Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

Circumpolar and widespread in the Southern Hemisphere, Weddell seals are the world’s southern-most breeding mammal and occur in large numbers on fast ice, right up to the shoreline of the Antarctic continent. They also occur offshore in the pack ice zone north to the seasonally shifting limits of the Antarctic Convergence. A small population lives all year on South Georgia. Weddell seals are present at many islands along the Antarctic Peninsula that are seasonally ice-free. Vagrants have been recorded in many areas north of the Antarctic in South America, New Zealand and southern Australia (Kooyman 1981, Rice 1998, Bengtson 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Weddell seals are found throughout the Antarctic continent as well as on fifteen small neighboring islands (Stirling 1971).

Biogeographic Regions: antarctica (Native ); oceanic islands (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Weddell seals have a dark gray coat that is marked with black and lighter gray areas. Males are 2.5 to 2.9 meter in length and females reach up to 3.5 meters. They weigh between 400 and 600 kg.

Range mass: 400 to 600 kg.

Range length: 2.5 to 3.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adult males reach 2.9 m in length, while females reach 3.3 m. Adults in their prime weigh 400 to 450 kg, with females being somewhat heavier than males. Adult female weight fluctuates dramatically during the year with significant weight loss occurring after birth during lactation. Newborns are about 1.5 m long and average 29 kg. Females become mature at 3-6 years of age and males at 7-8 years. The annual pregnancy rate of mature females is 70-80%. Gestation lasts 11 months, including a delay of implantation of 2 months. Longevity is approximately 25 years (Reijnders et al. 1993).

Weddell seal pups are born from September through November and nursed for seven to eight weeks. Animals at lower latitudes pup earlier than animals living at higher latitudes. Males set up territories in the water around holes in the ice used by females to enter and leave the water. The only copulation that has been observed occurred underwater. The behavior of animals breeding in the pack ice or in the sub-Antarctic is not well known.

Weddell seals are not very social when out of the water, avoiding physical contact most of the time. However, they are loosely social; when in the shore-fast ice habitat they tend to congregate in groups along recurrent cracks, leads, and near access holes to the water. There is debate over whether or not this species is migratory or if there is just dispersal of weaned pups, juveniles and some older animals. Some individuals remain in residence year round in the fast ice at latitudes as high as 78°S in McMurdo Sound. Others, particularly newly weaned and subadult animals, move north from the continent and spend the winter in the pack ice. Seals living in fast ice areas or facing freezing over of access holes and leads, abrade and grind the ice to maintain access to and from the water. They bite at the ice and then rapidly swing the head from side to side to grind away the ice with their teeth. Seals living in areas where extensive grinding of ice is necessary for much of the year have accelerated wearing down of their teeth and decreased life expectancy. Predators include killer whales and leopard seals.

Weddell seals are prodigious divers, reaching over 600 m depth, and can undertake dives of at least 82 minutes. Deep dives are regularly used for foraging on Antarctic cod, and long dives occur when the animals are searching for new breathing holes, cracks and leads. In addition to Antarctic cod, the diet of Weddell seals primarily consists of Notothenid fishes. Squid and other invertebrates are also taken as small percentages of the diet.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leptonychotes weddellii live in Antarctic regions on fast ice areas and in the sea. They don't migrate and local movements are caused by changes in ice conditions. Underwater swimming occurs under natural ice cracks or under ice areas thin enough so that the seals can chew breathing holes using canine teeth. Ice areas where these seals dwell are usually flat icy plains (Stirling, 1970).

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 27409 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4611 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.719 - -0.674
  Nitrate (umol/L): 22.624 - 30.285
  Salinity (PPS): 33.574 - 33.915
  Oxygen (ml/l): 7.617 - 8.186
  Phosphate (umol/l): 1.246 - 1.865
  Silicate (umol/l): 21.227 - 66.028

Graphical representation

Temperature range (°C): -1.719 - -0.674

Nitrate (umol/L): 22.624 - 30.285

Salinity (PPS): 33.574 - 33.915

Oxygen (ml/l): 7.617 - 8.186

Phosphate (umol/l): 1.246 - 1.865

Silicate (umol/l): 21.227 - 66.028
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of Leptonychotes weddellii consists of notothenid fishes, squids, and crustaceans, although they have been witnessed attacking Dissostichus mawsoni (Antarctic toothfish) as large as 54 kg in weight (Stirling 1971). These seals can dive up to 600 meters in search of food and are stealthy hunters, able to sneak attack fish from close range. They also use a method of disturbing fish from ice cracks by blowing bubbles into them and preying on the fish that emerge.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These seals are heavily infested with worms and often reguritate them as a means of expulsion. The louse, Antarctophthirus ogmorhini, attacks the hind quarters as well as the penile orifice of these seals. Lice also infest subadults.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Weddell's seals can be preyed on by orcas (Orca orcinus) or, occasionally, leopard seals (Hydrurga leptonyx).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Leptonychotes weddellii (Weddell seals) preys on:
Euphausia superba
Euphausia crystallorophias
Trematomus borchgrevinki
Pleurogramma antarctica
Actinopterygii

Based on studies in:
Antarctic (Estuarine)

This list may not be complete but is based on published studies.
  • G. A. Knox, Antarctic marine ecosystems. In: Antarctic Ecology, M. W. Holdgate, Ed. (Academic Press, New York, 1970) 1:69-96, from p. 87.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The eyes of Leptonychotes weddellii are well developed for low light visibility. This is an adaptive feature of this creature which assists it in locating breathing holes in the ice (Stirling 1971). Vocalization occurs underwater for communication. Overlapped calls are longer than solitary calls, which constitute the varied repertoire of vocal communication in the Weddell seal (Terhume 1994).

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Observations: The total gestation time probably includes a period of delayed implantation (Ronald Nowak 2003). In the wild, females have been estimated to live up to 25 years (Bernhard Grzimek 1990). Their longevity in captivity has not been studied in detail.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproductive behavior occurs underwater. The female is mounted by the male from behind while her sides are held by his foreflippers. Quite often she is bitten on her neck while copulation occurs. Male-male fighting occurs, which suggests that mating systems are polygynous.

Mating System: polygynous

From mid-September to late December active spermatogenesis occurs. In late November to mid-December females are impregnated and about mid-January implantation occurs (Stirling 1971). Gestation last 9 to 10 months. Young pups are born with their permanent dentition. Birth occurs onto the sea ice, which often results in a change of external temperature in newborn pups. Pups are usually born singly, and the time of birth usually varies with latitude from early September at latitude 60 degrees south to late October at latitude 78 degrees south (Stirling 1971). Weddell seal pups weigh about 29 kg at birth. They have a gray lanugo, which after 3 to 4 weeks turns to a dark coat. Weaning takes place at 6 weeks of age and maturity at 3 years. First breeding of females may be denied for 1 or 2 years under some population conditions and males usually don't mate until 6 to 8 years of age because of social pressures (Stirling 1971).

Breeding season: In late November to mid-December females are impregnated and about mid-January implantation occurs.

Average number of offspring: 1.

Range gestation period: 9 to 10 months.

Average weaning age: 6 weeks.

Average time to independence: 6 weeks.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 6 to 8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 29000 g.

Average number of offspring: 1.

Parental Investment: precocial ; pre-fertilization (Provisioning); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leptonychotes weddellii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTTTCCACAAACCACAAAGATATTGGTACTCTCTATCTATTATTTGGTGCATGAGCCGGTATAGTAGGTACCGCCCTCAGTCTTTTAATTCGCGCAGAACTAGGACAACCTGGTGCTTTACTAGGAGAT---GATCAGATTTATAACGTGATTGTCACCGCCCACGCATTCGTAATAATCTTTTTCATAGTAATACCTATCATAATCGGAGGCTTCGGAAACTGATTAGTACCCCTAATAATCGGCGCTCCTGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCTTACCGCCATCTTTCCTACTACTACTGGCCTCCTCCATAGTAGAAGCAGGCGCAGGAACAGGATGAACCGTATATCCTCCCTTAGCTGGTAACCTAGCCCACGCAGGAGCATCTGTAGACCTGACGATTTTCTCCCTTCACCTAGCAGGTGTATCATCCATCCTTGGGGCTATTAATTTCATCACTACTATCATCAATATAAAACCTCCTGCAATATCTCAATATCAAATTCCCCTATTCGTGTGATCCGTACTAATCACAGCAGTACTCCTACTACTATCACTACCAGTTCTAGCAGCTGGCATTACTATACTACTTTCAGATCGAAACCTGAATACAACATTCTTTGACCCCGCTGGAGGAGGGGATCCTATTCTATATCAACACCTATTCTGATTCTTTGGACATCCTGAAGTTTACATCCTAATCCTCCCAGGATTCGGAATGATTTCACATATCGTTACCTACTACTCAGGGAAAAAAGAACCCTTTGGTTATATAGGAATAGTATGAGCAATAATATCCATCGGCTTCCTAGGTTTCATCGTATGGGCCCACCATATATTTACCGTAGGAATGGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Leptonychotes weddellii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gelatt, T. & Southwell, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Due to its widespread occurrence, paucity of known threats, and large population size, the Weddell Seal should be classified as Least Concern (LC).

IUCN Evaluation of the Weddell Seal, Leptonychotes weddellii
Prepared by the Pinniped Specialist Group

A. Population reduction
Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Generation time in Weddell Seals based on the average age of reproducing adults is uncertain but has been estimated at approximately 12 yrs in an isolated population within McMurdo Sound. With sexual maturity attained at 3-6 years of age and a maximum longevity in excess of 30 years a generation time of 12-15 years seems reasonable. A population reduction of Weddell Seals has not been observed, estimated, inferred, or suspected in the past 30 years. However, global population abundance is difficult to estimate and has only been based on extrapolations from ship-based surveys. These extrapolations use seal density in a given area, extrapolated to an estimate based on ice available to be used by the seals.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Weddell seals has not been observed, estimated, inferred, or suspected in the past 30 years.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of Weddell Seals is not suspected in the future as there are no compelling threats to Weddell Seals at this time. They are no longer hunted to feed dog teams and there is no other threats beyond potential habitat losses due to climate change via predicted reductions in sea ice habitats due to continued climate warming.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Weddell Seals has not been observed, estimated, inferred, or suspected in the past 30 years.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
The EOO of Weddell Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Weddell Seals is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The current abundance of Weddell Seals is poorly known, but the total number of individuals was last estimated at a minimum of 500,000.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN > 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii)
% individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The current abundance of Weddell Seals is poorly known, but the number of mature individuals is certainly > 1,000. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative Analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction for Weddell Seals.

Listing recommendationPast, extrapolated, estimates of Weddell Seal abundance suggest a total population size of more than 500,000. Current abundance and population trend are unknown but there has been no evidence of significant changes in recent decades. Currently, the greatest threat to Weddell Seals may be the unknown effects of a changing climate. Recent work in McMurdo Sound suggested that sea ice in the area has expanded, but that there has been a local decrease in pup production. However, the overall effects of climate change on the world wide population of Weddell Seals are unknown. Weddell Seals do not appear to have changed in abundance in recent years and there are no known current threats. Thus, Weddell Seals qualify for listing as Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

US Federal List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population of Weddell seals has been variously estimated at 500,000 to one million or more (Erickson and Hanson 1990). This is a widespread species and, as with other Antarctic seals inhabiting the pack ice, population assessments are very difficult and expensive to conduct and therefore infrequently undertaken. Also, most past surveys do not account for seals in the water and unavailable for counting. To date a circumpolar survey has not been completed and reported. Published reports are limited to ship-based surveys of seals that produced a density estimate that is later extrapolated for the amount of land-fast sea ice present at the time (Erickson and Hanson 1990).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Weddell seals served as an important source of food for men and dogs throughout the early periods of Antarctic exploration. They continued to be taken to feed sled dogs at one base in to the 1980s. Local populations of seals no doubt suffered declines from these harvests, but in the case of the population in McMurdo Sound the population has recovered in the 20 years since the harvest ended. At present, there are no immediate or significant threats to the Weddell seal.

The effects of global climate change on Antarctic seals are unknown. However, Learmonth et al., (2006) suggest that Weddell seal numbers may decline with increasing temperatures if Antarctic sea ice is significantly reduced. Loss of sufficient areas of fast ice habitat used for pupping, resting, avoidance of predators (possible), and access to preferred foraging areas because of changes from warming could lead to population declines of Weddell seals. This is in contrast to a paper by Proffit et al. (2007), which reports that the localized cooling and increased sea ice extent in the Ross sea is associated with decreased reproduction and lower weaning mass of Weddell seals in McMurdo Sound. Thus, the overall effects of global climate change on Weddell seals is unknown.

Two of the four species of Antarctic ice seal, the leopard and crabeater tested positive for antibodies to canine distemper virus (CDV). Weddell seals were tested and did not have any antibodies, and Ross seals were not tested. A mass mortality of crabeater seals occurred in 1955, and many animals displayed viral illness symptoms prior to death (Bengtson and Boveng 1991).

Seasonal tourism in the Antarctic and sub-Antarctic has increased steadily in the last 30 plus years, and is currently at all time high levels. The effects of increased vessel noise, disturbance from vessels passage, and close approach by people in small boats and on land or ice on Weddell seal behaviour, distribution, and foraging are unknown. There is also a risk of injury to a small number of animals from collision with boats or crushing from large vessel passage through and disruption of ice fields. There are no reports of significant fisheries interactions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Weddell seal is not listed as endangered or threatened. Weddell seals are protected by the Antarctic Treaty and the Convention for the Conservation of Antarctic Seals, and any future commercial harvest would be regulated by these international agreements (Reijnders et al 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Leptonychotes weddellii are often killed and used as dog food. Their dead bodies are also of benefit to those studying worms and parasite infestation since these occur so often in this species. Study of their vocal abilities has advanced our attempt to communicate with animals, similar to the vocal communication studies performed with dolphins (Terhune 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Weddell seal

Weddell seal, Neko Harbour, Antarctica
Weddell seal puppy with its grey natal coat, Deception Island
Weddell seal

The Weddell seal, Leptonychotes weddellii, is a relatively large and abundant true seal (family: Phocidae) with a circumpolar distribution surrounding Antarctica. Weddell seals have the most southerly distribution of any mammal, with a habitat that extends as far south as McMurdo Sound (at 77° S). It is the only species in the genus Leptonychotes,[1] and the only member of the Antarctic tribe of lobodontine seals to prefer in-shore habitats on shore-fast ice over free-floating pack ice. Because of its abundance, relative accessibility, and ease of approach by humans, it is the best studied of the Antarctic seals. It is estimated that there are approximately 800,000 individuals today. Weddell Seal pups leave their mothers at the age of a few months. In those months they get fed by their mothers fat and warming milk. They soon leave when they are ready to hunt and are fat enough to survive in the harsh weather

The Weddell seal was discovered and named in the 1820s during expeditions led by James Weddell, the British sealing captain, to the parts of the Southern Ocean now known as the Weddell Sea.[3] However, it is found in relatively uniform densities around the entire Antarctic continent.

Contents

Taxonomy and evolution [edit]

The Weddell seal shares a common recent ancestor with the other Antarctic seals, which are together known as the lobodontine seals. These include the crabeater seal (Lobodon carcinophaga), the Ross seal (Ommatophoca rossii), and the leopard seal (Hydrurga leptonyx).[4] These species share teeth adaptations including lobes and cusps useful for straining smaller prey items out of the water column. The ancestral Lobodontini likely diverged from its sister clade, the Mirounga (elephant seals) in the late Miocene to early Pliocene, when they migrated southward and diversified rapidly to form four distinct genera in relative isolation around Antarctica.[4]

Physical appearance [edit]

Weddell seals measure about 2.5-3.5 m (8.2-11.5 ft) long and weigh between 400–600 kg[citation needed] (880-1360 lbs).[5] Male Weddell seals weigh less than female Weddell seals. So males usually weigh about 500 kg (1100 lbs) or less. Male and female Weddell seals are generally about the same size, though females can be slightly larger.[6] However, male seals tend to have a thicker neck and a broader head and muzzle than the females.[7] The Weddell seal face has been compared to that of a cat due to a short mouth line and similarities in the structure of the nose and whiskers.[7] Their upturned mouths give them the appearance of smiling.

The Weddell seal grows a thin fur coat around their whole body except for small areas around the flippers. The colour and pattern of the coat varies, often fading to a duller colour as the seal ages.[6] This coat moults around the beginning of summer.[7] Adults are generally brown, with lighter ventral (belly) pelage. They are mottled with large darker and lighter patches, those on the belly being silvery white. Adult males usually bear scars, most of them around the genital region.

Young Weddell seals have gray pelage for the first 3 to 4 weeks; later they turn a darker color. The pups reach maturity at 3 years of age. The pups are around half the length of their mother at birth, and weigh 25 to 30 kg (55 to 66 lb). They gain around 2 kg (4.4 lb) a day, and by 6–7 weeks old they can weigh around 100 kg (220 lb).[6]

Behavior and breeding [edit]

Weddell seals gather in small groups around cracks and holes in the ice. These animals can also be found in large groups on ice attached to the continent. In the winter months, they stay in the water to avoid blizzards, with only their heads poking through breathing holes in the ice.[6] This seal is often observed lying on its side, when on land.[8] They are very docile and placid animals and can be approached easily.[7]

Depending on the latitude it inhabits, this marine mammal gives birth from early September through November, with those living at lower latitudes giving birth earlier. During the mating season, Weddell seals make noises that are loud enough to be felt through the ice.[3] Copulation has only been observed to occur underwater, where the female is often bitten on the neck by her partner. The seals are normally around six to eight years old when they first breed, but this can be much earlier for some females.[7] The Weddell seal is one of the only breeds of seals that can give birth to twin pups.[3] Birth of the pup only takes around one to four minutes. The pups take their first swim at around one to two weeks old. They can hold their breath for five minutes, enabling them to dive to depths of 100 m (330 ft). After six to seven weeks they are weaned and begin to hunt independently.[6]

Diving [edit]

The Weddell seal is known for its very deep dives, which may reach some 750 m (2,460 ft). After dropping away from a breathing hole in the ice, the seals become negatively buoyant in the first 30 to 50 meters, allowing them to dive with little effort as they make a “meandering descent.[9]

They can also stay underwater for approximately 80 minutes. Such deep dives involve foraging sessions, as well as searching for cracks in the ice sheets that can lead to new breathing holes. The seals can remain submerged for such long periods of time because of high concentrations of myoglobin in their muscles.[10]

Weddell seals' metabolism is relatively constant during deep water dives, meaning there must be another way to account for functioning with a lack of oxygen over an extended period of time. Seals, unlike other mammals (such as humans) can undergo anaerobic metabolism for these extended dives, which causes a build up of lactic acid in the muscles. The lactic acid does not enter the bloodstream, however, until after the animal has surfaced. This is done by constricting the capillaries going from the muscles to the veins. This requires a longer recovery time though, which in the long run, may be less efficient than quicker, aerobic metabolic dives.

These seals also compensate for prolonged lack of available oxygen by increasing their oxygen carrying capacity. This is done by having more red blood cells per unit volume of blood, as well as more having more blood relative to other mammals. Typical oxygen concentration levels in human blood at sea level are about 15cc/kg, where as Weddell Seals can have 60cc/kg. They can also release oxygenated blood from their spleen into the rest of their body acting as an oxygen reserve. Muscle cells also contain more myoglobin, which has a high affinity for oxygen.

Other circulatory adjustments include reducing their heart rate, and blood buffering, which prevents the pH of the blood from decreasing too much. Low pH in the blood sends a signal to the brain that it needs oxygen before it actually needs oxygen. This can be observed after holding ones breath for a long time, and then exhaling, relieving the need to breath for a few more seconds.

The seals do not send blood to where it is not needed while diving. Essential structures like the brain still receive blood, while the gut and lungs may not (oftentimes they will collapse their lungs at great depths due to such high pressure). It is important to understand that diving mammals are not able to dive for long periods of time because of a higher lung capacity, but more importantly, because of increased oxygen carrying capacity in the blood and muscles.

Diet and predation [edit]

Weddell seals eat an array of fish, krill, squid, bottom-feeding prawns, cephalopods, crustaceans and sometimes penguins.[11] A sedentary adult will eat around 10 kg (22 lb) a day, while an active adult will eat over 50 kg (110 lb) a day.[6]

Scientists believe Weddell seals rely mainly on eyesight to hunt for food when light is available. However, during the Antarctic winter darkness, when there is no light under the ice where the seals forage, they rely on other senses, primarily vibrissae or whiskers, which are not just hairs but very complicated sense organs with more than 500 nerve endings that attach to the animal’s snout. The hairs allow the seals to detect the wake of swimming fish and use that to capture prey.[9]

Weddell seals have no natural predators when on fast ice. At sea or on pack ice, they become prey for killer whales and leopard seals, which prey primarily on juveniles and pups.[6] The Weddell seal is protected by the Antarctic Treaty and the Convention for the Conservation of Antarctic Seals.

Habitat [edit]

The Weddell Seal habitat generally extends no further than a concentric ring around the Antarctic shoreline. They spend most of their lives in the water rather than on the ice sheets or dry land.

References [edit]

  1. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Gelatt, T. & Southwell, C. (2008). Leptonychotes weddellii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 January 2009.
  3. ^ a b c Todd, B. (2002). Seals and sea lions. New Zealand: Reed Publishing Ltd.
  4. ^ a b Fyler, C. A.; Reeder, T. W.; Berta, A.; Antonelis, G.; Aguilar, A.; Androukaki (2005), "Historical biogeography and phylogeny of monachine seals (Pinnipedia: Phocidae) based on mitochondrial and nuclear DNA data", Journal of Biogeography 32 (7): 1267–1279, doi:10.1111/j.1365-2699.2005.01281.x 
  5. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 
  6. ^ a b c d e f g Westerskov, K. (1997). Seals of the blizzard: The Weddell Seals of Antarctica. Australia: Omnibus Books.
  7. ^ a b c d e Shirihai, H. & Jarrett, B. (2006). Whales, dolphins and seals: A field to the marine mammals of the world. London: A & C Black Publishers Ltd.
  8. ^ Peter Saundry. 2010. Weddell Seal. eds. C. Michael Hogan and Cutler Cleveland .Encyclopedia of Earth. National Council for Science and the Environment, Washington DC.
  9. ^ a b Peter Rejcek (August 27, 2010). "Scientists track seal predation behavior through the dark of Antarctica". The Antarctic Sun. Retrieved May 30, 2012. 
  10. ^ Zapol, W. M., Hill, R.D., Qvist, J., Falke, K., Schneider, R. C., Liggins, G. C. & Hochachka, P. W. (September 1989). "Arterial gas tensions and hemoglobin concentrations of the freely diving Weddell seal". Undersea Biomedical Research 16 (5): 363–373. PMID 2800051. Retrieved 2008-07-22. 
  11. ^ Riedman, M. (1990). The pinnipeds: Seals, sea lions, walruses. Berkeley: University of California Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!