You are viewing this Species as classified by:

Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Description

Instantly recognisable by the large, inflatable proboscis, the male southern elephant seal is the biggest seal in its family. Males can weigh eight to ten times as much as females, making them the most sexually dimorphic of all mammals (2). Females do not have a proboscis, but rather a short nose and a muzzle (4). Both sexes have robust bodies, thick necks and broad heads, and each digit of the fore flippers bears a large, black nail (4). The coat is light to dark silvery-grey or brown in adults and juveniles, whilst newborns have black coats, which turns into a short silvery-grey coat at around three weeks of age (5). Males develop a chest shield of thickened, creased and heavily scarred skin as they age, and also become paler across the face, proboscis and head (4). During the breeding season, southern elephant seals become stained rusty orange and brown from lying in their own excrement.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

In August each year, southern elephant seals return from the open ocean to their breeding grounds to give birth and mate. Males arrive before the pregnant females and wait for their arrival. Once on land, the non-receptive females are harassed by aggressive males who want to mate. To avoid these males, the females collect together into groups known as harems, where a dominant alpha male will protect them from other males, gaining exclusive mating access once they have given birth. Competition for this alpha position is intense, and results in much fighting, vocalizing and impressive displays. The females give birth to a single pup, two to five days after arriving on the breeding grounds. The pups are nursed for around 23 days, but several days before weaning their pups, the females are mated by the dominant males. Once the pup is weaned, the females return to the sea leaving the pups to fend for themselves, and they teach themselves to swim and hunt for four to six weeks before leaving the beaches for the ocean (2). Southern elephant seals make fairly deep dives for squid, fish, crustaceans, and ascidians. The main foraging areas are located in Antarctic waters. Males forage in areas over the Antarctic continental shelf while females tend to search for food in deeper, offshore waters. As much as 90 percent of their time at sea is spent submerged (2), and thus have an incredible ability to dive to depths as great as 1,430 meters for as longs as 120 minutes (6). Between January and April, the southern elephant seal will again haul itself out onto beaches to molt (5). Molting, during which these enormous mammals gain new skin and hair, can take three to five weeks, during which time the seal relies in stored blubber to provide energy (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Southern Elephant Seals have a nearly circumpolar distribution in the Southern Ocean. While most haulout sites are on Subantarctic and Antarctic islands, a number of animals haul out regularly at sites on the coasts of southern Argentina and Chile (Campagna and Lewis 1992) and Antarctica (Bester 1988, Heimark and Heimark 1986, Murray 1981). They forage at sea between about 40 south and the Antarctic Continent. Occasional vagrants have been recorded on the coasts of northern South America (Alava and Carvajal 2005, De Moura et al. 2010), southern Africa (Kettlewell and Rand 1955, Oosthuizen et al. 1988), Australia and New Zealand (Mills et al. 1977, Taylor and Taylor 1989). The most distant vagrant was recorded at Oman on the Arabian Peninsula, some 9,000 km from the nearest possible point of origin (Johnson 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circumpolar distribution in southern hemisphere
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mirounga leonina (southern elephant seals) are found along the coast of Antarctica and on sub-Antarctic islands when breeding or molting. However, before human exploitation they were more common farther north. The largest present population occurs on the island of South Georgia, in the South Atlantic Ocean. Southern elephant seals are also common on Macquarie Island, Heard Island, Kerguelen Island, and the Peninsula Valdez in Argentina. When at sea, M. leonina often journey thousands of miles from their breeding grounds. Despite the occasional sighting, not much is known about their range outside of the breeding season.

Biogeographic Regions: antarctica (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • 1983. Elephant Seals. Pp. 1130-1132 in R Nowak, J Paradiso, eds. Walker's Mammals of the World, Vol. 2, 4 Edition. Baltimore and London: Johns Hopkins University Press.
  • 2002. Elephant Seal. Pp. unknown in P Lagasse, ed. Columbia Encyclopedia, Vol. 1, sixth Edition. New York: Columbia University Press. Accessed February 08, 2004 at http://www.encyclopedia.com/html/e1/elphnt-se.asp.
  • 2002. Elephant Seals. Pp. 370-373 in W Perrin, B Wursig, J Thewissen, eds. Encyclopedia of Marine Mammals, Vol. 1, 1 Edition. San Diego: Academic Press.
  • Anderson, G. 2003. "Elephant Seals" (On-line). Marine Science. Accessed February 08, 2004 at http://www.biosbcc.net/ocean/marinesci/05nekton/esindex.htm.
  • Bradshaw, C., M. Hindell, N. Best, K. Phillips, G. Wilson, P. Nichols. 2003. You are what you eat: Describing the foraging ecology of southern elephant seals using blubber fatty acids. Proceedings of the Royal Society of London, 270: 1283-1292.
  • Carroll, P. 2002. "The Kerguelen Island, Southern Indian Ocean" (On-line). Accessed December 04, 2002 at http://www.btinternet.com/~sa_sa/kerguelen/kerguelen_islands.html.
  • Crown. 1997. "Southern Elephant Seal (Sea Elephant)" (On-line). Department of Conservation (New Zealand). Accessed February 04, 2004 at http://www.doc.govt.nz/Conservation/001~Plants-and-Animals/003~Marine-Mammals/Southern-Elephant-Seal-(Sea-Elephant).asp.
  • Gaskin, D. 1972. Whales Dolphins and Seals. London: heinemann Educational Books.
  • Nowak, R. 2003. Walker's Marine Mammals of the World. Baltimore and London: Johns Hopkins University Press.
  • Rice, D. 1998. Marine Mammals of the World-Systematics and Distribution. Lawrence, Kansas: Allen Press Inc..
  • Seal Conservation Society. 2001. "Southern Elephant Seal" (On-line). Seal Conservation Society. Accessed February 04, 2004 at http://www.pinnipeds.org/species/selephnt.htm.
  • Slip, D., M. Clippingdale. 2002. "Elephant Seals" (On-line). Australian Antarctic Division. Accessed February 04, 2004 at http://www.antdiv.gov.au/default.asp?casid=1733.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The southern elephant seal is found throughout the southern oceans during the non-breeding season, but in the breeding season, it splits into three discrete populations on islands north of the Antarctic's pack ice. The main islands to support the breeding seals are South Georgia, near the southern-most tip of South America; Macquarie Island, 1,500 km south-southeast of Tasmania; and Kerguelen Island, midway between Africa, Antarctica and Australia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Male southern elephant seals are the largest pinnipeds, larger even than northern elephant seals, Mirounga angustirostris, their closest relatives. Mirounga leonina males have been documented reaching over six meters long and weighing over 4000 kg. This is in sharp contrast to females, which are rarely over 800 kg or four meters long. In fact, both species of the genus Mirounga are more sexually dimorphic than any other mammal. This dimorphism stretches beyond just size. Males also have a large, inflatable proboscis, which enhances vocalizations used to challenge other males for mating rights. The southern elephant seal proboscis is slightly smaller than the proboscis of northern elephant seals, overhanging the mouth by only about 10 centimeters compared to 30 centimeters in their northern relatives.

Breeding populations vary in size. In the South Georgian population, males average 450 cm in length and weigh 4,000 kg. Females average 280 cm and weigh 900 kg. The seals from Macquarie Island population are somewhat smaller, with males averaging 420 cm in length and 3,000 kg and females averaging 260 cm and 400 kg.

Despite the large difference in size, male and female southern elephant seals do share many physical traits. They have a similar body type. This includes short front flippers used primarily for steering in the water, and very strong, fully webbed, rear flippers that can propel them through the water with remarkable speed and agility. They also have a layer of short, stiff hair covering their bodies. At birth this fur is very dark in color, but lightens after the first molt. New fur after a molt is typically a dark gray/brown with lighter underside and lightens over the course of the year. It is also common for the bodies of both sexes to have scars, usually around the neck, from fighting and mating.

Range mass: 300 to 4000 kg.

Average mass: 2000 (male) 500 (female) kg.

Range length: 260 to 600 cm.

Average length: 500 (male) 300 (female) cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Southern Elephant Seals are the largest of all pinnipeds with adult males reaching masses of two to four tons and lengths of up to 4.5 m. They show considerable sexual dimorphism, with adult females only reaching masses of 400-900 kg and average lengths of 2.8 m. Newborn pups weigh between 40 and 46 kg (Laws 1993). Females first haul out to pup at ages of three to six years, and males typically breed for the first time at six to ten years of age (Laws 1956,Carrick et al. 1962a, Jones 1981,McCann 1981,Pistoriuset al.2001,Kirkman et al. 2004). At Marion Island, less than 5% of females survived beyond 13 years of age, and less than 5% of males beyond 10 years of age (de Bruyn 2009). Longevity of 23 years has been recorded for adult females at Macquarie Island (Hindell and Little 1988).

Southern Elephant Seals undergo an annual double migration between foraging grounds and isolated haulout sites, at which they are born and where they breed in the austral spring, moult in the austral summer, and as immatures haulout in the winter (Bartholomew and Hubbs 1960, Carrick et al. 1962b, Hindell and Burton 1988). Southern Elephant Seals are predominantly marine. Adult females spend more than 85% of each year at sea while adult males spend less than 80% (Carrick et al. 1962a, Hindell and Burton 1988, McIntyre et al. 2010). Their foraging grounds may be located over 5,000 km from their terrestrial haulout sites (Bester and Pansegrouw 1992, Jonker and Bester 1998,Campagnaet al.1999,Bailleulet al.2007).

Southern Elephant Seals spend most of their at-sea time foraging in association with frontal systems, currents and shifting marginal ice-edge zones. Studies of foraging sites suggest that they are sensitive to fine-scale variation in bathymetry and ocean properties (sea-ice concentration and sea temperature profiles) (Bailleul et al. 2007, Biuw et al. 2010). Southern Elephant Seals are prodigious divers. Dive depth and duration vary during the year and between the sexes, but mostly range from 200 to 700 m deep and from 20 to just over 30 minutes in duration (Biuw et al. 2010, McIntyre et al. 2010). Both sexes spend over 65% of their lives below 100 m. The maximum record dive depth is 2,133 m for an adult male (McIntyre et al. 2010).

The diet varies between populations and seasons. It consist primarily of myctophid and notothenid fish and squid (Brown et al. 1999,Piatkowskiet al.2002,Bradshawet al.2003,van den Hoffet al.2003,Cherel et al. 2008, Newland et al. 2011).

Four types of terrestrial periods are experienced over the course of their lives: the breeding, moult and winter haulouts, and the natal terrestrial period. The mating system is mate-defense polygyny. Breeding seasons are highly synchronized (Carrick et al. 1962b, Laws 1956, McCann 1981,Bonner 1989). Adult females spend approximately a month ashore during the breeding season, while adult males may spend one to three months ashore. During this time adult females will haul out in large aggregations that may contain up to a thousand animals (Carrick et al. 1962a,Bonner 1989). Some three to seven days after females come ashore they give birth to a single pup, which they will suckle for some three weeks. Mating takes place shortly before the pup is weaned and the adult female returns to the sea a few days later. Breeding aggregations are ephemeral, and do not last beyond the breeding season. Access to all females in one breeding aggregation is defended by a dominant adult male. In larger breeding aggregations, subdominant males also gain access to females (Laws 1956,Carrick et al. 1962a, McCann 1981).

Killer Whales are the primary predators of Southern Elephant Seals (Reisinger et al. 2011) but Leopard Seals are also known to take pups (Gwyn 1953).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16424 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16344 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.726 - 13.900
  Nitrate (umol/L): 1.714 - 30.651
  Salinity (PPS): 33.556 - 34.912
  Oxygen (ml/l): 5.959 - 8.248
  Phosphate (umol/l): 0.278 - 2.131
  Silicate (umol/l): 1.783 - 78.870

Graphical representation

Temperature range (°C): -1.726 - 13.900

Nitrate (umol/L): 1.714 - 30.651

Salinity (PPS): 33.556 - 34.912

Oxygen (ml/l): 5.959 - 8.248

Phosphate (umol/l): 0.278 - 2.131

Silicate (umol/l): 1.783 - 78.870
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

When southern elephant seals are on land, they are typically found along the coast of sub-Antarctic islands on smooth beaches of sand or small rocks. Although they used to breed well into temperate regions, M. leonina are now only found farther south. They are found on land during the breeding season, from August to November, and the molting season, which lasts 3 to 5 weeks in the spring. The rest of the year is spent entirely at sea. During this time they can be found from sub-Antarctic waters to almost as far north as the equator, often venturing thousands of kilometers from their breeding grounds. While males typically forage on the Antarctic continental shelf, females travel farther into open waters. During their time at sea, southern elephant seals can sustain dives for up to two hours, but most dives last only around thirty minutes. Amazingly, they only spend 2 to 3 minutes on the surface between dives. During most trips at sea, they are underwater for 90% of the time, day and night. While most dives are only between 300 and 800 m, dives of over 1500 m have been recorded, nearing depths only surpassed in mammals by sperm whales.

Range depth: 1500+ to surface m.

Average depth: 300-800 m.

Habitat Regions: polar ; terrestrial ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Other Habitat Features: intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16424 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16344 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.726 - 13.900
  Nitrate (umol/L): 1.714 - 30.651
  Salinity (PPS): 33.556 - 34.912
  Oxygen (ml/l): 5.959 - 8.248
  Phosphate (umol/l): 0.278 - 2.131
  Silicate (umol/l): 1.783 - 78.870

Graphical representation

Temperature range (°C): -1.726 - 13.900

Nitrate (umol/L): 1.714 - 30.651

Salinity (PPS): 33.556 - 34.912

Oxygen (ml/l): 5.959 - 8.248

Phosphate (umol/l): 0.278 - 2.131

Silicate (umol/l): 1.783 - 78.870
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits the open ocean during the non-breeding season, where they can dive to remarkable depths (2). During the breeding season, the southern elephant seal is generally found on beaches and rocky terrain, and sometimes on ice and snow (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Southern elephant seals feed exclusively when they are at sea. For this reason not much is known about what they eat. The main known sources of food are squid, crabs, shrimp, fish, and sharks. This prey is obtained both near the surface and also during very deep dives. They have been known to eat bottom dwelling fish.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

  • Slip, D. 1995. The diet of southern elepahant seals (Mirounga leonina) from Heard Island. Candian Journal of Zoology, 73: 1519-1528.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Not much is known of the roles of southern elephant seals while they are at sea. However, they are known to be important to their ecosystem as predators of fish, sharks, squid, crabs, and shrimp and as prey for large sharks, killer whales, and leopard seals. Another important role they play in the ecosystem is as a host for many kinds of parasites. Some of the known parasites include tapeworms, acanthocephalans, and the louse Lepidophthirus macrorhini.

Commensal/Parasitic Species:

  • tapeworms
  • acanthocephalans
  • the louse Lepidophthirus macrorhini 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Knowledge of predation of M. leonina is limited due to their deep ocean habitat. Known predators include large sharks, specifically great white sharks, and killer whales. Leopard seals are also known to prey on pups. In order to avoid predation, southern elephant seals have dark dorsal surfaces with lighter undersides. This allows some camouflage by blending in with the lighter water when viewed from below and the darker water when seen from above.

Known Predators:

  • large sharks, specifically great white shark 
  • killer whale
  • leopard seal

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Mirounga leonina is prey of:
Odontoceti
Homo sapiens

Based on studies in:
Antarctic (Marine)

This list may not be complete but is based on published studies.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Mirounga leonina preys on:
Actinopterygii
Cephalopoda
non-insect arthropods
Mollusca
Crustacea

Based on studies in:
Antarctic (Marine)

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

When at sea, Mirounga leonina rarely encounter each other and thus have no need for communication. The only time communication is used is during breeding. Males use their large proboscis as a sound chamber for amplifying their bellows. These sounds are made to establish territories and challenge males for established harems. Upright posturing often accompanies these vocalizations and males are known to visually assess their competitor before fighting. Lesser males will also exhibit a flattened posture without inflating their proboscis when near another male’s harem to demonstrate that they are not threats.

A threat vocalization is a low-pitched harsh vocalization. While the seal is doing this it will raise its head and forequarters off of the ground, supporting itself without fore flippers. A lunge from an animal is a rapid movement of the head towards an opponent or invader. This is done with an open mouth. A high rear is the raising of the front half of the body then delivering blows to another animal with the neck or chin. A bite may also be used, mainly from a low rear or a high rear position.

Females are known to communicate with newborn pups through vocalizations. Females and pups recognize each other through these vocal cues and through their individual smells.

Communication Channels: visual ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is little known about lifespan in southern elephant seals. This is largely due to the lack of substantial information concerning the periods of the year when they are at sea. Average life expectancy in the wild, as seen during the breeding season, is about 23 years. However, about 30% of pups die in their first year. Captive M. leonina have lived to 15 years of age. Not much is known concerning the deaths of these mammals but, in addition to predation, weather and disease may play a large role in limiting their lifespan.

Range lifespan

Status: captivity:
15 (high) years.

Average lifespan

Status: wild:
23 years.

Average lifespan

Sex: male

Status: wild:
20.0 years.

Average lifespan

Sex: female

Status: wild:
18.0 years.

Average lifespan

Status: wild:
23.0 years.

Average lifespan

Status: wild:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The total gestation time, of about 11.5 months, includes a 3 to 4 months period of delayed implantation (Ronald Nowak 2003). Males are typically much bigger than females. In the wild, males have been reported to live more than 23 years (http://www.demogr.mpg.de/longevityrecords), and there are anecdotal reports of animals living over 25 years. Their longevity in captivity has not been studied in detail, but one specimen lived 23.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male southern elephant seals arrive at breeding grounds several weeks before females and, through vocalizations, body positions, and occasional fighting, claim territories on the beach. The best and largest territories go to the largest and strongest males. These “alpha” males become the head of a harem when the females arrive, often mating with up to 60 females in their harem. If harems exceed this size, additional “beta” males may be present, each claiming as many females as they can. Females become a part of a harem simply through their position on the beach and may move from one harem to another incidentally.

In addition to their mating duties, alpha males are responsible for keeping unwanted males away from the harems. This is done through the same vocalizations and aggressive body postures that were used originally to claim their harem. Males must remain on their territory to defend it and, therefore, go for periods of months without eating. This, and the stress of aggressive encounters with other males and the energy expense of mating with multiple females, can take a significant toll on male physical condition. Only males in the best physical condition at the beginning of breeding season will successfully defend their territory and breed with multiple females. Subordinate males attempt to copulate with females on the edges of territories or in the surf as they leave the beach.

Females that were pregnant from the previous year’s mating give birth to one pup shortly after arriving on land. A period of lactation follows the birth. Then, several days before the pups are weaned from their mother’s milk, females enter estrus and mate with the alpha male or a successful beta male. Shortly following mating, males return to sea. Females return to the sea immediately after the pups are weaned.

Mating System: polygynous

Once a year, from August to November, southern elephant seals return to land to breed. Amazingly, most return to the very same breeding grounds on which they were born. Five to seven days after pregnant females arrive on the beaches, they give birth to one pup. Occasionally twin pups are born but one typically dies soon afterwards. The mothers then nurse their young for about 23 days. Females may nurse longer if their energy reserves allow them to do so. During their time on the breeding grounds females eat little or not at all. Towards the end of this time, females enter estrus and mate with a male. Shortly after mating, females wean their young. At this point, they abandon their young and return to the ocean. Pups then forage on their own for several weeks before venturing out to sea in small groups. Female southern elephant seals typically reach sexual maturity by the age of 3 and participate in the annual breeding cycle by age 6. Males reach sexual maturity by age 5 or 6, but rarely are developed enough to compete for mates until they reach 10 to 12 years of age. The gestation period of female M. leonina is about eight months. There is a period of several weeks during late October when all mature females mate. In order to maintain the yearly birthing cycle with an eight-month gestation period, there is delayed implantation of the fertilized egg for about three months. After the three-month delay, the egg implants and begins to develop to become mature enough for birth during the next breeding season.

Breeding interval: Southern elephant seals mate once each year.

Breeding season: Breeding season lasts from August to November.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 9 to 7 months.

Range weaning age: 20 to 35 days.

Average weaning age: 23 days.

Range time to independence: 20 to 25 days.

Average time to independence: 23 days.

Range age at sexual or reproductive maturity (female): 2 to 4 years.

Range age at sexual or reproductive maturity (male): 5 to 6 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous ; delayed implantation

Average birth mass: 42500 g.

Average number of offspring: 1.

Female southern elephant seals are the sole caregivers for their young from the moment of conception until weaning, a period that lasts around one year. After delayed implantation, which follows mating, the nine-month gestation period of the pregnancy begins. During this time, the pup develops inside the mother as she is diving and feeding in sub-Antarctic waters. Shortly after coming to land, females give birth to their pups, typically weighing between 25 and 50 kg at birth. Following birth, mothers bond vocally and through smell with their pup. For the next 20 to 25 days (sometimes as long as 35 days) mothers are responsible for providing milk and protecting pups. Mothers are typically less than one-meter from their pups during the stage of suckling, regardless of tide, the position in the harem, or the time in the breeding season. A pup might get separated from its mother due to male harassment and herding of females. This can result in an abandoned pup. Once a pup is separated from its mother the results are fatal. Alien suckling (nursing between unrelated cows and pups) isn't tolerated in this species. If an orphan pup attempts to steal milk from a sleeping or resting cow, it usually is bitten and will succumb to starvation or the effects of the bites. The most dire threat to young pups is adult males who crush pups as they travel and fight on beach territories. During lactation, mothers do not return to the water to feed and instead live on fat reserves built up during the previous foraging season. At weaning pups weigh from 120 to 130 kg, a weight gain of as much as 105 kg in a few weeks!

Immediately following weaning, female southern elephant seals return to sea, leaving their pups alone on the beach. Eventually the pups begin to get hungry and find their way to the ocean, learning to feed and swim on their own. After weaning, there is no interaction between parents and pups. Approximately 30% of these pups will not live through their first year.

Parental Investment: no parental involvement; precocial ; female parental care ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • 1983. Elephant Seals. Pp. 1130-1132 in R Nowak, J Paradiso, eds. Walker's Mammals of the World, Vol. 2, 4 Edition. Baltimore and London: Johns Hopkins University Press.
  • 2002. Elephant Seal. Pp. unknown in P Lagasse, ed. Columbia Encyclopedia, Vol. 1, sixth Edition. New York: Columbia University Press. Accessed February 08, 2004 at http://www.encyclopedia.com/html/e1/elphnt-se.asp.
  • 2002. Elephant Seals. Pp. 370-373 in W Perrin, B Wursig, J Thewissen, eds. Encyclopedia of Marine Mammals, Vol. 1, 1 Edition. San Diego: Academic Press.
  • Anderson, G. 2003. "Elephant Seals" (On-line). Marine Science. Accessed February 08, 2004 at http://www.biosbcc.net/ocean/marinesci/05nekton/esindex.htm.
  • Baldi, R., C. Campagna, S. Pedraza, B. Le Boeuf. 1996. Social effects of space on the breeding behavior of elephant seals in Patagonia. Animal Behaviour, 51: 717-724.
  • ESRG - Filippo Galimberti & Simona Sanvito. 2002. "The Elephant Seals page" (On-line). Accessed February 08, 2004 at http://www.eleseal.org/index.html.
  • Englehard, G., A. Baarspul, M. Broekman, J. Creuwels, P. Reijnders. 2002. Human disturbance, nursing behaviour, and lactational pup growth in a declining southern elephant seal population. Canadian Journal of Zoology, 80/11: 1876-1886.
  • Galimberti, F., A. Fabiani, L. Boitani. 2003. Socio-spatial levels of linearity analysis of dominance hierarvhies: a case study on elephant seals. Journal of Ethology, 21/2: 131-136.
  • Gaskin, D. 1972. Whales Dolphins and Seals. London: heinemann Educational Books.
  • Hindell, M., B. McConnell, M. Fedak, D. Slip, H. Burton. 1999. Environmental and physiological determinants of successful foraging by native southern elephant seal pups during their first trip to sea. Canadian Journal of Zoology, 77: 1807-1821.
  • Le Boeuf, B., L. Petrinovich. 1974. Elephant seals: Interspecific comparisons of vocal and reproductive behavior. Mammalia, 38: 16-32.
  • McCann, T. 1980. Population structure and social organization of southern elephant seals. Journal of the Linnaen Society, 14: 133-150.
  • McCann, T. 1982. Aggressive and maternal activites of female southern elephant seals (Mirounga leonina). Animal Behavior, 30: 268-276.
  • McConell, B., M. Fedak, H. Burton, G. Englehard, P. Reijnders. 2002. Movements and foraging areas of naive, recently weaned southern elephant seal pups. Journal of Animal Ecology, 71/1: 65-78.
  • Nowak, R. 2003. Walker's Marine Mammals of the World. Baltimore and London: Johns Hopkins University Press.
  • Seal Conservation Society. 2001. "Southern Elephant Seal" (On-line). Seal Conservation Society. Accessed February 04, 2004 at http://www.pinnipeds.org/species/selephnt.htm.
  • Slip, D., M. Clippingdale. 2002. "Elephant Seals" (On-line). Australian Antarctic Division. Accessed February 04, 2004 at http://www.antdiv.gov.au/default.asp?casid=1733.
  • Van Der Toorn, J. 1999. "Elephant Seals" (On-line). Accessed December 02, 2002 at http://ourworld.compuserve.com/homepages/jaap/elepseal.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Bulging proboscis amplifies sound: southern elephant seal
 

The proboscis of the male elephant seal amplifies calls by bulging using a combination of air, blood, and muscle.

     
  "Another species in which the male sports an exaggerated nose is the elephant seal, largest of all seals at 5-6 m long and up to 3500 kg in weight. The huge, bulging nose of the mature male is used during the breeding season, when the seals gather in vast herds on the shores of California or the South Atlantic islands. The proboscis of the mature male bulges with the combined efforts of blood, muscle and air, and amplifies his defiant bellowing at other males." (Foy and Oxford Scientific Films 1982:136)

Watch video
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mirounga leonina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCTACAAATCATAAAGACATCGGCACTCTCTACCTATTATTTGGTGCATGAGCCGGCATAGTAGGCACCGCCCTCAGTCTTTTAATTCGCGCAGAACTAGGGCAGCCTGGCGCTTTACTAGGAGAC---GATCAGATCTATAACGTGATTGTCACCGCTCACGCATTCGTAATAATCTTTTTTATAGTAATACCTATCATGATCGGAGGTTTCGGAAACTGGTTAGTACCTCTAATGATTGGTGCCCCTGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTCTACCACCATCCTTCCTATTACTATTAGCTTCCTCCATAGTAGAAGCAGGTGCAGGAACAGGATGAACCGTCTATCCCCCTCTAGCTGGTAACCTAGCCCATGCAGGAGCATCTGTAGACCTAACAATTTTCTCTCTTCACTTGGCAGGTGTATCATCCATCCTTGGAGCCATCAACTTTATTACCACTATTATTAACATAAAACCCCCTGCAATATCTCAATATCAAATTCCCTTATTCGTATGATCCGTACTAATTACAGCAGTACTTCTGCTATTATCACTACCAGTTCTAGCAGCTGGTATTACTATACTACTTACAGACCGAAATCTAAATACAACATTCTTTGATCCTGCTGGAGGAGGTGACCCTATTCTATATCAACATCTATTCTGATTCTTTGGACACCCCGAAGTATATATTCTAATTCTTCCAGGATTTGGAATAATCTCACACATCGTCACCTACTACTCAGGAAAAAAAGAACCCTTCGGCTATATAGGAATAGTCTGAGCAATAATATCCATTGGTTTCCTAGGCTTCATTGTATGAGCTCATCATATATTTACCGTAGGAATAGATGTTGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mirounga leonina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Hofmeyr, G.J.G.

Reviewer/s
Hckstdt, L.A.

Contributor/s

Justification

Estimates of Southern Elephant Seal abundance indicate a global pup production of over 200,000 at some 15 islands or island groups. However recent estimates are lacking, including for the largest subpopulation. Global abundance is inferred to have been stable or to have increased over the past three generations. While 50% of pup production is estimated to take place at South Georgia, four other sites each support more than 5% of global pup production. Three of those sites have experienced decreases over the past three generations that are not fully understood. While decreases have ceased at two of these sites, they continue at a third. In the light of the unknown effects of global climate change on this species, and the age of estimates of abundance for some subpopulations, demographic monitoring is imperative. This species continues to qualify for listing by IUCN as Least Concern.


History
  • 2008
    Least Concern (LC)
  • 1996
    Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although once hunted by humans, southern elephant seals were never near extinction like northern elephant seals. This is largely because most of the breeding grounds of M. leonina were out of reach of hunting boats. Hunting did have some impact, but numbers have recovered since hunting has ceased. Some populations are are experiencing declines. This may be normal population fluctuations, however.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Lower Risk / Least Concern (LR/lc) on the IUCN Red List (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No recent comprehensive estimate of Southern Elephant Seal abundance is available throughout the entire distribution. The worldwide population was estimated to be 650,000 in the mid 1990s (SCAR EGS 2008). Four distinct populations have been identified in the Southern Ocean (Gales et al. 1989, Hoelzel et al. 1993, Slade et al. 1998). While the movement of breeding individuals between these populations is rare, it does occur (Fabiani et al. 2003, Reisinger and Bester 2010). These populations include subpopulations at or close to Argentina (Peninsula Valds and the Falkland Islands), in the Atlantic sector (South Georgia, South Orkney Islands, South Shetland Islands, Bouvetya and Gough Island), in the Indian sector (Iles Kerguelen, Iles Crozet, Heard Island and the Prince Edward Islands) and in the Pacific sector (Macquarie Island, Campbell Island and Antipodes Island). A further four historical populations are extinct, likely due to exploitation: St. Helena Island, Tristan da Cunha, Islas Juan Fernndez and the Bass Strait (Bester 1980, Carrick and Ingham 1962, Wace and Holdgate 1976). A subpopulation from Victoria Land on the Antarctic coast became extinct a few hundred years prior to human discovery (Hall et al. 2006).

While Southern Elephant Seals breed at 14 islands or island groups, five of these are responsible for 99% of pup production. More than 50% of pup production takes place at South Georgia (Boyd et al. 1996, M. Fedak pers. comm. in SCAR EGS 2008), with Isle Kerguelen responsible for some 21% (Authier et al. 2011) and the Peninsula Valdes, Heard Island and Macquarie Island each responsible for greater than 5% (Lewis et al. 1998, Slip and Burton 1999, van den Hoff et al. 2014).

The Peninsula Valdes/Falkland Island colonies have increased in recent times (Lewiset al.1998,Galimberti et al. 2001, SCAR EGS 2008). Colonies in the Atlantic sector of the Southern Ocean are also growing or stable (Boyd et al. 1996, Galimberti et al. 2001,SCAR EGS 2008,Gil-Delgado et al. 2013). In contrast, those in the Indian Ocean (Guinetet al.1999,Slip and Burton 1999,Pistoriuset al.2004,Bester and Hofmeyr 2005, de Bruyn 2009,Pistorius et al.2011) and Pacific Ocean (van den Hoff et al. 2007, 2014) sectors have been either stable or decreasing to the mid 1990s. However, recent cessations of decrease, and increases, have been recorded at island groups in the Indian Ocean sector (McMahonet al.2009,Authier et al. 2011, Pistorius et al. 2011). This is not true for the Macquarie Island subpopulation, the only substantial population within the Pacific sector (van den Hoff et al. 2014). Numbers of adult females in this subpopulation declined at a mean annual rate of -0.8% between 1988 and 2011, and continued to do so through 2014.

The causes of these declines are debated. They are not completely understood and may differ between populations but evidence indicates that the low survival of adult females (Pistoriuset al.2004,de Bruyn 2009, Pistorius et al.2011, van den Hoff et al. 2014) or of pups (McMahon and Burton 2005, McMahon et al. 2005ab) is important. Survival of both adult females (Pistorius et al. 2011, van den Hoff et al. 2014) and pups (McMahon and Burton 2005, McMahon et al. 2005b) varies interannually with climatic conditions. The low survival of adult females may be due to the effects of the limitation of food on an age and sex class that is responsible for successfully weaning offspring, and migrating to distant foraging grounds to recover from terrestrial fasts (Pistorius et al. 2011, van den Hoff et al. 2014) whereas the low survival of pups may be due to low weaning mass and also reduced food availability to nave, and therefore vulnerable, animals (McMahon et al. 2003, 2005a).

Generation length has been calculated at 9.5 years (Pacifici et al. 2013). Population change over three generations from 19822009 is inferred to have been stable or positive (SCAR EGS 2008,Authier 2011, Pistorius et al. 2011, van den Hoff 2014).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Southern Elephant Seals face few threats and conflicts today, since they live far from human population centres and have minimal interactions with commercial fisheries. Intensive fishing could, however, deplete important prey stocks (Hanchet et al. 2003). The possible effects of global climate change on Southern Elephant Seals are not well known but such changes may negatively impact prey populations or change marine habitat (Learmonthet al. 2006, Kovacs et al. 2012). It is also possible that a reduction in sea ice due to climate change may benefit Southern Elephant Seals (van den Hoff et al. 2014). Southern Elephant Seals that haul out at mainland sites could come in contact with domestic and wild animals and be exposed to a variety of diseases including morbilliviruses (Lavigne and Schmitz 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the 18th and 19th centuries southern elephant seals were hunted extensively for their fur for clothing, and oil for mechanical lubrication (2) (6), and a large-scale sealing industry continued in South Georgia until 1964 under a management scheme (4) (6). This exploitation resulted in many populations declining, which recovered after the cessation of such activities (6), however, since the 1950s and 1960s, numbers of the southern elephant seal have again decreased significantly (2). Reasons for this decline are unclear, but it is thought to be due to changes in distribution and abundance of the seal's prey (2). There is some concern that large-scale fisheries may be competing with the elephant seals for their preferred prey (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Any future exploitation of Southern Elephant Seals within the Antarctic Treaty area (south of 60S) is regulated by the Convention for the Conservation of Antarctic Seals, while north of this area the Convention on Antarctic Marine Living Resources and various national measures apply to the islands and continental areas on which the species breeds and occurs. The Falkland Islands Dependencies Conservation Ordinance provides protection for Southern Elephant Seals on South Georgia and the South Sandwich Islands (Reijnders et al. 1993). Seals on the Prince Edward Islands are protected by virtue of these islands status as a special nature reserve, their location within a marine protected area, and also by the South African Seabirds and Seals Protection Act (PEIMP 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Southern elephant seals are protected by the U.S. Fish and Wildlife Service's Marine Mammal Act 1972, but research into the reasons behind the decline of this species must be conducted before management plans can be drawn up. Priorities for research need to focus on the continuation of census programmes, demographic studies and investigations into several aspects of the biology of first-year seals, particularly diet and foraging ranges (6). Some of the breeding sites of the southern elephant seal are protected, such as the Provincial Wildlife Reserve of North Point, at Peninsula Valdés, Argentina (7), and MacQuarie Island Nature Reserve and World Heritage Site (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Southern elephant seals may occasionally compete with some fisheries, but this is unlikely. Southern elephant seals live in remote regions where they have few interactions with humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the past, southern elephant seals were hunted for their blubber that was boiled down into oil. A typical male could produce about 350 liters of oil. Some aboriginal people also hunted them for food and skins. This activity has ceased and killing is now controlled by the Convention for the Conservation of Antarctic Seals. The only use of M. leonina to man today is for purely scientific purposes.

Positive Impacts: body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Southern elephant seal

The southern elephant seal (Mirounga leonina) is one of the two extant species of elephant seals. It is both the largest pinniped and member of the order Carnivora living today, as well as the largest Antarctic seal. The seal gets its name from its great size and the large proboscis of the adult males, which is used to make extraordinarily loud roaring noises, especially during the mating season. Rather larger at average than the male northern elephant seal (Mirounga angustirostris) (which is 40% lighter) and male walrus (Odobenus rosmarus) (the average North Pacific bull, of the larger race, is 2.5 times lighter), the adult bull southern elephant seal is without rival the largest carnivoran alive.[3][4][5] An average adult male southern elephant seal weighs six to seven times more than the largest terrestrial carnivorans, the polar bear (Ursus maritimus) and Kodiak bear (Ursus arctos middendorffi).[6][7]

Description[edit]

Skeleton of a southern elephant seal
Close-up of juvenile southern elephant seal, showing face and mouth detail

The southern elephant seal is distinguished from the northern elephant seal (which does not overlap in range with this species) by its greater body mass and a shorter proboscis. The southern males also appear taller when fighting, due to their tendency to bend their backs more strongly than the northern species. This seal shows extreme sexual dimorphism in size, seemingly the largest of any mammal by mass, with the males typically five to six times heavier than the females.[8] In comparison, in two other very large marine mammals with high size sexual dimorphism, the northern elephant seal and the sperm whale (Physeter macrocephalus), the males weigh on average about three times as much as the females, and only more than four times as heavy in exceptionally heavy bull specimens.[9] While the females southern elephant seal typically weighs 400 to 900 kg (880 to 1,980 lb) and measures 2.6 to 3 m (8.5 to 9.8 ft) long, the bulls typically weigh 2,200 to 4,000 kg (4,900 to 8,800 lb) and measure from 4.2 to 5.8 m (14 to 19 ft) long.[10][11] An adult female averages 771 kg (1,700 lb) in mass, while a mature bull averages about 3,175 kg (7,000 lb).[12][13] Studies have indicated elephant seals from South Georgia are around 30% heavier and 10% longer on average than those from Macquarie Island.[8] The record-sized bull, shot in Possession Bay, South Georgia, on 28 February 1913, measured 6.85 m (22.5 ft) long and was estimated to weigh a hulking 5,000 kg (11,000 lb), although it was only partially weighed piecemeal.[7][14] The maximum size of a female is 1,000 kg (2,200 lb) and 3.7 m (12 ft).[7] The eyes are large, round, and black. The width of the eyes, and a high concentration of low-light pigments, suggest sight plays an important role in the capture of prey. Like all seals, elephant seals have hind limbs whose ends form the tail and tail fin. Each of the "feet" can deploy five long, webbed fingers. This agile dual palm is used to propel water. The pectoral fins are used little while swimming. While their hind limbs are unfit for locomotion on land, elephant seals use their fins as support to propel their bodies. They are able to propel themselves quickly (as fast as 8 km/h (5.0 mph)) in this way for short-distance travel, to return to water, to catch up with a female, or to chase an intruder.

Pups are born with fur and are completely black. Their coats are unsuited to water, but protect infants by insulating them from the cold air. The first moulting accompanies weaning. After moulting, the coats may turn grey and brown, depending on the thickness and moisture of hair. Among older males, the skin takes the form of a thick leather which is often scarred.

Like other seals, the vascular system of elephant seals is adapted to the cold; a mixture of small veins surround arteries, capturing heat from them. This structure is present in extremities such as the hind legs.

Range and population[edit]

The world population was estimated at 650,000 animals in the mid-1990s,[1] and was estimated in 2005 at between 664,000 and 740,000 animals.[15] Studies have shown the existence of three geographic subpopulations, one in each of the three oceans.

Tracking studies have indicated the routes traveled by elephant seals, demonstrating their main feeding area is at the edge of the Antarctic continent. While elephant seals may come ashore in Antarctica occasionally to rest or to mate, they gather to breed in subantarctic locations.

Southern elephant seal harem on a beach on the Kerguelen Islands

The largest subpopulation is in the South Atlantic, with more than 400,000 individuals, including about 113,000 breeding females on South Georgia;[16] the other breeding colonies of the Atlantic subpopulation are located on the Falkland Islands and Valdes Peninsula in Argentina (the only continental breeding population).

The second subpopulation, in the south Indian Ocean, consist of up to 200,000 individuals, three-quarters of which breed in the Kerguelen Islands and the rest in the Crozet Islands, Marion and Prince Edward Islands, and Heard Island. Some individuals also breed on Amsterdam Island.

King penguins and southern elephant seal at South Georgia Island

The third subpopulation of about 75,000 seals is found in the subantarctic islands of the Pacific Ocean south of Tasmania and New Zealand, mainly Macquarie Island.

Colonies once existed in Tasmania, Saint Helena, and the Juan Fernández Islands off the coast of Chile. Some individuals at the time of moulting have been found in South Africa or Australia. Lost animals have also been reported from time to time on the shores of Mauritius, with two reports from the Río Guayas estuary area in Ecuador.[15]

After the end of large-scale seal hunting in the 19th century, the southern elephant seal recovered to a sizable population in the 1950s; since then, an unexplained decline in the subpopulations of the Indian Ocean and Pacific Ocean has occurred. The population now seems to be stable; the reasons for the fluctuation are unknown. Suggested explanations include a phenomenon of depression following a rapid demographic rebound that depletes vital resources, a change in climate, competition with other species whose numbers also varied, or even an adverse influence of scientific monitoring techniques.[citation needed]

Lifestyle[edit]

Social behavior and reproduction[edit]

Bull elephant seals fighting

Elephant seals are among the seals that can stay on land for the longest periods of time, as they can stay dry for several consecutive weeks each year. Males arrive in the colonies earlier than the females and fight for control of harems when they arrive.[17] Large body size confers advantages in fighting and the agonistic relationships of the bulls gives rise to a dominance hierarchy with access to harems and activity within harems, being determined by rank.[18] The dominant bulls (“harem masters”) establish harems of several dozen females. The least successful males have no harems, but may try to copulate with a harem male's females when the male is not looking. The majority of primiparous females and a significant proportion of multiparous females mate at sea with roaming males away from harems.[19]

Southern elephant seal (females): one is giving birth

An elephant seal must stay in his territory to defend it, which could mean months without eating, having to live on his blubber storage. Two fighting males use their weight and canine teeth against each other. The outcome is rarely fatal, and the defeated bull will flee; however, bulls can suffer severe tears and cuts. Some males can stay ashore for more than three months without food. Males commonly vocalize with a coughing roar that serves in both individual recognition and size assessment.[18] Conflicts between high-ranking males are more often resolved with posturing and vocalizing than with physical contact.[18]

Generally, pups are born rather quickly in the breeding season.[20] After being born, a newborn will bark or yap and its mother will respond with a high-pitched moan.[21] The newborn begins to suckle immediately. Lactation lasts an average of 23 days. Throughout this period, the female fasts. Newborns weigh about 40 kg (88 lb) at birth, and reach 120 to 130 kg (260 to 290 lb) by the time they are weaned. The mother loses significant weight during this time. Young weaned seals gather in nurseries until they lose their birth coats. They enter the water to practice swimming, generally starting their apprenticeship in estuaries or ponds. In summer, the elephant seals come ashore to moult. This sometimes happens directly after reproduction.

Feeding and diving[edit]

Southern elephant seal (just weaned pup): first bath

Satellite tracking revealed the seals spend very little time on the surface, usually a few minutes for breathing. They dive repeatedly, each time for more than 20 minutes, to hunt their prey—squid and fish—at depths of 400 to 1,000 m (1,300 to 3,300 ft). They are the deepest diving air-breathing non-cetaceans and have been recorded at a maximum of 2,133 m (6,998 ft) in depth.[22]

Southern elephant seal (young males): collective mudbath during moulting

As far as duration, depth, and the sequence of dives, the southern elephant seal is the best performing seal. In many regards, they exceed even most cetaceans. These capabilities result from nonstandard physiological adaptations, common to marine mammals, but particularly developed in elephant seals. The coping strategy is based on increased oxygen storage and reduced oxygen consumption.

In the ocean, the seals apparently live alone. Most females dive in pelagic zones for foraging, while males dive in both pelagic and benthic zones.[23] Individuals will return annually to the same hunting areas. Due to the inaccessibility of their deep-water foraging areas, no comprehensive information has been obtained about their dietary preferences, although some observation of hunting behavior and prey selection has occurred.[24]

While hunting in the dark depths, elephant seals seem to locate their prey, at least in part, using vision; the bioluminescence of some prey animals can facilitate their capture. Elephant seals do not have a developed system of echolocation in the manner of cetaceans, but their vibrissae (facial whiskers), which are sensitive to vibrations, are assumed to play a role in search of food. When at the subantarctic or Antarctic coasts, the seals can also consume molluscs, crustaceans, nothothens,[25] lanternfish,[25] krill, cephalopods[26] or even algae.

Predation[edit]

Weaned pups may be prey for killer whales or orcas (Orcinus orca) while juveniles and even adults of up to adult male size may also fall prey to orcas.[27] Cases where weaned pups have been attacked and killed by leopard seals (Hydrurga leptonyx) and New Zealand sea lions (Phocarctos hookeri), exclusively small pups in the latter case, have been recorded. Great white sharks (Carcharodon carcharias) have hunted elephant seals near Campbell Island, while bite marks from a southern sleeper shark (Somniosus antarcticus) have been found on surviving elephant seals in the Macquarie Islands.[28][29]

Conservation[edit]

Play fight

After their near extinction due to hunting in the 19th century, the total population was estimated at between 664,000 and 740,000 animals in 2005,[15] but as of 2002, two of the three major populations were declining.[30] The reasons for this are unclear, but are thought to be related to the distribution and declining levels of the seals' primary food sources.[30] Most of their most important breeding sites are now protected by international treaty, as UNESCO World Heritage Sites, or by national legislation.

Minazo[edit]

One of the most famous southern elephant seals is Minazo, who lived in Japan's Enoshima Aquarium from when he was a half-year old until his death in 2005 at age 11.[31] Minazo became popular for his signature bucket-holding, tongue-lolling pose. In 2006, Minazo was memorialized by the Japanese noise musician Masami Akita, also known as Merzbow, in a two-volume album,[32][33] with artwork by Jenny Akita showing Minazo holding his beloved bucket.

In 2007, Minazo became the subject of an image macro similar to lolcat called "lolrus". In his liner notes, Masami Akita suggested Minazo's frequent and demanding performances left him exhausted, contributing ultimately to his death.[citation needed] Akita's intention in celebrating Minazo was to highlight the plight of captive animals used for performance before public audiences.[31] Minazo has also featured on several T-shirt designs.

References[edit]

  1. ^ a b C. Campagna (IUCN SSC Pinniped Specialist Group) (2008). Mirounga leonina. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 22 March 2009.
  2. ^ Linnæus, Carl (1758). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin) (10 ed.). Holmiæ: Laurentius Salvius. pp. 37–38. Retrieved 23 November 2012. 
  3. ^ Mirounga angustirostris. Northern Elephant Seal. Smithonian National Museum of Natural History
  4. ^ Carling, M. (1999). Odobenus rosmarus walrus. Animal Diversity Web
  5. ^ Walrus. Odobenus rosmarus . National Geographic
  6. ^ Klappenbach, Laura. "The 10 Largest Mammals". About.com. Retrieved 18 October 2013.  N.B. However, see: Wiktionary > carnivore
  7. ^ a b c Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  8. ^ a b Perrin, William F.; Würsig, Bernd; Thewissen, J. G. M., eds. (24 November 2008). "Earless Seals". Encyclopedia of Marine Mammals (2nd ed.). Burlington, Massachusetts: Academic Press. p. 346. ISBN 978-0-12-373553-9. 
  9. ^ Shirihai, H. and Jarrett, B. (2006). Whales, Dolphins, and Other Marine Mammals of the World. Princeton: Princeton Univ. Press. pp. 112–115. ISBN 0-691-12757-3. 
  10. ^ "Southern Elephant Seal". pinnipeds.org. Seal Conservation Society. 
  11. ^ Block, D.; Meyer, Philip; Myers, P. (2004). "Miroun". Animal Diversity Web. The Regents of the University of Michigan. Retrieved 11 September 2010. 
  12. ^ Sarkar, Amita (2003). Social Behaviour In Animals. New Delhi: Discovery Publishing House. ISBN 9788171417476. Retrieved 2013-01-15. 
  13. ^ Burton, Maurice; Burton, Robert, eds. (15 January 2013). "Elephant Seal". International Wildlife Encyclopedia. Tarrytown, NY: Marshall Cavendish Corporation. p. 772. ISBN 978-0-76-1472667. 
  14. ^ Carwardine, Mark (2008). Animal Records. New York: Sterling. p. 61. ISBN 978-1-4027-5623-8. 
  15. ^ a b c Alava, Juan José; Carvajal, Raúl (July–December 2005). "First records of elephant seals on the Guayaquil Gulf, Ecuador: on the occurrence of either a Mirounga leonina or M. angustirostris". Latin American Journal of Aquatic Mammals (PDF) (Rio de Janeiro: Sociedade Latino-Americana de Especialistas em Mamíferos Aquáticos) 4 (2): 195–198. doi:10.5597/lajam00086. ISSN 1676-7497. 
  16. ^ Boyd, I. L.; Walker, T. R.; Poncet, J. (1996). Walton, David W. H.; Vaughan, Alan P. M.; Hulbe, Christina L., eds. "Status of Southern Elephant seals at South Georgia". Antarctic Science 8 (3): 237–244. doi:10.1017/S0954102096000338. ISSN 0954-1020. 
  17. ^ Jones, E. (1981). "Age in relation to breeding status of the male Southern Elephant Seal, Mirounga leonina (L.), at Macquarie Island". Australian Wildlife Research 8 (2): 327–334. doi:10.1071/WR9810327. 
  18. ^ a b c McCann, T. S. (1981). "Aggression and sexual activity of male Southern elephant seals, Mirounga leonina". Journal of Zoology 195 (3): 295–310. doi:10.1111/j.1469-7998.1981.tb03467.x. 
  19. ^ de Bruyn, P.J.N.; Tosh, C.A.; Bester, M.N.; Cameron, E.Z.; McIntyre, T.; Wilkinson, I.S. (2011). "Sex at sea: alternative mating system in an extremely polygynous mammal". Animal Behaviour 82: 445–451. doi:10.1016/j.anbehav.2011.06.006. 
  20. ^ McCann, T. S. (1980). "Population structure and social organization of Southern Elephant Seals, Mirounga leonina (L.)". Biological Journal of the Linnean Society 14 (1): 133–150. doi:10.1111/j.1095-8312.1980.tb00102.x. 
  21. ^ Link, J. K.; Bryden. M. M. (1992). "Mirounga leonina". Mammalian Species 391:1–8.
  22. ^ McIntyre, T., de Bruyn, P.J.N., Ansorge, I.J., Bester, M.N., Bornemann, H., Plötz, J. and Tosh, C.A., 2010a. A lifetime at depth: vertical distribution of southern elephant seals in the water column. Polar Biology 33, 1037-1048
  23. ^ M. A. Hindell, D. J. Slip & H. R. Burton (1991). "The diving behavior of adult male and female Southern Elephant Seals, Mirounga leonina (Pinnipedia, Phocidae)". Australian Journal of Zoology 39 (5): 595–619. doi:10.1071/ZO9910595. 
  24. ^ 2002. Elephant Seal. Columbia Encyclopedia, Vol. 1, sixth Edition. New York: Columbia University Press.
  25. ^ a b G. Daneri & A. Carlini (2002). "Fish prey of southern elephant seals, Mirounga leonina, at King George Island". Polar Biology 25 (10): 739–743. doi:10.1007/s00300-002-0408-5. 
  26. ^ P. G. Rodhouse, T. R. Arnbom, M. A. Fedak, J. Yeatman & A. W. A. Murray (1992). "Cephalopod prey of the southern elephant seal, Mirounga leonina L.". Canadian Journal of Zoology 70 (5): 1007–1015. doi:10.1139/z92-143. 
  27. ^ "Southern Elephant Seal (Mirounga leonina)". Seal Conservation Society. Archived from the original on 26 October 2010. Retrieved 27 November 2011. 
  28. ^ Van Den Hoff, J., & Morrice, M. G. (2008). Sleeper shark (Somniosus antarcticus) and other bite wounds observed on southern elephant seals (Mirounga leonina) at Macquarie Island. Marine mammal science, 24(1), 239-247.
  29. ^ McMahon, C. R., Burton, H. R., & Bester, M. N. (1999). First-year survival of southern elephant seals, Mirounga leonina, at sub-Antarctic Macquarie Island. Polar Biology, 21(5), 279-284.
  30. ^ a b Perrin, Wursig, and Thewissen, p. 371.
  31. ^ a b "Popular Enoshima aquarium seal dies after 1012-year run". The Japan Times. 7 October 2005. 
  32. ^ Minazo Volume 1 at AllMusic
  33. ^ Minzao Volume 2 at AllMusic

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!