Articles on this page are available in 1 other language: Spanish (16) (learn more)

Overview

Brief Summary

Description

As is often the case in species where males compete to mate with as many females as possible, northern elephant seal males are much larger than females (1,800 kg versus 650 kg on average). Competitions can be battles, but more often involve mock threats and loud vocalizations. The dominant (alpha) male gets to mate with the most females, maximizing the number of offspring he produces. Fasting is part of their life cycle: males stay on the beach and fast for up to three months during the breeding season, while they are guarding a harem. Females stay on shore with their pups and fast for about a month while they are nursing. Afterward, males and females spend 8-10 mostly solitary months at sea. Males often migrate along a northern route and the females remain farther south. They may travel as far as Japan and log more than 20,000 km annually, spending much of their time underwater foraging for squid and fish. Dives can be as deep as 1,500 m and last as long as two hours, but the seals typically stay submerged for about 18-25 minutes and forage at depths of 350-650 m.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Gill, T., 1866.  Prodome of a monograph of the Pinnepedes.  Proceedings of the Essex Institute, Salem Communications, p. 13.  5:3-13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The annual breeding cycle of the northern elephant seal begins in December, when the huge males haul out onto deserted beaches. Large numbers of pregnant females soon follow the males, aggregating into large groups known as harems, with each group presided over by a large, dominant male (3). Competition for this dominant position is intense (3), with males establishing their supremacy through stares, gestures, and snorts and grunts amplified by the inflation of their proboscis (2). Spectacular fights may ensue, with males delivering serious, but rarely fatal, blows with their large canine teeth (2). Between two and five days after arriving at the colony, each female will give birth to a single pup (3). For the next 27 days (2), the female will stay with her new pup, feeding it large quantities of rich, fatty milk, while she relies on her own thick blubber for sustenance (3). Shortly before the young are weaned, the females come into oestrus and mate with the dominant male. After weaning their young, the females return to sea, leaving the pups to fend for themselves (3). For the next four to six weeks, the pups practice swimming and diving, before leaving the beach where they were born to spend the next six months at sea. Northern elephant seal pups are highly vulnerable at this time, with around 30 percent perishing (3). After breeding, many northern elephant seals travel north towards Alaska to feed. Northern elephant seals feed primarily on deepwater fish and squid, a diet that necessitates an exceptional diving ability (3). They can dive down to over 1,500 metres, remaining underwater for up to an extraordinary 120 minutes, although most dives are to shallower depths and last for around 20 minutes (3). More than 80 percent of the year is spent feeding at sea, in order to build up their essential blubber stores to provide energy for breeding and moulting, times at which the seals do not feed (3). Northern elephant seals return to their southern breeding ground to moult, a process in which the very outer layer of skin is shed in addition to the hair. As rich supplies of blood are pumped to the skin to enable the growth of the new skin and hair, conserving body heat becomes essential, and so the seals do not enter the water to feed for the next three to five weeks (3). Following moulting, northern elephant seals travel northwards once more, before returning to their breeding colonies to commence the breeding cycle again. This remarkable journey, undertake twice each year, covers an impressive 10,000 kilometres (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

On land, this enormous marine mammal may be a lumbering mass of blubber, but once in water, it transforms into a graceful swimmer and remarkable diver. One of the most striking features of the northern elephant seal is the pronounced differences between the sexes (3). Males are not only significantly larger and heavier than females, but they also have (like their namesakes) a prominent, trunk-like proboscis, and a region of thickened, scarred skin on the neck, chest and shoulders called a 'chest shield', the result of numerous fights with other males (3). The short, stiff hair of males is dark grey, fading to a rusty greyish-brown throughout the year (2). Females are generally darker than males, having a brown coat with a lighter area around the neck, which is actually scarring from being repeatedly bitten by the male during mating (2). Like other true seals (those belonging to the Phocidae family), the northern elephant seal has long, webbed feet, providing effective propulsion through the water, and forelimbs that are used to steer whilst swimming or drag themselves across land (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Northern elephant seals are found in the eastern and north central North Pacific. Breeding takes place on offshore islands and at a few mainland localities from central Baja California to Northern California. The species breeds at over fifteen discrete locations, of which a dozen are well-known and distributed mostly in islands of southern California (USA) and Baja California (Mexico) (Condit et al. in press). A few pups are born in Oregon, Washington and southern British Columbia. Año Nuevo, in Central California, is a major breeding site.

Northern elephant seals migrate to and from their rookeries twice a year, returning once to breed from December to March and again later for several weeks to molt, at different times depending on sex and age. They also show up at additional coastal sites as far north as southern Oregon for moulting. Their post-breeding and post-moult migrations take most seals north and west to oceanic areas of the North Pacific and Gulf of Alaska twice a year. Adult males tend to travel further north and west than adult females. Wanderers have been found as far away as Japan and the Midway Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northern elephant seals are found in the coastal waters of the Pacific Ocean from the Gulf of Alaska down to Baja California. Foraging migrations by males and females are made seperately, two times yearly. Males journey north to the Aleutian Islands and the Gulf of Alaska. Females don't travel as far north, but instead migrate further west to more open ocean. The total linear distances migrated by these animals each year has been recorded at 21,000 km. Seals can be seen on shore most often from December through March, during the mating season and again beginning in April and continuing through August as they haul out for moulting.

Biogeographic Regions: nearctic (Native ); oceanic islands (Native ); pacific ocean (Native )

  • Feldhamer, G., L. Drickamer, S. Vessey, J. Merritt. 1999. Mammalogy: Adaptation, Diversity, and Ecology. Boston: McGraw Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Central North Pacific, East North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Northern elephant seals range widely in the North Pacific (regularly north to British Columbia), with males ranging farther north (as far as Gulf of Alaska and Aleutian Islands) than females. Breeding sites are distributed on islands and the mainland from the central Baja California coast north to California, including islas Guadalupe, San Benito, Cedros, Natividad (few), San Martin (few), and Coronado (few) in Mexico; and Santa Barbara, San Nicolas, San Miguel, Santa Rosa, San Clemente (few), Ano Nuevo, and Southeast Farallon islands, and Ano Nuevo Point, Point Reyes, and Piedras Balncas, in the United States; recently, pupping was observed at Shell Island, Oregon (Hodder et al. 1998). Largest breeding colony is on Guadalupe Island off Baja. Has strayed to Midway Island, Hawaii (Tomich 1986) and to a small island near Japan.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The northern elephant seal occurs in the eastern Pacific Ocean, where it breeds on approximately 15 islands and a few mainland beaches situated between northern California and the Baja California Peninsula in Mexico (2) (3). When not breeding, many northern elephant seals migrate north, along the North American coast to the Gulf of Alaska and the Aleutian Islands (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Northern elephant seals are generally brown in color, however there are variations to this coloration. Males are usually a darker brown, while females are a light tan color. Hair is reduced on adult males and females and is completely absent for a short time after moulting. Newborns have hair that is black in color until successfully weaned, when they shed their black coat and it is replaced by a lighter one. Countershading is a feature to all adults and newly weaned youngsters, displaying a darker color dorsally and a lighter color ventrally. They possess two, lobed hind flippers. Pinnae are absent, giving the ear the appearance of being flush with the skin. The most conspicuous feature to the male body is the inflated proboscis that adorns his face. This feature is absent in females and is larger than that of their slightly larger close relatives, southern elephant seals. Young males begin development of the proboscis at 2 years of age, but it is not fully developed until the animal reaches its 8th year of maturity. These mammals are among the largest of the group comprising aquatic carnivores in the Northern Hemisphere. Females typically weigh 600 to 900 kg and males, which outweigh females by 3 to 10 times, can top out at 2300 kg. Females reach a length of 3.1 m on average and males usually extend from 4.0 m to 5.0 m. Newborns typically weigh about 47 kg at birth. They weigh about 147 kg and measure about 1.5 m between 24 and 28 days old, when they are weaned. Teeth are dimorphic in the sexes with males having considerably enlarged canines that are used in fighting.

Range mass: 600 to 2300 kg.

Range length: 3.0 to 5.0 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently; ornamentation

  • Ingles, L. 1965. Mammals of the Pacific States. Stanford, California: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 650 cm

Weight: 3500000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are much larger than females, have much larger canine teeth, and develop a large inflatable bulb on the nose.

Length:
Average: 3.8 m males; 2.5 m females
Range: 3.6-4.2 m males; 2.2-3 m females

Weight:
Average: 1,800 kg males; 650 kg females
Range: 1,500-2,300 kg males; 400-800 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Lectotype for Mirounga angustirostris
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Immature
Preparation: Skull
Collector(s): W. Ayres
Year Collected: 1857
Locality: St. Bartholomews Bay, Baja California, Mexico, North America, North Pacific Ocean
  • Lectotype: Gill, T. N. 1866. Proc. Essex Inst. 5: 13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Northern elephant seals are huge and imposing animals. Significant sexual dimorphism exists in size and secondary sexual characteristics. Males are three to four times heavier, and nearly 1.5 times the length of adult females. Adult males reach 4.2 m in length and a maximum weight of 2,500 kg. Mean length for males is 3.85 m and mean weight is 1,844 kg. Maximum weight is seen when the bulls are newly arrived for the breeding season after a summer and fall largely spent feeding.

The mean length of adult females is 2.65 m, and they can reach a length of 2.82 m. Mean mass is 488 kg, with a maximum recorded mass of 710 kg, both values are from shortly after females give birth. Newborn pups are about 1.25 m long and weigh 30-40 kg. Pups are born in a long woolly black lanugo coat that is shed without the epidermis starting at about 4-5 weeks and usually lasting several weeks until after the pup is weaned. After molting, the newly weaned juvenile’s coat is made up of short hairs like those found on adults and they are counter shaded dark gray above and silver gray below.

Body weight of adults fluctuates dramatically due to the demands of fasting during the breeding season. Adult females can lose almost half their mass during lactation, when they take their single pup from birth to weaning in approximately 25 days. The situation is similar for breeding males, which also lose about half their mass while ashore for periods that can exceed three months.

Females reach sexual maturity at the age of 2 years and males at 7-9 years. Gestation lasts 11.3 months, including a delay of implantation. The annual pregnancy rate of mature females is 95 %. Longevity is above 14 years for males and 21 years for females (Reijnders et al 1993).

Northern elephant seals are highly polygynous, but not strictly territorial. Males compete for access to females by ranking themselves in a hierarchy. There is much male-male fighting, vocalizing, and displaying during the breeding season, when bulls may be ashore for months at a time. One of the most impressive displays occurs when a male rears up on his hindquarters, thrusts one half to two-thirds of his body upward and produces a distinctive clap threat vocalization as a challenge to other bulls. The sound is a rolling, resonant, metallic-sounding series of backfire like sounds punctuated with pauses.

Females give birth within a few days of coming ashore, from late December to March. Females have a throaty sputtering growl, made with the mouth wide open, which is used as threat gesture. Females and pups have a warbling scream call that they use to call to each other, and in the case of the pup, to notify its mother when it is disturbed. Mother and pup form a strong bond immediately after birth, and females aggressively bite other pups that approach them, occasionally killing them with bites to the head. However, bulls are a greater source of pup mortality as they regularly crush pups when they charge through aggregations of mothers and pups to chase off or fight encroaching males, or when approaching females for mating. Occasionally, bulls suffocate pups by stopping on top of them and not moving again soon enough.

Northern elephant seals hold the record as the deepest-diving pinniped. Time-depth recording devices have documented dives to an astounding 1580 m by an adult male. They also have extreme breath holding ability and have been recorded to dive for as long as 77 minutes. Rest intervals at the surface are usually short, lasting only several minutes between routine dives that last 20-30 minutes and reach 300 to 800 m in depth. After leaving the rookeries, most of these seals spend 80-90% of their time underwater, helping explain why they are infrequently seen at sea.

During migration, females travel further west, but males travel further north. Most of the males go all the way up to the coast of Alaska and the Aleutians, while females move into the deep waters of the Pacific.

Fifty-three species of prey have been identified in the diet of northern elephant seals. More than half of these species are squid. Other prey includes various fishes, such as Pacific whiting, several species of rock fish, and a variety of small sharks and rays. They have also been reported to feed on pelagic red crabs. Approximately 70% of their prey comes from mid and deep water zones in open ocean habitat far offshore.

Great white sharks and killer whales are predators on northern elephant seals. Recent work at the Farallon Islands off of central California has revealed that large great white sharks aggregate around the islands in the fall when juvenile elephant seals return for their annual moult. Seals that swim at or near the surface as they are approaching or departing the islands are particularly vulnerable to ambush attacks by fast-rising sharks that patrol near the bottom in waters seven to ten meters deep.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Northern elephant seals reside terrestrially on the sandy, rocky or muddy shores of the coastline, particularly on offshore islands. They typically aggregate in large groups while on land. These animals spend only 10% of their time on land, during reproduction and moulting. The other 90% is spent in the water, diving and foraging for food, and only 11% of this time in the water is spent at the surface. This means that an extraordinary 85-90% of their time is spent at sea and under water. These mammals can dive exceptionally deep, to 500 to 600 meters (almost 1 mile) on average and to record depths of over 1500 meters for extended periods of time (20 to 70 minutes).

Range depth: 1000 (high) m.

Average depth: 500-700 m.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Terrestrial Biomes: desert or dune

Aquatic Biomes: pelagic ; coastal

Other Habitat Features: intertidal or littoral

  • Lawlor, T. 1979. Handbook to the Orders and Families of Living Mammals. Eureka, California: Mad River Press.
  • Andrews, R., D. Costa, B. Le Boeuf, D. Jones. 2000. Breathing frequencies of northern elephant seals at sea and on land revealed by heart rate spectral analysis. Respiration Physiology, 123: 71-85.
  • Davis, R., L. Fuiman, T. Williams, B. Le Boeuf. 2001. Three-dimensional movements and swimming activity of a northern elephant seal. Comparative Biochemistry and Physiology Part A, 129: 759-770.
  • Delong, R., B. Stewart. 1991. Diving patterns of northern elephant seal bulls. Marine Mammal Science, 7 (4): 369-384.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1596 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1310 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 5.161 - 22.648
  Nitrate (umol/L): 0.025 - 17.622
  Salinity (PPS): 30.381 - 34.431
  Oxygen (ml/l): 4.855 - 7.455
  Phosphate (umol/l): 0.152 - 1.777
  Silicate (umol/l): 1.436 - 38.397

Graphical representation

Temperature range (°C): 5.161 - 22.648

Nitrate (umol/L): 0.025 - 17.622

Salinity (PPS): 30.381 - 34.431

Oxygen (ml/l): 4.855 - 7.455

Phosphate (umol/l): 0.152 - 1.777

Silicate (umol/l): 1.436 - 38.397
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Northern elephant seals feed at sea (temperate and subtropical) and use beaches for breeding and molting.

In California, elephants seals occupy beaches of continental islands and the mainland during breeding (winter) and molting (spring, summer) periods; also a peak in abundance on shore occurs in October when resting females, pups of the year, and some juveniles haul out briefly. When at sea, elephant seals spend little time at the surface; commonly they are at depths of several hundred meters. Young are born on beaches of continental islands and mainland (Ano Nuevo, Point Reyes). Young stay ashore 2-3 months after weaning, leave beaches by end of April. Females generally return to natal area to breed, but some emigrate to other sites hundreds of kilometers away.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Sandy or gravel beaches, far from human activity, are the preferred breeding sites of the northern elephant seal (2). When feeding at sea, males tend to be found over continental shelves whereas females inhabit deeper open water (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Elephant seals make protracted migrations between breeding/molting areas and feeding grounds; over a period of 12 months, they migrate from breeding areas to feeding areas then back to breeding areas (to molt) then back to feeding areas and finally back to breeding areas (to breed); over a year, the distance traveled is about 20,000 km (Stewart and DeLong 1995). From San Miguel Island, adult females move to feeding areas at latitudes of but far away from Oregon and Washington; adult males move north to Alaska when not breeding or molting (Stewart and DeLong 1995). Many weaned pups leave breeding grounds in April, diperse north as far as Vancouver Island, return to central California coast in September. Young from southern California rookeries may move north to central California, return to island of birth to molt in spring of next year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Northern elephant seals spend 90% of their lives in the water in order to feed. During their foraging migrations, they dive into the water repeatedly and continuously to find food, never stopping to rest or sleep for months at a time. Females and males feed separately from each other. Males travel north, remain closer to land, and tend to return to the same locations to feed year after year. Females migrate away from the land, west to the open ocean, and are less accurate in returning to the same places each year. Male foraging behavior is characterized by benthic dives to the sea floor. By contrast, females exhibit pelagic diving while foraging which is defined by a trip to the floor, a partial ascent, another trip to the floor, a partial ascent, etc. There is some speculation as to the reason why male size is so extreme in relation to female size and some suggestions indicate that food type may be a contributing factor. Males are more likely to eat food sources that are dense in mass such as sharks and skates, while females eat foods that are less dense such as squid. These differences in foods is a likely occurence to the different locales in which they are foraging. This resource partitioning is likely to be the result of differences in body size. Males are less vulnerable to predators and are thus safer foraging in areas with more predators. Females are more vulnerable to predators and thus must forage in areas with fewer predators.

While elephant seals are on land they are fasting. They go for extended periods of time without food while they are reproducing and moulting. During this time, all nutrition and energy is broken down from fat that is stored on their bodies as blubber. It is believed that these animals never drink water. Their source of water comes from food sources and broken down fats. In addition they have developed physiological methods to retain water, such as producing a concentrated urine. Another interesting phenomenon about these mammals is the behavior of eating stones before coming ashore. The true purpose of this behavior is not known. The stones are eliminated when they re-enter the water for migration, so it has been suggested that this phenomenon is in response to the long period of fasting.

Foods eaten include: cephalopods, skates, small sharks, and fish.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats cephalopods, Pacific hake and other teleosts, various cartilaginous fishes, and jawless fishes (Condit and Le Boeuf 1984). Preys mostly on mesopelagic squid; also apparently feeds commonly on bottom in deep water; commonly dives to several hundred meters. Males do not feed during breeding season.

Northern elephant seals are exceptional divers. When foraging on fishes and squid, they sometimes dive deeper than 1,500 meters and can remain submerged for 1-2 hours. After weaning her pup, a female goes to sea and spends 83-90% of her time underwater.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Northern elephant seals are important as predators on octopus, squid, small sharks, skates, and fish. In this way they impact the populations of these animals. They are also important as food for animals which prey on them, such as great white sharks and orcas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Northern elephant seals try to feed by diving deep when in the water because the animals that view them as prey typically feed near the surface. Females migrate to the open ocean to feed in order to avoid predators as much as possible.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Mirounga angustirostris is prey of:
Carcharodon carcharias
Orcinus orca

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Mirounga angustirostris preys on:
Actinopterygii
Mollusca

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population in the early 1990s was about 127,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Dominance hierarchy forms among males on breeding grounds. Highly gregarious when ashore, during breeding season and when molting. Adult females and juveniles come ashore to molt in spring, males in summer, nonpregnant females and young in fall. Preweaning mortality varies greatly among different colonies, from a few percent to sometimes 76% (see Stewart and Huber 1993 for additional survivorship data).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Adult females and juveniles return to shore to molt in April-May. Males return to beaches to molt in late spring and summer. After molting, seals go to sea again to feed before returning once again to the breeding beaches.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Because these animals spend such an extraordinary amount of time in the water, there are many gaps in how much we know about them. It is difficult to discern lifespans of these animals and what might be defined as a "natural" cause of death. Estimates of survival of reproductive females is represented in percentages with the probability of survival decreasing with each year of life. In the first year of life, a female's chances of survival are 35%, at 2 years, 30%, and at 3 years, 20%. Adult males live an average of 11 to 13 years old. Young pups are quite vulnerable to death, particularly by predation and trampling. Trampling usually happens as a result of a large male defending its females, crushing the pup under his weight as he tries to quickly move toward an intruder. By some estimates as many as 10% of the young pup population may perish this way annually.

Range lifespan

Status: wild:
18 (high) years.

Average lifespan

Status: wild:
9 years.

Typical lifespan

Status: wild:
13 (high) years.

Average lifespan

Status: wild:
6.5 years.

Average lifespan

Status: captivity:
15.0 years.

  • Klimley, A., B. Le Boeuf, K. Cantara, J. Richert, S. Davis. 2001. Radio-acoustic positioning as a tool for studying sit-specific behavior of the white shark and other large marine species. Marine Biology, 138: 429-446.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The total gestation time is about 11 months and includes a 2-3 months period of delayed implantation (Ronald Nowak 2003). Not much is known about the longevity of this species. In the wild, it is estimated that females live up to 18-20 years (Don Wilson and Sue Ruff 1999). One wild born specimen was about 15.8 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

There is a definitive hierarchy structure to the mating system of these animals because they are polygynous and they aggregate in colonies on land during the breeding season. Each dominant male controls access to mating opportunities with a group of females. Bonner (1990) calls this mating system "female defence polygyny". Less dominant males are restricted to the fringes of a colony and continually try to gain access to females, resulting in battles between males and aggressive charges by the dominant male. Sub-dominant males usually run away but occasionally a male will challenge the dominant male in an attempt to take over the harem. Females release an audible "bawling" sound when a non-dominant male tries to mate with her. This results in a defense attempt by the dominant bull, who chases the less dominant male away. Occasionally the less dominant male becomes defiant and this can result in spectacular displays of threats and sometimes violent fighting. When a male wants to mate, he throws a flipper over the side of a female, grips her neck in his teeth and begins copulation. Resistance by a female only results in the male moving his large and heavy body on top of the female so she is unable to move. Aggressive interactions among males often result in elephant seal pups being killed by trampling. (Bonner 1990)

Mating System: polygynous

Northern elephant seals haul out for birthing and breeding from December to March. The females come into heat only 19 days after giving birth. They remain receptive for about four days, during which mating occurs. Females become sexually mature at 2 years of age, but usually begin giving birth in the 4th year of life. Males are sexually mature at the age of 6 or 7, but only occasionally are allowed to mate before they reach the age of 9 or 10 because of the hierarchy system of mating exhibited by these animals. (Reeves, et al. 1992; Bonner 1990) These animals display a phenomenon in their development cycle called delayed implantation. Delayed implantation lasts for about 3 months, resulting in a total gestation time of nearly one year. This allows both birthing and mating to occur in the same time frame, during the short period of the year when these animals are aggregated in terrestrial colonies. Interestingly, the embryo is never actually implanted, by definition of most mammals. Instead, it attaches only outwardly to the uterine wall throughout its development. (Bonner 1990; Mathews 1952)

Breeding interval: Females may breed as often as once yearly.

Breeding season: Breeding and birthing occurs from December to March.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 10 to 12 months.

Range weaning age: 23 to 27 days.

Range age at sexual or reproductive maturity (female): 2 to 10 years.

Average age at sexual or reproductive maturity (female): 9 years.

Range age at sexual or reproductive maturity (male): 2 to 10 years.

Average age at sexual or reproductive maturity (male): 9 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 37500 g.

Average number of offspring: 1.

The pregnancy will ultimately last just under one year, as a result of delayed implantation. Parturition, which results in one offspring per year (although there have been occurrences of twins), will occur the following winter and lactation will follow for about 27 days before the pup is weaned. Pup weight gain during the period of lactation is phenomenal, the milk is extremely high in fat. During weaning the pup remains close to the mother until such a time that the mother leaves the pup behind to return to sea. Young pups left alone form groups or "pods", which remain on shore for up to 12 weeks without parental care. They learn to swim in the surf and eventually swim further out to sea for a short time to feed. An interesting phenomenon displayed by young male pups left to fend for themselves is that of "milk stealing". An attempt to nurse from lactating females still on the beach raising their young can give the successful pup a significant advantage in survival and higher ranking later on in his life by increasing his weight and overall health.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Matthews, L. 1952. Sea Elephant: The Life and Death of the Elephant Seal. London: MacGibbon & Kee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Single pup is born late December-February (rarely March), mainly in February. Pups are weaned in 4 weeks. Mating occurs a few days before the pups are weaned, then females go to sea to feed. Most adults vacate the breeding areas by the end of February. Young go to sea at 11-16 weeks, after fasting on beach for several weeks. Relatively few males (mainly 9-11 years old, or younger in newly established colonies) inseminate most of the females. Females produce their first pup usually at 3-5 years. Most females breed annually. Reproductive success increases between maternal ages of 3-7 years, then levels off; however, females breeding at a young age may experience lowered reproductive success later in life (Sydeman et al. 1991). Males live up to 15-16 years; oldest known female was 18 years old.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Nasal turbinates reduce water loss: northern elephant seal
 

The nasal turbinates of the northern elephant seal reduce water loss via countercurrent heat exchange.

     
  "Elephant seals fast completely from food and water for 1-3 months during terrestrial breeding. Temporal countercurrent heat exchange in the nasal passage reduces expired air temperature (Te) below body temperature (Tb). At a mean ambient temperature of 13.7 degrees C, Te is 20.9 degrees C. This results in the recovery of 71.5% of the water added to inspired air. The amount of cooling of the expired air (Tb - Te) and the percentage of water recovery varies inversely with ambient temperature. Total nasal surface area available for heat and water exchange, located in the highly convoluted nasal turbinates, is estimated to be 720 cm² in weaned pups and 3140 cm² in an adult male. Nasal temporal countercurrent heat exchange reduces total water loss sufficiently to allow maintenance of water balance using metabolic water production alone." (Huntley et al. 1984:447)
  Learn more about this functional adaptation.
  • Huntley, A. C.; Costa, D. P.; Rubin, R. D. 1984. The contribution of nasal countercurrent heat exchange to water balance in the northern elephant seal, Mirounga angustirostris. 447-454 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mirounga angustirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0240-06|AY377139|Mirounga angustirostris| AATCGATGACTATTCTCTACAAATCATAAAGACATCGGCACCCTCTACCTATTATTCGGTGCATGAGCCGGCATAGTAGGCACCGCCCTC---AGTCTTTTAATTCGCGCAGAACTAGGGCAGCCTGGCGCTTTACTAGGAGAC---GATCAGATCTATAACGTGATTGTCACCGCTCACGCATTCGTAATAATCTTTTTTATAGTAATACCTATCATGATCGGAGGTTTCGGAAACTGATTAGTACCTCTAATG---ATTGGTGCCCCTGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTACCACCATCTTTCCTATTACTATTAGCCTCCTCCATAGTAGAAGCAGGTGCAGGAACAGGATGAACCGTCTATCCCCCTCTAGCCGGTAACCTAGCCCATGCAGGAGCATCTGTAGACCTA---ACAATTTTCTCTCTTCACTTAGCAGGTGTATCATCTATCCTTGGAGCCATCAACTTTATTACCACTATTATTAACATAAAACCTCCCGCAATGTCTCAATATCAAATTCCCTTATTCGTATGATCCGTACTAATTACAGCAGTACTTCTGCTATTATCACTACCAGTTCTAGCAGCT---GGTATTACTATACTACTTACAGACCGAAATCTTAATACAACATTCTTTGACCCTGCTGGGGGAGGTGACCCTATTCTATATCAACATCTATTTTGATTCTTTGGACACCCCGAAGTATATATCCTAATTCTTCCAGGATTTGGAATAATTTCACACATTGTCACCTTCTACTCAGGAAAAAAA---GAACCCTTCGGCTATATAGGAATAGTCTGAGCAATAATATCCATTGGTTTTCTAGGCTTCATTGTATGAGCTCATCATATATTTACCGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mirounga angustirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Campagna, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
The Northern Elephant Seal has recovered from near extinction and population growth is expected to continue over the coming decades. Due to its large and increasing population, expanding range and lack of foreseeable threats, the northern elephant seal should be classified as Least Concern.

IUCN Evaluation of the Northern Elephant Seal, Mirounga angustirostris
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

The current population is ~170,000 and growing. The population is renowned for its remarkable growth during the 20th century, following virtual annihilation by sealers in the 19th century. In 2005, 42,589 pups were counted, an increase of 14,699 (53%) over the number observed in 1991. Total population size increased at a rate of 3% from 1991 to 2005.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

The total population of this species is probably expanding.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under Al.

A population reduction is not suspected, although the species is susceptible to El Niño and climate warming may increase its effects.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction to negligible numbers was observed in the past due to hunting by sealers. Hunting stopped and the population recovered, thus the criteria do not apply.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO (distribution of colonies) is > 20,000 km². The EOO at sea of foraging individuals is much larger than that.

B2. Area of occupancy (AOO): CR
The AOO (distribution of colonies) is > 2,000 km². The AOO at sea of foraging individuals is much larger than that.

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

Does not apply for the species.

C. Small population size and decline
Number of mature individuals: CR
Population size is larger than the criteria and is not declining.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

Does not apply to the species.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
Most populations are larger than the criteria and are widely distributed.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction. Climate change may impact the population to the point that the probability of extinction may be important but the quantitative value is unknown.

Listing recommendationThe Northern Elephant Seal is increasing and currently expanding its range. Despite past population reductions, this species should now be classified as Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Northern elephant seals are not presently endangered. At one time, however, this species was thought to have been hunted to extinction. They were presume extinct by the 1880's, after being exploited by hunters and whalers seeking to use the animals' thick layer of blubber as an oil source. A few animals were then discovered in 1892 which were captured and killed for scientific study. Eventually, it was discovered that a population of about 20 to 100 individuals had survived. Studies have shown that all individuals of the current population, which has grown to over 175,000, are relatives of these few survivors. The population bottleneck that occurred during this time is of concern because genetic variation is reduced, creating the possibility for the population to be vulnerable to disease or reproductive failure.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Weber, D., B. Stewart, J. Garza, N. Lehman. 2000. An empirical genetic assessment of the severity of the northern elephant seal population bottleneck. Current Biology, 10: 1287-1290.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The northern elephant seal population continues to expand rapidly (R. Condit et al. in press). In 2005, 42,589 pups were counted, an increase of 14,699 (53%) over the number observed in 1991. Based on pup production, total population size in 2005 was estimated to be 171,000, compared to 113,000 in 1991. This is a mean annual growth rate of 3.0% yr1. In 1977, fewer than 14,000 pups were born (Stewart et al. 1994), so annual growth from 1977 to 1991 was 5.2% yr-1.

Population growth was due primarily to growth at colonies in southern California. Three colonies accounted for 88.2% of the growth in pups produced: increases in pup production of 5,683 for San Nicolas Island, 4,096 for Santa Rosa Island and 3,459 for Piedras Blancas.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Nearly hunted to extinction; population has increased from no more than 100 in late 1800s to 80,000 in 1984 and 127,000 in 1991 (Stewart and Huber 1993). In 1991, more than 21,000 pups were born at California rookeries, about 85% of them on San Nicolas and San Miguel islands (Reeves et al. 1992). In the mid-1990s, the California population was increasing and the Mexican population was apparently stable or decreasing (NMFS, Federal Register, 15 March 1996). See Cooper and Stewart (1983), Bodkin et al. (1985), and Stewart and Huber (1993) for discussion of increase.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The northern elephant seal was hunted to the brink of extinction in a surge of commercial exploitation in the late 1800s. Estimates are that as few as 20 animals survived the period of commercial harvesting. Fortunately, for the species, their pelagic nature and the fact that most seals spend 80% or more of their lives at sea, and that they all do all not return to their rookeries at the same time, ensured that enough seals were at sea to support continuation of the species when sealers undertook wholesale slaughters at rookery sites. Following a slow recovery in the early 1900s, northern elephant seals began to recolonize formerly used sites throughout the 1980s.

Incidental take in a variety of coastal net fisheries does occur, but at low levels. This is assumed to be because northern elephant seals move offshore rapidly after leaving colonies to minimize their risk of shark predation. Most of the prey of the northern elephant seal is either of low commercial value or minimally harvested in fisheries. If the population continues to expand there will likely be new rookeries on mainland beaches, and there will be additional challenges to keep conflicts with humans and domestic and feral animals to a minimum. The risk of transfer of diseases, such as morbillivirus from domestic animals to northern elephant seals, is unknown, but the species is considered to be one of several pinnipeds at high risk of disease outbreaks because of their rapidly expanding population and environmental changes associated with global warming (Lavigne and Schmitz 1990). Tourism at several mainland locations in the United States is extremely popular but highly regulated and is not considered a major threat to the species. Tourist access to nearly all of the islands occupied by elephant seals is controlled by law or otherwise regulated in the United States and Mexico, although a number of Mexican islands are inhabited either year round or most of the year by fishermen and their families.

As the species has now recovered from a very small number of survivors, it has likely lost a considerable amount of diversity from passing through this genetic bottleneck, and may now be at greater risk from disease outbreaks and environmental change.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

In the past, the northern elephant seal suffered intense exploitation for its thick blubber which yields high quality oil (3). Hunting started around 1818 and by the 1860s about 250,000 seals had been killed, leaving numbers too low to make hunting worthwhile (2). On a number of occasions it was thought that the species had gone extinct, and by 1892, just a single population of about 100 individuals remained on Guadalupe Island, off northern Baja California (2). Thankfully, the implementation of legal protection allowed numbers to recover, and the northern elephant seal population slowly spread north and south until they reoccupied most of the original range (2). Today, northern elephant seals continue to increase in both number and range (3). There is some concern that commercial fisheries may be competing with the northern elephant seal for its preferred prey, but otherwise, this species faces no negative interactions with humans (3). Possibly the most serious potential threat to the northern elephant seal is the significant lack of genetic diversity in populations, the result of the drastic declines they underwent in the past. This may leave the northern elephant seal ill equipped to adapt to any changes in their environment (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Northern elephant seals are fully protected on their Mexican and US rookeries, and when they are within the 200 mile EEZ of the United States and Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Complete legal protection for the northern elephant seal was implemented in Mexico in 1922 (2), and subsequently, the severely depleted populations went on to display one of the most incredible recoveries ever observed in a mammal (3). The northern elephant seal is also protected in the United States under the Marine Mammal Protection Act (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Northern elephant seals may consume some fish and other prey that are important to the fishing industry. However, their impact is probably exaggerated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern elephant seals are a huge attraction for tourists to the Año Nuevo State Reserve in California. Here visitors can watch these magnificent animals from a safe distance, during breeding season. Northern elephant seals were once hunted for their blubber, which was refined to use as oil.

Elephant seals are the only known animals capable of filling collapsed lungs. Their lungs collapse during dives. The surfactant/lubricant responsible for this ability is being researched at the Scripps Institute in San Diego for the potential benefit to premature humans with immature lungs.

Northern elephant seals have also been used in research related to the effect of weightlessness on bone density because they spend 90% of their time in a neutrally buoyant environment. NASA has used this research in their efforts to counteract the effect of weightlessnes on bone density in astronauts.

Because northern elephant seals can dive to extreme depths it has been suggested that they can greatly aid human efforts to explore and map the deep oceans once instruments that can withstand extreme pressures are developed.

Positive Impacts: ecotourism ; research and education

  • Hill, A. 1996. "Get Outside! the Bay Area...naturally" (On-line). Accessed November 11, 2001 at http://www.sfgate.com/getoutside/1996/feb96/elephantseals.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Nearly driven to extinction by commercial exploitation in the 1800s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern elephant seal

The northern elephant seal (Mirounga angustirostris) is one of two species of elephant seal (the other is the southern elephant seal). It is a member of the family Phocidae ("true seals"). Elephant seals derive their name from their great size and from the male's large proboscis, which is used in making extraordinarily loud roaring noises, especially during the mating competition. There is a great sexual dimorphism in size. The males can grow to 14 ft (4 m) and 5,000 lb (2,300 kg), while the females grow to 11 ft (3 m) and 1,400 lb (640 kg). Correspondingly, there is a highly polygynous mating system, with a successful male able to impregnate up to 50 females in one season.

Contents

Description

The much larger male northern elephant seal typically weighs 1,500–2,300 kg (3,300–5,100 lbs) and measures 4–5 m (13.2–16.5 ft), although some males can weigh up to 3,700 kg (8,152 lbs).[2] Females can range from 400 to 900 kg (990-2,000 lbs) and measure from 2.5 to 3.6 m (8.2–11.9 ft).[3] Both adult and juvenile elephant seals are bar-skinned and black before molting. After molting they generally have a silver to dark gray coat that fades to brown yellow and tan. Adult males have hairless necks and chests speckled with pink, white and light brown. Pups are mostly black at birth and molt to a silver gray after weaning.

Skull of a northern elephant seal

The eyes are large, round and black. The width of the eyes and a high concentration of low light pigments suggest that sight plays an important role in the capture of prey. Like all seals, elephant seals have atrophied hind limbs whose underdeveloped ends form the tail and tail fin. Each of the "feet" can deploy 5 long webbed fingers. This agile, dual palm is used to propel water. The pectoral fins are used little while swimming. While the hind limbs are unfit for locomotion on land, elephant seals use their fins as support to propel their bodies. They are able to propel themselves quickly (as fast as 8 km/h) in this way for short-distance travel, to return to water, catch up with a female or chase an intruder.

Like other seals, elephant seals have a bloodstream adapted to the cold in which a mixture of small veins surrounds arteries capturing heat from them. This structure is present in extremities such as the hind legs.

Range and ecology

The northern elephant seal lives in the Eastern Pacific Ocean. Feeding grounds extend from northern Baja California to northern Vancouver Island.[4] Males migrate as far north as Alaska and British Columbia,[4][5] while females migrate as far west as Hawaii.[4] They come ashore to breed, give birth and molt, mostly on offshore islands. While the pelagic range covers an enormous span, there are only about seven principal breeding areas, four of which are on islands off the coast of California. Recently increasing numbers have been observed in the Gulf of California. Breeding colonies exist at Channel Islands, Año Nuevo State Reserve, Piedras Blancas Light, Morro Bay State Park and the Farallon Islands in the US[6] and Isla Guadalupe, Isla Benito del Este and Isla Cedros in Mexico.[6] Some breeding has been observed at Castle Rock in Northern California and Shell Island off Oregon[7][8] and in January, 2009 the first elephant seal births were recorded in British Columbia at Race Rocks.[9] The California breeding population is now demographically isolated from the population in Baja California.[6]

Adult male Northern elephant seal in dunes at Año Nuevo State Park mainland

The northern elephant seals are nocturnal deep feeders famous for the long time intervals they remain underwater.[10] This species dives to great depths while feeding, typically between 300 m (1,000 ft) and 800 m (2,600 ft); moreover, the Northern elephant seal will generally not feed in depths of less than 200 m (700 ft).[5] Both sexes eat a variety of prey including pelagic, deep water squid, Pacific hake, sharks, rays, and ratfish.[5][10] Octopoteuthis deletron squid are the most common prey item, found in the stomachs of 58% of individuals sampled off the coast of California.[11] Elephant seals don't need to drink as they get their water from food and broken down fats.

While hunting in the dark depths, it is partly thanks to the use of vision that the elephant seals seem to locate their prey; the bioluminescence of some prey animals can facilitate their capture. Elephant seals do not have a developed a system of echolocation in the manner of cetaceans, but it is assumed that their vibrissae, which are sensitive to vibrations, play a role in search of food. Males and females differ in both diving behavior. Males tend to hug the continental shelf while making deep dives and forage along the bottom,[4] while females have more jagged routes and forage in the open ocean.[4] Males return to the same feeding ground every year while female have less predictable feeding migrations. Elephant seals are preyed on by orcas and white sharks. Both are most likely to hunt pups and seldom hunt large bull elephant seals but have taken seals of all ages. The shark, when hunting adults, is most likely to ambush a seal with a damaging bite and wait to finish the kill until it is weakened by blood loss.[12]

Social behavior and reproduction

Male elephant seals fighting for mates.

The Northern elephant seal returns to its terrestrial breeding ground in December and January, with the bulls arriving first. The bulls haul out on isolated or otherwise protected beaches typically on islands or very remote mainland locations. It is important that these beach areas offer protection from the winter storms and high surf wave action.[13] The bulls engage in fights of supremacy to determine which few bulls will achieve a harem.[14][15]

Three pups are nursing from a single adult female. Female elephant seals deliver only one pup; the two other may have wandered away from their mothers and gotten lost. In this situation no pup would get enough milk.

After the males have arrived the beach, the females arrive to give birth. Females fast for 5 weeks and nurse their single pup for 4 weeks; in last few days of lactation, females come into estrus and mate.[16] In this polygynous society, a high-ranking bull can have a harem of 30–100 cows depending on his size and strength. Males that can't etablish harems are on the periphery but will try and mount females that come by.[14] Dominant bulls will will disrupt copulations of lower ranking bulls.[14] They themselves can mount females without inference, but commonly break off to chase off rivals.[14] While fights are not usually to the death, they are brutal and often with significant bloodshed and injury; however, in many cases of mismatched opponents, the younger, less capable males are simply chased away, often to upland dunes. In a lifetime a successful bull could easily sire over 500 pups. Most copulations in a breeding colony are done by only a small number of males and the rest may never be able to mate with a female.[15] Pups are sometimes crushed during battles between bulls.[13][15]

After arrival on shore males fast for three months, and females fast for five weeks during mating and when nursing of their pups. The gestation period is approximately eleven months. Sometimes, a female can become very aggressive after giving birth and will defend her pup from other females.[17] Such aggression is more common in crowded beaches.[17] While most females nurse their own pup and reject nursings from alien pups, some do accept alien pups with their own.[13][16] An orphaned pup may try to find another female to suckle and some are adopted, at least on Año Nuevo island.[13][16] Pups nurse about four weeks and are weaned abruptly approximately two months before being abandoned by their mother. Left alone weaned pups will gather into groups and stay on shore for 12 more weeks. The pups learn how to swim in the surf and eventually swim farther to forage. Thus their first long journey at sea begins.

Elephant seals communicate though various means. Male will threaten each other with the snort, a sound caused by expelling air though its proboscis, and the clap-trap, a loud clapping sound comparable to the sound of a diesel engine.[18] Pups produce will vocalize when stressed or when prodding their mothers to allow them to suckle. Female make an unpulsed attraction call when responding to their young and a harsh, pulsed call when threated other females, males or alien pups.[18] Elephant seals produce sounds of low-frequency and substrate-borne as well as air-borne vocalizations. These sounds help maintain social hierarchy in crowded or noisy environments and reduce energy consumption when fasting[18]

History and status

The northern elephant seal population was estimated to be 171,000 in 2005.[1]

Beginning in the 18th century northern elephant seals were hunted extensively almost to extinction by the end of the 19th century,[1] being prized for oil that could be made from their blubber, and the population may have fallen as low as 20.[1] In 1874 Charles Melville Scammon recorded in Marine Mammals of the Northwestern Coast of America, that a eighteen feet-long bull caught on Santa Barbara Island yielded 210 gallons of oil.[19] They were thought to be extinct in 1884 until a remnant population of eight individuals was discovered on Guadalupe Island in 1892 by a Smithsonian expedition, who promptly killed seven of the eight for their collections.[20] The elephant seals managed to survive, and were finally protected by the Mexican government in 1922. Since the early 20th century, they have been protected by law in both Mexico and in the United States. Subsequently the U.S. protection was strengthened after passage of the Marine Mammal Protection Act, and numbers have now recovered to over 100,000.

Nevertheless, there is a genetic bottleneck in the existing population, which could make it more susceptible to disease and pollution [21][22] In California, the population is continuing to grow at around 25% per year, and new colonies are being established; they are now probably limited mostly by the availability of haulout space. Their breeding was probably restricted to islands, before large carnivores were exterminated or prevented from reaching the side of the ocean.[23] Numbers can be adversely affected by El Niño events and the resultant weather conditions, and the 1997–98 El Niño may have caused the loss of about 80% of that year's pups. Presently the northern elephant seal is protected under the Federal Marine Mammal Act and under California law has a fully protected status.

Populations of rookery sites in California have increased during the past century.[1] At Año Nuevo State Park, for example, there were no individuals observed whatsoever until the 1950s; the first pup born there was observed in the early 1960s. Currently, thousands of pups are born every year at Año Nuevo, on both the island and mainland. The growth of the site near San Simeon has proved even more spectacular; there were no animals there prior to 1990. Currently, the San Simeon site hosts more breeding animals than Año Nuevo State Park during winter season.

References

  1. ^ a b c d e Campagna, C. (2008). Mirounga angustirostris. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 January 2009.
  2. ^ Beer, Encyclopedia of North American Mammals: An Essential Guide to Mammals of North America. Thunder Bay Press (2004), ISBN 978-1-59223-191-1.
  3. ^ Mirounga angustirostris. Northern Elephant Seal. Smithonian National Museum of Natural History
  4. ^ a b c d e Le Boeuf, B., D. Crocker, D. Costa, S. Blackwell, P. Webb (2000). "Foraging ecology of northern elephant seals". Ecological Monographs 70 (3): 353–382. 
  5. ^ a b c R. Condit and B.J. LeBoeuf (1984). "Feeding Habits and Feeding Grounds of the Northern Elephant Seal". J. Mammal 65 (2): 281–290. doi:10.2307/1381167. 
  6. ^ a b c U.S. Pacific Marine Mammal Stock Assessments: 2007 (NMFS-SWFSC-414). (PDF) . Retrieved on 2011-09-15.
  7. ^ Stewart BS, Yochem PK, Huber HR, DeLong RL, Jameson RJ, Sydeman WJ, Allen SG, Le Boeuf BJ (1994) "History and present status of the Northern elephant seal population". In: Le Boeuf BJ, Laws RM (eds) Elephant Seals: Population Ecology, Behavior, and Physiology. University of California Press, Berkeley, CA, pp. 29–48.
  8. ^ Hodder J, Brown RF, Cziesla C (1998). "The northern elephant seal in Oregon: A pupping range extension and onshore occurrence". Marine Mammal Science 14: 873–881. doi:10.1111/j.1748-7692.1998.tb00772. 
  9. ^ Elephant Seal birth of baby ninene. Racerocks.com. Retrieved on 2011-09-15.
  10. ^ a b G.V. Morejohn and D.M. Beltz (1970). "Contents of the stomach of an elephant seal". Journal of Mammalogy 51 (1): 173–174. doi:10.2307/1378554. 
  11. ^ Le Beouf, Burney J.; Richard M. Laws (1994). Elephant Seals: Population ecology, behavior, and physiology. University of California Press. pp. 213–214. ISBN 978-0-520-08364-6. 
  12. ^ White Sharks – Carcharodon carcharias. Pelagic Shark Research Foundation.
  13. ^ a b c d M.L. Riedman and B.J. LeBoeuf (1982). "Mother-pup separation and adoption in northern elephant seals". Behav. Ecol. Sociobiol 11 (3): 203–213. doi:10.1007/BF00300063. JSTOR 4599535. 
  14. ^ a b c d Leboeuf BJ (1972). "Sexual behavior in the Northern Elephant seal Mirounga angustirostris". Behaviour 41 (1): 1–26. doi:10.1163/156853972X00167. JSTOR 4533425. PMID 5062032. 
  15. ^ a b c Leboeuf BJ (1974). "Male-male competition and reproductive success in elephant seals". Amer. Zool. 14: 163–176. doi:10.1093/icb/14.1.163. 
  16. ^ a b c Leboeuf BJ; Whiting, R. J.; Gantt, R. F. (1972). "Perinatal behavior of northern elephant seal females and their young". Behaviour 43 (1): 121–156. JSTOR 4533472. PMID 4656181. 
  17. ^ a b T. E. Christenson and B. J. Le Boeuf (1978). "Aggression in the Female Northern Elephant Seal, Mirounga angustirostris". Behaviour 64 (1/2): 158–172. doi:10.1163/156853978X00495. JSTOR 4533866. 
  18. ^ a b c Steward, B. S.; Huber, Mirounga angustirostris" 1993. Mammalian Species 449:1-10.
  19. ^ Charles Melville Scammon (2007). The marine mammals of the northwestern coast of North America: together with an account of the American whale-fishery. Heyday Books. p. 132. ISBN 978-1-59714-061-4. http://books.google.com/books?id=GJ1tlnhkTWcC&printsec=frontcover. Retrieved 2011-09-05. 
  20. ^ Briton Cooper Busch (1987). The War Against the Seals: A History of the North American Seal Fishery. McGill-Queen's Press. p. 187. ISBN 978-0-7735-0610-7. http://books.google.com/books?id=Q4WF3PTh4kQC&pg=PA187. Retrieved 2011-09-05. 
  21. ^ Hoelzel, A. R., Fleischer, R. C., Campagna, C., Le Boeuf, B. J. and Alvord, G. (2002). "Impact of a population bottleneck on symmetry and genetic diversity in the northern elephant seal". Journal of Evolutionary Biology 15 (4): 567–575. doi:10.1046/j.1420-9101.2002.00419.x. 
  22. ^ Weber, D. S., Stewart, B. S., Garza, J. C. & Lehman, N. (2000). "An empirical genetic assessment of the severity of the northern elephant seal population bottleneck". Current Biology 10 (20): 1287–1290. doi:10.1016/S0960-9822(00)00759-4. PMID 11069110. 
  23. ^ Chapter 7 "Mammals", The Natural History of Ano Nuevo, 1981, edited by Le Boeuf and Kaza
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!