes on smooth cordgrass (Spartina alterniflora) by timing feeding periods with high tide (Baugh et al. 1989, Zoodsma 1991).

Breeding takes place when one or more males (ranging from 5 to 22) are attracted to an oestrous female to form an ephemeral mating herd (Rathbun et al. 1995). Mating herds can last up to four weeks, with different males joining and leaving the herd daily (Hartman 1979, Bengtson 1981, Rathbun et al. 1995). Permanent bonds between males and females do not form. During peak activity, the males in mating herds compete intensely for access to the female (Hartman 1979). Successive copulations involving different males have been reported. Some observations suggest that larger, presumably older, males dominate access to females early in the formation of mating herds and are responsible for most pregnancies (Rathbun et al. 1995), but males as young as three years old are spermatogenic (Hernandez et al. 1995). Although breeding has been reported in all seasons, Hernandez et al. (1995) reported that histological studies of reproductive organs from carcasses of males found evidence of sperm production in 94% of adult males recovered from March through November. Only 20% of adult males recovered from December through February showed similar production.

Females appear to reach sexual maturity by about age five but have given birth as early as four (Marmontel 1995, Odell et al. 1995, O’Shea and Hartley 1995, Rathbun et al. 1995), and males may reach sexual maturity at 3 to 4 years of age (Hernandez et al. 1995). Manatees may live in excess of 50 years (Marmontel 1995), and evidence for reproductive senescence is unclear (Marmontel 1995, Rathbun et al. 1995). Wild females have been documented continuing to calve into their late 30s (USGS-Sirenia, unpubl.), and a captive animal gave birth in her mid-40s (FWS, unpubl.). The length of the gestation period is uncertain but is thought to be between 11 and 14 months (Odell et al. 1995, Rathbun et al. 1995, Reid et al. 1995). The normal litter size is one, with twins reported rarely (Marmontel 1995, Odell et al. 1995, O’Shea and Hartley 1995, Rathbun et al. 1995).

Calf dependency usually lasts one to two years after birth (Hartman 1979, O’Shea and Hartley 1995, Rathbun et al. 1995, Reid et al. 1995). Calving intervals average about 2.5 years (when the calf survives to weaning), but they vary greatly among individuals and may be considerably longer depending on age and perhaps other factors (Marmontel 1995, Odell et al. 1995, Rathbun et al. 1995, Reid et al. 1995). Females that abort or lose a calf due to perinatal death may become pregnant again within a few months (Odell et al. 1995), or even weeks (Hartman 1979).

Trichechus manatus manatus
The habitat and ecology of the Antillean manatee is thought to be similar to its sister subspecies. However, given that the Florida manatee inhabits the most northern extent of the species range, behaviour and life history characteristics may be dissimilar in this tropical subspecies. Antillean manatees use rivers, lakes, coastal and inland lagoons, and coastal marine environments, including seagrass, mangrove, and coral reef ecosystems. Although they are able to survive in fresh, estuarine, or marine environments for extended periods of time, several lines of evidence indicate a dependence on periodic access to fresh water for osmoregulation (Ortiz et al. 1998, 1999; Lefebvre et al. 2001; Reid et al. 2003). As herbivores, access to aquatic vegetation is necessary for survival; seagrasses (Thalassia, Halodule, Halophila and Syringodium) appear to be favored in estuarine and marine areas. Osmoregulation and thermoregulation are behaviorally controlled by movements between activity centers. Quiet protected areas are necessary for resting and for cows with young calves; connections (travel corridors) between feeding, drinking, nursery, mating, and resting areas are very important. A discussion of the environmental factors influencing seasonal movements and migratory behavior in both subspecies is provided in Deutsch et al. (2003).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

West Indian manatees are capable of withstanding large changes in salinity and move freely between freshwater and marine habitats. They can be found in shallow rivers, canals, saltwater bays, estuaries and coastal areas. Because of their extremely low metabolic rate and absence of a thick layer of insulating body fat, they are restricted to tropical and subtropical waters.

This species may inhabit clear or muddy waters. Because of their large size, manatees prefer water reaching at least 1 to 2 meters in depth. These animals are most commonly found travelling in waters 3 to 5 meters deep and waters over 6 meters are generally avoided.

If the water is deep enough and the currents are not too strong (under 5 kilometers per hour), manatees are capable of travelling large distances upstream on inland rivers. In St. John's river, manatees live up to 200 km away from the ocean. Manatees found in the Gulf of Mexico are rarely more than a kilometer from the mouth of a river.

(FPL 1989, Rathbun 1990)

Aquatic Biomes: rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

in coastal marine, brackish, and freshwater areas, tropical and subtropical
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6766 specimens in 2 taxa.
Water temperature and chemistry ranges based on 100 samples.

Environmental ranges
  Depth range (m): 0 - 6.5
  Temperature range (°C): 25.997 - 27.443
  Nitrate (umol/L): 0.227 - 0.740
  Salinity (PPS): 35.999 - 36.403
  Oxygen (ml/l): 4.582 - 4.769
  Phosphate (umol/l): 0.063 - 0.101
  Silicate (umol/l): 1.289 - 2.334

Graphical representation

Depth range (m): 0 - 6.5

Temperature range (°C): 25.997 - 27.443

Nitrate (umol/L): 0.227 - 0.740

Salinity (PPS): 35.999 - 36.403

Oxygen (ml/l): 4.582 - 4.769

Phosphate (umol/l): 0.063 - 0.101

Silicate (umol/l): 1.289 - 2.334
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Habitat includes shallow coastal waters, estuaries, bays, rivers, and lakes; throughout most of the range, manatees appear to prefer rivers and estuaries over marine habitats (Lefebvre et al. 1989). Manatees are not averse to traveling through dredged canals or using quiet marinas. They apparently are not able to tolerate prolonged exposure to water colder than 20 C. In the north during October-April, manatees congregate in warmer water bodies (spring-fed rivers, outfalls from power plants). They prefer waters at least 1-2 meters in depth; along the coast manatees often are in water 3-5 meters deep, usually in areas lacking strong current. Except in the Greater Antilles, manatees are consistently associated with freshwater sources (Lefebvre et al. 1989). In Brevard County, Florida, the cul-de-sac shelter type was the most ecologically valuable of all shelter types (Burke 1994).

In Florida, manatees occur in freshwater, brackish, and marine environments; typical coastal and inland habitats include coastal tidal rivers and streams, mangrove swamps, salt marshes, freshwater springs, and vegetated bottoms; where feeding often occurs in shallow grass beds, with ready access to deep channels (Smith 1993). In coastal Georgia and northeastern Florida, manatees feed on smooth cordgrass (Spartina alterniflora) in salt marshes at high tide (Baugh et al. 1989, Zoodsma 1991). Manatees drink from springs and freshwater runoff sites, mating, calving, and care of young often occur in secluded canals, creeks, embayments, and lagoons (Marine Mammal Commission 1986, 1988; O'Shea and Ludlow 1992; Gannon et al. 2007).

In Puerto Rico, manatees are primarily marine but appear to depend on access to fresh water, and seagrass beds provide the primary foraging habitat (USFWS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The West Indian manatee inhabits freshwater, estuarine, and marine waters, where it can be found in near-shore waters, canals, rivers, estuaries and saltwater bays (2) (6). Antillean manatees tend to be found further from the shore than their Florida relatives, and distribution and local use patterns throughout the range are influenced by access to freshwater areas, which are used for drinking (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

n North America north of Florida, this species is mainly a migrant or irregular visitor. In Florida, manatees may migrate southward for winter; seasonal migrations of at least 530 miles (850 kilometers) to wintering areas have been documented, and migrations of 125-190 miles (200-300 kilometers) are usual along the Atlantic coast (O'Shea and Ludlow 1992).

Home range varies widely throughout the year. In summer, males may move over areas extending up to a couple hundred kilometers and tend to travel more widely than do females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The snout of West Indian manatees is bent further down than other species in this family. This may be related to the food habits of this species. West Indian manatees feed mainly on sea grasses growing on the sea floor and the orientation of the mouth aids in grasping these plants. One of the unique characteristics of manatees is their flexible split upper lip which is used to pass food to the mouth. Manatees are opportunistic feeders, eating the leaves of most plants that can be manipulated by the upper lip. Manatees may also use their flippers to dig up the roots of these plants. This variable diet is most likely necessary to meet their nutritional demands. Some manatees may also eat invertebrates and will eat fish both in captivity and in the wild.

Because of the low nutritional value of the plants consumed, manatees must graze for 6 to 8 hours a day. Each day they consume 5-10 percent of their body weight, which can be over 100 kg in a large individual. This low-nutient diet also has also contributed to the the development of low metabolic rates. Manatees can survive on 25% percent less energy than a typical mammal of similar size.

Manatees feed on abrasive plants and, as a result, their molars are continually replaced throughout life as they wear down. Hind-gut fermentation is another adaptation to the herbivorous diet of the manatee, aiding in breaking down the cellulose of the plants eaten.

(FPL 1989, Nowak 1999, Rathbun 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: The manatee's diet is mainly submergent, emergent, and floating vegetation, but the diet varies with plant availability and opportunistically may include other foods (e.g., acorns in early winter in Florida, fishes caught in gill nets in Jamaica). In Florida, the diet is not restricted to native plant species (O'Shea and Ludlow 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Manatees are non-ruminant herbivores that specialize in hind-gut fermentation. They man consume approximately 8% of body weight daily and feed for 6 - 8 hours per day (Best 1981; Hartman 1979). Manatees and are apparently unparticular in their choice of feeding sites when food is abundant, and will often continue to exploit specific areas until food resources are depleted (Best 1981; Hartman 1979).The stomach is small relative to body size. A fingerlike projection, called the cardiac gland, protrudes from the cardiac portion of the stomach and secretes most enzymes used in digestion (Best 1981). Digestive efficiencies in manatees are similar to those of terrestrial herbivores such as the horse (Best 1981). Intestines may measure up to 40 m (130 ft.) in length (Reynolds 1979).Manatees feed exclusively on submerged, emergent and floating vegetation in freshwater, brackish and marine waters, with seagrasses an important staple in the diet (USFWS 2001). They are indiscriminate feeders that ingest whatever vegetation is available, and move freely between habitats in search of food (Hartman 1979). Feeding generally occurs in shallow water 1- 4 m deep. Plants are consumed in situ or taken below the surface to be manipulated into the mouth using the foreflippers. The upper lips of a manatee are bilobed, prehensile, and covered with stiff bristles. To feed, the lobes are everted so they project forward to the food source. Upon contact with food, Lips then close laterally, the bristles grasping the food and tucking it into the mouth (Hartman 1979).In fresh water, manatees tend to favor submerged, vascular plants such as Hydrilla verticilata, Myriophyllum spicatum, Ceratophyllum demersum, Vallisneria sp. and Callisneria neotropicalis (Snipes 1984; Best 1981). In marine and estuarine habitats, algae such as Anabena, Cladophora, Enteromorpha, Gracilaria, Oscillatoria, and Spirogyra are often consumed, as well as a variety of seagrasses, especially Thalassia testudinum (turtle grass) (Best 1981, Hartman 1979). Provancha and Hall (1991) found spring aggregations of manatees feeding in seagrasses dominated by Syringodium filiforme (manatee grass) and reported an apparent preference for both Syringodium and Halodule wrightii (shoalgrass) over other seagrasses and macroalgae such as Caulerpa spp.Manatees continuously replace worn teeth. As anterior-most teeth wear and are lost, replacement teeth grow at the posterior end of the tooth row (Best 1981).Competitors: Manatees do not strongly compete with other herbivores, likely due to their flexibility in making food choices based on availability (Best 1981). Predators: Manatees have few known predators, but all members of the Sirenia have been hunted for food (Rathbun 1984; Best 1981; Domning 1978), with some populations, especially in the southern hemisphere, still noted to be at risk from poaching and subsistence hunting (IUCN 2006, Jiménez 2002; Domning 1982). A related species, Steller's sea cow (Hydrodamalis gigas), was a 25-foot kelp-feeder that inhabited the Bering Sea. It was hunted to extinction by fur seal hunters within 25 years of its discovery in 1741 (Hartman1979; Marmontel et al. 1997; Domning 1978). In Florida, evidence shows manatees were hunted by pre-Columbian societies. After Spanish occupation of Florida, the increase in human population increased hunting pressures on the manatee, heavily impacting population levels. Commercial and subsistence hunting during the 1800s also significantly reduced the population in Florida. In 1893, the State of Florida passed legislation banning the killing of manatees and they have been protected since that time (USFWS 2001). Parasites: Manatee skin supports a variety of parasitic or commensal organisms. Ectoparasites and commensals include the copepod Harpacticus pulex; Lyngbya, a blue-green algae; diatoms, balanid barnacles, protozoans, nematodes, isopods, small gastropods, and leeches (Hartman 1979). Endoparasites include digenetic trematodes and a variety of nematodes (Hartman 1979). Habitats: Manatees are habitat generalists that utilize canal systems, mangrove creeks, saltmarshes, estuaries, bays and nearshore coastal waters. They move freely between habitat types and regularly seek out fresh water sources for osmoregulation (Haubold et al. 2006; Lefebvre et al. 2001; Hartman 1979). Manatees typically inhabit waters less than 3.7 m (12 feet) in depth (Haubold et al. 2006). Hartman (1979) reported manatees in Western Florida generally inhabited depths of 1.5 - 2 meters (4.9 - 6.6 feet), and observed that manatees tended to avoid waters less than 1.5 m deep unless these areas had access to deeper waters nearby. Feeding is sometimes observed on grassflats less than 50 cm (19.7 inches.) deep. Estrous females often escape the attentions of following males by moving into waters as shallow as 60 cm (23.6 inches), with some even stranding themselves for brief periods. Hartman (1979) reported that fast moving currents, generally over 5 km/hr. (3 miles/hr.), discourage manatees from occupying certain areas. In Sebastian Inlet, currents can exceed 11 km/hr. (6.8 miles/hr.) at certain points during the day. These strong currents likely deter manatees from entering or exiting the inlet during periods of peak velocity. Rather, manatees may swim adjacent to the shoreline, or slip in or out of the Inlet during slack tides.Activity Time: Manatees are generally arrhythmic (Hartman 1979), with feeding, resting, traveling, socializing, and other activities showing no consistent differences between day and evening hours. Feeding occurs over 1 - 2 hour periods and totals 6 - 8 hours daily. Socialization among manatees is highly variable, but is apparently higher in winter when animals aggregate in warm-water refuges. Though manatees spend much of their days seeking out food; sleeping, or traveling (Best 1981), they also spend approximately 6 - 10 hours at rest with no apparent pattern their activities.
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Observations of manatee behavior show that manatees largely ignore the presence of other animals, though they are sometimes startled by them (Hartman 1979).
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: The precise number of distinct occurrences (subpopulations) is unknown. MtDNA data suggest the existence of three main lineages, which could be regarded as occurrences from the broad perspective but may be too large for most practical conservation purposes.

In Florida, where manatee distribution is well known, manatees exist as four major units that in the past have been referred to as subpopulations but today are recognized as management units rather than as discrete subpopulations, due to the high level of gene flow among the four units (USFWS 2007).

USFWS (2001) identified 26 winter aggregation sites in Florida, not counting many lesser known minor aggregation sites used as temporary thermal refuges. These do not necessarily represent distinct occurrences from the perspective of population biology, but they do help identify some of the important focal areas for manatee conservation in the northern portion of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Total adult population size is unknown but is at least a few thousand and probably is less than 10,000.

The best, current, minimum population estimate of the statewide Florida manatee population is approximately 3,300 animals, based on a single statewide count at warm-water refuges and adjacent areas in January 2001 (USFWS 2007); although surveys have been conducted more recently than 2001, the weather conditions for that particular survey were ideal and, as a result, the count from that year still provides the best minimum population estimate (USFWS 2007). However, the 2001 count is now several years old, and given ongoing mortality (see threats) the current manatee population in Florida may no longer be 3,300.

A January 2005 helicopter survey of the entire Puerto Rico coast yielded a count of 121 manatees, including 20 calves (Mignucci-Giannoni 2005). Mignucci-Giannoni (2005) speculated that the relative abundance of manatees in Puerto Rico may be between 150 and 360 individuals.

Numbers are undocumented elsewhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current data indicate the manatee population has increased slowly since the 1970s, though there are no statistically-based current estimates of abundance for the entire Florida manatee population (Haubold et al. 2006). The Florida Fish and Wildlife Conservation Commission utilizes data from rangewide, synoptic surveys which are used to calculate minimum documented abundance. Surveys have been conducted annually since 1991 and are timed to coincide with periods of extreme cold weather when manatees aggregate at warm-water refuges and can thus be easily surveyed using aircraft and observers in boats. Based on highest minimum counts, manatees are approximately equal in abundance on Florida's East and West coasts (USFWS 2001). The most recent biological status review of the manatee in Florida (Haubold et al. 2006) reported a minimum documented population size of 3,300, which reflects the Winter survey of 2001, and is the highest number of manatees ever recorded. The most recent survey, conducted in February, 2006, reported a total of 3,116 manatees in Florida. Of this, 1,642 were reported on the East coast, with 1,474 reported on the West coast (FWRI 2006 press release). Population viability analysis for the Florida manatee using derived age-specific data on reproduction and survival shows a slightly negative growth rate of -0.003, with a 44% probability that Trichechus manatus latirostris will persist as a species over 1000 years. The main factors affecting population projections are adult survival and fecundity. Marmontel et al. (1997) reported that as little as a 10% increase in adult mortality, or a 10% decrease in reproduction, would likely drive the population to extinction over 1000 years. However, this model also showed that if manatee mortality were to be reduced by 10%, slow population growth would likely occur. Four regional subpopulations of Trichechus manatus latirostris have been identified in Florida. These subpopulations consist of individuals that tend to return to the same warm-water refuges each winter, and tend to disperse similarly in the warmer months. Based on telemetry data, these subpopulations tend to have only limited exchanges (Deutsch et al 2003; USFWS 2001; Bengtson 1981) with one another, and each has somewhat distinctive population characteristics as outlined below.Figure 1. Four subpopulations of the Florida manatee with percentage estimates based on winter survey counts in each region between 1996 - 2000. Atlantic subpopulation: The Atlantic subpopulation includes all manatees occurring along Florida's east coast. During the January 2001 survey, 1447 manatees were counted. Data from Craig and Reynolds (2004) was in agreement with this estimate, and reported the population size of manatees using power plants on the Atlantic Coast during winter 2001 was 1607 (within a 95% Bayesian credible interval of 1353 - 1972) (Haubold et al. 2006). Over the most recent 10-year period, Runge et al. (2004) estimated the Atlantic subpopulation has grown 1.0% per year, but this figure is not statistically different from zero, meaning the subpopulation may have increased slowly or it may have declined slightly. What is concerning is that over the last 5 years, lower adult survival rates have been observed, suggesting that this subpopulation may be declining by approximately 3.0% each year (Haubold et al. 2006). Langtimm et al. (1998) estimated adult survival in this subpopulation to be 90.7%. While this figure may appear to represent high survival, the low reproductive rates and slow rate of population increase in manatees makes adult survival vital to population stability. The USFWS (2001) reports that adult survival below 90% in the subpopulation would be a cause for concern. St. Johns River subpopulation: The St. Johns River subpopulation utilizes the upper St. Johns River Basin and its tributaries, but occurs in a significantly smaller area, primarily south of Palatka, when winter temperatures turn cold. During the 2001 survey, 112 manatees were counted. However, observations attempting to identify nearly every individual using Blue Spring, the main overwintering site in the region, showed that at least 141 different manatees visited the spring during winter of 2001. A total of 154 manatees were counted at Blue Spring during the most recent synoptic survey in January 2005 (Haubold et al. 2006).Runge et al. (2004) reported that the St. Johns River subpopulation has shown strong growth over the last 10 years, increasing by 6.2% (95% CI: 3.7 - 8.1%) per year. Coupled with the strong growth rate are high adult survival and reproductive rates. Thus, the smallest of the four subpopulations, accounting for only 5% of the total population, is growing at the fastest rate (Haubold et al. 2006).Northwest subpopulation: The Northwestern subpopulation occurs from the Pasco-Hernando County line northward through the Florida Panhandle and includes the Gulf coast to Louisiana. During the January, 2001 survey, 377 manatees were counted (Haubold et al. 2006).Runge et al. (2004) reported that this subpopulation has grown by 3.7% (95% CI: 1.6 - 5.6%) per year from 1991 - 2001. This subpopulation is the second smallest in number and accounts for approximately 11% of the total manatee count. Its population characteristics are similar to those of the St. Johns Basin subpopulation in terms of having high adult survival rates, but reproduction seems to be somewhat lower (Haubold et al. 2006). Southwest subpopulation: The Southwestern subpopulation occurs from approximately the Pasco-Hernando County line southward to Whitewater Bay in the Everglades. During the Winter 2001 survey, 1364 individuals were counted in this region (Haubold et al. 2006).Runge et al. (2004) reported that from 1994 - 2002, the southwestern subpopulation has declined at an estimated rate of 1.1% per year (95% CI: -5.4 to +2.4%). There is somewhat greater uncertainty about survival and reproductive rates in this region, as is reflected by the relatively wide confidence interval. This population has lower estimates of adult survival than those of all other subpopulations, likely due to the combined effects of watercraft mortality and episodic mortality events caused by red tide, but possibly also due to the geographic extent of current sampling efforts (Haubold et al. 2006). Interestingly, the 2 smallest subpopulations (St. Johns River Basin and Northwest) are growing in number at rates of 6.2% and 3.7% respectively (Runge et al. 2004). Eberhardt and O'Shea (1995) estimated these growth rates are currently adequate to sustain these populations. However, the 2 largest subpopulations (Atlantic and Southwestern), which together account for 74% of the total population, are either just stable, or declining by 1-3% annually (Haubold 2006; Runge et al. 2004). The most likely cause for this lack of growth is depressed adult survival rates, reported at 90.7% for adults in the Atlantic population (Langtimm et al 1998), and as yet undetermined for the Southwest population (USFWS 2001). Model predictions presented in Haubold et al. (2006) projected future decline in both the Atlantic and Southwestern populations.Locomotion: Stabilization in the water arises from the elongate body shape of the manatee, dorsal position of the lungs, and the heavy bones of the manatee, which contribute to the animal's neutral buoyancy by acting as ballast. Most swimming activity in manatees is accomplished solely by dorsoventral undulations of the wide, rounded tail, which also serves as a rudder. Manatees are able to steer, bank, and roll simply by adjusting tail position. Newborns tend to use the flippers exclusively while swimming (Hartman 1979). Flippers are used primarily for turning, but also for precise movements, course corrections, stabilizing position, and for orientation while feeding, idling or socializing. When idling on the bottom while resting or feeding, the flippers provide the sole source of movement, with many manatees using the tips of their flippers to balance upon while resting. Manatees have often been observed "walking" along the bottom using alternating flipper movements (Hartman 1979). Swimming speeds in adults are approximately 18 - 21 strokes per minute while idling; 24 - 36 strokes per minute while cruising; and 45 - 50 strokes per minute while escaping. Average idling speeds of adults were clocked at approximately 2 - 5 km/hr. while idling; 3 - 7 km/hr. while cruising; and 18 - 25 km/hr. in flight. Fleeing sprints are generally short in duration, usually not more than 100 meters. Calves, being smaller, must stroke at a higher rate to keep pace with adults; however, observations show that cows tend to swim more slowly when accompanied by calves. (Hartman 1979).
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In the north, manatees congregate in winter (largest groups may exceed 300); otherwise they are not highly social (except close mother/calf bond and temporary aggregations of several males around an estrous female).

Die-offs associated with red tides and with unusually cold weather have occurred in Florida (Van Meter 1987).

Maximum potential rate of population increase has been estimated at 2-7% per year and is most sensitive to changes in adult survival (secondarily, subadult survival) (see O'Shea and Ludlow 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Manatees may be intermittently active day or night. In Honduras, where hunted, they were mainly nocturnal (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
28.0 years.

Average lifespan

Status: wild:
30.0 years.

Average lifespan

Status: captivity:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 56 years (captivity) Observations: Laboratory studies show that males are physiologically capable of mating when they are 2-3 years old. In the wild, however, they appear to reach full sexual maturity at the age of 9-10 years (Ronald Nowak 2003). Manatees may also feature some form of continuous tooth development (Caleb Finch 1990). One 56 year old male was still alive in captivity (Richard Weigl 2005). Another specimen was estimated to be 59 years old in the wild (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Although individuals of this species are largely solitary, mating herds form when a female is in estrus. These groups are made up of bulls pursuing the sexually receptive female. Courting bulls establish a dominance hierarchy for mating rights while the female attempts to avoid these males during most of her estrus cycle.

Females may attract up to 20 males, which pursue her for one week to one month.

Males reach full reproductive maturity between the ages of 9 and 10, but they are capable of mating as early as 2. Females are capable of reproduction at 4 to 5 years of age. Young females lack the skills necessary to raise calves and are less successful breeders. Most females breed successfully between the ages of 7 and 9. Gestation periods for West Indian manatees range from 12 to 14 months and calves are dependent on their mothers for about 2 years. One calf is produced at a time, however twins have been occasionally recorded. The inter-birth interval is 3 to 5 years, but this period may be shortened in the event of the early death of a calf. Calves nurse underwater from teats near the forelimbs. Calves are born with both molars and premolars and can begin consuming plants soon after birth, usually within the first 3 weeks.

The mother-young pair is the only stable, long-term association within the species. It has been suggested that the mother and her young can recognize each other after weaning and the association continues, to a certain extent, through the subadult years of the young. This long period of parental care might aid in the transfer of information about migration routes and other learned information.

(FPL 1989, Nowak 1999, Rathbun 1990)

Average birth mass: 32000 g.

Average gestation period: 335 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
913 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1278 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species exhibits a promiscuous mating system. Gestation lasts about 12-14 months. One young (rarely 2) is born in spring/early summer (usually). Young are weaned in 1-2 years. The interval between successive births for an individual female is 3-5 years (though 2 years if the calf is lost early). Females are sexually mature at a minimum age of 4-5 years, though newly mature individuals often do not successfully rear young; most females breed successfully by 7-9 years. Males may be 9-10 years old before they breed, though they may attain physical maturity a few years earlier. Maximum longevity is several decades. See O'Shea and Ludlow (1992) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Manatees have an approximately 1:1 sex ratio and low reproductive rates. Males mature at 2 - 3 years of age, while females first become pregnant at 3 - 5 years of age. Most produce a calf by Age 7 (USFWS 2001; Garcia-Rodriguez et al. 1998; Marmontel 1995). Females produce 1 calf every 2 - 3 years, with twins occurring approximately 2% of the time. Cows that lose calves tend to come into estrous faster than those feeding calves. Females continue to produce calves into at least their thirties (Haubold et al 2006; Marmontel 1995), with observations of some captive cows giving birth at older ages. Cohesive social interactions among manatees occur only in mating herds, which typically consist of a female in heat being pursued by courting bulls. Herds may persist up to 4 weeks with different males cycling in and out of the herd daily (Haubold et al. 2006; Rathbun 1999; Rathbun et al. 1995). Hartman (1979) observed one estrous herd on Florida's West coast consisting of a single female and as many as 17 mature bulls that constantly pursued her. Juvenile males in the population joined and exited the pursuit at various times as well. Bulls generally are tireless while courting a female, constantly embracing or mouthing her as she swims. The constant harassment often leads females to swim into very shallow water, where they are known to beach themselves to avoid the attention of males. Rathbun et al. (1995) suggested that older, larger males dominate access to females in mating herds and are responsible for the majority of pregnancies. Breeding is reported in all seasons, and successive copulation frequently occurs. However, peak sperm production (as analyzed in recovered carcasses) occurs primarily from March through November. Only 20% of adult males showed evidence of sperm production from December - February (Hernandez et al. 1995). Marmontel et al. (1997) calculated the gross annual recruitment rate of manatees in Florida as 8% using the following formula: (# females in population) X (% mature females) X (Annual pregnancy rate). Life tables reported in this study indicated approximately zero population growth with a net reproductive rate of 1.09, and a finite rate of increase of 0.005, which is not statistically different from zero (Marmontel et al. 1997). Further, the authors suggested that manatee survival in Florida did not follow the pattern observed in other large mammals species, but rather resembled survivorship curves calculated in exploited populations.
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

The gestation period in manatees lasts 11 - 14 months (USFWS 2001; Rathbun et al. 1995; Hartman 1979). Most calves are born from May through September, but young calves are observed throughout the year (Hartman 1979). Newborns average 1.2 - 1.4 m (4 - 4.5 ft.) in length and 30 kg (66 lbs.) (O'Dell 1981). Survival rates are low among the youngest calves, with half of all recovered carcasses (n = 1,212) from 1976 - 1991 belonging to Age Classes 0, 1 and 2 (Marmontel et al. 1997).Metabolism: In comparison to other large mammals, manatees have fairly low basal metabolic rates that measure only 36 - 50% those of similarly sized terrestrial mammals. This is perhaps the lowest weight-specific metabolic rate for any mammal known (Irvine 1983; Best 1981; Scholander and Irving 1941). Irvine speculated that low basal metabolism in the manatee may be an ecological adaptation of a large, tropical animal to a relatively low-quality food source.
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trichechus manatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1727-08|AM904728|Trichechus manatus| AATCGTTGATTATTCTCAACCAATCACAAAGATATTGGCACCCTGTATTTACTATTCGGCGCTTGAGCCGGAATGGTAGGAACTGCTCTG---AGCATTCTAATTCGGGCCGAATTAGGCCAGCCCGGCACCCTCCTGGGAGAT---GATCAAATCTACAATGTCATCGTAACAGCCCATGCCTTCGTAATAATTTTCTTCATGGTTATGCCCATCATAATCGGAGGATTTGGGAACTGACTAGTCCCTCTAATA---ATTGGAGCCCCCGACATGGCGTTCCCCCGAATAAATAATATGAGCTTCTGACTCCTACCTCCATCATTTCTACTCCTTCTAGCCTCATCTATAATTGAAGCTGGGGCTGGAACAGGCTGAACAGTCTACCCACCTCTAGCTGGGAACCTAGCCCATGCCGGAGCCTCGGTAGATCTG---ACTATCTTCTCGCTCCATCTGGCTGGAGTATCTTCAATTCTAGGGGCTATTAACTTTATCACTACAATTATCAACATGAAACCTCCAGCCATATCTCAATACCAAACTCCCCTGTTTGTCTGATCTGTTCTAGTCACAGCCGTCCTTCTTCTTCTGTCCCTCCCAGTTCTAGCAGCA---GGAATCACTATACTCCTGACGGACCGCAACCTAAACACTACCTTCTTTGACCCGGCTGGAGGGGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGGCACCCTGAAGTGTACATTCTTATCCTACCCGGCTTCGGTATAATTTCACACATCGTCACTTATTATTCAGGTAAAAAA---GAACCATTCGGTTATATAGGTATGGTTTGGGCCATAATGTCTATCGGCTTTCTCGGTTTCATCGTATGAGCTCATCATATATTCACCGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trichechus manatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
Deutsch, C.J., Self-Sullivan, C. & Mignucci-Giannoni, A.

Reviewer/s
Reynolds III, J.E. & Powell, J.A. (Sirenia Red List Authority)

Contributor/s

Justification
Listed as Vulnerable because the number of mature individuals is currently estimated to number less than 10,000 (based on combined population estimates for the Florida and Antillean subspecies) and is expected to decline at a rate of at least 10% over the course of three generations (given a generation time of ~20 years) as a result of both habitat loss and anthropogenic factors.

Trichechus manatus latirostris: EN C1:
The Florida manatee subspecies is listed as Endangered on the basis of a population size of less than 2,500 mature individuals and the population is estimated to decline by at least 20% over the next two generations (estimated at ~40 years) due to anticipated future changes in warm-water habitat and threats from increasing watercraft traffic over the next several decades.

Trichechus manatus manatus: EN C1:
The Antillean manatee subspecies is listed as Endangered because the current population is estimated at less than 2,500 mature individuals and is predicted to undergo a decline of more than 20% over the next two generations (estimated at ~40 years for an unexploited population, based on T. m. latirostris data) without effective conservation actions, due to current and projected future anthropogenic threats (habitat degradation and loss, hunting, accidental fishing-related mortality, pollution, and human disturbance).

History
  • 2007
    Vulnerable
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

While manatees have no natural predators, their numbers are threatened by human activities. Because of their low reproductive rate, it is difficult for the species to rebound from a decline in numbers. Although the population in Florida has historically been hunted by Native Americans and, later, by the European inhabitants, it was never the victim of commercial hunting. In other parts of their range West Indian manatees have been exploited commercially and, in some cases, this continues. Although protection laws exist in countries such as Costa Rica and Venezuela, illegal poaching still occurs.

One of the main causes of manatee mortality is collisions with motorboats. Manatees are also killed in canal locks and found entangled in fishing nets. They are also threatened by the loss of (or damage to) sea beds due to agricultural and industrial runoff. These same pollutants have been shown to accumulate in the tissues of manatees and some could be toxic to the animals.

Manatee conservation efforts were initiated as early as the eighteenth century, when the English established Florida as a marine sanctuary for the species. In 1893 a state law was established to protect manatees. At the start of the twentieth century fines were established for the killing of a manatee. Manatees are now protected by the U.S. Marine Mammal Act (1972), the U.S. Endangered Species Act (1973), and the Florida Manatee Sanctuary Act (1978).

(Marsh 1994, Oshea 1998, Reynolds 1995, FPL 1989)

US Federal List: endangered

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Small range in coastal areas from the southeastern U.S. to northeastern South America; population size probably not much larger than a few thousand adults; high mortality rate, often a result of boat collisions (Florida, Puerto Rico) and hunting (elsewhere); threat from boat collisions is increasing despite improved regulations; low reproductive rate; population stable or possibly increasing in Florida and Puerto Rico, but a good estimate of the population in Florida is now several years old, status and trend poorly known elsewhere.

Intrinsic Vulnerability: Highly vulnerable

Comments: Reproductive rate is very low; a healthy adult female produces just one calf every three years.

Other Considerations: This species benefits from some human disturbances, such as thermal pollution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/11/1967
Lead Region:   Southeast Region (Region 4) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Trichechus manatus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1). Listed on Appendix I of CITES (3) and Appendix I of the Convention on Migratory Species (CMS or Bonn Convention) (4). Subspecies: Florida manatee (T. m. latirostris) classified as Endangered (EN), Antillean manatee (T. m. manatus) classified as Endangered (EN) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

# Florida Manatee (T. manatus latirostris) and Carribbean Manatee (T. manatus manatus) are Endangered. Both the parent species and the Florida Manatee, T. manatus latirostris, are Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Trichechus manatus latirostris
The Florida Fish and Wildlife Conservation Commission (FWC) recently conducted two Biological Status Reviews of the Florida manatee that involved comprehensive compilation and synthesis of population and range data, along with extensive modeling of population projections (FWC 2002, 2003; Haubold et al. 2006). In addition, the Manatee Population Status Working Group of the Florida Manatee Recovery and Implementation Team has produced a comprehensive Biological Population Assessment (MPSWG 2005).

There are no statistically based estimates (with variance) of abundance for the entire Florida manatee population. The minimum documented abundance is determined from range-wide synoptic surveys which have been conducted nearly every winter since 1991. The surveys are timed to coincide with periods of extreme cold weather when manatees aggregate at a limited number of warm-water sites. The highest count obtained during these surveys was 3,300 manatees in January 2001 (Haubold et al. 2006); this is presumed to be a minimum count, but the fraction detected is unknown. Based on the assumption of a stable age distribution, and estimating proportion mature to be 0.70 from the core biological population model, the estimated number of mature individuals in the population is 2,310. Because detection probability varies greatly with weather conditions and across sites, population experts have consistently cautioned against using these data for trend analyses.

Long-term studies of the Florida manatee indicate that there are four relatively distinct regional subpopulations, as recognized in the Florida Manatee Recovery Plan (USFWS 2001). Each subpopulation comprises individuals that tend to return to the same warm-water refuges each winter and have similar non-winter distribution patterns. Exchange of individuals among subpopulations is considered to be relatively limited, based on data from telemetry (Rathbun et al. 1990, Weigle et al. 2001, Deutsch et al. 2003) and photo-identification (Rathbun et al. 1990, Reid et al. 1991, FWC and USGS, unpubl.). The four subpopulations differ in abundance, demographic rates, habitats, and major threats. What follows is a summary of our understanding of their rates of population growth over the past decade and very brief statements on the status of each subpopulation. Minimum population sizes are provided by the high synoptic survey count of 5 to 6 January 2001 (FWC unpubl.). Population growth rates cited below were estimated by Runge and colleagues (2004) using a stage-based model that integrated mark-recapture estimates of survival and reproduction (Kendall et al. 2004, Langtimm et al. 2004). The estimates of vital rates were made possible through a long-term, multi-agency effort to photographically identify individual manatees based on their distinct patterns of scars and mutilations (Beck and Reid 1995).

Atlantic Subpopulation:
The Atlantic Coast subpopulation extends along the entire east coast of Florida (including the Florida Keys and Florida Bay), coastal states northward along the Atlantic seaboard, and the lower St. Johns River north of Palatka. A total of 1,444 manatees were counted in the Atlantic region during the 2001 synoptic survey. Craig and Reynolds (2004) estimated that the population size of manatees using power plants on the Atlantic Coast during winter 2001 was 1,607 (95% Bayesian credible interval: 1,353 to 1,972). Over the most recent 10-year period, Runge et al. (2004) estimated that the Atlantic subpopulation had grown at an annual rate of 1.0% per year (95% CI: -1.2 to 2.9%), but this was not statistically different from zero. The subpopulation may have increased slowly or it may have declined slightly over this time period. Craig and Reynolds (2004) used a Bayesian approach to model growth in aerial counts of manatees at several major aggregation sites along the Atlantic coast (primarily power plants). This model took into account manatee movement between surveys and variation in detection rates with ambient temperature. The trends in counts suggest the population of animals using Atlantic power plants increased at a rate of 5 to 7% per year from 1982 to 1989, leveled off (growth rate 0 to 4%yr-1) between 1990 and 1993, and has been increasing at about 4 to 6% per year since 1994. The discrepancy in growth rates of these two modeling approaches needs further investigation to provide a better understanding of population trends along the Atlantic coast.

Upper St. Johns River Subpopulation:
The Upper St. Johns River subpopulation occurs in a much smaller area in the river south of Palatka. A total of 112 manatees were counted during the 2001 synoptic survey, but intensive observations that facilitate identification of nearly every individual using Blue Spring, the main overwintering site in the region, indicate that at least 141 different manatees visited the spring during that winter. A total of 190 manatees were counted at Blue Spring during a synoptic survey in 2006. The subpopulation occupying the Upper St. Johns River has shown strong growth over the past decade, increasing at an annual rate of 6.2% (95% CI: 3.7 to 8.1%) based on the stage-based model. This growth rate is supported by high survival and reproductive rates. This is the smallest of the four subpopulations, contributing less than 5% to the maximum synoptic count, but it is growing the fastest.

Northwest Subpopulation:
The Northwest subpopulation extends from the Pasco-Hernando County line along the central Gulf coast northward through the Florida Panhandle and including the coastal areas of adjoining states at least as far as Louisiana. A total of 377 manatees were counted in the Northwest region during the 2001 synoptic survey. This subpopulation has grown at an annual rate of 3.7% (95% CI: 1.6 to 5.6%) over the past 10 years. This is the second smallest subpopulation, accounting for about 11% of the highest synoptic count. Its dynamics are similar to those of the USJ, with a high adult survival rate, except reproduction seems to be lower.

Southwest Subpopulation:
The Southwest subpopulation extends from the Pasco-Hernando County line (north of Tampa) southward to Whitewater Bay (part of Everglades National Park) in Monroe County. Minimum subpopulation size from the high synoptic survey count in 2001 was 1,367 individuals for the Southwest region. This subpopulation has declined at an estimated rate of -1.1% per year (95% CI: -5.4 to +2.4%) over the most recent eight-year period. The relatively wide confidence interval reflects greater uncertainty about survival and reproductive rates in this region, in part due to a shorter time series of sight-resight data. Estimates of adult survival are lower than those of all other subpopulations, probably due to the combined effects of chronic human-related (watercraft) mortality and episodic mortality events caused by red tide. It should also be noted that manatees in the Southwest subpopulation are found in a broad diversity of habitats from the more developed Tampa Bay to the more pristine reaches of Everglades National Park; demographic data are lacking for individuals in the southernmost parts of the region. Temporary emigration outside of the study areas may result in a downward bias in survival rates.

FWC has a wide-reaching manatee carcass salvage and necropsy programme that recovers nearly every dead manatee reported in the state of Florida. Consequently, we have a long time series of excellent data on causes of death. In all of the four subpopulations, adult mortality is mostly attributable to human-related causes, primarily watercraft collisions. However, because of the lower survival rates in the Atlantic and Southwest subpopulations, the impact of this anthropogenic mortality on population growth is much greater than in the other two regions. For the immature age class, perinatal mortality is the most common “cause” and watercraft collisions is the next highest known cause of death for all subpopulations (see Major Threats).

It is clear that the two smallest subpopulations have been growing over the past decade, while the two largest subpopulations have grown slightly, not at all, or may be declining. Available data suggest that the Southwest subpopulation is in decline. One way to estimate the overall growth rate for the Florida manatee is to take an average of the four subpopulation's growth rates, weighted by relative size. This yields a point estimate of 0.6% per year. Confidence intervals do not incorporate our uncertainty in the relative sizes of the subpopulations. That is, this point estimate assumes that the sighting detection rate in the synoptic survey was the same in each region in 2001, which is very unlikely, and that weights have remained constant over time. So, while the available data suggest that the point estimate of population growth for this subspecies may be close to zero or slightly positive, the associated uncertainty means that the population could be declining or increasing slightly.

Population Projections: FWC used population viability analysis models to address the three criteria that involved the probability of future population decline or extinction (FWC 2002, 2003; Haubold et al. 2006). The models were based on vital rate estimates for each of four subpopulations and they incorporated demographic and environmental stochasticity. The models simulated scenarios based on plausible future threats to manatees and their habitat, including expected declines in carrying capacity through loss of warm-water refugia (loss of power plant discharges, declines in spring flow), potential increases in mortality (mostly due to watercraft collisions) associated with projected human population growth, and natural catastrophic mortality events (red tide, cold, disease). The outcome of the most recent PVA model was that there is a 12.1% chance of a 50% decline in the next three generations (generation time estimated between 16.8 and 22.6 years), and a 55.5% chance of a 20% reduction in the next two generations (Criterion C1) (Haubold et al. 2006). For details, peer reviews, and a fuller discussion of these results, assumptions, limitations, and conclusions, please see the FWC’s Biological Status Reviews of the Florida manatee.

Trichechus manatus manatus
There are no statistically derived population estimates for T. m. manatus within its range, which historically covers 41 countries in the Wider Caribbean Region. Peer-reviewed publications are sparse, but there has been a significant increase in research on Antillean manatees over the past 10 years, resulting in many theses, presentations at regional meetings, local reports, and adoption of management plans.

We compiled data gathered through an extensive literature review and personal communication with 45 scientists representing expertise in 29 countries, but exclusive of the Florida manatee population (which was assessed independently). Antillean manatee populations occur in 20 of the 37 countries assessed, with sightings of vagrants in additional countries. However, distribution is not continuous and populations are patchy and fragmented. Using these documents, supplemented by the questionnaires completed by local experts, we derived a very rough minimum population estimate for the subspecies. Our confidence in population estimates varies dramatically from country to country, depending on the nature and extent of recent research efforts. For that reason, we used orders of magnitude in an effort to establish some baseline population estimates for each of the 20 countries where populations are most probably extant and viable. Although the quality and quantity of data vary from country to country, there is consistency regarding a continuing decline in both manatees and the quality and quantity of available habitat.

Estimates by country, based on the best available data, range from less than 10 up to ~1,000 total animals, with the largest populations reported from Mexico and Belize (Table 1). No country reports an increasing country-wide population (except Bahamas with less than 10 animals). All publications and personal communications indicate country-wide populations are declining, stable, or unknown. In a few countries, localized populations may be increasing; in most countries, reports indicate a significant decline over the past 30-50 years, but this is based solely on anecdotal evidence and/or interviews with local people.

While the data in Table 1 suggest that approximately 2,600 individuals exist, scattered widely through the Caribbean region, optimistic "estimates" of the size of the manatee population (also based on interviews with experts in different countries, and not necessarily on empirical data) suggest that it may actually be in the range of 5,600 individuals. The age structure of the various manatee subpopulations of T. m. manatus is unknown, but the percentage of mature animals in Florida was estimated to be 70% through population modeling (Haubold et al. 2006) and 46% through carcass recovery (Hernandez et al. 1995, Marmontel 1995, Marmontel et al. 1997). The figure based on carcasses is biased low due to the presence of a large proportion of calves in the sample. We note that hunting and other threats in the Caribbean may lead to a very different age structure for T. m. manatus than for T. m. latirostris; in fact, if hunters target large (i.e., mature) manatees, the percentage of mature individuals for T. m. manatus could be substantially lower than is the case for T. m. latirostris. Therefore, we consider that the percentage of mature individuals for the Antillean subspecies is likely to lie somewhere between 46% and 70%.

Based on the above information, we feel it is likely that the actual population size is intermediate between the number counted (2,600; minimum population size) and the more optimistic suggestions (5,600); an average between those two numbers would place the actual population size at approximately 4,100 manatees. Using this average value, and the two percentages given above for mature animals, the number of mature individuals would therefore lie between 1,886 and 2,870. Selecting the average value between these numbers produces an estimate of 2,378 mature individuals. While we do not place much significance in these average values, it is reasonable to conclude - based on the available evidence and taking the precautionary approach - that the overall number of mature individuals in this subspecies is likely to be less the 2,500.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10-25% to decline of 30%

Comments: Current information suggests that the Florida manatee population (subspecies latirostris) is growing (USFWS 2007), but the latest good population estimate is from 2001. The Antillean manatee population (subspecies manatus) in Puerto Rico, while not as well studied as the Florida manatee, is also thought to have increased over the past 40 years and is now stable or slowly increasing (USFWS 2007). Little is known about trends in areas outside U.S. jurisdiction (USFWS 2007).

Based on status and trend information primarily from Florida and secondarily from Puerto Rico, USFWS (2007) concluded that the West Indian manatee no longer meets the definition of an endangered species. However, because of the threats of potential habitat loss and watercraft collisions and the concerns regarding the adequacy of regulatory mechanisms associated with those threats, USFWS (2007) stated that the West Indian manatee should be classified as threatened.

Global Long Term Trend: Decline of 30-50%

Comments: Over the long term, extent of occurrence has not changed much, but population size and habitat quality presumably have declined to a large but undetermined degree.

In Florida, the overall range has not changed over the long term, but the winter range has shifted from one based solely on natural warm waters to one based primarily on warm-water outlets of power plants (almost two-thirds of population) (USFWS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Trichechus manatus latirostris
Threats to the Florida manatee encompass catastrophic natural events and anthropogenic factors that could cause declines in reproductive and survival rates or declines in the carrying capacity of the environment. Much of the following text is modified from the Biological Status Reviews for the Florida manatee (FWC 2002, Haubold et al. 2006).

Anthropogenic Threats
About half of adult mortality rangewide is attributable to human-related causes, primarily watercraft collisions (Ackerman et al. 1995, Deutsch et al. 2002). This is significant because the manatee population growth rate is highly sensitive to changes in adult survival rate (Eberhardt and O’Shea 1995, Marmontel et al. 1997, Runge et al. 2004). The future of the Florida manatee is also jeopardized by the predicted loss and deterioration of warm-water habitat, including retirement or deregulation of aging power plants and reduction in natural spring flows.

Watercraft collisions: Watercraft collisions account for approximately 25% of all manatee deaths and 35% of documented deaths of known cause, and are the single greatest cause of human-related mortality (Ackerman et al. 1995, Wright et al. 1995, FWC-FWRI unpubl.). In 2005, there were over one million registered vessels in Florida (FHSMV, http://casey.hsmv.state.fl.us/Intranet/dmv/TaxCollDocs/vesselstats2005.pdf), and many more out-of-state boaters visit Florida annually. The number of registered vessels in Florida has increased by an average of 2.9% per year over the past 25 years, doubling since 1980 (FWC, unpubl.). Given that about 97% of registrations are for recreational watercraft (Wright et al. 1995), it can be expected that there will be a continued increase in recreational vessels plying the waterways of Florida with a concomitant increase in the human population. In addition to the expected increase in boat numbers over the coming century, there are other factors that may act synergistically to increase the risk of collisions between manatees and watercraft. Modifications to the design of vessel hulls and engines are allowing boats to travel at higher speeds in shallower waters (Wright et al. 1995), thus threatening manatees and scarring seagrass beds. Boater compliance with existing slow speed zones is inconsistent (Gorzelany 1998, Shapiro 2001).

Sub-lethal effects on manatees of increased vessel traffic and a growing human population in the coastal zone are cause for concern. Most adult manatee carcasses bear scars from previous boat strikes and the healed, skeletal fractures of some indicate that they had survived previous traumatic impacts (Wright et al. 1995, Lightsey et al. 2006). Of over 1,000 living individuals in the manatee photo-identification database (Beck and Reid 1995), 97% had scar patterns from multiple boat strikes (O’Shea et al. 2001). Approximately one-third of these individuals were severely mutilated, especially on the tail and the dorsum. It should be noted that the photo-identification database contains only animals with scars or other identifiable features. Non-lethal injuries may reduce the breeding success of wounded females and may permanently remove some animals from the breeding population (O’Shea 1995, Reynolds 1999). Vessel traffic and recreational activities that disturb manatees may cause them to leave preferred habitats and may alter biologically important behaviours such as feeding, suckling, or resting (O’Shea 1995, Wright et al. 1995).

Loss of Warm-water Habitat: Expected changes in the network of warm-water refuges over the next several decades present the most serious long-term threat to manatees in Florida, as noted in the federal Recovery Plan: “one of the greatest threats to the continued existence of the Florida manatee is the stability and longevity of warm-water refuges” (USFWS 2001, p. 28). Ultimately, the discharges from power plants provide unreliable warm-water habitat when viewed over the long term (i.e., next 20 to 100 years) because the once-through cooling technology that creates the large thermal plumes is being replaced by more efficient and alternative cooling technologies (Laist and Reynolds 2005a). Short-term threats to the network of warm-water sites also loom on the immediate horizon. Some aging power plants may be shut down and potential deregulation of the electric utility industry may eliminate or reduce the reliability of warm-water effluents that large numbers of manatees depend on to survive winter cold periods (Rose 1997, U.S. Fish and Wildlife Service 2000). Temporary disruptions in heated effluents during winter have caused changes in local manatee distribution (Packard et al. 1989) and have been implicated in elevated numbers of deaths from cold stress (Campbell and Irvine 1981, Ackerman et al. 1995). The complete elimination of a secondary warm-water refuge in northeastern Florida through diffusion of the heated effluent resulted in a shift in manatee distribution within the area and in substantial mortality of manatees that remained in the region (Deutsch et al. 2000, Laist and Reynolds 2005a). Loss of certain key warm-water sites could result in catastrophic mortality and would likely reduce the environmental carrying capacity for manatees in Florida.

The long-term reliability of artesian springs that provide natural warm-water refuges for manatees is also in doubt because human demand for ground water and loss of recharge areas through development will likely result in diminished spring flows (Reynolds 2000, Laist and Reynolds 2005a). According to the U.S. Census Bureau (2001), Florida’s human population increased by about 23% to 16 million between 1990 and 2000, and projections suggest that the number of people living in Florida will increase by another 10 million people by 2025. In order to meet the increased demand for water that a growth in human population will entail, it is likely that spring flows and water quality will decline, further reducing natural warm-water habitat for manatees. This natural habitat will become even more important in the future as existing industrial sites disappear.

Other Direct Threats to Manatees from Human Activities: Other threats from human activities include entanglement (in fishing gear or debris), entrapment in water-control structures and pipes, exposure to contaminants, incidental ingestion of debris, and crushing (in flood-control structures, in canal locks, or between large ships and docks) (Beck and Barros 1991, Ackerman et al. 1995). Indirect effects from increased vessel traffic include increased water turbidity from wake action and scarring of seagrass beds by propellers (Sargent et al. 1995).

Indirect Threats to Manatees from Human Activities: There is no commercial or subsistence utilization in the USA. However, manatees have become the centre of a large ecotourism industry at certain winter aggregation sites, such as Crystal River. Tens of thousands of people visit these areas to observe and swim with manatees. No-entry sanctuaries provide manatees with havens to avoid swimmers and boats at these sites. Manatees do, in fact, increase their use of these sanctuaries when more boats and swimmers are present (Buckingham et al. 1999, King and Heinen 2004). Manatees also have been found to alter their behaviour in response to the presence of human swimmers, including decreased resting and suckling and increased swimming (King and Heinen 2004).

The tremendous growth in the human population in coastal Florida over the past half century has resulted in drastic losses of coastal wetland habitats. Seagrass distribution and abundance in many estuaries have declined as the result of direct human impacts (dredging and propeller scarring) and indirect effects of development (declining water quality and nutrient loading). Within Tampa Bay, for example, an estimated 80% of the seagrass present in the early 1900s was lost by 1980 (Kurz et al. 2000). This decline in seagrass coverage is slowly being reversed through actions to reduce nitrogen loading in the regional watershed, which have improved water clarity in much of Tampa Bay (Johansson and Greening 2000, Kurz et al. 2000). Non-point-source runoff is difficult to control, however, so water clarity declines in years of above-average precipitation. Reductions in optical water clarity cause declines in the health and abundance of submerged aquatic vegetation (Stevenson et al. 1993). Indirect effects from increased vessel traffic include increased water turbidity from wake action and scarring of seagrass beds by propellers (Sargent et al. 1995). It will be particularly important to protect, restore, and maintain aquatic vegetation communities in the vicinity of warm-water aggregation sites. Without conservation measures to secure these winter habitats, manatees would have to travel greater distances, concentrate into smaller areas, and forage in sub-optimal environments.

Natural Threats
Naturally-occurring catastrophic threats to manatees include prolonged periods of very cold temperatures, hurricanes, harmful algal blooms (i.e., “red tide”), and the potential for a disease epizootic. The threat from extended periods of cold weather relates to the availability and quality of warm-water habitat, which has already been discussed above.

Hurricanes: Hurricanes are another type of weather-related phenomenon that can potentially impact manatee populations. In the Northwest subpopulation, Langtimm and Beck (2003) found that adult survival rate was depressed in years with severe storms or hurricanes. The mechanism(s) underlying the lower survival probabilities are unknown, as there has not been a corresponding elevation in the number of reported carcasses. Such events could also result in large-scale emigration out of the affected region. In eastern Australia, for example, the simultaneous occurrence of flooding and a cyclone, combined with poor watershed management practices, resulted in the loss of 1,000 km² of seagrass beds and in the mass movement and mortality of dugongs (Dugong dugong; Preen and Marsh 1995). Given the notice from meteorologists that we have entered a new 25- to 50-year cycle of greater hurricane activity and intensity (Landsea et al. 1996), as well as possible longer-term changes associated with global climate change (McCarthy et al. 2001), storm activity may have a greater impact on manatee populations in the future.

Red Tide: Manatees on Florida’s Gulf coast are frequently exposed to brevetoxin, a potent neurotoxin produced by the dinoflagellate Karenia brevis during red tide events. In 1996, 151 manatees were confirmed or suspected to have died in southwestern Florida from brevetoxicosis (Landsberg and Steidinger 1998, Bossart et al. 1998). This epizootic was particularly detrimental to the manatee population because more adults were killed than any other age class. Other red tide mortality events in 1982, 2002, 2003, and 2005 resulted in the confirmed red tide-related deaths of 37, 33, 86, and 68 manatees, respectively, with an additional 35 carcasses suspected to have died from red tide during those years (O’Shea et al. 1991; FWC unpubl.). Recent studies have determined that brevetoxin can exist outside of the algal cells (e.g., on seagrass) for extended periods of time, thus further increasing the threat to foraging manatees (Flewelling et al. 2005). Red tide represents a major natural source of mortality for manatees in the southwest region. There is no clear evidence that these events have been increasing in frequency along Florida’s coast, but certainly the impact on the manatee population has increased over the past two decades. The role of nutrient loading to coastal systems relative to the intensity and duration of inshore red tides is an active area of research for the FWRI harmful algal blooms group.

Pathogens: Manatees could potentially be exposed to pathogens. Spread of such pathogens could be particularly rapid during winter when manatees are concentrated in warm-water refuges. Large-scale mortality events caused by disease or toxins have decimated other populations of marine mammals, including seals and dolphins, removing 50% or more of the individuals in some events (Harwood and Hall 1990). Manatees have robust immune systems that have, through the present time, provided disease resistance. Since 1997 papilloma virus has been found in captive Florida manatees and there is some evidence that it may also be present in the wild population in northwest Florida (Bossart et al. 2002a, Woodruff et al. 2005). While the consensus is that this virus probably does not present a serious threat to manatees at this time, managers are proceeding cautiously (e.g., by establishing a quarantine on exposed captives) and surveillance for papilloma lesions in wild manatees continues.

Trichechus manatus manatus
Major threats to survival of the Antillean manatee include habitat degradation and loss, hunting, incidental catch/accidental take, watercraft collisions, entanglement in fishing gear, pollution, natural disasters, and human disturbance. Although threats due to hunting are diminishing in some areas, all other threats are increasing in most areas. Illegal hunting for subsistence and profit was reported as a significant threat in Brazil, Colombia, Costa Rica, Cuba, Dominican Republic, French Guiana, Guatemala, Honduras, Mexico, Suriname, Trinidad and Tobago, and Venezuela. Pollution from agriculture and mining was consistently noted in reports from South American countries. Intrinsic factors that limit the population’s ability to withstand these anthropogenic impacts include low fecundity, slow growth, limited dispersal, and restricted range.

Of particular note were: (1) In Belize, watercraft related mortality was reported as the major threat, followed by illegal hunting and entanglement in fishing gear; and (2) In north-eastern Brazil, the stranding of live-orphaned calves was identified as the main recent threat to the species (Parente et al. 2004). Between 1981 and 2002, 74 stranded manatees were reported on the north-eastern coast of Brazil with 58% (n=43) being live dependent calves. This high percentage suggested that that the main threat may be human disturbance resulting in mother-calf separation. Disturbance in the area is due to shrimp farms, salt farms, a general increase in human activities in the coastal zone, and uncontrolled tourism. Additional major threats include hunting, entanglement in fishing nets, watercraft collisions, indiscriminate development of the coast, and degradation of aquatic environments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: OVERVIEW: Threats include habitat loss and degradation, and mortality from boat collisions, hunting, fishing, red tide poisoning, entrapment in water control structures, entanglement in fishing gear, and exposure to cold temperatures. Manatees are vulnerable to catastrophic mortality when gathered in large numbers at winter aggregation sites in Florida. In Florida, primary human-related threats include mortality and injury from collisions with watercraft, entrapment and/or crushing in water control structures, and entanglement in fishing gear (USFWS 2007). Natural threats include exposure to cold (loss of warm-water winter refuges) and red tide (brevitoxicosis) (USFWS 2007). The most significant threats to Florida manatees are collisions with boats and potential loss of warm water habitat throughout the state (USFWS 2007). In Belize, watercraft-related mortality was reported as the major threat, followed by illegal hunting and entanglement in fishing gear, whereas in northeastern Brazil the stranding of live-orphaned calves was identified as the main recent threat (Parente et al. 2004, cited by Deutsch et al. 2008).

FURTHER INFORMATION:

In many areas this species is threatened by high mortality often associated with human activity (especially collisions with boats in Florida), in conjunction with low reproductive rate and habitat loss. In Florida, mortality from boat collisions is increasing (69-95 deaths per year during 2000-2007; data from Florida Wildlife Research Institute). Mortality from collisions with boats is believed to be the primary threat to the small manatee population in Puerto Rico (USFWS 2007).

A significant threat to manatee habitat is the potential loss of natural and man-made warm-water refugia (USFWS 2007). Natural springs are vulnerable to reductions in water quality and flow(resulting in part from human consumption of groundwater) and are threatened by factors that affect manatee access and use of the springs, whereas power plants are not permanent reliable sources of warm water, and many power plants upon which manatees now depend are expected to terminate operations within the next couple of decades (USFWS 2007).

In Florida, habitat loss caused by residential and commercial development of coastal land remains a problem.

In Florida in 1996, about 160 died apparently as a result of the toxic effects of the "red tide" alga Gymnodinium breve (Turner 1996).

Fisheries result in low numbers of deaths and nonlethal injuries in Florida but may be significant elsewhere in the range.

Hunting is responsible for the decline throughout much of the range. Illegal hunting is still a problem in much of the range in Mexico, the West Indies, and Central and South America. Opportunistic taking by fishermen is a major source of mortality in the Greater Antilles.

Manatees have low tolerance of human disturbance in calving areas, but are moderately tolerant of swimmers in wintering sites. There are no data at this time to indicate that harassment is limiting the recovery of the Florida manatee (USFWS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As of 1996, the International Union for the Conservation of Nature and Natural Resources (IUCN), which maintains the IUCN Red List of species threatened with extinction, listed the Florida manatee as Vulnerable to extinction based on habitat loss or degradation; harvesting for subsistence, materials or medicinal purposes; accidental mortality; and pollution effects. However, a more recent assessment, completed in 2005, proposes to list the manatee as Endangered. This assessment has not, to date, been accepted.The U.S. Fish and Wildlife Service first listed the manatee as an Endangered species in 1967, predating implementation of the Endangered Species Act of 1973. This initial listing and subsequent designation of critical manatee habitat was historic in that it was one of the first designations of critical habitat for an endangered species, and the first for any marine mammal. Manatees are also federally protected under provisions of the Marine Mammal Protection Act of 1972.Developed in 1980, the initial Federal recovery plan for manatees covered both subspecies of Trichechus manatus (the Florida manatee and the Antillean manatee, which occurs in Puerto Rico and the U.S. Virgin Islands). This recovery plan was revised in 1989 to focus solely on Florida manatees. Subsequent revisions of this manatee recovery plan occurred in 1996 and 2001. The State of Florida's Fish and Wildlife Conservation Commission downlisted the manatee from Endangered to Threatened status on June 7, 2006 under newly developed criteria for listing imperiled species. Why are manatees endangered? Trichechus manatus latirostris is endangered due to the many near and long term effects of human activities on population growth and adult survival. Habitat loss as the result of unconstrained coastal development is a major consideration, as are human-related factors such as death due to watercraft collisions, entrapment in flood gates and canal locks, entanglement in gear or lines, etc. Beyond human-related causes, natural factors such as cold stress, depressed rates of survival in young manatees, red tides, and stochastic events, all contribute to annual losses to the population that may be unsustainable over the long term.Because manatees are long-lived, their natural history and population biology operate over extended time periods (Marmontel et al. 1997). The manatee is characterized as a species with a low maximum rate of potential increase (USFWS 2001). It is slow to mature, generally produces only one offspring per pregnancy, has long periods of offspring dependency, and long interbirth periods. Thus, like other large mammals, for populations to remain stable over time, high rates of adult survival are vital.Survival rates, however, are depressed in both young manatees and in adults.Marmontel et al. (1997) analyzed population viability in the manatee and noted survival rates between 1976 - 1991 were low among the youngest calves, with half of the manatee carcasses recovered recovered under the Florida Fish and Wildlife Research Institute's Marine Mammal Rescue and Recovery Program belonging to Age Classes 0, 1 and 2. Under the provisions of this program, manatee carcasses are recovered and transported to the State's Marine Mammal Pathobiology Laboratory in St. Petersburg for necropsy and determination of cause of death. Using data from 1974 - 2005, Florida Marine Research Institute (FWRI 2006) reported 5,725 manatee carcasses recovered statewide. Of this, 1,199 (21%) deaths occurred in manatees measuring less than 5 feet in length.From 1985 - 2005, there were a total of 4,850 manatee carcasses recovered in Florida. USFWS (2001) reported a 6.0% annual increase in manatee deaths between 1976 - 2000. Note that 1996 was the deadliest year for manatees, followed by 2005 and 2003. In 1996 and 2005, red tides may have increased mortality to greater levels than was observed in other years (FWRI 2006 press release). A large red tide outbreak on Florida's West coast killed 151 manatees in 1996, while red tides were believed to be responsible for the deaths of 81 manatees in 2005. However, most of the increase in manatee mortality is attributable to increased watercraft-related death and perinatal death (USFWS 2001; Marine Mammal Commission 1993).The Importance of Watercraft-Related Mortality: Because the manatee is slow to mature and has a low reproductive capacity, population stability and growth are linked closely to adult survival rates. Marmontel et al. (1997) reported that manatee survivorship curves resembled those of exploited populations and explained this observation as being due primarily to human-related causes that account for 30% or more of total documented mortality annually. Watercraft collisions alone account for 25% of annual mortality (FWRI 2006; Haubold et al 2006; FFWCC 2003; USFWS 2001; Marmontel et al 1997) and approximately 3.5 - 5.3% of the annual observed total population (Haubold et al. 2006). Many researchers (Haubold et al. 2006; USFWS 2001; Marmontel et al. 1997; Wright et al. 1995) have emphasized that besides habitat protection, population stability and growth can be achieved by reducing watercraft-related deaths. However, all indicators show that on an annual basis, there is likely to be even greater watercraft pressure on manatee populations as Florida's human population grows and the number of watercraft increases.Florida's human population has increased 130% since 1970, and will exceed 18 million by 2010 (USFWS 2001; Bureau of Economics and Business Research 1993). Net immigration of new permanent residents to Florida is approximately 760 persons per day, with 80% of immigrants choosing to settle within 16 km (7 miles) of a coast (Bureau of Economics and Business Research 1993). Haubold et al. (2006) noted that by 2004, the number of registered boats in Florida had doubled since 1980 to over 982,000, excluding those that are brought to Florida by seasonal visitors and tourists. As of December, 2005, the number of registered vessels in all size classes in Florida was 1,010,370 (FDHSMV 2005), approximately 1 vessel for every 17 persons. Wright et al. (1995) projected that this number is expected to increase by approximately 2.9% each year, and will continue to increase in concert with increases in Florida's human population. Ackerman et al. (1995) reported that boating-related mortality in manatees increased by 10.3% annually since 1976. Additionally, the sub-lethal effects of watercraft collisions are also cause for alarm. Based on a photo identification database, more than 1000 Florida manatees are documented to have at least one healed scar caused by a boat strike. Moreover, 97% of manatees in this sample bear scars from multiple collisions (O'Shea et al. 2001; Wright et al 1995; Beck and Reid 1995). IRL Manatee Mortality Statistics: In the 5-county area of the Indian River Lagoon, manatee mortality from 1985-2005 totaled 1,414 animals. A disproportionately high amount of total mortality occurred in Brevard County with 896 manatee deaths (63%). Volusia County followed distantly with 222 deaths (16%). Martin County accounted for 134 deaths (9%), while deaths in Indian River and St. Lucie Counties numbered 104 (7%) and 58 (4%) respectively.As in other areas, watercraft collisions are the leading factor in manatee deaths in IRL Counties, with Brevard County accounting for 57% of watercraft-related deaths in the IRL and leading all Florida counties in the number of watercraft-related manatee deaths.Management and Recovery Plans: Marmontel et al. (1997) stressed that manatee management and recovery efforts must focus on retaining and improving the conditions under which manatee demography operates, with research and management priorities centered on habitat protection and reduction of adult mortality. Recovery Plans:USFWS:Trichechus manatus latirostris is Federally listed as an Endangered species under the Endangered Species Act of 1973, and was downlisted in Florida to Threatened status as of June 7, 2006. The most significant and controllable threat to manatee recovery remains human-related mortality, specifically boat strikes that cause death or debilitating injury (USFWS 2001). As a result, the challenge for managers has increasingly become how to modify human, not manatee, behavior (Reynolds 1999). The USFWS and FFWCC will both continue to evaluate needs for additional protection areas that may be necessary to achieve manatee recovery, with the goal of considering manatee needs at the ecosystem-level, thus assuring that protection regulations as well as quality and quantity of habitat are sufficient to ensure recovery of the species.Recently, both the USFWS and FFWCC have used targeted enforcement strategies in an attempt to increase boater compliance with manatee protection areas and slow-speed zones, which ultimately will reduce manatee injuries and deaths.Current priority actions in manatee conservation and protection include improved boater education, increased enforcement of existing regulations, improved maintenance of signs and buoys, compliance assessment, and periodic re-evaluation of the effectiveness of the rules. However, increased protection and enforcement efforts have generally met with vehement opposition by recreational boaters, boat manufacturers, legislators, and development interests throughout the State.Another significant problem for managers is the insuring the stability and longevity of warm-water winter refuges. Historically, manatees relied on warm temperate waters of south Florida and on natural warm-water springs throughout their range as winter refuges. However, with the increased construction of power plants and other industrial plants discharging thermal effluents, manatees expanded their winter ranges to include these sites as well. Currently, approximately 66% of the total manatee population relies on industrial sites for winter refuge from cold waters. Should the stability of these sites come into question, as could occur as the power industry continues to deregulate, then manatees in these areas could become vulnerable to escalating mortality rates. Intensive coastal development throughout Florida poses an additional long-term threat to the Florida manatee (USFWS 2001). There are three major approaches to address this problem. First, the USFWS, and the state agencies of Florida, Georgia, and the Gulf States, as well as other regional recovery partners continue to review and comment on permit applications for construction projects that could occur in manatee habitat areas so that detrimental impacts can be minimized. Second, coastal counties in Florida have been required to develop their own plans for manatee protection. Third, habitat protection is being accomplished through land acquisition. Both the USFWS and the State of Florida have taken steps to acquire new areas of critical manatee habitat for protected areas. The State of Florida has acquired important areas through several programs, most notably the Florida Forever Program (USFWS 2001).The USFWS Manatee Recovery Plan (2001) sets the long-term goals of minimizing the causes of manatee disturbance, harassment, injury and death; determining and monitoring the status of the manatee population; identification, protection, evaluation and monitoring of critical manatee habitats; facilitation of manatee recovery efforts through improved public awareness and education. There are also threats from natural events such as red tides and cold events that may require additional efforts. It is anticipated that full recovery may not be possible for another 14 years or more. Federal downlisting of the manatee will occur when the following conditions are met:1. Threats to manatee habitat or range, as well as threats fromnatural or man-made factors are reduced; minimum spring flowsin warm-water refuges are identified; critical foraging habitats areprotected; and human-caused deaths are reduced. 2. In each of the 4 regional subpopulations over 10 years, thefollowing benchmarks are achieved: the average adult survival rateis 90% or greater; there is statistical confidence that the averagenumber of adult females accompanied by first- or second-yearcalves in winter is at least 40%; and there is statistical confidencethat the annual rate of population growth equals or is greater thanzero. In August 2001, the Coastal Conservation Association petitioned the Florida Fish and Wildlife Conservation Commission to assess the Endangered status of Trichechus manatus latirostris with a view to delisting it as an endangered species. Manatee status was reviewed, but in December 2003, FFWCC postponed most listing decisions to re-evaluate the listing process. This new process was adopted in April 2005, and the manatee was reviewed under the criteria for this new process. It was found that though manatee numbers appear to have risen over the last several decades, many human-related (habitat loss, coastal development, watercraft-related mortality) and natural threats (uncertainty of future warm-water refuges, red tide events, hurricanes and other stochastic events) to the population remained. Under Criterion A, which addresses population reduction, it was found that the manatee had a 12.1% probability of a 50% population reduction within 3 generations; and a 46.5% probability of a 30% population reduction in 3 generations. It thus qualified as a Threatened species under Criterion A.Criterion B concerns the extent of occurrence and area of occupancy. It was found that the extent of manatee occurrence is approximately 7500 square miles, with an area of occupancy of 100 - 300 square miles. Manatees met the condition of a decline in area of occupancy, but the Biological Review Committee did not feel that manatees occur only in a limited number of locations, nor was their habitat severely fragmented. Hence, manatees did not qualify under Criterion B.Criterion C addresses population size and population trends. The total minimum population size for the manatee was calculated to be 2,310 adults, with no evidence of extreme fluctuation in population numbers, and no subpopulation contained greater than 90% of the total population. However, the probability of a 20% reduction in population size within 2 generations was calculated to be 55.5%; and there was a 77.1% probability of a 10% population reduction. Manatees thus qualified as Threatened under Criterion C.Criterion D concerns the number of mature individuals in the population. With a minimum adult population size of 2, 310, and an area of occupancy of 100 - 300 square miles, the manatee did not qualify under Criterion D.Criterion E addresses the probability of imminent extinction. It was calculated that manatees had an overall probability of extinction in the next 100 years of only 1%. Further, the total population is not likely to approach any of the qualifying thresholds outlined in the listing criteria; though one of the 4 subpopulations would qualify for listing if the subpopulations were considered separately. Thus, manatees did not meet the listing qualifications under Criterion E.On June 7, 2006, the State of Florida downlisted the manatee to Threatened status under Criteria A and C above.
  • Ackerman, B.B. 1995. Aerial surveys of manatees: A summary and progress report. In: T.J. O'Shea, B.B. Ackerman & H.F. Percival(eds). Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. pp. 13-33. Washington D.C.
  • Beck, C.A., and J.P. Reid. 1995. An automated photo-identificationcatalog for studies of the life history of the Florida manatee. Pages120-134 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors.Population Biology of the Florida Manatee. National Biological Service Information and Technology Report 1. Washington, D.C.289 pp.
  • Beck, C.A. and N.B. Barros. 1991. The Impact of Debris on the Florida Manatee. Marine Pollution Bulletin. 22(10): 508-510.
  • Beck, C.A., R.K. Bonde, and G.B. Rathbun. 1982. Analyses of Propeller Wounds on Manatees in Florida. Journal of WildlifeManagement, 46(2):531-535.
  • Bengtson, J.L. 1983. Estimating Food Consumption of Free RangingManatees in Florida. Journal of Wildlife Management, 47(4):1186 - 1192.
  • Bengtson, J.L. and S.M. Fitzgerald. 1985. Potential Role of Vocalizations in West Indian Manatees. Journal of Mammalogy, 66(4):816-819.
  • Best, R.C. 1981. Foods and Feeding Habits of Wild and Captive Sirenia. Mammal Rev. 11(1):3-29. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B. and Wright, S.D.1998.
  • Brevetoxicosis in manatees (Trichechus manatus latirostris)from the 1996 epizootic: gross, histologic and immunohistochemicalfeatures. Toxicologic Pathology 26:276-282.
  • Brownell, R.L. and K. Ralls, eds. 1981. The West Indian Manatee inFlorida. Proceedings of a Workshop held in Orlando, Florida 27 - 29 March, 1978. Florida Department of Natural Resources, Tallahassee, FL. 154 pp.
  • Bureau of Economics and Business Research. 1993. Florida StatisticalAbstract. University of Florida Press, Gainesville, FL. Campbell, H.W. and B. Irvine. 1977. Feeding Ecology of the West Indian Manatee Trichechus manatus Linnaeus. Aquaculture 12(1977) 249-251.
  • Craig, B.A. and Reynolds, III, J.E. 2004. Determination of manatee population trends along the Atlantic coast of Florida using a Bayesian approach with temperature-adjusted aerial survey data.Marine Mammal Science 20: 386-400.
  • Deutsch, C.J., J.P. Reid, R.K. Bonde, D.E. Easton, H.I. Kochman, andT.J. O'Shea. 2003. Seasonal movements, migratory behavior and site fidelity of West Indian manatees along the Atlantic Coast of the United States. Wildlife Monographs 151:1-77.
  • Deutsch, C J., Ackerman, B.B., Pitchford, T.D. and Rommel, S.A.2002.Trends in manatee mortality in Florida. Manatee Population Ecology andManagement Workshop. Gainesville, Florida.
  • Domning, D.P. 1982. Evolution of Manatees: A Speculative History. Journal of Paleontology. 56(3): 599-619.
  • Domning, D.P. 1982. Commercial exploitation of manatees (Trichechus) in Brazil c.1785-1973. Biological Conservation 22: 101-126.
  • Domning, D.P. Feeding Position Preference in Manatees (Trichechus).Journal Mammalogy, 61(3):544-547.
  • Domning, D.P. and L.C. Hayek. 1986. Interspecific and IntraspecificVariation in the Manatees (Sirenia: Trichechus). Marine Mammal Science, 2(2):87-144.
  • Etheridge, K., G.B. Rathbun, J.A. Powell, and H.I. Kochman. 1985. Consumption of Aquatic Plants by the West Indian Manatee. Journal of Aquatic Plant Research 23:21-25.
  • Fernald, E.A., editor. 1981. Atlas of Florida. Florida State University,Tallahassee, FL 276 pp.Florida Department of Highway Safety and Motor Vehicles. 2005. Annual vessel statistics by county. Available on-line at http://www.hsmv.state.fl.us/dmv/vslfacts.html. Florida Fish and Wildlife Research Institute (FWRI). 2006.
  • Manatee Mortality Statistics 1974 - 2005. Available online at http://research.myfwc.com/manatees/.Florida Fish and Wildlife Conservation Commission (FFWCC). 2003.
  • Final biological status review of the Florida manatee (Trichechusmanatus latirostris): Addendum. 148 pp. Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute. St. Petersburg, Florida.
  • García-Rodríguez, A.I., Bowen, B.W., Domning, D., Mignucci-Giannoni, A.A., Marmontel M., Montoya-Ospina, R.A., Morales-Vela, B., Rudin, M., Bonde R.K. and McGuire, P.M. 1998. Phylogeography of the West Indian manatee(Trichechus manatus): how many populations and how many taxa? MolecularEcology 7: 1137-1149.
  • Gorzelany, J. 2004. Evaluation of boater compliance with manatee speed zones along the Gulf coast of Florida. Coastal Management32:215-226.
  • Griebel, U. and A. Schmid. 1996. Color Vision in the Manatee. VisionResearch. 30(17): 2747-2757.
  • Hartman, D.S. 1979. Ecology and Behavior of the Manatee Trichechus manatus) in Florida. American Society of Mammalogists, SpecialPublication No. 5. Pittsburgh, PA. 154 pp.
  • Haubold, E.M., C. Deutsch, and C. Fonnesbeck. 2006. Final BiologicalStatus Review of the Florida Manatee (Trichechus manatus latirostris). Status Assessment by the 2005-2006 Florida Manatee Biological ReviewPanel. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute, St. Petersburg, FL. 133 pp.
  • Hernandez, P., J. Reynolds, III, H. Marsh, and M. Marmontel. 1995. Age and seasonality in spermatogenesis of Florida manatees. Pgs.84 - 87 in: T. O'Shea, B. Ackerman, and H. Percival (eds.). Population biology of the Florida manatee.
  • National Biological Service, Information and Technology Report No. 1. Washington, DC. Husar, S.L. The West Indian Manatee. 1977. U.S. Department of the Interior, Fish and Wildlife Service, Wildlife Research Report No. 7, Washington, D.C. 22 pp.
  • IFAS. 2006. Plant management in Florida waters: Florida Ecotourism. Webpage available at http://aquat1.ifas.ufl.edu/guide/ecotouri.html. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.
  • Irvine, B.A. Manatee Metabolism and its Influence on Distribution in Florida. Biological Conservation. 25: 315-334.
  • Irvine, B.A., J.E. Caffin, and H.I. Kockman. 1981. Aerial Surveys for Manatees and Dolphins in Western Peninsular Florida. Fishery Bulletin 80(3): 621-630.
  • Irvine, A.B. and H.W. Campbell. 1978. Aerial Census of the West Indian Manatee, Trichechus manatus, in the Southeastern United States. Journal of Mammology. 59(3):613-617.
  • IUCN 2006. 2006 IUCN Red List of Threatened Species. Available online at www.iucnredlist.org. Jiménez, I. 2002. Heavy poaching in prime habitat: the conservation status of the West Indian manatee in Nicaragua. Oryx 36(3): 272-278.
  • Ketten, D.R., D.K. Odell, and D.P. Domning. 1992. Structure, function, and adaptation of the manatee ear. Pages 77-95 in J. Thomas, R. Kastelein, and A. Supin (eds.). Marine mammal sensory systems. Plenum Press. New York.
  • Kinnaird, M.F. Aerial Census of Manatees in Northeastern Florida. Biological Conservation, 32:59-79.
  • Langtimm, C., T. O'Shea, R. Pradel, and C. Beck. 1998. Estimates of Annual Survival Probabilities for Adult Florida Manatees (Trichechus manatus latirostris). Ecology 79(3):981-997.
  • Laist, D.W. and Reynolds, III, J.E. 2005. Florida manatees, warm-water refuges, and an uncertain future. Coastal Management 33: 279-295.
  • Ledder, D.A. 1986. Food Habits of the West Indian Manatee, Trichechus manatus latirostris, in South Florida. Master's Thesis, University of Miami, Coral Gables, FL. 62 pp.
  • Lefebvre, L.W., M. Marmontel, J.P. Reid, G.B. Rathbun, and D.P. Domning. 2001. Status and biogeography of the West Indian manatee. Pages 425-474 in C.A. Woods and F.E. Sergile, editors. Biogeography of the West Indies: new patterns and perspectives. CRC Press LLC, Boca Raton, Florida.
  • Marine Mammal Commission. 1988. Preliminary Assessment of Habitat Protection Needs for West Indian Manatees on the East Coast of Florida and Georgia. U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 121 pp.
  • Marmontel, M. 1995. Age and reproduction in female Florida manatees.Pp. 98-119 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, eds.,Population Biology of the Florida Manatee (Trichechus manatus latirostris).
  • National Biological Service, Information and Technology Report 1. 289 pp. Marmontel, M., S.R. Humphrey, and T.J. O'Shea. 1997. Population Viability Analysis of the Florida Manatee (Trichechus manatus latirostris), 1976-1991. Conservation Biology 11(2):467-481.
  • Marmontel, M., T.J. O'Shea, H.I. Kochman, and S.R. Humphrey. 1996.Age determination in manatees using growth-layer-group counts in bone. Marine Mammal Science 12: 54-88.
  • Moore, J.C. 1951. The Range of the Florida Manatee. Journal of the Florida Academy of Science 14(1): 1-19.
  • O'Dell, D.K. 1982. West Indian Manatee (Trichechus manatus). In: Wild Mammals of North America. Johns Hopkins University Press, Baltimore, MD.
  • O'Dell, D.K. and J.E. Reynolds, 1978. Observations of Manatee Mortality in South Florida. Journal of Wildlife management, 43(2):572-577.
  • O'Shea, T.J. 1995. Waterborne Recreation and the Florida Manatee. Pgs. 297-311 in R.U. Knight and K.J. Gutzwiller, eds., Wildlife and Recreationists: Coexistence Through Management and Research. Island Press, Washington, DC.
  • O'Shea, T.J., C.A. Beck, R.K. Bonde, H.I. Kochman, and D.K. O'Dell. 1985. An Analysis of Manatee Mortality Patterns in Florida, 1976-1981. Journal of Wildlife management 49(1):1-11.
  • Packard, J.M. 1981. Abundance, Distribution, and Feeding Habits of Manatees (Trichechus manatus) Wintering Between St. Lucie and Palm Beach Inlets,Florida. Final Report to U.S. Fish and Wildlife Service. Contract No. 14-16-0004-80-105.
  • Packard, J.M., R.K. Frohlich, J.E. Reynolds, and J.R. Wilcox. 1989. Manatee Response to Interruption of a Thermal Effluent. Journal of WildlifeManagement. 53(3):692-700.
  • Powell, J.A. and G.B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science7(1):1-28.
  • Powell, J.A. 1978. Evidence of Carnivory in Manatees (Trichechus manatus). Journal of Mammalogy, 59(2):442.
  • Provancha, J.A. and M.J. Provancha. 1988. Long-Term Trends in Abundance and Distribution of Manatees (Trichechus manatus) in the NorthernBanana River, Florida. Marine Mammal Science 4(4):323-338.
  • Rathbun, G.B., J.P. Reid, R.K. Bonde, and J.A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pages 135-156 in T.J. O'Shea, B.B. Ackerman, and H.F. Percival, editors. Population biology of the Florida manatee. National Biological Service Information and Technology Report 1. Washington, D.C. 289 pp.
  • Rathbun, G.B., J.R. Reid, and G. Carowan. 1990. Distribution and Movement Patterns of Manatees (Trichechus manatus) in Northwestern Peninsular Florida. Florida Marine Research Publications No. 48. State of Florida, Department of Natural Resources, Florida Marine Research Institute. St. Petersburg, FL. 33 pp.
  • Reid, J.P., G.B. Rathbun, and J.R. Wilcox. 1991. Distribution Patterns of Individually Identifiable West Indian Manatees (Trichechus manatus) in Florida. Marine Mammal Science 7(2):180-190.
  • Reynolds III, J.E. 1981. Behavior Pattern in the West Indian Manatee, with Emphasis on Feeding and Diving. Florida Scientist 44(4):233-242.
  • Reynolds III, J.E., and C.J. Gluckman. 1988. Protection of West Indian Manatees (Trichechus manatus) in Florida. Final Report to U.S. MarineMammal Commission, Contract No. MM4465868-3 and MM3309741-7.U.S. Department of Commerce, National Technical Information Service, Springfield, VA. 85 pp.
  • Reynolds III, J.E., and K.D. Haddad, editors. 1990. Report of the Workshop on Geographical Information Systems as an Aid to Managing Habitat for West Indian Manatees in Florida and Georgia. Florida Marine Research Publications, No. 49. State of Florida, Department of Natural Resources,Florida Marine Research Institute, St. Petersburg, FL. 22 pp.
  • Reynolds III, J.E., and J.R. Wilcox. 1994. Observations of Florida Manatees (Trichechus manatus latirostris) Around Selected Power Plants in Winter. Marine Mammal Science, 10(2):163-177.
  • Reynolds III, J.E., and J.R. Wilcox. 1986. Distribution and Abundance of the West Indian Manatee, Trichechus manatus, Around Selected Florida PowerPlants Following Winter Cold Fronts:1984 - 85. Biological Conservation, 38:103-113.
  • Reynolds, J.E. 1979. Internal and External morphology of the manatee (sea cow). The Anatomical Record. 193(3):663. Schevill, W.E. and W.A. Watkins. 1965. Underwater calls of Trichechus(Manatee). Nature, Jan. 23, 1965, Vol. 205
  • Scholander, P.F. and L. Irving. 1941. Experimental Investigations on the Respiration and Diving of the Florida Manatee. Journal of Cellular and Comparative Physiology, 17:169-191.
  • Shapiro, S.L. 2001. Assessing boater compliance with manatee speed zones in Florida. Final report submitted to the U.S. Fish and Wildlife Service, Grant No. 2280. 73 pp. St. Petersburg, Florida.
  • Snipes, R.L. 1984. Anatomy of the Cecum of the West Indian manatee, Trichechus manatus (Mammalia, Sirenia). Zoomorphology, 104:67-78.
  • U.S. Fish and Wildlife Service. 2001. Florida Manatee Recovery Plan, (Trichechus manatus latirostris), Third Revision. U.S. Fish and Wildlife Service. Atlanta, Georgia. 144 pp. + appendices.
  • Wray, P. 1978. The West Indian Manatee (Trichechus manatus) in Florida: A Summary and Analysis of Biological, Ecological, and Administrative Problems Affecting Preservation and Restoration of the Population. Final Report to the Marine Mammal Commission, Contract No. MM8AD054, U.S. Marine Mammal Commission, Washington, D.C. 95 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Dugongs and manatees have been extensively hunted for their meat, hide and oil but today the major threats to the survival of the West Indian manatee is collision with the hulls and propellers of boats, and habitat loss caused by coastal development (2) (9). Between 1976 and 2000, watercraft-related deaths accounted for 24 percent of the total West Indian manatee mortality (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Trichechus manatus latirostris
The following text was excerpted directly from the Florida Manatee Recovery Plan (USFWS 2001), with condensation and some minor revisions from the assessors. The state of Florida’s Manatee Management Plan is due to be completed by June 2007 and will provide further details of planned management and conservation actions.

Efforts to Reduce Watercraft-Related Injuries and Deaths
The largest identified cause of manatee death is collisions with watercraft. Many living manatees also bear scars or wounds from vessel strikes. Because watercraft operators cannot reliably detect and avoid hitting manatees, federal and state managers have sought to limit watercraft speed in areas where manatees are most likely to occur to afford both manatees and boaters time to avoid collisions. In 1989, the Florida Governor and Cabinet approved a series of recommendations by the former FDNR to improve protection of manatees in 13 key counties. Since then state and local governments have cooperated in the creation and implementation of county Manatee Protection Plans and county-wide manatee protection speed zone rules. Two types of manatee protection areas also have been developed by FWS: (1) manatee sanctuaries, areas in which all waterborne activities are prohibited; and (2) manatee refuges areas where certain waterborne activities are restricted or prohibited. FWS and FWC continue to evaluate needs for additional protection areas that may be necessary to achieve recovery. The goal is to consider the needs of the manatee at an ecosystem level and to establish regulations to ensure that adequate protected areas are available throughout Florida to satisfy habitat requirements of the Florida manatee population with a view toward recovery.

In recent years, both the FWS and FWC have been using targeted enforcement strategies in an attempt to increase boater compliance with speed zones and ultimately reduce manatee injuries and death. FWS’ strategy has been to allocate significant enforcement manpower to specific areas on designated weekends. These enforcement teams travel to various locations around the state, with particular emphasis given to those zones within counties where there is a history of high watercraft-caused manatee deaths. FWC has increased its emphasis on enforcement and compliance with manatee speed zones by adding new officers, conducting law enforcement task force initiatives, increasing overtime, and increasing the proportion of law enforcement time devoted to manatee conservation.

Managers, researchers, and the boating industry have investigated the use of various devices to aid in the reduction of watercraft-related manatee deaths. For example, the State of Florida funded an evaluation of propeller guards (Milligan and Tennant 1998). The state’s evaluation concluded that these devices would reduce cutting damage associated with propellers when boats were operating at low speeds. However, when boats (including boats equipped with propeller guards) operate at high speeds, guards would be of little benefit because animals would continue to be killed by blunt trauma associated with impacts from boat hulls, lower units, and other gear. The U.S. Coast Guard (USCG) identified additional concerns, stating that propeller guards on small recreational vessels “may create more problems than they solve” and does not support their use on recreational vessels at this time (Carmichael 2001). There are propeller guard applications, however, that appear to work for certain large, commercial vessels; for example, the use of guards on C-tractor tugs has eliminated this specific source of manatee mortality at the Kings Bay Naval Submarine Base in St. Marys, Georgia. To prevent injuries to manatees, propeller guards are used on some rental and sight-seeing boats at Blue Spring and Crystal River.

Researchers have also begun to investigate the manatees’ acoustic environment to better evaluate the animal’s response to vessel traffic. This line of research needs to be thoroughly assessed for its potential as another management tool to minimize collisions between manatees and boats. Results from Gerstein et al. (1999) indicate that manatees hear in the range from 500 Hz to 46 kHz and that inadequate hearing sensitivity at low frequencies may be a contributing factor to the manatees’ ability to effectively detect boat noise to avoid collisions. One technology often discussed is an acoustic deterrence device mounted on a boat. Conceptually, this technological approach may sound like an answer to the manatee/watercraft issue. A number of problems have been defined with the use of acoustic deterrents. No alarm/warning device has yet been demonstrated to adequately protect wildlife or marine mammals. Additionally, concern has also been stated regarding the increase in background noise that these deterrents would add to an already noisy marine environment. It has not been determined what negative impacts this device would have on marine life and what effects it would have on animals that use acoustic cues for a variety of purposes. For these reasons, this technology needs to be thoroughly researched and assessed and managers need to evaluate the MMPA and ESA “take” issues related to implementing such technology.

Current research into the sensory capabilities of manatees is being supported at both the state and federal levels. One study assessed the effects of boat noise in a more controlled environment, by recording the physical and acoustic reaction of a manatee to a pre-determined acoustical level. This study design will allow the development of a relationship between acoustic amplitude and behavioural responses. Another study examined acoustical propagation over various types of marine topography. In cooperation with Mote Marine Laboratory and the Woods Hole Oceanographic Institution, the FWC is also examining manatee behavioural response to watercraft using new technology, the DTAG, a digital acoustic tag which records acoustic attributes of the environment and detailed manatee movement simultaneously. A study to assess manatee behaviours in the presence of fishing gear and their response to novelty and the potential for reducing gear interactions also has an acoustic component. The FWC is also supporting the development and implementation of technological solutions for reducing the risks that watercraft pose to manatees.

Additional priority actions to better protect manatees include boater education, maintenance of signs and buoys, compliance assessment, and periodic re-evaluation of the effectiveness of the rules. Such work requires close cooperation between FWC Imperiled Species Management, FWC’s Division of Law Enforcement, county officials, the Inland Navigation Districts, FWS, USCG, and, of course, boaters.

Efforts to Reduce Flood Gate and Navigation Lock Deaths
Entrapment in water-control structures and navigational locks is the second largest cause of human-related manatee deaths. In some cases, manatees appear to have been crushed in closing gates; in others, they may have been drowned after being pinned against narrow gate openings by water currents. Water-control structures implicated in manatee deaths in Dade and Broward counties are operated by the South Florida WMD. From 1976 through 2000, 166 manatees have been killed in water control structures in Dade County alone, accounting for 33% of all manatee deaths in this county. In the early 1980s, steps were taken to modify gate-opening procedures to ensure openings were wide enough to allow a manatee to pass through unharmed. Steps were also initiated to fence off openings and cavities in gate structures where manatees might become trapped. Manatee deaths subsequently declined and remained low for much of that decade. Much progress has been made toward identifying, testing, and installing manatee protection devices (e.g., pressure sensors) at water control structures. The Army Corps of Engineers (ACOE) has also installed removable barriers on the upstream side of the Ortona and St. Lucie Lock spillway structures. The large difference in the upstream and downstream water levels at these structures compromises the effectiveness and use of pressure sensor devices. Locks frequented by manatees have been retrofitted with an acoustic array on the gates; this device detects the presence of a manatee during lock closing to avoid pinning or crushing. An interagency task force, established in 1991, continues to monitor, examine and make recommendations to protect manatees at water control structures and navigational locks.

Habitat Protection
Intensive coastal development throughout Florida poses a long-term threat to the Florida manatee. There are three major approaches to address this problem. First, FWS, FWC, Georgia Department of Natural Resources (GDNR), and other recovery partners review and comment on applications for federal and state permits for construction projects in manatee habitat areas and to minimize their impacts. Under section 7 of the Endangered Species Act, FWS annually reviews hundreds of permit applications to the ACOE for construction projects in waters and wetlands that include or are adjacent to important manatee habitat. FWC and GDNR provide similar reviews to their respective state’s environmental permitting programs.

A second approach is the development of county manatee protection plans. The provisions of these plans are implemented through amendments to local growth management plans under the Florida’s Local Government Comprehensive Planning and Land Development Regulation Act of 1985. In addition to boat speed rules, manatee protection plans are to include boat facility siting policies and other measures to protect manatees and their habitat.

A third approach to habitat protection is land acquisition. Both FWS and the State of Florida have taken steps to acquire and add new areas containing important manatee habitat to federal and state protected area systems. The State of Florida has acquired important areas through several programs, most notably the Florida Forever Program. In Florida, the Governor and Cabinet have included special consideration for purchase of lands that can be of benefit to manatees and their habitat. Over $500 million has been spent to acquire 250,000 acres, whose importance included, but was by no means limited to, protection of manatee habitat. FWS has also acquired and now manages thousands of acres of land important to manatees and many other species in the NWR System. In addition to these efforts, FWS’s initiative to propose new manatee refuges and sanctuaries factors into habitat protection. Both the State of Florida and FWS are continuing cooperative efforts with a view towards establishing a network of important manatee habitats throughout Florida.

Manatee Rescue, Rehabilitation and Release
Thousands of reports of distressed manatees purportedly in need of assistance have been made to the state wildlife enforcement offices and other resource protection agencies by a concerned public. While most of the manatees do not require assistance, dozens of manatees are rescued and treated each year. A network of state and local agencies and private organizations, coordinated by FWS, has been rescuing and treating these animals for well over 20 years.

Manatees are brought into captivity when stressed by cold weather, when struck and injured by watercraft, when injured because of entanglements in crab traps and monofilament fishing line, when orphaned, and when compromised by other natural and man-made factors. Programme veterinarians and staff have developed treatments and protocols for these animals and have been remarkably successful in their efforts to rehabilitate compromised individuals. Since 1973, over 180 manatees have been treated and returned to the wild (FWS unpubl.).

Media coverage of manatee rescues, treatments, and releases helps to educate millions of people about manatees, the life-threatening problems that they face, and actions that can be taken to minimize the effect of anthropogenic activities on this species. In addition, more than 18 million visitors a year see manatees at rehabilitation facilities and participate in manatee education programs sponsored by several parks. The publicity and outreach inherent in this program provide significant support to efforts to recover the manatee.

Public Education, Awareness, and Support
Government agencies, industries, oceanaria and environmental groups have all contributed to manatee public awareness and education efforts that were initiated in the 1970s. These efforts have expanded in scope and increased in quantity since that time. Some key counties in Florida have also started the education component of their manatee protection plans. These public awareness and education efforts encourage informed public participation in regulatory and other management decision-making processes and provide constructive avenues for private funding of state manatee recovery programs, research, and land acquisition efforts through programmes such as the specialty automobile license tag for manatees.

The public has been made aware of new information on the biology and status of manatees, urgent conservation issues, and the regulations and measures required to assure their protection through the production of brochures, posters, films and videos, press releases, public service announcements and advertisements, and other media-oriented materials. Outdoor signs have been produced that provide general manatee information and highlight the problems associated with feeding manatees.

Manatee viewing opportunities have also been made available to the public. In addition, volunteers from several organizations annually give presentations to schools and other groups and distribute educational materials at festivals and events. Such efforts are essential for obtaining public compliance with conservation measures to protect manatees and their habitats.

Many public awareness materials have been developed specifically focusing on boater education. Public awareness waterway signs are produced and distributed alerting boaters to the presence of manatees. Brochures, boat decals, boater’s guides, and other materials with manatee protection tips and boating safety information have been produced and are distributed by law enforcement groups, through marinas, and boating safety classes. Educational kiosks have been designed and installed at marinas, boat ramps, and other waterfront locations. Monofilament fishing line collection sites and cleanup efforts are being established. Several agencies and organizations provide educator’s guides, posters, and coloring and activity books to teachers in Florida and across the United States. In addition, Save The Manatee Club (SMC) and FWC Advisory Council on Environmental Education have produced a video for distribution to schools throughout Florida and the United States. SMC and FWC also provide free manatee education packets to students and staff interviews for students. Agencies and organizations help to educate law enforcement personnel about manatees and inform them about available outreach materials that can be distributed to user groups.

Trichechus manatus manatus
Conservation of the Antillean manatee at the regional level has been driven by the SPAW Protocol to the Cartagena Convention (Freestone 1991), resulting in the Regional Management Plan for the West Indian Manatee, Trichechus manatus (UNEP 1995). In all countries with extant populations there is protective legislation with some effort towards conservation through governmental agencies and/or non-governmental organizations. In a few countries efforts have increased significantly over the past decade. Conservation measures include: (1) policy-based actions such as protective legislation, management plans, recovery plans, and community management; (2) educational outreach programs and awareness activities; (3) research actions such as site specific and country-wide surveys, behavioural studies both in captivity and in situ, remote sensing projects, health assessments, and genetic studies; (4) habitat and site-based actions such as protected areas and community-based initiatives; and (5) species-based actions such as re-introductions, stranding networks, and rehabilitation programs.

The species is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: .

Biological Research Needs: See USFWS (2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many (13-40) occurrences appropriately protected and managed

Comments: This species receives limited protection in several managed areas within the United States, but no entire occurrence is adequately protected. U.S. Fish and Wildlife Service listed the following national wildlife refuges in which this species is known to occur: Ace basin, Blackbeard Island, Chassahowitzka, Crystal River, Harris Neck, Island Bay, J. N. 'Ding' Darling. Lake Woodruff, Lower Suwannee, Matlacha Pass, Merritt Island, Pelican Island, Pine Island, Pinellas, Savannah-Pinckney, St. Marks, Ten Thousand Islands, Vieques, and Wolf Island.

In Florida, all primary warm-water refuge sites, except the Weeki Wachee/Mud Creek/Jenkins Creek complex, have been protected (USFWS 2007). Secondary sites are variously protected, with some sites continuing to go unprotected and others fully protected. Ten of the 47 total warm-water sites either need protection or are in need of additional protection (USFWS 2007). While all important warm-water refuge sites within the network in Florida have been identified, the Manatee Habitat Working Group has not yet identified nor characterized feeding sites associated with these refuges (USFWS 2007). The Manatee Habitat Working Group also is in the process of identifying a network of migratory corridors and other use areas to ensure protection of feeding, calving and nursing areas throughout the state (USFWS 2007). Many of these sites are already known in the various counties and are variously protected under the Florida Manatee Sanctuary Act and/or the Federal Endangered Species Act/ Marine Mammal Protection Act.

In Florida, USFWS has designated sanctuaries at warm-water sites, patrols these areas, and uses its permitting authorities to minimize harassment of manatees (USFWS 2007). Outreach and education programs are also in place to minimize harassment in these areas.

The Florida Manatee Sanctuary Act of 1978 established Florida as a refuge and sanctuary for manatees. The Act protects manatees from injury, disturbance, harassment, or harm in the waters of Florida and allows for enforcement of boat speeds and operations in areas where manatees are concentrated.

Subsequent to the 2001 Florida Manatee Recovery Plan (USFWS 2001), there have been numerous additions and improvements to federal, state, and local manatee protection zones throughout peninsular Florida, as well as a number of ongoing studies to assess the effectiveness of these protection zones (USFWS 2007). To reduce unauthorized "take" associated with boat facility construction and the boats that use them, USFWS, state, and permitting authorities have developed permitting guidance to minimize the effects of these activities on manatees (USFWS 2007). In addition, the state of Florida recently drafted a management plan in conjunction with their decision to reclassify the state status of the manatee from "endangered" to "threatened." In addition, numerous counties have adopted manatee protection plans and other manatee protection measures (USFWS 2007).

Needs: Efforts should be made to reduce poaching in areas outside the United States. In Florida, reduction is needed in the level of mortality resulting from boat collisions.

In Florida, warm-water winter refuges are in great need of protection. USFWS and the state of Florida are working together and coordinating with other agencies and industry to address possible warm water loss from a variety of angles, including seeking alternative sources of warm water in the short term, and restoring major springs to provide access to natural sources of warm water for the long term (USFWS 2007). Failure to protect existing sources of warm water in winter or to provide secure surrogate habitats for the long-term could lead to a future decline in the Florida manatee population, reduced long-term carrying capacity, and an elevated risk of extirpation on either coast of Florida (USFWS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

West Indian manatees are protected by law in the United States and a Manatee Recovery Plan has been established in an effort to prevent the decline in this species (9). There are specific boat speed zones to prevent watercraft collisions and an ongoing research programme (6). Internationally, a number of organisations are involved in extensive research into manatee populations including surveys, tagging programmes and habitat assessment. This data will be vital for the introduction of successful management schemes to safeguard the future of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

N/A

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

For centuries West Indian manatees have been hunted for their meat, hide, and bones. This hunting continues in many South and Central American countries. The domestication of manatees has been suggested. Their status as an endangered species makes this an unlikely option. It has also been suggested that manatees be used as a method of aquatic weed control within their range. However, it has been shown that the amount of plant material consumed by these animals is not large enough to make this a viable option.

As the state's official marine mammal, the Florida manatee (a subspecies of Trichechus manatus) is of particular interest to tourists visiting the area.

(FPL 1989)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: This species has been hunted for meat, bone, hides, and fat (subsistence harvest mainly, some commercial harvest formerly in South America). Some subsistence hunting still occurs in parts of Central and South America. Some people believe that certain parts of the body have medicinal value.

Manatee populations may not eat enough to be an effective control on undesirable aquatic plants (Van Meter 1987), though Reeves et al. (1992) gave two examples of apparently successful weed control by manatees in South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: For the Florida manateee, USFWS (2001) summarized recovery efforts as follows: "The near and long term threats from human-related activities are the reasons for which the Florida manatee currently necessitates protection under the Endangered Species Act. The focus of recovery is not on how many manatees exist, but instead the focus is on implementing, monitoring and addressing the effectiveness of conservation measures to reduce or remove threats which will lead to a healthy and self-sustaining population."

Actions needed in Florida include the following: minimize causes of manatee disturbance, harassment, injury, and mortality; determine and monitor the status of the manatee population; protect, identify, evaluate, and monitor manatee habitats; facilitate manatee recovery through public awareness and education (USFWS 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

West Indian manatee

The West Indian manatee (Trichechus manatus) is a manatee, and the largest surviving member of the aquatic mammal order Sirenia (which also includes the dugong and the extinct Steller's sea cow).

The West Indian manatee is a species distinct from the Amazonian manatee (T. inunguis), and the African manatee (T. senegalensis). Based on genetic and morphological studies, the West Indian manatee is divided into two subspecies, the Florida manatee (T. m. latirostris) and the Antillean or Caribbean manatee (T. m. manatus).[3][4] However, recent genetic (mtDNA) research suggests that the West Indian manatee actually falls out into three groups, which are more or less geographically distributed as: (1) Florida and the Greater Antilles; (2) Central and Northern South America; and (3) Northeastern South America.[5][6]

Contents

Physical description

Like other manatees, the West Indian manatee has adapted fully to an aquatic life style, having no hind limbs. Pelage cover is sparsely distributed across the body, which may play a role in reducing the build-up of algae on their thick skin. The average West Indian manatee is approximately 2.7–3.5 m (8.9–11 ft) long and weighs 200–600 kg (440–1,300 lb), with females generally larger than males.[7] The largest individual on record weighed 1,655 kg (3,650 lb) and measured 4.6 m (15 ft) long.[8][9] This manatee's color is gray or brown. Its flippers also have either 3 or 4 nails so it can hold its food as it is eating.

Habitat and geographic range

As its name implies, the West Indian manatee lives in the West Indies, or Caribbean, generally in shallow coastal areas. However, it is known to withstand large changes in water salinity, and so has also been found in shallow rivers and estuaries. It can live in fresh water, saline water, and even brackish water. It is limited to the tropics and subtropics due to an extremely low metabolic rate and lack of a thick layer of insulating body fat. While this is a regularly occurring species along coastal, southern Florida, during summer this large mammal has even been found as far north as New York City, New York and as far west as Texas.[10]

Manatee from Crystal River, Florida

The Florida manatee (Trichechus manatus latirostris), a subspecies of the West Indian manatee, is the largest of all living sirenians. Florida manatees inhabit the most northern limit of sirenian habitat. Over three decades of research by universities, governmental agencies, and NGOs, has contributed to our understanding of Florida manatee ecology and behavior, which is more than we know about any other sirenian species. They are found in fresh water rivers, in estuaries, and in the coastal waters of the Gulf of Mexico and the Atlantic Ocean. Females usually have their first calf when they are about 7 or 8 years old. Normally they only have one calf every three years because manatees nurse their calf for 1 or 2 years, but there are rare occurrences of twins. When a calf is born, they usually weigh between 60 and 70 pounds and are between 4 and 4.5 feet. The family unit consists of mother and calf, which remain together for up to 2 years. Males aggregate in mating herds around a female when she is ready to conceive, but contribute no parental care to the calf. Florida manatees may live to be greater than 60 years old in the wild, and one captive manatee -- "Snooty" [3] -- has lived for 63 years. In captivity, West Indian Manatees live up to 28 years.[citation needed] The biggest single threat to Florida manatees is death from collisions with recreational watercraft. Large concentrations of Florida manatees are located in the Crystal River area and also Wakulla Springs regions in central and north Florida. The best time to see the Wakulla Springs manatees are in November and December, and in the spring for the Crystal River manatees.

The other subspecies of the West Indian manatee is sometimes referred to as the Antillean manatee (Trichechus manatus manatus). Antillean manatees are sparsely distributed throughout the Caribbean and the Northwestern Atlantic Ocean, from Mexico, east to the Greater Antilles, and south to Brazil. They are found in French Guiana, Suriname, Guyana, Trinidad (however there has been a lack of recent sightings), Venezuela, Colombia, Panama, Costa Rica, Nicaragua, Honduras, Guatemala, Belize, Mexico, Trinidad, Cuba, Haiti, Dominican Republic, Jamaica, and Puerto Rico. Historically, Antillean manatees were hunted by local natives and sold to European explorers for food. Today, they are threatened by loss of habitat, poaching, entanglement with fishing gear, and increased boating activity. Several of Sirenian International's scientists study Antillean manatees in Belize, which may be the last stronghold for the subspecies. Funds for research, education, and conservation projects are desperately needed in other Central American nations.

Behavior and food

The West Indian manatee is surprisingly agile in water, and individuals have been seen doing rolls, somersaults, and even swimming upside-down. Manatees are not territorial and do not have complex predator avoidance behavior, as they have evolved in areas without natural predators. The common predators of marine mammals, such as orcas and large sharks, are rarely (if ever) found in habitats inhabited by this species.

The West Indian manatee is an opportunistic feeder, with large adults consuming 10% to 15% of their body weight in food daily. Manatees feed on about 60 plant species which includes sea grasses as their major food source. They also consume some fish and small invertebrates. Because manatees feed on abrasive plants, their molars are often worn down and are continually replaced throughout life, called "marching molars".

The West Indian manatee has a high casualty rate due to thermal shock from cold temperatures. During cold weather many die due to their digestive tract shutting down at water temperatures below 68 °F (20 °C). Many manatee deaths are caused by large commercial vessels but are attributed to "recreational watercraft" due to the elimination of that classification.

Reproduction

Although female West Indian manatees are mostly solitary creatures, they form mating herds while in estrus. Most females breed successfully between ages of seven and nine; they are, however, capable of reproduction as early as four years of age. The gestation period (pregnancy) lasts from twelve to fourteen months. Normally, one calf is born, although on rare occasions two have been recorded. The young are born with molars, allowing them to consume sea grass within the first three weeks of birth. On average, manatees that survive to adulthood will have between five and seven offspring between the ages of 20 and 26.

Manatee interaction with humans

The West Indian manatee has been hunted for hundreds of years for meat and hide, and continues to be hunted to this day in Central and South America. Illegal poaching, as well as collisions with speeding motorboats, are a constant source of manatee fatalities.

Due to their low reproductive rates, a decline in manatee population may be hard to overcome. They enjoy protection from the U.S. Endangered Species Act of 1973, and the U.S. Marine Mammal Protection Act of 1972. The West Indian Manatee is also protected by the Florida Manatee Sanctuary Act of 1978, the Manatee Recovery Plan, and the Save the Manatee Club. However, in April 2007, the U.S. Fish and Wildlife Service announced that the West Indian manatee population of Florida had rebounded. It advised that the species be reclassified as threatened rather than endangered. A computer model produced for the federal study showed a 50 percent chance that the current statewide manatee population of about 3,300 could dwindle over the next 50 years to just 500 on either coast.[11]

The Florida manatee subspecies (Trichechus manatus latirostris) was listed in October 2007 as Endangered by the IUCN on the basis of a population size of less than 2,500 mature individuals and a population that is estimated to be in decline by at least 20% over the next two generations (estimated at ~40 years) due to anticipated future changes in warm-water habitat and threats from increasing watercraft traffic over the next several decades.[12]

During the winter months, manatees often congregate near the warm water outflows of power plants along the coast of Florida instead of migrating south as they once did, causing some conservations to worry that they have become too reliant on these artificially warmed areas.[13] The U.S. Fish and Wildlife Service is trying to find a new way to heat the water for manatees that are dependent on plants that have closed.

References

  1. ^ Shoshani, Jeheskel (16 November 2005). "Order Sirenia (pp. 92-93)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 93. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=11600012. 
  2. ^ Deutsch, C.J., Self-Sullivan, C. & Mignucci-Giannoni, A. (2008). "Trichechus manatus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/22103. Retrieved 2010-01-27. 
  3. ^ Domning and Hayek; Hayek, Lee-Ann C. (1986). "Interspecific and intraspecific morphological variation in manatees (Sirenia: Trichechus)". Marine Mammal Science 2 (2): 87–144. doi:10.1111/j.1748-7692.1986.tb00034.x. 
  4. ^ Hatt (1934). "The American Museum Congo Expedition manatee and other recent manatees". Bulletin of the American Museum of Natural History 66: 533–566. 
  5. ^ Garcia-Rodriguez, B. W. Bowen, D. Domning, A. A. Mignucci-Giannoni, M. Marmontel, R. A. Montoya-Ospina, B. Moreales-Vela, M. Rudin, R. K. Bonde, and P. M. McGuire (1998). "Phylogeography of the West Indian manatee (Trichechusmanatus): How many populations and how many taxa?". Molecular Ecology 7 (9): 1137–1149. doi:10.1046/j.1365-294x.1998.00430.x. PMID 9734072. 
  6. ^ Vianna et al (2006). "Phylogeography, phylogeny and hybridization in trichechid sirenians: implications for manatee conservation". Molecular Ecology 15 (2): 433–47. doi:10.1111/j.1365-294X.2005.02771.x. PMID 16448411. 
  7. ^ [1] (2011).
  8. ^ Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0851122359
  9. ^ [2]
  10. ^ msnbc.msn.com
  11. ^ "Manatees May Lose Status". St. Petersburg Times. 2007-04-10. http://pqasb.pqarchiver.com/sptimes/access/1252260721.html?dids=1252260721:1252260721&FMT=FT&FMTS=ABS:FT&date=Apr+10%2C+2007&author=CRAIG+PITTMAN&pub=St.+Petersburg+Times&edition=&startpage=1.B&desc=MANATEES+MAY+LOSE+STATUS. Retrieved 2007-05-10 
  12. ^ "Trichechus manatus ssp. latirostris". IUCN Red List of Threatened Species. Version 2007. International Union for Conservation of Nature. 2007. http://www.iucnredlist.org/apps/redlist/details/22106. Retrieved 2007-12-03. 
  13. ^ http://www2.tbo.com/content/2011/jan/07/100913/can-manatees-survive-without-warm-waters-from-powe/
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: One of only four living species in the order Sirenia; the two other manatee species occur along the coast of West Africa (T. senegalensis) and in rivers of northeastern South America (T. inunguis). The other living sirenian, Dugong dugong, occurs in tropical bays and estuaries of the Indian and western Pacific oceans.

García-Rodríguez et al. (1998) examined range-wide phylogeography based on mtDNA variation in eight locations from Florida south to coastal Brazil. They detected three distinctive mtDNA lineages, corresponding approximately to: (1) Florida and the West Indies (Puerto Rico, Hispaniola); (2) Gulf of Mexico to the Caribbean rivers of South America (Mexico, Colombia, Venezuela); and (3) northeast Atlantic coast of South America (Guyana, Brazil). These lineages, which exhibit strong but incomplete geographical partitioning, are not concordant with previously recognized subspecies designations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!