Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Dugongs are usually seen as solitary individuals or in a group of two, although larger groups of several hundred individuals have often been recorded. The most stable and long-lasting groups appear to be mothers and calf pairs; calves suckle from their mothers for approximately 18 months (8). Dugongs can be extremely long-lived, reaching ages of 70 years or more (3). Both dugongs and manatees (Trichechus spp.) have a low metabolic rate allowing them to exist on a herbivorous diet, and consequently they usually move relatively slowly. They have pectoral mammary glands reminiscent of human breasts. These features may have caused sailors to liken them to mermaids or sirens; hence the order name of 'Sirenia' (5). Although most seagrass beds upon which dugongs feed occur at depths of 1 - 5m (4), they are known to feed at depths of up to 33 m (9). Using their flexible upper lip to rip out the whole plant, dugongs leave characteristic furrows known as 'feeding trails' on the sea floor (3). Dugongs are more closely related to elephants than the cows after which they are named, and have a particularly long large intestine to aid digestion (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Dugongs reproduce slowly and experience substantial hunting pressure in portions of their range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dewey, Tanya

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The dugong is the only living marine mammal to feed almost exclusively on plants (3), a trait that leads to its other common name of 'sea cow'. These large, rotund animals have short front flippers and a fluke-like tail that is used for propulsion (4). The thick skin is a grey-bronze colour and there are short, coarse hairs sparsely distributed over the body but concentrated as bristles on the muzzle (3). All dugongs grow tusks but these only break the skin, and therefore become visible, in mature males and old females (3). The large, rounded snout ends in a cleft, muscular upper lip that hangs over the down-turned mouth (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Dugongs are large sirenians found in coastal marine areas of the Pacific Ocean and the Red Sea, along coastal eastern Africa, India, the Malay Peninsula, and to Australia and New Guinea. They can get up to 900 kg in size and are herbivorous, feeding on sea grasses, macroalgae, and occasional invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dewey, Tanya

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Comores, Dodori, Eritrea, Gazi, Indo-Pacific, Kenya, Kiunga Marine National Reserve, Madagascar, Mkokoni Creeks, Mozambique, Msambweni Reef, Shimoni, Siyu Channel, Somalia, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Coastal and Island waters between East Africa and Vanuatu between latitudes of about 27° North and South of Equator. See Marsh et al. (2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dugongs (Dugong dugon), also known as sea cows, have a broad but fragmented range, encompassing tropical waters from East Africa to Vanuatu, about 26 degrees both north and south of the equator. This range spans at least 48 countries and about 140,000 km of tropical coastline. The largest population of sea cows is found in the northern waters of Australia between Shark Bay (Western Australia) and Moreton Bay (Queensland). The second largest population is found in the Arabian Gulf. Dugongs are not considered migratory but are known to travel great distances within their range in order to find food.

Biogeographic Regions: oriental (Native ); ethiopian (Native ); australian (Native ); indian ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

widely distributed in tropical and subtropical waters
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Red Sea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
East Africa to southern Japan, including U.S.A. (Trust Territories)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Dugongs have a wide range throughout the Indo-Pacific region from the east coast of Africa to islands of the western Pacific such as Vanuatu. Many populations are today severely depleted or almost extinct; the majority are found off the coast of northern Australia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dugongs are large, solid mammals with short, paddle-like front flippers and a tail with a straight or concave perimeter that is used as a propeller. Their tail differentiates them from manatees, the tail of which is paddle-shaped. Dugong fins resemble those of dolphins, but unlike dolphins, dugongs lack a dorsal fin. Females have mammary glands under the fins from which their calves suckle. Adult dugongs weigh from 230 to 400 kg and can range from 2.4 to 4 m in length. Their thick skin is brownish-grey, and its color can vary when algae grows on it. Tusks are present in all dugongs, but they are usually only visible through the skin in mature males, whose tusks are prominent, and in old females. Their tusks are projections of the incisor teeth. There are no other external physical differences between sexes, as they are monomorphic. Their ears have no flaps or lobes but are nonetheless very sensitive. Dugongs are suspected to have high auditory accuity to compensate for poor eye sight. Their snout is rather large, rounded over and ends in a cleft. This cleft is a muscular lip that hangs over the down-turned mouth and aids the dugong in its foraging of sea grass. Dugongs have a down-tipped jaw which accommodates the enlarged incisors. Sensory bristles that cover their upper lip assist in locating food. Bristles also cover the dugong’s body. Paired nostrils, used in ventilation when the dugong surfaces every few minutes, are located on top of the head. Valves keep them shut during dives.

The only other species known in the family Dugongidae is Hydrodamalis gigas (Steller’s sea cow), hunted to extinction in 1767, just 36 years after their discovery. They were similar in appearance and color to dugongs but were substantially larger, with a body length of 7 to 10 m and weight between 4,500 and 5,900 kg.

Range mass: 230 to 400 kg.

Range length: 2.4 to 4 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; ornamentation

  • Anderson, D. 1984. Sea Cows and Manatees. Pp. 292-303 in D Macdonald, P Forbes, B MacKeith, R Peberdy, G Bateman, eds. The Encyclopedia of Mammals, Vol. 1, 1st Edition. New York, NY: Facts on File Inc..
  • Odell, D. 2003. Dugongs and sea cows. Pp. 199-204 in D Kleiman, V Giest, M McDade, M Hutchins, eds. Grzimek's Animal Life Encyclopedia, Vol. 15, 2nd Edition. Farmington Hills: Gale Group.
  • Spain, A., H. Marsh, J. Wake, G. Heinsohn. 1977. The Dugong (Dugong dugon [Muller]) in the Seagrass System. Aquaculture, 12: 235-248. Accessed October 11, 2009 at http://dugong.id.au/publications/JournalPapers/1977/Heinsohn%20et%20al%201977.%20Aquaculture,%2012..pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Unlike their mostly freshwater cousins, manatees, dugongs are primarily marine mammals. Dugongs generally inhabit shallow waters, remaining at depths of around 10 m, although they occasionally dive to depths of 39 m to feed. These shallow areas are typically located in protected bays, wide mangrove channels and in sheltered areas of inshore islands. Seagrass beds consisting of phanerogamous seagrasses, their primary source of nourishment, coincide with these optimal habitats. Dugongs, however, are also observed in deeper water where the continental shelf is broad, neritic and sheltered. Dugongs use different habitats for different activities. For example, tidal sandbanks and estuaries that are quite shallow, are potential areas suitable for calving. Another example of specialized habitats are lekking areas, which are only used during mating season.

In a study off the coast of Australia, near Darwin, a pair of dugongs was captured in and tracked frequenting rocky reef habitats. Aerial surveys also showed that most dugongs in that region were found associated with a rocky reef. Because habitats of this kind have relatively low spatial coverage, dugongs actively select them. However, it is not known why dugongs frequently seem to forage in these areas, as there is no seagrasses on these reefs and they are not known algae consumers.

Range depth: 0 to 39 m.

Average depth: 10 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

coastal, also in bays and channels
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 26.555 - 28.645
  Nitrate (umol/L): 0.016 - 0.422
  Salinity (PPS): 34.445 - 35.083
  Oxygen (ml/l): 4.539 - 4.709
  Phosphate (umol/l): 0.114 - 0.270
  Silicate (umol/l): 0.900 - 6.969

Graphical representation

Temperature range (°C): 26.555 - 28.645

Nitrate (umol/L): 0.016 - 0.422

Salinity (PPS): 34.445 - 35.083

Oxygen (ml/l): 4.539 - 4.709

Phosphate (umol/l): 0.114 - 0.270

Silicate (umol/l): 0.900 - 6.969
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits shallow and protected (7) coastal waters (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Dugongs are primary consumers and the only completely herbivorous marine mammals. They consume seagrass, particularly of the families Potamogetonaceae and Hydrocharitaceae in the genera Halophila and Halodule. They prefer seagrasses that are low in fiber, high in available nitrogen, and are easily digestible for better nutrient absorption. Their long intestine aids the digestion of seagrass. They also have a low metabolism. When seagrass is scarce, dugongs also eat marine algae. They are speculated to supplement their diet with invertebrates such as polychaete worms, shellfish and sea squirts which live in seagrasses.

Dugongs use their flexible upper lip to rip up entire seagrass plants. If the entire plant cannot be uprooted, they rip off leaves. Their grazing leaves distinctive furrows in the seagrass beds that can be detected from the surface. To be supported properly by their environment for a year, dugongs require a territory with approximately 0.4 ha of seagrass. This area varies with individual and the extent of their movement, the amount of seagrass detected on the sea floor compared to what it actually ingested, the yearly productivities of seagrass, and the rates of re-growth of seagrass.

Animal Foods: aquatic or marine worms; other marine invertebrates

Plant Foods: algae; macroalgae

Primary Diet: herbivore (Folivore , Eats sap or other plant foods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kebiasaan Makan

Dugon adalah konsumen primer dan mamalia laut benar-benar herbivora. Mereka mengkonsumsi lamun, terutama dari keluarga dan Potamogetonaceae Hydrocharitaceae di Halophila marga dan Halodule. Mereka lebih memilih lamun yang rendah serat, tinggi dalam nitrogen yang tersedia, dan mudah dicerna untuk penyerapan nutrisi yang lebih baik. Usus panjang mereka membantu pencernaan lamun. Mereka juga memiliki metabolisme rendah. Ketika padang lamun langka, dugong juga makan ganggang laut. Mereka berspekulasi untuk melengkapi diet mereka dengan invertebrata seperti menyemprotkan polychaete cacing, kerang dan laut yang hidup di lamun.

Dugong menggunakan bibir fleksibel atas mereka untuk merobek-robek seluruh tanaman lamun. Jika seluruh lamun tidak bisa tercabut, mereka akan merobek daun. Sebagai herbivora mereka meninggalkan khas alur-alur di padang lamun yang dapat dideteksi dari permukaan. Harus didukung dengan baik oleh lingkungan mereka selama setahun, duyung membutuhkan suatu wilayah dengan sekitar 0,4 hektar padang lamun. Daerah ini bervariasi dengan individu dan sejauh mana gerakan mereka, jumlah lamun terdeteksi di dasar laut dibandingkan dengan apa yang sebenarnya dicerna, produktivitas tahunan padang lamun, dan tingkat pertumbuhan kembali dari padang lamun. Makanan Hewan: air atau cacing laut; invertebrata laut lainnya. Makanan: ganggang; makroalga dengan diet primer: herbivora (Folivore, Santapan getah atau makanan nabati lainnya).

Creative Commons Attribution 3.0 (CC BY 3.0)

© sri ratnaningsih

Supplier: sri ratnaningsih

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Intensive grazing of dugongs on seagrass has numerous effects on the ecosystem, both directly on the seagrass and indirectly on other organisms that live in or feed on seagrass. Their grazing contributes to nutrient cycling and energy flow as they stir up sediment. Their fecal matter also acts as a fertilizer, which helps seagrass to more quickly reestablish. However, in the short term, intense grazing reduces habitats and nurseries for important commercial fish species and other invertebrates which live in seagrass.

Ecosystem Impact: biodegradation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Dugongs have very few natural predators. Their massive size, tough skin, dense bone structure, and rapidly clotting blood may aid defenses. Sharks, crocodiles, and killer whales, however, feed on juvenile dugongs. Additionally, dugongs are often killed by humans. The are hunted by some ethnic tribes in Australia and Malaysia, caught in gill and mesh nets set by fishers, struck by boats and ships, and are losing habitat and resources due to anthropogenic activities.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Dugongs are very social creatures, occurring in mother and calf pairs to herds of 200 individuals. Communication is therefore vital among individuals in this species. The two primary methods of communication this species uses are sound and vision. Much like dolphins, dugongs use chirps, whistles, barks and other sounds that echo underwater in order to communicate. Each sound has its own amplitude and frequency that characterizes the signal, which implies a possible purpose. For example, “chirp-squeaks” have frequencies between 3 and 18 kHz and last for about 60 ms. These "chirp-squeaks" were observed in dugongs foraging on the sea floor for vegetation and when patrolling territories. Barks are used in aggressive behavior and trills in movements that seem to be displays. In order to hear the ranges of sound, dugongs have developed exceptional hearing, which they use more than their sight.

Visual communication is a useful source of communication when dugongs are in close contact. During breeding season, males perform lekking behavior, a physical display in a specific location to draw in females with which to mate. The vision of dugongs, however, is quite poor and they rely on other senses to create a mental map of their surroundings. Dugongs also utilize their sense of smell. They have an elementary olfactory system that allows them to sense chemicals in their environment to a certain degree. This can be used to detect other dugongs, or most likely, for foraging. They can smell aquatic plants and can therefore determine where the next feeding ground should be or where to proceed on their feeding furrow.

Touch is another sense that dugongs use in order to communicate. They have sensatory bristles all over their body, including many on their lip, which help detect vibrations from their surrounds. This allows dugongs to forage more efficiently as they can sense the seagrass against their bristles. This is particularly useful as it complements their poor eyesight. Mothers and calves also engage in physical communication, such as nose touching or nuzzling that strengthens their relationship. Mothers are almost always in physical contact with their calf, the calf either swimming beneath the mother by the fin or riding on top of her. Calve may even on occasion reach out a fin to touch their mother to gain reassurance.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: vibrations

Perception Channels: visual ; acoustic ; ultrasound ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Dugongs have lifespans of 70 years or more in the wild, which is estimated by counting the growth layers that make up a dugong’s tusks. However, they are prone to a extensive array of parasites and diseases, some of which are infectious. Dugongs are difficult to keep in captivity due to their specialized diet, which is expensive to provide as the specific type of seagrasses cannot be grown in captivity. Calves are rarely seen in captivity because they suckle for about 18 months after birth. Only one orphaned calf has ever been successfully introduced into captivity in Australia.

Average lifespan

Status: wild:
70 years.

Average lifespan

Status: wild:
70.0 years.

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: wild:
55.0 years.

Average lifespan

Status: wild:
55.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 73 years (captivity) Observations: The dugong may feature some form of continuous tooth development (Caleb Finch 1990). It is estimated that these animals live more than 50 years in the wild, with one estimate suggesting that they may live up to 73 years (Ronald Nowak 1999). Their longevity has not been studied in detail in captivity, but one animal was still alive after 25.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating behavior of dugongs varies slightly with location. For example, in a mating herd in Moreton Bay, off the coast of Queensland, males take part in aggressive competitions for females in oestrous. In comparison, dugongs in South Cove in Western Australia display a mating behavior similar to lekking. A lek refers to a traditional area where male dugongs gather during mating season to participate in competitive activities and displays that attract females. As these lekking areas lack resources necessary to females, they are drawn to the area only to view the males' displays. Male dugongs defend their territories, and they change their behavioral displays to attract females. After attracting females, male dugongs proceed through several phases in order to copulate. The “following phase” occurs when groups of males follow a single female, attempting to mate with her. The “fighting phase” occurs after, consisting of splashing, tail thrashing, rolls and body lunges. This can be violent, as witnessed by scars observed on the body of females and on competing males from their protruding tusks. The “mounting phase” occurs when a single male mounts a female from underneath, while more males continue to vie for that position. Hence, the female is mounted several times with the competing males, almost guaranteeing conception. Dugongs are thus polyandrous.

Mating System: polyandrous

Female dugongs reach sexual maturity at 6 years of age and may have their first calf between the ages of 6 and 17. Males reach sexual maturity between 6 and 12 years of age. Because breeding occurs year-round, males are always waiting for a female in oestrous. The reproductive rate of dugongs is very low, and they only produce one calf every 2.5 to 7 years depending on location. This may be due to the long gestation period, which is between 13 and 14 months. At birth, calves are about 30 kg in weight, 1.2 m in length, and very vulnerable to predators. Calves nurse for 18 months or longer, during which time they do not stray far from their mother, often riding on their mother's back. Despite the fact that dugong calves can eat seagrasses almost immediately after birth, the suckling period allows them to grow at a much faster rate. Calves mature between 6 and 9 years of age for both genders.n. Once mature, they leave their mothers and seek out potential mates.

Breeding interval: Females dugongs breed every 2.5 to 7 years.

Breeding season: Dugongs mate year round.

Average number of offspring: 1.

Range gestation period: 13 to 15 months.

Average birth mass: 30 kg.

Range weaning age: 14 to 18 months.

Average time to independence: 7 years.

Range age at sexual or reproductive maturity (female): 6 to 17 years.

Range age at sexual or reproductive maturity (male): 6 to 12 years.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 27500 g.

Average number of offspring: 1.

Females dugongs invest considerable time and energy in raising calves and are the primary caregivers of their young. Mothers and calfs form a bond which is strengthened throughout the long suckling period of the calf, which is up to 18 months, as well as physical touches that occur during swimming and nursing. Each female spends about 6 years with their calf. During the first 1.5 years, mothers nurse their calf and demonstrate how to feed on seagrasses. The next 4.5 years, or until the calf reaches maturity, are spent feeding together and bonding. In their early years, calves do not travel far from their mother as they are easy prey for sharks, killer whales and crocodiles.

Parental Investment: precocial ; female parental care ; pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dugong dugon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGACTGTTCTCAACTAACCACAAAGACATTGGAACTCTGTACCTACTATTTGGCGCTTGAGCCGGGATGGTAGGAACCGCCCTAAGTATCTTAATTCGAGCTGAGTTGGGCCAACCAGGTACCCTACTAGGAGATGACCAAATCTATAATGTCATCGTAACGGCTCATGCCTTCGTGATAATTTTCTTCATAGTGATACCCATCATAATTGGAGGCTTCGGAAACTGGCTGGTCCCTCTAATAATCGGAGCACCTGATATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTTTGCCCCCCTCATTCCTTCTCCTACTGGCCTCATCTATAATCGAAGCTGGGGCCGGAACGGGCTGAACAGTCTACCCGCCTCTAGCAGGGAACCTAGCTCATGGTGGGGCCTCAGTAGATCTAACAATCTTCTCACTCCACCTGGCTGGGGTGTCCTCAATTCTAGGGGCTATCAATTTTATCACCACAATCATCAACATAAAACCCCCAGCTATAACCCAATACCAAACTCCCTTATTTGTTTGATCTGTCCTAGTCACGGCCGTCTTACTCCTTTTATCCCTTCCAGTCCTAGCAGCGGGGATCACGATACTCCTAACTGACCGCAACCTGAACACGACCTTCTTCGACCCAGCTGGGGGAGGAGACCCAATCCTGTATCAACACCTATTCTGATTTTTCGGGCACCCTGAGGTATATATTCTTATCCTGCCAGGATTTGGTATAATCTCACATATTGTCACCTACTATTCAGGTAAGAAAGAACCATTTGGATATATGGGAATGGTCTGAGCTATAATATCAATCGGTTTCCTTGGATTTATCGTATGAGCCCACCACATATTCACTGTAGGGATGGATGTGGATACCCGAGCCTACTTTACGTCAGCTACAATAATTATCGCTATCCCAACAGGCGTGAAAGTATTTAGCTGATTAGCTACACTCCACGGCGGCAACATCAAATGGTCCCCTGCCCTACTGTGAGCACTAGGCTTCATCTTCCTATTTACAGTTGGGGGCCTGACAGGAATCGTTCTAGCCAACTCCTCATTAGACGTTGTCCTCCATGACACCTACTATGTCGTCGCACATTTCCACTACGTCCTATCTATAGGTGCTGTATTCGCCATCATAGGTGGGTTCGTCCACTGGTTCCCTCTATTTTCAGGGTACACACTCAATCAAACATGAGCTAAAATCCACTTCCTAATCATATTTGTAGGTGTCAACCTAACATTCTTCCCTCAACATTTCCTCGGCTTATCAGGTATACCTCGTCGATACTCAGACTATCCAGACGCCTACACCATGTGGAACACTGTATCCTCTATAGGGTCATTTATTTCACTCACAGCCGTGATCCTAATAGTATTCATGGTATGAGAAGCATTTGCCTCTAAACGAGAAGTTTCTACAGTTGAACTAACAACAACCAACCTAGAGTGACTCAACGGCTGCCCGCCTTCATACCACACATTTGAAGAACCAGCCTATGTCAAGATCTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dugong dugon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bcd

Version
3.1

Year Assessed
2008

Assessor/s
Marsh, H.

Reviewer/s
Reynolds III, J.E. & Powell, J.A. (Sirenia Red List Authority)

Contributor/s

Justification
The dugong’s range spans at least 48 countries and an estimated 140,000 km of coastline. We have used two relatively crude relative indices of extent of occurrence: (1) length of coastline, and (2) area of continental shelf with a depth of <10 m. We then assembled the evidence for all countries in the dugong’s range based on the review of the status of the dugong throughout its range conducted in 2002 with the assistance of more than 100 experts (Marsh et al. 2002) plus additional literature published since that time (see Tables 1.1 and 1.2 in attached PDF). The results of this synthesis are summarized in Table 2.1 (see attached PDF). This synthesis indicates that the dugong is declining or extinct in at least a third of its range, of unknown status in about half its range and possibly stable in the remainder – mainly the remote coasts of the Northern Territory and Western Australia.

The only reference site is the urban coast of Queensland where the most robust quantitative data on population trends are available and a 40 year time series of catch rates in nets set for bather protection indicates that the CPUE in 1999 was only 3% of that in 1962 (Marsh et al. 2005). This CPUE is considered an index of dugong decline in the region from all causes during this period. This decline and modern aerial survey estimates of dugong abundance were used to backcast the population in the region in the early 1960s (which would be expected to have been lower than that at the time of European settlement as a cottage commercial industry for dugong oil had existed at several locations along this coast since the 1850s. The extrapolation suggested that the region supported 72,000 (95% CI 31,000, 165,000) dugongs in the early 1960s compared with an estimated 4,220 (95% CI 2,360, 8,360) dugongs in the mid 1990s. The seagrass habitat in the region is currently insufficient to support 72,000 dugongs, a result which suggests that the habitat had also declined (unlikely) or that the shark net CPUE has overestimated the decline (see Marsh et al. 2005). If the magnitude of this decline was robust and typical of the entire range of the dugong, the dugong would qualify for being classified as Critically Endangered at a global scale.

As summarized in Table 2.1, the major causes of the dugong’s decline along the urban coast of Queensland are still present in most of the dugong’s range as follows: gill netting 87-99%, subsistence hunting 85-98%, human settlement 82-85%, agricultural pollution 80-89%. The magnitude of these threats is likely to be greater in most other parts of the dugong’s range than in Queensland. The Queensland coast supports a low human population density relative to most other parts of the dugong’s range and has a well developed system of marine parks and pro-active management. There is also anecdotal evidence that the area of occupancy of the dugong has declined in many parts of its range, especially along the coasts of east African and India where anecdotal evidence suggests that it is at high risk of extinction.

Even in the regions where we have classified the status of the dugong as stable, this classification is unconfirmed. Much of the northern Western Australian and some of the Northern Territory coast has never been surveyed for dugongs and there are no accurate estimates of the Indigenous harvest. The sustainability of this harvest must be questioned as it has been shown to be unsustainable by population modeling in remote parts of Queensland and Torres Strait (Heinsohn et al. 2004, Marsh et al. 2004).

Genetic information on dugong stocks is limited. Recent work based on mitochondrial DNA and microsatellite markers (Brenda McDonald, unpublished data) indicates that the Australian dugong population is not panmictic. There is clear evidence of two maternal lineages, which have a geographical basis apparently reflecting the existence of the Torres Strait land bridge between Australia and PNG, despite the flooding of this land bridge some six thousand years ago. The Australian dugong population still has a fair degree of genetic diversity indicating that recent losses are not yet reflected in the genetic makeup of the population. There is some evidence of gene flow between dugongs in Australia and Eastern Indonesia.

To date, there has been little effective management intervention to reduce anthropogenic impacts on the dugong, apart from legislative protection which is almost ubiquitous throughout its range. Management plans have been developed for some 22-24% of the range (mainly in Australia) but are in place in only 18-22% of the range. The dugong is protected by marine protected areas in 22-23% of its range (again mostly in Australia) (see Table 1.3 in attached PDF).

Because of the uncertainty associated with the assessment of the status of the dugong both on the Queensland coast based on the CPUE data (Marsh et al. 2005) and the rest of its range, we suggest that the classification should remain as Vulnerable A2bcd.

Follow the link below to see the tables referred to in the text.

History
  • 2006
    Vulnerable
    (IUCN 2006)
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dugongs are listed as a vulnerable on the IUCN Red List, endangered on the US Federal list, and is on Appendix I on CITES. This threatened status is primarily due to human hunting and activities. Dugongs are inadvertently trapped in fish and shark nets and die due to lack of oxygen. They also get struck by boats and ships. Additionally, pollution into the oceans from surrounding land kills seagrass beds and may also negatively influence dugongs directly. Dugongs are also hunted for their meat, oil and other valuable commodities as previously mentioned.

Populations of dugongs are unable to rebound in part because of their very low reproduction rate. If all female dugongs in the population bred at their full potential, the maximum rate the population could increase is 5%. This rate is low even despite their long lifespan and low natural mortality rate from lack of predators.

Some protected sites for dugongs have been established, particularly off the coast of Australia. These areas contain seagrass beds and optimal environments for dugongs, such as shallow water and areas in which to calve. Reports have been made assessing what each country in the dugong range should carry out to preserve and rehabilitate these gentle creatures.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Numbers low or very low, but unknown whether there is a sustainable population in Egypt.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/02/1970
Lead Region: Foreign (Region 10) 
Where Listed: except Palau

Status: Endangered
Date Listed: 12/02/1970
Lead Region: Foreign (Region 10) 
Where Listed: in Palau


Population detail:

Population location: Palau
Listing status: E

Population location: Entire, except Palau
Listing status: E

For most current information and documents related to the conservation status and management of Dugong dugon , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU - A1cd) on the IUCN Red List 2002. Listed on Appendix I of CITES, and Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total population size is unknown. See Marsh et al. (2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Traditionally persecuted by humans throughout much of their range for their meat, hide and oil; their rather slow movement, large size and dependence on coastal habitats has made dugongs particularly vulnerable to human impacts (2). Fishing nets have also been a major cause of population decline as dugongs are unable to hold their breath for more than about 12 minutes and therefore easily drown once entangled (3). Dugongs have decreased in number throughout their range to the extent that in some areas only relict populations remain, but a significant stronghold still persists in Australia (3). Even here however, these animals are under threat from fishing nets, habitat loss from the silting of sea grass beds, pollution, boat traffic and illegal hunting (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

International trade in dugongs is banned by its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (1). They are also found within the Great Barrier Reef World Heritage Area, and the Great Barrier Reef Marine Park Authority is currently working with other agencies in an effort to halt the decline in this species (3). A system of 16 Dugong Protection Areas, where there are key populations, has been established and there is ongoing research into the distribution and behaviour of this gentle mermaid of the sea (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of dugongs on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Dugongs are economically valuable while alive as a form of ecotourism. Activities such as dugong-watching cruises in Australia and swimming with dugongs in the Philippines and Vanuatu help local economies. Dugongs are also hunted for a variety of reasons. In Malaysia, dugongs are eaten opportunistically when incidentally caught in fishing nets or traps and when incidentally or purposely caught when fish bombing, a method of fishing which involves throwing a bomb into the water. Dugongs killed in these circumstances are usually consumed locally or sold to neighboring islands for a good price, as the meat is considered a delicacy. One dugong apparently sold for $105 USD, which could stimulate local economy. In Australia, some native people regard hunting the dugong an integral part of their traditions. Humans eat their meat and use their oil. Dugong tusks are also used as a treatment for a variety of ailments including asthma, back pain, and shock. Tusks are also made into amulets and, in powdered form, mixed to make a drink. Smoking pipes can be carved from the tusks and the emitted smoke is said to have medicinal properties. Dugongs provide a thriving trade between villages and islands, although trafficking dugong parts is illegal.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dugong

The dugong (Dugong dugon) is a large marine mammal which, together with the manatees, is one of four living species of the order Sirenia. It is the only living representative of the once-diverse family Dugongidae; its closest modern relative, Steller's sea cow (Hydrodamalis gigas), was hunted to extinction in the 18th century. It is also the only sirenian in its range, which spans the waters of at least 37 countries throughout the Indo-Pacific, though the majority of dugongs live in the northern waters of Australia between Shark Bay and Moreton Bay. The dugong is the only strictly marine herbivorous mammal, as all species of manatee use fresh water to some degree.

Like all modern sirenians, the dugong has a fusiform body with no dorsal fin or hind limbs, instead possessing paddle-like forelimbs used to manoeuvre. It is easily distinguished from the manatees by its fluked, dolphin-like tail, but also possesses a unique skull and teeth. The dugong is heavily dependent on seagrasses for subsistence and is thus restricted to the coastal habitats where they grow, with the largest dugong concentrations typically occurring in wide, shallow, protected areas such as bays, mangrove channels and the lee sides of large inshore islands. Its snout is sharply downturned, an adaptation for grazing and uprooting benthic seagrasses.

The dugong has been hunted for thousands of years for its meat and oil. Traditional hunting has great cultural significance throughout its range. The dugong's current distribution is reduced and disjunct, and many populations are close to extinction. The IUCN lists the dugong as a species vulnerable to extinction, while the Convention on International Trade in Endangered Species limits or bans the trade of derived products. Despite being legally protected in many countries, the main causes of population decline remain anthropogenic and include hunting, habitat degradation, and fishing-related fatalities. With its long lifespan of 70 years or more, and slow rate of reproduction, the dugong is especially vulnerable to extinction.

Contents

Etymology and taxonomy [edit]

The word "dugong" derives from the Tagalog term dugong which was in turn adopted from the Malay duyung, both meaning "lady of the sea".[3] Other common local names include "sea cow", "sea pig" and "sea camel".[4]

Dugong dugon is the only extant species of the Dugongidae family, and one of only four extant species of the Sirenia order, the others forming the manatee family.[5] It was first classified by Müller in 1776 as Trichechus dugon,[6] a member of the manatee genus previously defined by Linnaeus.[7] It was later assigned as the type species of Dugong by Lacépède[8] and further classified within its own family by Gray[9] and subfamily by Simpson.[10]

Dugongs and other sirenians are not closely related to other marine mammals, being more related to elephants.[11] Dugongs and elephants share a monophyletic group with hyraxes and the aardvark, one of the earliest offshoots of eutherians. The fossil record shows sirenians appearing in the Eocene, where they most likely lived in the Tethys Ocean. The two extant families of sirenians are thought to have diverged in the mid-Eocene, after which the dugongs and their closest relative, the Steller's sea cow, split off from a common ancestor in the Miocene. The Steller's sea cow became extinct in the 18th century. No fossils exist of other members of the Dugongidae.[12]

Molecular studies have been made on dugong populations using mitochondrial DNA. The results have suggested that the population of Southeast Asia is distinct from the others. Australia has two distinct maternal lineages, one of which also contains the dugongs from Africa and Arabia. Limited genetic mixing has taken place between those in Southeast Asia and those in Australia, mostly around Timor.[5] One of the lineages stretches all the way from Moreton Bay to Western Australia, while the other only stretches from Moreton Bay to the Northern Territory.[11] However, there is not yet sufficient genetic data to make clear boundaries between distinct groups.[5]

Anatomy and morphology [edit]

The dugong's body is large with a cylindrical shape that tapers at both ends. It has thick, smooth skin that is a pale cream colour at birth, but darkens dorsally and laterally to brownish-to-dark-grey with age. The colour of a dugong can change due to the growth of algae on the skin.[13] The body is sparsely covered in short hair, a common feature among sirenians which may allow for tactile interpretation of their environment.[14] These hairs are most developed around the mouth, which has a large horseshoe shaped upper lip forming a highly mobile muzzle.[12] This muscular upper lip aids the dugong in foraging.[13]

Diagram of the bones in a dugong forelimb at different stages of life
Bones in the forelimb can fuse variously with age.

The dugong's tail flukes[15] and flippers[11] are similar to those of dolphins. These flukes are raised up and down in long strokes to move the animal forward, and can be twisted to turn. The forelimbs are paddle-like flippers which aid in turning and slowing.[12] The dugong lacks nails on its flippers, which are only 15% of a dugong's body length.[12] The tail has deep notches.[16]

A dugong's brain weighs a maximum of 300 g (11 oz), about 0.1% of the animal's body weight.[12] With very small eyes,[17] dugongs have limited vision, but acute hearing within narrow sound thresholds. Their ears, which lack pinna, are located on the sides of their head. The nostrils are located on top of the head and can be closed using valves.[11] Dugongs have two teats, one located behind each flipper.[12] There are few differences between sexes; the body structures are almost the same.[13] A male's testes are not externally located, and the main difference between males and females is the location of the genital aperture in relation to the umbilicus and the anus. The lungs in a dugong are very long, extending almost as far as the kidneys, which are also highly elongated in order to cope with the saltwater environment.[12] If wounded, a dugong's blood will clot rapidly.[13]

The skull of a dugong is unique.[16] The skull is enlarged with sharply downturned premaxilla, which are stronger in males. The spine has between 57 and 60 vertebrae.[12] Unlike in manatees, the dugong's teeth do not continually grow back via horizontal tooth replacement.[18] The dugong has two incisors (tusks) which emerge in males during puberty. The female's tusks continue to grow without emerging during puberty, sometimes erupting later in life after reaching the base of the premaxilla.[12] The number of growth layer groups in a tusk indicates the age of a dugong,[5] and the cheekteeth move forward with age. The full dental formula of dugongs is 2.0.3.33.1.3.3, meaning they have two incisors, three premolars, and three molars on each side of their upper jaw, and three incisors, one canine, three premolars, and three molars on each side of their lower jaw.[16] Like other sirenians, the dugong experiences pachyostosis, a condition in which the ribs and other long bones are unusually solid and contain little or no marrow. These heavy bones, which are among the densest in the animal kingdom,[19] may act as a ballast to help keep sirenians suspended slightly below the water's surface.[20]

An adult's length rarely exceeds 3 metres (9.8 ft). An individual this long is expected to weigh around 420 kilograms (926 lb). Weight in adults is typically more than 250 kilograms (551 lb) and often less than 900 kilograms (1,984 lb).[21] The largest individual recorded was 4.06 metres (13.32 ft) long and weighed 1,016 kilograms (2,240 lb),[12] and was found off the Saurashtra coast of west India.[22] Females tend to be larger than males.[12]

Distribution and habitat [edit]

Dugong on its side stirring up sand
Dugong on the sea floor at Marsa Alam, Egypt

Dugongs are found in warm coastal waters from the western Pacific Ocean to the eastern coast of Africa,[15] along an estimated 140,000 kilometres (86,992 mi) of coastline[2] between 26° and 27° degrees to the north and south of the equator. Their historic range is believed to correspond to that of seagrasses from the Potamogetonaceae and Hydrocharitaceae families. The full size of the former range is unknown, although it is believed that the current populations represent the historical limits of the range,[5] which is highly fractured.[13] The dugong is the only strictly-marine herbivorous mammal, as all species of manatee utilise fresh water to some degree. Recorded numbers of dugongs are generally believed to be lower than actual numbers, due to a lack of accurate surveys. Despite this, the dugong population is thought to be shrinking,[5] with a worldwide decline of 20 per cent in the last 90 years. They have disappeared from the waters of Hong Kong, Mauritius, and Taiwan, as well as parts of Cambodia, Japan, the Philippines and Vietnam. Further disappearances are likely.[11]

Populations of dugongs exist in the water of 37 countries and territories.[11] In the late 1960s, herds of up to 500 dugongs were observed off the coast of East Africa and nearby islands. However, current populations in this area are extremely small, numbering 50 and below, and it is thought likely they will become extinct. The eastern side of the Red Sea is the home of large populations numbering in the hundreds, and similar populations are thought to exist on the western side. In the 1980s, it was estimated there could be as many as 4,000 dugongs in the Red Sea. The Persian Gulf has the second-largest dugong population in the world, inhabiting most of the southern coast,[5] and the current population is believed to be around 7,500.[17]

A highly isolated breeding population exists in the Gulf of Kutch, the only population remaining in western India. It is 1,500 kilometres (932 mi) from the population in the Persian Gulf, and 1,700 kilometres (1,056 mi) from the nearest population in India. Former populations in this area, centred on the Maldives and the Laccadive Islands, are presumed to be extinct. A population exists in the Gulf of Mannar and the Palk Strait between India and Sri Lanka, but it is seriously depleted. A small population exists around the Nansei Shoto islands, and a population formerly existed off Taiwan.[5] An endangered population of 50 or fewer dugongs survives around Okinawa.[23]

Dugong swimming in blue water with a remora attached
Dugong with attached remora off Lamen Island, Vanuatu.

A small population exists off Southern China, centred around the island of Hainan. The population around the Andaman and Nicobar Islands are known only from a few records, and although the population was large during British rule, it is now believed to be small and scattered. All the islands of the Philippines are believed to have once provided habitat for dugongs, which were common until the 1970s. The Gulf of Thailand also used to have a large population, but they have not recently been sighted in the west of the gulf, and the population in the east is thought to be very small. Dugongs are believed to exist in the Straits of Johor in very small numbers. The waters around Borneo support a small population, with more scattered throughout the Malay archipelago. Populations exists around the Solomon Islands archipelago and New Caledonia, stretching to a westernmost population in Vanuatu. A highly isolated population lives around the islands of Palau.[5]

Australia is home to the largest population, stretching from Shark Bay in Western Australia to Moreton Bay in Queensland.[11] The population of Shark Bay is thought to be stable with over 10,000 dugongs. Smaller populations exist up the coast, including one in Ashmore reef. Large numbers of dugongs live to the north of the Northern Territory, with a population of over 20,000 in the gulf of Carpentaria alone. A population of over 25,000 exists in the Torres Strait, although there is significant migration between the strait and the waters of New Guinea.[5] The Great Barrier Reef provides important feeding areas for the species;[24] this reef area houses a stable population of around 10,000, although the population concentration has shifted over time. Large bays facing north on the Queensland coast provide significant habitats for dugong, with the southernmost of these being Hervey Bay and Moreton Bay.[11]

Dugongs are generally found in warm waters around the coast[15] with large numbers concentrated in wide and shallow protected bays. Large numbers also exist in wide and shallow mangrove channels and around leeward sides of large inshore islands, where seagrass beds are common.[5] They are usually located at a depth of around 10 m (33 ft),[13] although in areas where the continental shelf remains shallow dugongs have been known to travel more than 10 kilometres (6 mi) from the shore, descending to as far as 37 metres (121 ft), where deepwater seagrasses such as Halophila spinulosa are found.[5] Special habitats are used for different activities. It has been observed that shallow waters are used as sites for calving, minimising the risk of predation. Deep waters may provide a thermal refuge from cooler waters closer to the shore during winter.[5]

Ecology and life history [edit]

A large dugong swimming towards the right with a smaller dugong half its size hugging its back, both in very shallow water with the surface and seabed just above and below them respectively
A mother and calf in shallow water

Dugongs are long lived, and the oldest recorded specimen reached age 73.[5] They have few natural predators, although animals such as crocodiles, killer whales, and sharks pose a threat to the young,[11] and a dugong has also been recorded to have died from trauma after being impaled by a stingray barb. A large number of infections and parasitic diseases affect dugongs. Detected pathogens include helminths, cryptosporidium, different types of bacterial infections, and other unidentified parasites. 30% of dugong deaths in Queensland since 1996 are thought to be because of disease.[5]

Although they are social animals, they are usually solitary or found in pairs due to the inability of seagrass beds to support large populations.[13] Gatherings of hundreds of dugongs sometimes happen,[15] but they last only for a short period of time.[13] Because they are shy, and do not approach humans, little is known about dugong behaviour.[13] They can go six minutes without breathing (though about two and a half minutes is more typical),[25] and have been known to rest on their tail to breathe with their heads above water.[15] They can dive to a maximum depth of 39 metres (128 ft), although they spend most of their lives no deeper than 10 metres (33 ft). Communication between individuals is through chirps, whistles, barks, and other sounds that echo underwater. Different sounds have been observed with different amplitudes and frequencies, implying different purposes. Visual communication is limited due to poor eyesight, and is mainly used for activities such as lekking for courtship purposes. Mothers and calves are in almost constant physical contact, and calves have been known to reach out and touch their mothers with their flippers for reassurance.[13]

Dugongs are semi-nomadic, often travelling long distances in search of food, but staying within a certain range their entire life.[13] Large numbers often move together from one area to another. It is thought that these movements are caused by changes in seagrass availability. Their memory allows them to return to specific points after long travels.[11] Dugong movements mostly occur within a localised area of seagrass beds, and animals in the same region show individualistic patterns of movement. Daily movement is affected by the tides. In areas where there is a large tidal range, dugongs travel with the tide in order to access shallower feeding areas. In Moreton Bay, dugongs often travel between foraging grounds inside the bay and warmer oceanic waters. At higher latitudes dugongs make seasonal travels to reach warmer water during the winter. Occasionally individual dugongs make long-distance travels over many days, and can travel over deep ocean waters.[5] One animal was seen as far south as Sydney.[12] Although they are marine creatures, dugongs have been known to travel up to 2.7 kilometres (1.7 mi) up creeks, and in one case a dugong was caught 15 kilometres (9.3 mi) up a creek near Cooktown.[11]

Feeding [edit]

A river flowing into the ocean forming a small delta
Typical dugong feeding area in Moreton Bay

Dugongs, along with other sirenians, are referred to as "sea cows" because their diet consists mainly of sea-grass. When eating they ingest the whole plant, including the roots,[11] although when this is impossible they will feed on just the leaves.[5] A wide variety of seagrass has been found in dugong stomach contents, and evidence exists they will eat algae when seagrass is scarce.[12] Although almost completely herbivorous,[13] they will occasionally eat invertebrates such as jellyfish, sea squirts, and shellfish.[11] Dugongs in Moreton Bay, Australia, are omnivorous, feeding on invertebrates such as polychaetes[26] or marine algae when the supply of their choice grasses decreases. In other southern areas of both western and eastern Australia, there is evidence that dugongs actively seek out large invertebrates. This does not apply to dugongs in tropical areas, from which faecal evidence indicates that invertebrates are not eaten.[5]

Most dugongs do not feed from lush areas, but where the seagrass is more sparse. However, additional factors such as protein concentration and regenerative ability also affect the value of a seagrass bed.[11] The chemical structure and composition of the seagrass is important, and the grass species most often eaten are low in fibre, high in nitrogen, and easily digestible.[5] In the Great Barrier Reef, dugongs feed on low-fibre high-nitrogen seagrass such as Halophila and Halodule,[11] so as to maximize nutrient intake instead of bulk eating. Seagrasses of a lower seral are preferred, where the area has not fully vegetated. Only certain seagrass meadows are suitable for dugong consumption, due to the dugong's highly specialised diet. There is evidence that dugongs actively alter seagrass species compositions at local levels. Dugongs may search out deeper seagrass. Feeding trails have been observed as deep as 33 metres (108 ft), and dugongs have been seen feeding as deep as 37 metres (121 ft).[5] Dugongs are relatively slow moving, swimming at around 10 kilometres per hour (6.2 mph).[27] When moving along the seabed to feed they walk on their pectoral fins.[16]

Due to their poor eyesight, dugongs often use smell to locate edible plants. They also have a strong tactile sense, and feel their surroundings with their long sensitive bristles.[13] They will dig up an entire plant and then shake it to remove the sand before eating it. They have been known to collect a pile of plants in one area before eating them.[16] The flexible and muscular upper lip is used to dig out the plants. This leaves furrows in the sand in their path.[13]

Reproduction and parental care [edit]

A dugong mother with a calf half its size travelling just above the seabed
Dugong mother and offspring from East Timor

A dugong reaches sexual maturity between the ages of eight and eighteen, older than in most other mammals.[28] However, the age when a female first gives birth is disputed, with some studies placing the age between ten and seventeen years, while others place it as early as six years.[5] There is evidence that male dugongs lose fertility at older ages.[12] Despite the longevity of the dugong, which may live for 50 years or more, females give birth only a few times during their life, and invest considerable parental care in their young.[28] The time between births is unclear, with estimates ranging from 2.4 to 7 years.[5]

Mating behaviour varies between populations located in different areas.[13] In some populations, males will establish a territory which females in heat will visit.[5] In these areas a male will try to impress the females while defending the area from other males, a practice known as lekking.[13] In other areas many males will attempt to mate with the same female,[5] sometimes inflicting injuries to the female or each other.[11] During this the female will have copulated with multiple males, who will have fought to mount her from below. This greatly increases the chances of conception.[13]

Females give birth after a 13–15 month gestation, usually to just one calf.[28] Birth occurs in very shallow water, with occasions known where the mothers were almost on the shore.[12] As soon as the young is born the mother pushes it to the surface to take a breath.[15] Newborns are already 1.2 metres (4 ft) long and weigh around 30 kilograms (66 lb).[11] Once born, they stay close to their mothers, possibly to make swimming easier.[12] The calf nurses for 14–18 months, although it begins to eat seagrasses soon after birth.[5] A calf will only leave its mother once it has matured.[13]

Importance to humans [edit]

Cave painting that has a shape resembling a dugong
A cave painting of a dugong - Tambun Cave, Perak, Malaysia

Dugongs have historically provided easy targets for hunters, who killed them for their meat, oil, skin, and bones. They are often considered as the inspiration for mermaids,[15] and people around the world developed cultures around dugong hunting. In some areas it remains an animal of great significance,[12] and a growing ecotourism industry around dugongs has had economic benefit in some countries.[13]

There is a 5,000-year old wall painting of a dugong, apparently drawn by neolithic peoples, in Tambun Cave of Ipoh city in the state of Perak, Malaysia.[29] This was discovered by Lieutenant R.L Rawlings in 1959 while on a routine patrol. During the Renaissance and the Baroque eras, dugongs were often exhibited in wunderkammers. They were also presented as Fiji mermaids in sideshows.

Dugong meat and oil have traditionally been some of the most valuable foods of Australian aborigines and Torres Strait Islanders. Some aborigines regard dugongs as part of their Aboriginality.[11] Dugongs have also played a role in legends in Kenya, and the animal is known there as the "Queen of the Sea". Body parts are used as food, medicine, and decorations. In the Gulf states, dugongs served not only as a source of food, but their tusks were used as sword handles. Dugong oil is important to people in India, and its meat is believed to be an aphrodisiac. Dugong ribs were used to make carvings in Japan. In Southern China dugongs were traditionally regarded as a "miraculous fish", and it was bad luck to catch them. However, a wave of immigration beginning at the end of the 1950s resulted in dugongs being hunted for food. In the Philippines dugongs are thought to bring bad luck, and parts of them are used to ward against evil spirits. In areas of Thailand it is believed that the dugong's tears form a powerful love potion, while in parts of Indonesia they are considered reincarnations of women. In Papua New Guinea they are seen as a symbol of strength.[5]

Dugongs' or sea cows' hides have been thought[30] to have been used as coverings in the building of the Old Testament portable worship tent known as the Tabernacle.

Conservation [edit]

Dugong numbers have decreased in recent times. For a population to remain stable, 95 per cent of adults must survive the span of one year. The estimated percentage of females humans can kill without depleting the population is 1-2%.[11] This number is reduced in areas where calving is minimal due to food shortages. Even in the best conditions a population is unlikely to increase more than 5% a year, leaving dugongs vulnerable to over-exploitation. The fact that they live in shallow waters puts them under great pressure from human activity. Research on dugongs and the effects of human activity on them has been limited, mostly taking place in Australia. In many countries, dugong numbers have not even been surveyed. As such, trends are uncertain, with more data needed for comprehensive management.[5] The only data stretching back far enough to mention population trends comes from the urban coast of Queensland, Australia. The last major worldwide study, made in 2002, concluded that the dugong was declining and possibly extinct in a third of its range, with unknown status in another half.[2]

The IUCN Red List lists the dugong as vulnerable, and the Convention on International Trade in Endangered Species of Wild Fauna and Flora regulates and in some areas has banned international trade.[12] Regional cooperation is important due to the widespread distribution of the animal, and in 1998 there was strong support for Southeast Asian cooperation to protect dugongs. Kenya has passed legislation banning the hunting of dugongs and restricting trawling, but the dugong is not yet listed under Kenya's Wildlife Act for endangered species. Mozambique has had legislation to protect dugongs since 1955, but this has not been effectively enforced. Many marine parks have been established on the African coast of the Red Sea, and the Egyptian Gulf of Aqaba is fully protected. The United Arab Emirates has banned all hunting of dugongs within its waters, as has Bahrain. The UAE has additionally banned drift net fishing. India and Sri Lanka ban the hunting and selling of dugongs and their products. Japan has listed dugongs as endangered and has banned intentional kills and harassment. Hunting, catching, and harassment is banned by the People's Republic of China. The first marine mammal to be protected in the Philippines was the dugong, although monitoring this is difficult. Palau has legislated to protect dugongs, although this is not well enforced and poaching persists. The dugong is a national animal of Papua New Guinea, which bans all except traditional hunting. Vanuatu and New Caledonia ban hunting of dugongs. Dugongs are protected throughout Australia, although the rules vary by state; in some areas indigenous hunting is allowed.[5] Dugongs are listed under the Nature Conservation Act in the Australian state of Queensland as vulnerable. Most currently live in established marine parks, where boats must travel at a restricted speed and mesh net fishing is restricted.[11]

Human activity [edit]

Despite being legally protected in many countries, the main causes of population decline remain anthropogenic and include hunting, habitat degradation, and fishing-related fatalities.[4] Entanglement in fishing nets has caused many deaths, although there are no precise statistics. Most issues with industrial fishing occur in deeper waters where dugong populations are low, with local fishing being the main risk in shallower waters.[5] As dugongs cannot stay underwater for a very long period, they are highly prone to deaths due to entanglement.[17] The use of shark nets has historically caused large numbers of deaths, and they have been eliminated in most areas and replaced with baited hooks.[11] Hunting has historically been a problem too, although in most areas they are no longer hunted, with the exception of certain indigenous communities. In areas such as northern Australia, hunting remains the greatest impact on the dugong population.[5]

Vessel strikes have proved a problem for manatees, however the relevance of this to dugongs is unknown.[5] Increasing boat traffic has increased danger,[11] especially in shallow waters. Ecotourism has increased in some countries, although effects remain undocumented. It has been seen to cause issues in areas such as Hainan due to environmental degradation.[5] Modern farming practise and increased land clearing have also had an impact, and much of the coastline of dugong habitats is undergoing industrialisation, with increasing human populations.[11] Dugongs accumulate heavy metal ions in their tissues throughout their lives, more so than other marine mammals. The effects are unknown. Socio-political needs are an impediment to dugong conservation in many developing countries. The shallow waters are often used as a source of food and income, problems exacerbated by aid used to improve fishing. In many countries, legislation does not exist to protect dugongs, and if it does it is not enforced.[5]

Oil spills are a danger to dugongs in some areas, as is land reclamation. In Okinawa the small dugong population is threatened by United States military activity. Plans exist to build a military base close to Henoko, and military activity also adds the threats of noise pollution, chemical pollution, soil erosion, and exposure to depleted uranium.[5] The military base plans have been fought in US courts by some Okinawans, whose concerns include the impact on the local environment and dugong habitats.[23]

Environmental degradation [edit]

If dugongs do not get enough to eat they may calve later and produce fewer young.[11] Food shortages can be caused by many factors, such as a loss of habitat, death and decline in quality of seagrass, and a disturbance of feeding caused by human activity. Sewage, detergents, heavy metal, hypersaline water, herbicides, and other waste products all negatively affect seagrass meadows. Human activity such as mining, trawling, dredging, land-reclamation, and boat propeller scarring also cause an increase in sedimentation which smothers seagrass and prevents light from reaching it. This is the most significant negative factor affecting seagrass.[5]

One of the dugong's preferred species of seagrass, Halophila ovalis, declines rapidly due to lack of light, dying completely after 30 days. Extreme weather such as cyclones and floods can destroy hundreds of square kilometres of seagrass meadows, as well as washing dugongs ashore. The recovery of seagrass meadows and the spread of seagrass into new areas, or areas where it has been destroyed, can take over a decade. Most measures for protection involve restricting activities such as trawling in areas containing seagrass meadows, with little to no action on pollutants originating from land. In some areas water salinity is increased due to wastewater, and it is unknown how much salinity seagrass can withstand.[5]

Capture and captivity [edit]

The Australian state of Queensland has sixteen dugong protection parks, and some preservation zones have been established where even aborigines are not allowed to hunt.[11] Capturing animals for research has caused only one or two deaths,[5] however dugongs are expensive to keep in captivity due to the long time mothers and calves spend together, and the inability to grow the seagrass that dugongs eat in an aquarium.[11] Only one orphaned calf has ever been successfully kept in captivity.[13]

Worldwide, only five dugongs are held in captivity. A female (Serena) lives at Toba Aquarium in Toba, Mie, Japan, although she is from the Philippines.[5] A male named Junichi also lived there until it died on 10 February 2011.[31] Another, named Gracie, is at Underwater World, Singapore, due to her mother being killed when she was a calf.[32] A third resides in Sea World Indonesia,[33] after having been rescued from a fisherman's net and treated.[34] The last two, Pig, a 10-year-old male, and Wuru, a 4-year-old female, are kept at Sydney Aquarium, where they have resided since they were juveniles.[35]

References [edit]

Notes
  1. ^ Shoshani, J. (2005). "Order Sirenia". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 92. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c Marsh, H. (2008). Dugong dugon. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 December 2008.
  3. ^ Winger, Jennifer (2000). "What's in a Name: Manatees and Dugongs". National Zoological Park. Retrieved 22 July 2007. 
  4. ^ a b Reeves et al. 2002. National Audubon Society Guide to Marine Mammals of the World. Knopf. ISBN 0-375-41141-0. pp. 478-481
  5. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af ag ah ai aj ak al Marsh et al. 2002. Dugong : status reports and action plans for countries and territories. IUCN.
  6. ^ Dugong dugon. The Paleobiology Database. Retrieved on 22 July 2007.
  7. ^ Trichechus. The Paleobiology Database. Retrieved on 22 July 2007.
  8. ^ Dugong. The Paleobiology Database. Retrieved on 22 July 2007.
  9. ^ Dugongidae. The Paleobiology Database. Retrieved on 22 July 2007.
  10. ^ Dugonginae. The Paleobiology Database. Retrieved on 22 July 2007.
  11. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z Lawler et al. 2002. Dugongs in the Great Barrier Reef : Current State of Knowledge. Cooperative Research Centre (CRC) for The Great Barrier Reef World Heritage Area.
  12. ^ a b c d e f g h i j k l m n o p q r Marsh, Helene. "Chapter 57: Dugongidae". Fauna of Australia: Vol. 1B Mammalia. CSIRO. ISBN 978-0-644-06056-1.
  13. ^ a b c d e f g h i j k l m n o p q r s t Fox, David L. (1999). "Dugong dugon: Information". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 2007-04-29. 
  14. ^ Reep, R.L. et al.; Marshall, C.D.; Stoll, M.L. (2002). "Tactile Hairs on the Postcranial Body in Florida Manatees: A Mammalian Lateral Line?". Brain, Behavior and Evolution 59 (3): 141–154. doi:10.1159/000064161. 
  15. ^ a b c d e f g "Dugong". National Geographic. Retrieved 26 March 2011. 
  16. ^ a b c d e Myers, P. 2002. Dugongidae. University of Michigan Museum of Zoology. Retrieved on 10 March 2007.
  17. ^ a b c "Case Study". American.edu. Retrieved 7 April 2011. 
  18. ^ Self-Sullivan, Caryn. Evolution of Sirenia. www.sirenian.org. Retrieved on 10 March 2007.
  19. ^ Waller et al. 1996. Sealife: A Complete Guide to the Marine Environment. Smithsonian Institution. ISBN 1-56098-633-6. pp. 413-420
  20. ^ Myers, Phil (2000). "ADW: Sirenia: Information". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 2007-05-13. 
  21. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  22. ^ Wood. The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  23. ^ a b Galvin, Peter. "Saving the Okinawa dugong". Center for Biological Diversity web site. Center for Biological Diversity. Retrieved 2008-05-15. 
  24. ^ C.Michael Hogan. 2011. Coral Sea. Encyclopedia of Earth. Eds. P.Saundry & C.J.Cleveland. National Council for Science and the Environment. Washington DC
  25. ^ Diving behaviour of dugongs, Dugong dugon B. Louise Chilversa, Steven Deleana, Nicholas J. Galesb,c, Dave K. Holleyb, Ivan R. Lawlera,d, Helene Marsha,d,*, Anthony R. Preena,e Journal of Experimental Marine Biology and Ecology 304 (2004) 203– 224
  26. ^ Berta, Annalisa; Sumich, James L.; Kovacs, Kit M. Marine Mammals: Evolutionary Biology, Amesterdam: Elsevier. ISBN 0-12-088552-2
  27. ^ "44. Dugong (Dugong dugon)". edgeofexistence.org. Retrieved 8 April 2011. 
  28. ^ a b c Anderson, Paul K. (1984). In Macdonald, D. The Encyclopedia of Mammals. New York: Facts on File. pp. 298–299. ISBN 0-87196-871-1. 
  29. ^ Alexander, James (2006). Malaysia Brunei & Singapore. New Holland Publishers. p. 185. ISBN 1-86011-309-5. 
  30. ^ E. Rupell (Rupell and Leuckart, 1828, 1831) saw the Arabic word tucash (dugong) as equivalent to tahash (Heb. Bible). He designated them "Halicore tabernaculi" (Rothauscher's Dugong page "Mermaid"). Also among those who thought dugongs' or sea cows' hides were used as coverings of the Tabernacle, the editors of Easton's Bible Dictionary, "Badger", 1823-1894; Alfred Ely-Day, "Badger," International Standard Bible Encyclopedia, 1915; the editors of The Catholic Encyclopedia, "Tabernacle," 1915; the editors of various English translations of the Bible. However, the popular 20th-century academic opinion re. dugong as the meaning of "tahash" is noted as uncertain in the Encyclopaedia Judaica, 2nd ed. "TAHASH" 2000.
  31. ^ "訃報  ジュゴン死亡のお知らせ" (in Japanese). Toba Aquarium. 10 February 2011. Retrieved 28 July 2011. [dead link]
  32. ^ "Dugong Rescue". underwaterworld.com.sg. Retrieved 6 April 2011. 
  33. ^ "Dugong". seaworldindonesia.com. Retrieved 6 April 2011. 
  34. ^ "Little-known dugong center stage at Sea World bash". Jakarta Post. 6 March 2000. Retrieved 6 April 2011. 
  35. ^ "Dugongs at Mermaid Lagoon". Sydney Aquarium. Retrieved 6 April 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!