You are viewing this Species as classified by:

Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Description

Instantly recognisable by the large, inflatable proboscis, the male southern elephant seal is the biggest seal in its family. Males can weigh eight to ten times as much as females, making them the most sexually dimorphic of all mammals (2). Females do not have a proboscis, but rather a short nose and a muzzle (4). Both sexes have robust bodies, thick necks and broad heads, and each digit of the fore flippers bears a large, black nail (4). The coat is light to dark silvery-grey or brown in adults and juveniles, whilst newborns have black coats, which turns into a short silvery-grey coat at around three weeks of age (5). Males develop a chest shield of thickened, creased and heavily scarred skin as they age, and also become paler across the face, proboscis and head (4). During the breeding season, southern elephant seals become stained rusty orange and brown from lying in their own excrement.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

In August each year, southern elephant seals return from the open ocean to their breeding grounds to give birth and mate. Males arrive before the pregnant females and wait for their arrival. Once on land, the non-receptive females are harassed by aggressive males who want to mate. To avoid these males, the females collect together into groups known as harems, where a dominant alpha male will protect them from other males, gaining exclusive mating access once they have given birth. Competition for this alpha position is intense, and results in much fighting, vocalizing and impressive displays. The females give birth to a single pup, two to five days after arriving on the breeding grounds. The pups are nursed for around 23 days, but several days before weaning their pups, the females are mated by the dominant males. Once the pup is weaned, the females return to the sea leaving the pups to fend for themselves, and they teach themselves to swim and hunt for four to six weeks before leaving the beaches for the ocean (2). Southern elephant seals make fairly deep dives for squid, fish, crustaceans, and ascidians. The main foraging areas are located in Antarctic waters. Males forage in areas over the Antarctic continental shelf while females tend to search for food in deeper, offshore waters. As much as 90 percent of their time at sea is spent submerged (2), and thus have an incredible ability to dive to depths as great as 1,430 meters for as longs as 120 minutes (6). Between January and April, the southern elephant seal will again haul itself out onto beaches to molt (5). Molting, during which these enormous mammals gain new skin and hair, can take three to five weeks, during which time the seal relies in stored blubber to provide energy (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Southern elephant seals have a nearly circumpolar distribution in the southern Hemisphere. Although they reach the Antarctic continent and even very high latitude locations such as Ross Island, they are most common north of the seasonally shifting pack ice, especially in Subantarctic waters where most rookeries and haul-outs are located. Notable exceptions include the northern breeding colonies at Peninsula Valdés, in Argentina and on the Falkland-Malvina Islands.

Some pups are also born on the Antarctic continent. Southern elephant seals prefer sandy and cobble beaches, but will haul-out on sea ice, snow and rocky terraces and regularly rest above the beach in tussock grass, other vegetation, and mud wallows. At sea, females and males tend to disperse to different feeding grounds. Wandering and vagrant southern elephant seals reach southern Africa, southern Australia, New Zealand and Brazil in South America. An Indian Ocean record at Oman on the Arabian Peninsula represents a northernmost record.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Mirounga leonina (southern elephant seals) are found along the coast of Antarctica and on sub-Antarctic islands when breeding or molting. However, before human exploitation they were more common farther north. The largest present population occurs on the island of South Georgia, in the South Atlantic Ocean. Southern elephant seals are also common on Macquarie Island, Heard Island, Kerguelen Island, and the Peninsula Valdez in Argentina. When at sea, M. leonina often journey thousands of miles from their breeding grounds. Despite the occasional sighting, not much is known about their range outside of the breeding season.

Biogeographic Regions: antarctica (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Gaskin, D. 1972. Whales Dolphins and Seals. London: heinemann Educational Books.
  • Nowak, R. 2003. Walker's Marine Mammals of the World. Baltimore and London: Johns Hopkins University Press.
  • Rice, D. 1998. Marine Mammals of the World-Systematics and Distribution. Lawrence, Kansas: Allen Press Inc..
  • Bradshaw, C., M. Hindell, N. Best, K. Phillips, G. Wilson, P. Nichols. 2003. You are what you eat: Describing the foraging ecology of southern elephant seals using blubber fatty acids. Proceedings of the Royal Society of London, 270: 1283-1292.
  • 2002. Elephant Seal. Pp. unknown in P Lagasse, ed. Columbia Encyclopedia, Vol. 1, sixth Edition. New York: Columbia University Press. Accessed February 08, 2004 at http://www.encyclopedia.com/html/e1/elphnt-se.asp.
  • 2002. Elephant Seals. Pp. 370-373 in W Perrin, B Wursig, J Thewissen, eds. Encyclopedia of Marine Mammals, Vol. 1, 1 Edition. San Diego: Academic Press.
  • 1983. Elephant Seals. Pp. 1130-1132 in R Nowak, J Paradiso, eds. Walker's Mammals of the World, Vol. 2, 4 Edition. Baltimore and London: Johns Hopkins University Press.
  • Crown. 1997. "Southern Elephant Seal (Sea Elephant)" (On-line). Department of Conservation (New Zealand). Accessed February 04, 2004 at http://www.doc.govt.nz/Conservation/001~Plants-and-Animals/003~Marine-Mammals/Southern-Elephant-Seal-(Sea-Elephant).asp.
  • Seal Conservation Society. 2001. "Southern Elephant Seal" (On-line). Seal Conservation Society. Accessed February 04, 2004 at http://www.pinnipeds.org/species/selephnt.htm.
  • Anderson, G. 2003. "Elephant Seals" (On-line). Marine Science. Accessed February 08, 2004 at http://www.biosbcc.net/ocean/marinesci/05nekton/esindex.htm.
  • Carroll, P. 2002. "The Kerguelen Island, Southern Indian Ocean" (On-line). Accessed December 04, 2002 at http://www.btinternet.com/~sa_sa/kerguelen/kerguelen_islands.html.
  • Slip, D., M. Clippingdale. 2002. "Elephant Seals" (On-line). Australian Antarctic Division. Accessed February 04, 2004 at http://www.antdiv.gov.au/default.asp?casid=1733.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circumpolar distribution in southern hemisphere
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The southern elephant seal is found throughout the southern oceans during the non-breeding season, but in the breeding season, it splits into three discrete populations on islands north of the Antarctic's pack ice. The main islands to support the breeding seals are South Georgia, near the southern-most tip of South America; Macquarie Island, 1,500 km south-southeast of Tasmania; and Kerguelen Island, midway between Africa, Antarctica and Australia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male southern elephant seals are the largest pinnipeds, larger even than northern elephant seals, Mirounga angustirostris, their closest relatives. Mirounga leonina males have been documented reaching over six meters long and weighing over 4000 kg. This is in sharp contrast to females, which are rarely over 800 kg or four meters long. In fact, both species of the genus Mirounga are more sexually dimorphic than any other mammal. This dimorphism stretches beyond just size. Males also have a large, inflatable proboscis, which enhances vocalizations used to challenge other males for mating rights. The southern elephant seal proboscis is slightly smaller than the proboscis of northern elephant seals, overhanging the mouth by only about 10 centimeters compared to 30 centimeters in their northern relatives.

Breeding populations vary in size. In the South Georgian population, males average 450 cm in length and weigh 4,000 kg. Females average 280 cm and weigh 900 kg. The seals from Macquarie Island population are somewhat smaller, with males averaging 420 cm in length and 3,000 kg and females averaging 260 cm and 400 kg.

Despite the large difference in size, male and female southern elephant seals do share many physical traits. They have a similar body type. This includes short front flippers used primarily for steering in the water, and very strong, fully webbed, rear flippers that can propel them through the water with remarkable speed and agility. They also have a layer of short, stiff hair covering their bodies. At birth this fur is very dark in color, but lightens after the first molt. New fur after a molt is typically a dark gray/brown with lighter underside and lightens over the course of the year. It is also common for the bodies of both sexes to have scars, usually around the neck, from fighting and mating.

Range mass: 300 to 4000 kg.

Average mass: 2000 (male) 500 (female) kg.

Range length: 260 to 600 cm.

Average length: 500 (male) 300 (female) cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The southern elephant seal is the largest pinniped species. Adult males typically reach 4.5 m and a maximum of 5.8 m in length, and weigh 1,500-3,000 kg, with a maximum weight of about 3,700 kg. The literature contains numerous accounts of much larger males, with maximum lengths of 6-7 m, but these dimensions usually include hind flippers, whereas the standard length in use today is from tip of nose to tip of tail. Adult females are similar in size and weight to northern elephant seal females weighing 350-600 kg with exceptionally large females reaching 800 kg. Newborn pups are about 1.3 m and 40-50 kg. Pups are born in a long woolly black lanugo coat that is shed at about 3 weeks of age, to reveal a silver gray counter-shaded coat that is yellowish gray ventrally.

Females reach sexual maturity between 3 and 5 years and males reach sexual maturity at an age of 4 years. However, few males breed until they reach the age of least 10 years (Jones 1981). Ninety percent of males die before the age of 10 years while 90% of females die before the age of 14 years (McCann 1980, Reijnders et al. 1993).

Pregnant females arrive from September to October, and usually give birth within five days of their return. Pups are nursed for an average of 23 days and then are abruptly weaned when the female departs to sea. Females come into estrous about four days before they wean their pup and mate, starting a new reproductive cycle before completing their current effort. Pups remain on the breeding beaches for eight to ten weeks, during which time they complete the moult of their lanugo coat, before departing to sea.

Elephant seals have an annual cycle with two well-defined pelagic phases, with transitions being marked by moult and reproduction. Adult males and females come ashore to reproduce from August to October. This species provide one of the most extreme examples of polygyny among mammals. The social units are harems, each held by a single dominant male that monopolizes access to up to 120-150 sexually receptive females for a period of approximately two months. Early in the breeding season males establish dominance hierarchies on beaches via impressive displays, which include rearing up on the hindquarters and lifting almost two-thirds of the body straight up to fight with a peer or issue vocal challenges to nearby bulls.

Vocalizations include a booming, loud call of the adult male in the breeding season, variously called a bubbling roar, a harsh rattling sound, and a low pitched series of pulses with little variation in frequency. Adult females have a high-pitched yodeling call which they use when distressed, and to call their pups. They will also utter a low pitch, sputtering growl. Pups call to their mothers with a sharp bark or yap, which is also used when interacting with other seals.

Southern elephant seals spend a large percentage of their lives at sea and only return to land to give birth, breed and moult. At sea, they range far from their rookeries and predominantly feed between the Subantarctic convergence and the northern edge of the pack ice, south of the Antarctic convergence. Adult males typically venture further south than females, and are known to forage at the seaward edge of the Antarctic continental shelf.

Foraging elephant seals combine exceptionally deep diving with long-distance traveling, covering millions of square kilometers while traversing a wide range of oceanographic regions during periods of up to seven months at sea. The seals spend most of their at-sea time in particular water masses that include frontal systems, currents and shifting marginal ice-edge zones. Studies of foraging locations suggest that seals are sensitive to fine-scale variation in bathymetry and ocean surface properties (sea-ice concentration, sea surface temperature).

Southern elephant seals are prodigious divers and routinely reach the same depths as their northern counterparts. Dive depth and duration vary during the year and between the sexes, but normally range from 300 to 500 m deep and from 20 to just over 30 minutes in duration. A maximum depth of 1430 m was recorded for a female, following her return to sea after the moult. Another post-moult female dove for an astonishing 120 minutes, which is by far the longest dive ever recorded for a pinniped.

Prey consists of approximately 75% squid and 25% fish. Antarctic Notothenia fishes are thought to be important prey when these seals are near the Antarctic continental shelf. Most feeding by females occurs in deep ocean areas at mid-water depths. Adult males pass through female feeding areas on their way south to Antarctic continental slope and shelf waters, where their diving activity suggests they pursue more benthic prey.

Killer whales, and in lower latitudes, large sharks are predators on this species. Leopard seals are also known to kill southern elephant seals.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

When southern elephant seals are on land, they are typically found along the coast of sub-Antarctic islands on smooth beaches of sand or small rocks. Although they used to breed well into temperate regions, M. leonina are now only found farther south. They are found on land during the breeding season, from August to November, and the molting season, which lasts 3 to 5 weeks in the spring. The rest of the year is spent entirely at sea. During this time they can be found from sub-Antarctic waters to almost as far north as the equator, often venturing thousands of kilometers from their breeding grounds. While males typically forage on the Antarctic continental shelf, females travel farther into open waters. During their time at sea, southern elephant seals can sustain dives for up to two hours, but most dives last only around thirty minutes. Amazingly, they only spend 2 to 3 minutes on the surface between dives. During most trips at sea, they are underwater for 90% of the time, day and night. While most dives are only between 300 and 800 m, dives of over 1500 m have been recorded, nearing depths only surpassed in mammals by sperm whales.

Range depth: 1500+ to surface m.

Average depth: 300-800 m.

Habitat Regions: polar ; terrestrial ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Other Habitat Features: intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 16424 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16344 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.726 - 13.900
  Nitrate (umol/L): 1.714 - 30.651
  Salinity (PPS): 33.556 - 34.912
  Oxygen (ml/l): 5.959 - 8.248
  Phosphate (umol/l): 0.278 - 2.131
  Silicate (umol/l): 1.783 - 78.870

Graphical representation

Temperature range (°C): -1.726 - 13.900

Nitrate (umol/L): 1.714 - 30.651

Salinity (PPS): 33.556 - 34.912

Oxygen (ml/l): 5.959 - 8.248

Phosphate (umol/l): 0.278 - 2.131

Silicate (umol/l): 1.783 - 78.870
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits the open ocean during the non-breeding season, where they can dive to remarkable depths (2). During the breeding season, the southern elephant seal is generally found on beaches and rocky terrain, and sometimes on ice and snow (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Southern elephant seals feed exclusively when they are at sea. For this reason not much is known about what they eat. The main known sources of food are squid, crabs, shrimp, fish, and sharks. This prey is obtained both near the surface and also during very deep dives. They have been known to eat bottom dwelling fish.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

  • Slip, D. 1995. The diet of southern elepahant seals (Mirounga leonina) from Heard Island. Candian Journal of Zoology, 73: 1519-1528.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Not much is known of the roles of southern elephant seals while they are at sea. However, they are known to be important to their ecosystem as predators of fish, sharks, squid, crabs, and shrimp and as prey for large sharks, killer whales, and leopard seals. Another important role they play in the ecosystem is as a host for many kinds of parasites. Some of the known parasites include tapeworms, acanthocephalans, and the louse Lepidophthirus macrorhini.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Knowledge of predation of M. leonina is limited due to their deep ocean habitat. Known predators include large sharks, specifically great white sharks, and killer whales. Leopard seals are also known to prey on pups. In order to avoid predation, southern elephant seals have dark dorsal surfaces with lighter undersides. This allows some camouflage by blending in with the lighter water when viewed from below and the darker water when seen from above.

Known Predators:

  • large sharks, specifically great white shark 
  • killer whale
  • leopard seal

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Mirounga leonina is prey of:
Odontoceti
Homo sapiens

Based on studies in:
Antarctic (Marine)

This list may not be complete but is based on published studies.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Mirounga leonina preys on:
Actinopterygii
Cephalopoda
non-insect arthropods
Mollusca
Crustacea

Based on studies in:
Antarctic (Marine)

This list may not be complete but is based on published studies.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

When at sea, Mirounga leonina rarely encounter each other and thus have no need for communication. The only time communication is used is during breeding. Males use their large proboscis as a sound chamber for amplifying their bellows. These sounds are made to establish territories and challenge males for established harems. Upright posturing often accompanies these vocalizations and males are known to visually assess their competitor before fighting. Lesser males will also exhibit a flattened posture without inflating their proboscis when near another male’s harem to demonstrate that they are not threats.

A threat vocalization is a low-pitched harsh vocalization. While the seal is doing this it will raise its head and forequarters off of the ground, supporting itself without fore flippers. A lunge from an animal is a rapid movement of the head towards an opponent or invader. This is done with an open mouth. A high rear is the raising of the front half of the body then delivering blows to another animal with the neck or chin. A bite may also be used, mainly from a low rear or a high rear position.

Females are known to communicate with newborn pups through vocalizations. Females and pups recognize each other through these vocal cues and through their individual smells.

Communication Channels: visual ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little known about lifespan in southern elephant seals. This is largely due to the lack of substantial information concerning the periods of the year when they are at sea. Average life expectancy in the wild, as seen during the breeding season, is about 23 years. However, about 30% of pups die in their first year. Captive M. leonina have lived to 15 years of age. Not much is known concerning the deaths of these mammals but, in addition to predation, weather and disease may play a large role in limiting their lifespan.

Range lifespan

Status: captivity:
15 (high) years.

Average lifespan

Status: wild:
23 years.

Average lifespan

Sex: male

Status: wild:
20.0 years.

Average lifespan

Sex: female

Status: wild:
18.0 years.

Average lifespan

Status: wild:
23.0 years.

Average lifespan

Status: wild:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The total gestation time, of about 11.5 months, includes a 3 to 4 months period of delayed implantation (Ronald Nowak 2003). Males are typically much bigger than females. In the wild, males have been reported to live more than 23 years (http://www.demogr.mpg.de/longevityrecords), and there are anecdotal reports of animals living over 25 years. Their longevity in captivity has not been studied in detail, but one specimen lived 23.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male southern elephant seals arrive at breeding grounds several weeks before females and, through vocalizations, body positions, and occasional fighting, claim territories on the beach. The best and largest territories go to the largest and strongest males. These “alpha” males become the head of a harem when the females arrive, often mating with up to 60 females in their harem. If harems exceed this size, additional “beta” males may be present, each claiming as many females as they can. Females become a part of a harem simply through their position on the beach and may move from one harem to another incidentally.

In addition to their mating duties, alpha males are responsible for keeping unwanted males away from the harems. This is done through the same vocalizations and aggressive body postures that were used originally to claim their harem. Males must remain on their territory to defend it and, therefore, go for periods of months without eating. This, and the stress of aggressive encounters with other males and the energy expense of mating with multiple females, can take a significant toll on male physical condition. Only males in the best physical condition at the beginning of breeding season will successfully defend their territory and breed with multiple females. Subordinate males attempt to copulate with females on the edges of territories or in the surf as they leave the beach.

Females that were pregnant from the previous year’s mating give birth to one pup shortly after arriving on land. A period of lactation follows the birth. Then, several days before the pups are weaned from their mother’s milk, females enter estrus and mate with the alpha male or a successful beta male. Shortly following mating, males return to sea. Females return to the sea immediately after the pups are weaned.

Mating System: polygynous

Once a year, from August to November, southern elephant seals return to land to breed. Amazingly, most return to the very same breeding grounds on which they were born. Five to seven days after pregnant females arrive on the beaches, they give birth to one pup. Occasionally twin pups are born but one typically dies soon afterwards. The mothers then nurse their young for about 23 days. Females may nurse longer if their energy reserves allow them to do so. During their time on the breeding grounds females eat little or not at all. Towards the end of this time, females enter estrus and mate with a male. Shortly after mating, females wean their young. At this point, they abandon their young and return to the ocean. Pups then forage on their own for several weeks before venturing out to sea in small groups. Female southern elephant seals typically reach sexual maturity by the age of 3 and participate in the annual breeding cycle by age 6. Males reach sexual maturity by age 5 or 6, but rarely are developed enough to compete for mates until they reach 10 to 12 years of age. The gestation period of female M. leonina is about eight months. There is a period of several weeks during late October when all mature females mate. In order to maintain the yearly birthing cycle with an eight-month gestation period, there is delayed implantation of the fertilized egg for about three months. After the three-month delay, the egg implants and begins to develop to become mature enough for birth during the next breeding season.

Breeding interval: Southern elephant seals mate once each year.

Breeding season: Breeding season lasts from August to November.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 9 to 7 months.

Range weaning age: 20 to 35 days.

Average weaning age: 23 days.

Range time to independence: 20 to 25 days.

Average time to independence: 23 days.

Range age at sexual or reproductive maturity (female): 2 to 4 years.

Range age at sexual or reproductive maturity (male): 5 to 6 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 42500 g.

Average number of offspring: 1.

Female southern elephant seals are the sole caregivers for their young from the moment of conception until weaning, a period that lasts around one year. After delayed implantation, which follows mating, the nine-month gestation period of the pregnancy begins. During this time, the pup develops inside the mother as she is diving and feeding in sub-Antarctic waters. Shortly after coming to land, females give birth to their pups, typically weighing between 25 and 50 kg at birth. Following birth, mothers bond vocally and through smell with their pup. For the next 20 to 25 days (sometimes as long as 35 days) mothers are responsible for providing milk and protecting pups. Mothers are typically less than one-meter from their pups during the stage of suckling, regardless of tide, the position in the harem, or the time in the breeding season. A pup might get separated from its mother due to male harassment and herding of females. This can result in an abandoned pup. Once a pup is separated from its mother the results are fatal. Alien suckling (nursing between unrelated cows and pups) isn't tolerated in this species. If an orphan pup attempts to steal milk from a sleeping or resting cow, it usually is bitten and will succumb to starvation or the effects of the bites. The most dire threat to young pups is adult males who crush pups as they travel and fight on beach territories. During lactation, mothers do not return to the water to feed and instead live on fat reserves built up during the previous foraging season. At weaning pups weigh from 120 to 130 kg, a weight gain of as much as 105 kg in a few weeks!

Immediately following weaning, female southern elephant seals return to sea, leaving their pups alone on the beach. Eventually the pups begin to get hungry and find their way to the ocean, learning to feed and swim on their own. After weaning, there is no interaction between parents and pups. Approximately 30% of these pups will not live through their first year.

Parental Investment: no parental involvement; precocial ; female parental care ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Gaskin, D. 1972. Whales Dolphins and Seals. London: heinemann Educational Books.
  • Nowak, R. 2003. Walker's Marine Mammals of the World. Baltimore and London: Johns Hopkins University Press.
  • Galimberti, F., A. Fabiani, L. Boitani. 2003. Socio-spatial levels of linearity analysis of dominance hierarvhies: a case study on elephant seals. Journal of Ethology, 21/2: 131-136.
  • McConell, B., M. Fedak, H. Burton, G. Englehard, P. Reijnders. 2002. Movements and foraging areas of naive, recently weaned southern elephant seal pups. Journal of Animal Ecology, 71/1: 65-78.
  • McCann, T. 1980. Population structure and social organization of southern elephant seals. Journal of the Linnaen Society, 14: 133-150.
  • Englehard, G., A. Baarspul, M. Broekman, J. Creuwels, P. Reijnders. 2002. Human disturbance, nursing behaviour, and lactational pup growth in a declining southern elephant seal population. Canadian Journal of Zoology, 80/11: 1876-1886.
  • Baldi, R., C. Campagna, S. Pedraza, B. Le Boeuf. 1996. Social effects of space on the breeding behavior of elephant seals in Patagonia. Animal Behaviour, 51: 717-724.
  • Hindell, M., B. McConnell, M. Fedak, D. Slip, H. Burton. 1999. Environmental and physiological determinants of successful foraging by native southern elephant seal pups during their first trip to sea. Canadian Journal of Zoology, 77: 1807-1821.
  • Le Boeuf, B., L. Petrinovich. 1974. Elephant seals: Interspecific comparisons of vocal and reproductive behavior. Mammalia, 38: 16-32.
  • 2002. Elephant Seal. Pp. unknown in P Lagasse, ed. Columbia Encyclopedia, Vol. 1, sixth Edition. New York: Columbia University Press. Accessed February 08, 2004 at http://www.encyclopedia.com/html/e1/elphnt-se.asp.
  • 2002. Elephant Seals. Pp. 370-373 in W Perrin, B Wursig, J Thewissen, eds. Encyclopedia of Marine Mammals, Vol. 1, 1 Edition. San Diego: Academic Press.
  • 1983. Elephant Seals. Pp. 1130-1132 in R Nowak, J Paradiso, eds. Walker's Mammals of the World, Vol. 2, 4 Edition. Baltimore and London: Johns Hopkins University Press.
  • Seal Conservation Society. 2001. "Southern Elephant Seal" (On-line). Seal Conservation Society. Accessed February 04, 2004 at http://www.pinnipeds.org/species/selephnt.htm.
  • ESRG - Filippo Galimberti & Simona Sanvito. 2002. "The Elephant Seals page" (On-line). Accessed February 08, 2004 at http://www.eleseal.org/index.html.
  • Anderson, G. 2003. "Elephant Seals" (On-line). Marine Science. Accessed February 08, 2004 at http://www.biosbcc.net/ocean/marinesci/05nekton/esindex.htm.
  • McCann, T. 1982. Aggressive and maternal activites of female southern elephant seals (Mirounga leonina). Animal Behavior, 30: 268-276.
  • Slip, D., M. Clippingdale. 2002. "Elephant Seals" (On-line). Australian Antarctic Division. Accessed February 04, 2004 at http://www.antdiv.gov.au/default.asp?casid=1733.
  • Van Der Toorn, J. 1999. "Elephant Seals" (On-line). Accessed December 02, 2002 at http://ourworld.compuserve.com/homepages/jaap/elepseal.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Bulging proboscis amplifies sound: southern elephant seal
 

The proboscis of the male elephant seal amplifies calls by bulging using a combination of air, blood, and muscle.

     
  "Another species in which the male sports an exaggerated nose is the elephant seal, largest of all seals at 5-6 m long and up to 3500 kg in weight. The huge, bulging nose of the mature male is used during the breeding season, when the seals gather in vast herds on the shores of California or the South Atlantic islands. The proboscis of the mature male bulges with the combined efforts of blood, muscle and air, and amplifies his defiant bellowing at other males." (Foy and Oxford Scientific Films 1982:136)

Watch video
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mirounga leonina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCTACAAATCATAAAGACATCGGCACTCTCTACCTATTATTTGGTGCATGAGCCGGCATAGTAGGCACCGCCCTCAGTCTTTTAATTCGCGCAGAACTAGGGCAGCCTGGCGCTTTACTAGGAGAC---GATCAGATCTATAACGTGATTGTCACCGCTCACGCATTCGTAATAATCTTTTTTATAGTAATACCTATCATGATCGGAGGTTTCGGAAACTGGTTAGTACCTCTAATGATTGGTGCCCCTGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTCTACCACCATCCTTCCTATTACTATTAGCTTCCTCCATAGTAGAAGCAGGTGCAGGAACAGGATGAACCGTCTATCCCCCTCTAGCTGGTAACCTAGCCCATGCAGGAGCATCTGTAGACCTAACAATTTTCTCTCTTCACTTGGCAGGTGTATCATCCATCCTTGGAGCCATCAACTTTATTACCACTATTATTAACATAAAACCCCCTGCAATATCTCAATATCAAATTCCCTTATTCGTATGATCCGTACTAATTACAGCAGTACTTCTGCTATTATCACTACCAGTTCTAGCAGCTGGTATTACTATACTACTTACAGACCGAAATCTAAATACAACATTCTTTGATCCTGCTGGAGGAGGTGACCCTATTCTATATCAACATCTATTCTGATTCTTTGGACACCCCGAAGTATATATTCTAATTCTTCCAGGATTTGGAATAATCTCACACATCGTCACCTACTACTCAGGAAAAAAAGAACCCTTCGGCTATATAGGAATAGTCTGAGCAATAATATCCATTGGTTTCCTAGGCTTCATTGTATGAGCTCATCATATATTTACCGTAGGAATAGATGTTGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mirounga leonina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Campagna, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its widespread occurrence and large population size globally, the Southern Elephant Seal should remain classified as Least Concern. However, recent declines in some areas should be considered at a finer spatial/population scale.

IUCN Evaluation of the Southern Elephant Sea, Mirounga leonina
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Generation time is approximately 9-10 years. Some populations decreased markedly in the last 50 years to levels that meet the CR criterion locally. But, in the last 30 years (assuming a generation time of 10 years), some stopped declining while others are increasing but have not as yet recovered to baseline numbers.

The most recent information available for the largest population (South Georgia) is that it is stable. One of the five most important populations (Península Valdés) has been growing and it is now apparently stable. Based on best available information, the combined size of the declining colonies do not in combination bring the global status into a vulnerable condition according to IUCN criteria.


A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Local population reductions have been observed in the past 30 years for not well-understood reasons.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

Predicted reduction in sea ice habitats due to continued climate warming will impact the distribution of food and breeding habitat for the species. Predictions are not clear yet regarding how these effects will impact the size of the populations.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A global population reduction for the species has not occurred in the past 30 years.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
Elephant Seals reproduce in colonies where harems are dispersed over a few km of coastline. Colonies may be thousands of km away from each other. Distribution at sea is over millions of square km.

B2. Area of occupancy (AOO): CR
See above for B1. The AOO on land is relatively small for each stock but significantly larger than the above numbers during the pelagic phases (when animals are apparently solitary and disperse widely away from breeding sites).

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

Besides a few colonies in the Antarctic and the temperate SW Atlantic, subpopulations are distributed among sub-Antarctic islands around the Antarctic continent, but this is the normal pattern, not the result of induced fragmentation of the population(s).

C. Small population size and decline
Number of mature individuals: CR
The current abundance is > 10,000.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
Not applicable.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction. It is unlikely that the species will meet any of the above criteria, although the effects of global warming are unknown.

Listing recommendationThe Southern Elephant Sea should be classified as Least Concern. No serious threats have been affecting the land breeding colonies of the species in the last 30 years. The foraging areas may be affected by the impact on the distribution of prey by climate change effects, although it is unknown how this may actually influence the species distribution and numbers. Some local declines are a cause for concern and should be assessed at the level of populations by the IUCN SSC Pinniped Specialist Group

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although once hunted by humans, southern elephant seals were never near extinction like northern elephant seals. This is largely because most of the breeding grounds of M. leonina were out of reach of hunting boats. Hunting did have some impact, but numbers have recovered since hunting has ceased. Some populations are are experiencing declines. This may be normal population fluctuations, however.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Least Concern (LR/lc) on the IUCN Red List (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No recent integrated estimate is available throughout the entire distribution. The worldwide population of southern elephant seals was estimated to be 650,000 in the mid 1990s. Colonies in the South Atlantic, which include the largest breeding aggregation located at South Georgia, are stable or growing, while those in the Southern Indian and Pacific Oceans have decreased by up to 50%. There is some evidence that weaning mass is lower at Macquarie, Heard and Marion Islands, and Iles Kerguelen, than in the South Georgia and Peninsula Valdés (Argentina) populations, suggesting that the Indian and Pacific Ocean populations may have a reduced food supply.

Traditionally, three distinct populations have been distinguished: South Georgia, Macquarie and Iles Kerguelen. However, elephant seals breeding at Península Valdes on the mainland of South America and at the Falkland (Malvinas) Islands are thought to be a distinct population from those at South Georgia. Similarly, the elephant seal populations at the Prince Edward Islands and Iles Crozet are also considered to be distinct from those at Iles Kerguelen and Heard Island, and the small populations in the Tristan de Cunha Islands and Gough Island may also be distinct. Additionally, some colonies have unknown affiliations (e.g. Bouvet). Thus, there may be at least five and perhaps more, distinct breeding populations, although their foraging areas overlap quite extensively at sea (SCAR 1991, Reijnders et al. 1993, Bailleaul 2007, Biuw 2007).

The most important southern elephant seal populations in the world have been either stable or decreasing sharply in the last 50 years (Hindell and Burton 1987, Guinet et al. 1992, Pistorius et al. 2004). Today, some of those that were in decline are apparently returning to a positive trend (Boyd et al. 1996, Guinet et al. 1999).The Valdés population has grown and now is stable (Campagna and Lewis 1992, Lewis et al. 1998). The reason for the differences in the trends in various areas is not known with certainty, but different levels of food availability associated with various oceanographic features seems to have played a role.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Southern elephant seals were hunted for thousands of years by aboriginal and native peoples in Australia and South America. More recently, they were subjected to intensive commercial harvests starting in the early 19th century and not ending until 1964 at South Georgia. They were prized for their large quantity of blubber that could be rendered to fine, valuable oil.

There are few threats and conflicts today, as southern elephant seals live far from human population centres and have minimal interactions with commercial fisheries. Intensive fishing could potentially deplete important prey stocks. However, relatively little is known about their feeding habits. There is no evidence that recent declines for animals breeding in the Indian and Pacific Oceans are related to fisheries in the Southern Ocean (SCAR 1991). However, development of new fisheries at high latitudes in the future could have a significant impact on elephant seal populations (SCAR 1991, Reijnders et al. 1993).

In the South Orkney Islands a few young male elephant seals were killed for dog food in the 1950s and early 1960s when they were ashore moulting. Southern elephant seals that haul out at mainland sites could come in contact with feral dogs and other terrestrial carnivores and be exposed to a variety of diseases including morbiliviruses.

The possible effects of global climate change on southern elephant seals are not well known. Learmonth et al. (2006) suggest that while the effects of global climate change are uncertain, that the species is likely to decline as a result of habitat and ecosystem changes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the 18th and 19th centuries southern elephant seals were hunted extensively for their fur for clothing, and oil for mechanical lubrication (2) (6), and a large-scale sealing industry continued in South Georgia until 1964 under a management scheme (4) (6). This exploitation resulted in many populations declining, which recovered after the cessation of such activities (6), however, since the 1950s and 1960s, numbers of the southern elephant seal have again decreased significantly (2). Reasons for this decline are unclear, but it is thought to be due to changes in distribution and abundance of the seal's prey (2). There is some concern that large-scale fisheries may be competing with the elephant seals for their preferred prey (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Any future exploitation within the Antarctic Treaty area (south of 60ºS) would be regulated by the Convention for the Conservation of Antarctic Seals, while north of this area the Convention on Antarctic Marine Living Resources and various national measures for the islands and continental areas on which the species breeds and occurs apply. The Falkland (Malvinas) Islands Dependencies Conservation Ordinance provides protection for southern elephant seals on South Georgia and the South Sandwich Islands (Reijnders et al. 1993). Listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Southern elephant seals are protected by the U.S. Fish and Wildlife Service's Marine Mammal Act 1972, but research into the reasons behind the decline of this species must be conducted before management plans can be drawn up. Priorities for research need to focus on the continuation of census programmes, demographic studies and investigations into several aspects of the biology of first-year seals, particularly diet and foraging ranges (6). Some of the breeding sites of the southern elephant seal are protected, such as the Provincial Wildlife Reserve of North Point, at Peninsula Valdés, Argentina (7), and MacQuarie Island Nature Reserve and World Heritage Site (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Southern elephant seals may occasionally compete with some fisheries, but this is unlikely. Southern elephant seals live in remote regions where they have few interactions with humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past, southern elephant seals were hunted for their blubber that was boiled down into oil. A typical male could produce about 350 liters of oil. Some aboriginal people also hunted them for food and skins. This activity has ceased and killing is now controlled by the Convention for the Conservation of Antarctic Seals. The only use of M. leonina to man today is for purely scientific purposes.

Positive Impacts: body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!