Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

Circumpolar and widespread in the Southern Ocean, Weddell Seals are the worlds southern-most breeding mammal and occur in large numbers on fast ice, right up to the shoreline of the Antarctic continent. They also occur offshore in the pack ice zone north to the seasonally shifting limits of the Antarctic Convergence. A small population lives all year on South Georgia. Weddell Seals are present at many islands along the Antarctic Peninsula that are seasonally ice-free. Vagrants have been recorded in many areas north of the Antarctic in South America, New Zealand and southern Australia (Kooyman 1981, Rice 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Weddell seals are found throughout the Antarctic continent as well as on fifteen small neighboring islands (Stirling 1971).

Biogeographic Regions: antarctica (Native ); oceanic islands (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adult Weddell seals have a dark gray coat that is marked with black and lighter gray areas. Males are 2.5 to 2.9 meter in length and females reach up to 3.5 meters. They weigh between 400 and 600 kg.

Range mass: 400 to 600 kg.

Range length: 2.5 to 3.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adult male Weddell Seals reach 2.9 m in length, while females reach 3.3 m. Adults in their prime weigh 400-450 kg, with females being somewhat heavier than males, sometimes reaching over 500 kg (Stirling 1971). Adult female weight fluctuates dramatically during the year with significant weight loss occurring after birth and during lactation. Newborns are about 1.5 m long and average 29 kg. Females become mature at three to six years of age and males at seven to eight years. The annual pregnancy rate of mature females is 70-80%. Gestation lasts 11 months, including a delay of implantation of two months. Longevity is approximately 25 years (Stirling 1971, Reijnders et al. 1990).

Weddell Seals breed in areas of predictable stable fast ice or on land, allowing them to form loose aggregations (or breeding colonies) at specific sites (Siniff 1981, Testa et al. 1990). Weddell Seal pups are born from October through November. Adult females nurse their pups for a prolonged period (seven to eight weeks), and although they fast during the first one to two weeks, adult females do forage during lactation (Stirling 1971). Pups are born earlier at lower latitudes than at higher latitudes (Testa et al. 1990). Females enter oestrus approximately one week before weaning their pup, and copulation occurs underwater, where males maintain territories by controlling access to breathing holes and cracks. Adult Weddell Seals display strong site fidelity, with both males and females returning to the same breeding colony. When in the shore-fast ice habitat, Weddell Seals tend to congregate in loose groups along recurrent cracks, leads, and near access holes to the water (Siniff 1981). The behaviour of animals breeding in the pack ice or in the Sub-Antarctic islands is not well known.

Satellite data on movement patterns of Weddell Seals have increased during the last decade, providing a clearer picture of their distribution patterns. Weddell Seals habitat utilization and habitat patterns vary largely at a regional scale, showing large differences in the scale of their movements (tens to hundreds of km) depending on the area they inhabit (K. T. Goetz pers. comm., Heerah et al. 2013). Further, there seems to be large individual variability in their patterns of habitat usage, with some individuals staying in close proximity to their breeding colonies (e.g., McMurdo Sound), whereas others venture into the pack ice, likely exploiting polynyas and areas of thinner sea ice. The data available on newly weaned and subadult animals seem to indicate that younger animals move north from the continent and spend the winter in the pack ice.

The diving behaviour of Weddell Seals has been well studied, particularly at McMurdo Sound. They can reach depths of over 600 m, and can undertake dives of at least 82 minutes, feeding primarily feed at depths of 100350 m, with a diurnal feeding pattern (Testa 1994). Weddell Seals are generalist predators, and their diet likely varies at a regional scale. Their diet primarily consists of notothenoid fish (Icefishes), particularly the Antarctic Silverfish which largely dominates in the diet in certain areas (Burns et al. 1998), but also includes Antarctic Toothfish, Myctophids and Cephalopods. Although Weddell Seals in fast ice areas are relatively protected, animals in the pack ice are vulnerable to predation by Killer Whales and Leopard Seals (Stirling 1969a, Visser et al. 2008).

Weddell Seals that remain in fast ice areas abrade and grind the ice to maintain access to and from the water. They bite at the ice and then rapidly swing the head from side to side to grind away the ice with their teeth (Stirling 1969ab). Such behaviour, though, comes at a cost, as Seals living in areas where extensive grinding of ice is necessary have accelerated wearing down of their teeth and decreased life expectancy (Stirling 1969b).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27409 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4611 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.719 - -0.674
  Nitrate (umol/L): 22.624 - 30.285
  Salinity (PPS): 33.574 - 33.915
  Oxygen (ml/l): 7.617 - 8.186
  Phosphate (umol/l): 1.246 - 1.865
  Silicate (umol/l): 21.227 - 66.028

Graphical representation

Temperature range (°C): -1.719 - -0.674

Nitrate (umol/L): 22.624 - 30.285

Salinity (PPS): 33.574 - 33.915

Oxygen (ml/l): 7.617 - 8.186

Phosphate (umol/l): 1.246 - 1.865

Silicate (umol/l): 21.227 - 66.028
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Leptonychotes weddellii live in Antarctic regions on fast ice areas and in the sea. They don't migrate and local movements are caused by changes in ice conditions. Underwater swimming occurs under natural ice cracks or under ice areas thin enough so that the seals can chew breathing holes using canine teeth. Ice areas where these seals dwell are usually flat icy plains (Stirling, 1970).

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27409 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4611 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.719 - -0.674
  Nitrate (umol/L): 22.624 - 30.285
  Salinity (PPS): 33.574 - 33.915
  Oxygen (ml/l): 7.617 - 8.186
  Phosphate (umol/l): 1.246 - 1.865
  Silicate (umol/l): 21.227 - 66.028

Graphical representation

Temperature range (°C): -1.719 - -0.674

Nitrate (umol/L): 22.624 - 30.285

Salinity (PPS): 33.574 - 33.915

Oxygen (ml/l): 7.617 - 8.186

Phosphate (umol/l): 1.246 - 1.865

Silicate (umol/l): 21.227 - 66.028
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of Leptonychotes weddellii consists of notothenid fishes, squids, and crustaceans, although they have been witnessed attacking Dissostichus mawsoni (Antarctic toothfish) as large as 54 kg in weight (Stirling 1971). These seals can dive up to 600 meters in search of food and are stealthy hunters, able to sneak attack fish from close range. They also use a method of disturbing fish from ice cracks by blowing bubbles into them and preying on the fish that emerge.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

These seals are heavily infested with worms and often reguritate them as a means of expulsion. The louse, Antarctophthirus ogmorhini, attacks the hind quarters as well as the penile orifice of these seals. Lice also infest subadults.

Commensal/Parasitic Species:

  • louse (Antarctophthirus ogmorhini)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Weddell's seals can be preyed on by orcas (Orca orcinus) or, occasionally, leopard seals (Hydrurga leptonyx).

Known Predators:

  • orcas (Orca orcinus)
  • leopard seals (Hydrurga leptonyx)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Leptonychotes weddellii (Weddell seals) preys on:
Euphausia superba
Euphausia crystallorophias
Trematomus borchgrevinki
Pleurogramma antarctica
Actinopterygii

Based on studies in:
Antarctic (Estuarine)

This list may not be complete but is based on published studies.
  • G. A. Knox, Antarctic marine ecosystems. In: Antarctic Ecology, M. W. Holdgate, Ed. (Academic Press, New York, 1970) 1:69-96, from p. 87.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The eyes of Leptonychotes weddellii are well developed for low light visibility. This is an adaptive feature of this creature which assists it in locating breathing holes in the ice (Stirling 1971). Vocalization occurs underwater for communication. Overlapped calls are longer than solitary calls, which constitute the varied repertoire of vocal communication in the Weddell seal (Terhume 1994).

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Observations: The total gestation time probably includes a period of delayed implantation (Ronald Nowak 2003). In the wild, females have been estimated to live up to 25 years (Bernhard Grzimek 1990). Their longevity in captivity has not been studied in detail.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reproductive behavior occurs underwater. The female is mounted by the male from behind while her sides are held by his foreflippers. Quite often she is bitten on her neck while copulation occurs. Male-male fighting occurs, which suggests that mating systems are polygynous.

Mating System: polygynous

From mid-September to late December active spermatogenesis occurs. In late November to mid-December females are impregnated and about mid-January implantation occurs (Stirling 1971). Gestation last 9 to 10 months. Young pups are born with their permanent dentition. Birth occurs onto the sea ice, which often results in a change of external temperature in newborn pups. Pups are usually born singly, and the time of birth usually varies with latitude from early September at latitude 60 degrees south to late October at latitude 78 degrees south (Stirling 1971). Weddell seal pups weigh about 29 kg at birth. They have a gray lanugo, which after 3 to 4 weeks turns to a dark coat. Weaning takes place at 6 weeks of age and maturity at 3 years. First breeding of females may be denied for 1 or 2 years under some population conditions and males usually don't mate until 6 to 8 years of age because of social pressures (Stirling 1971).

Breeding season: In late November to mid-December females are impregnated and about mid-January implantation occurs.

Average number of offspring: 1.

Range gestation period: 9 to 10 months.

Average weaning age: 6 weeks.

Average time to independence: 6 weeks.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 6 to 8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; delayed implantation

Average birth mass: 29000 g.

Average number of offspring: 1.

Parental Investment: precocial ; pre-fertilization (Provisioning); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leptonychotes weddellii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTTTCCACAAACCACAAAGATATTGGTACTCTCTATCTATTATTTGGTGCATGAGCCGGTATAGTAGGTACCGCCCTCAGTCTTTTAATTCGCGCAGAACTAGGACAACCTGGTGCTTTACTAGGAGAT---GATCAGATTTATAACGTGATTGTCACCGCCCACGCATTCGTAATAATCTTTTTCATAGTAATACCTATCATAATCGGAGGCTTCGGAAACTGATTAGTACCCCTAATAATCGGCGCTCCTGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCTTACCGCCATCTTTCCTACTACTACTGGCCTCCTCCATAGTAGAAGCAGGCGCAGGAACAGGATGAACCGTATATCCTCCCTTAGCTGGTAACCTAGCCCACGCAGGAGCATCTGTAGACCTGACGATTTTCTCCCTTCACCTAGCAGGTGTATCATCCATCCTTGGGGCTATTAATTTCATCACTACTATCATCAATATAAAACCTCCTGCAATATCTCAATATCAAATTCCCCTATTCGTGTGATCCGTACTAATCACAGCAGTACTCCTACTACTATCACTACCAGTTCTAGCAGCTGGCATTACTATACTACTTTCAGATCGAAACCTGAATACAACATTCTTTGACCCCGCTGGAGGAGGGGATCCTATTCTATATCAACACCTATTCTGATTCTTTGGACATCCTGAAGTTTACATCCTAATCCTCCCAGGATTCGGAATGATTTCACATATCGTTACCTACTACTCAGGGAAAAAAGAACCCTTTGGTTATATAGGAATAGTATGAGCAATAATATCCATCGGCTTCCTAGGTTTCATCGTATGGGCCCACCATATATTTACCGTAGGAATGGATGTTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leptonychotes weddellii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Hckstdt, L.

Reviewer/s
Boveng, P.

Contributor/s

Justification

Due to its widespread occurrence, large population size and lack of major threats, the Weddell Seal is classified by IUCN as Least Concern.


History
  • Least Concern (LC)
  • 1996
    Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

US Federal List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

The global population of Weddell Seals has been variously estimated at 200,000 to 1,000,000 individuals (Erickson and Hanson 1990, Southwell et al. 2012), although there is large uncertainty in these figures. Weddell Seals are a widespread species and population assessments are very difficult and expensive to conduct, and are therefore infrequently undertaken. Southwell et al. (2012) reported on results from the Antarctic Pack-Ice Seals program which conducted extensive surveys during 1996-2001. They estimated 633,000 Weddell Seals in two of their survey sectors. In the third sector fast ice was not surveyed and Weddell Seal abundance was not estimated.


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
At present, there are no immediate or significant threats to the Weddell Seal.

The potential effects of global climate change on Antarctic seals are largely unknown. Sea ice provides habitat used for pupping, resting, avoidance of predators and access to preferred foraging areas. Learmonth et al. (2006) suggest that Weddell Seal numbers may decline with increasing temperatures if Antarctic sea ice is significantly reduced. In contrast, Proffit et al. (2007), reported that the localized cooling and increased sea ice extent in the Ross Sea was associated with decreased reproduction and lower weaning mass of Weddell Seals in McMurdo Sound. Further, the fact that some populations breed on land (e.g., at South Georgia), could demonstrate an ability in the species to colonize different environments, although the extent of such plasticity is uncertain. Thus, the overall effects of global climate change on Weddell Seals are unknown.

Seasonal tourism in the Antarctic and Sub-Antarctic has increased steadily in the last 30 plus years, and is currently at all-time high levels. The effects of increased vessel noise, disturbance from vessels passage, and close approach by people in small boats and on land or ice, on Weddell Seal behaviour, distribution and foraging are unknown. There is also a risk of injury to a small number of animals from collision with boats or crushing from large vessel passage through ice fields. Currently there are no reports of significant fisheries interactions. However, the development of new fisheries in Antarctic waters, particularly one targeting the Antarctic Toothfish, could have an impact on Weddell Seal nutrition, and potential operational interactions should be considered in the management plans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

The Weddell Seal is not listed as endangered or threatened under any national Red List. They are protected by the Antarctic Treaty and the Convention for the Conservation of Antarctic Seals, and any future commercial harvest would be regulated by those international agreements.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Leptonychotes weddellii are often killed and used as dog food. Their dead bodies are also of benefit to those studying worms and parasite infestation since these occur so often in this species. Study of their vocal abilities has advanced our attempt to communicate with animals, similar to the vocal communication studies performed with dolphins (Terhune 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Weddell seal

Weddell seal, Neko Harbour, Antarctica
Weddell seal puppy with its grey natal coat, Deception Island
Weddell seal

The Weddell seal, Leptonychotes weddellii, is a relatively large and abundant true seal (family: Phocidae) with a circumpolar distribution surrounding Antarctica. Weddell seals have the most southerly distribution of any mammal, with a habitat that extends as far south as McMurdo Sound (at 77°S). It is the only species in the genus Leptonychotes,[1] and the only member of the Antarctic tribe of lobodontine seals to prefer in-shore habitats on shore-fast ice over free-floating pack ice. Because of its abundance, relative accessibility, and ease of approach by humans, it is the best-studied of the Antarctic seals. An estimated 800,000 individuals remain today. Weddell seal pups leave their mothers at a few months of age. In those months, they are fed by their mothers' warming and fat-rich milk. They leave when they are ready to hunt and are fat enough to survive in the harsh weather.

The Weddell seal was discovered and named in the 1820s during expeditions led by James Weddell, the British sealing captain, to the parts of the Southern Ocean now known as the Weddell Sea.[3] However, it is found in relatively uniform densities around the entire Antarctic continent.

Taxonomy and evolution[edit]

The Weddell seal shares a common recent ancestor with the other Antarctic seals, which are together known as the lobodontine seals. These include the crabeater seal (Lobodon carcinophaga), the Ross seal (Ommatophoca rossii), and the leopard seal (Hydrurga leptonyx).[4] These species share teeth adaptations including lobes and cusps useful for straining smaller prey items out of the water. The ancestral Lobodontini likely diverged from its sister clade, the Mirounga (elephant seals) in the late Miocene to early Pliocene, when they migrated southward and diversified rapidly to form four distinct genera in relative isolation around Antarctica.[4]

Physical traits[edit]

Weddell seals measure about 2.5-3.5 m (8.2-11.5 ft) long and weigh 400-600 kg[citation needed] (880-1360 lb).[5] Males weigh less than females, usually about 500 kg (1100 lb) or less. Male and female Weddell seals are generally about the same length, though females can be slightly larger.[6] However, the male seal tends to have a thicker neck and a broader head and muzzle than the female.[7] The Weddell seal face has been compared to that of a cat due to a short mouth line and similarities in the structure of the nose and whiskers.[7] Their upturned mouths give them the appearance of smiling.

The Weddell seal grows a thin fur coat around its whole body except for small areas around the flippers. The colour and pattern of the coat varies, often fading to a duller colour as the seal ages.[6] This coat moults around the beginning of summer.[7] Adults are generally brown, with lighter ventral (belly) pelage. They are mottled with large darker and lighter patches, those on the belly being silvery white. Adult males usually bear scars, most of them around the genital region.

Young Weddell seals have gray pelage for the first 3 to 4 weeks; later, they turn a darker color. The pups reach maturity at 3 years of age. The pups are around half the length of their mother at birth, and weigh 25 to 30 kg (55 to 66 lb). They gain around 2 kg (4.4 lb) a day, and by 6–7 weeks old they can weigh around 100 kg (220 lb).[6]

Behavior and breeding[edit]

Weddell seals gather in small groups around cracks and holes in the ice. These animals can also be found in large groups on ice attached to the continent. In the winter, they stay in the water to avoid blizzards, with only their heads poking through breathing holes in the ice.[6] These seals are often observed lying on their sides, when on land.[8] They are very docile and placid animals and can be approached easily.[7]

Depending on the latitude it inhabits, this marine mammal gives birth from early September through November, with those living at lower latitudes giving birth earlier. During the mating season, Weddell seals make noises loud enough to be felt through the ice.[3] Copulation has only been observed to occur under water, where the female is often bitten on the neck by her partner. The seals are normally around six to eight years old when they first breed, but this can be much earlier for some females.[7] The Weddell seal is one of the only species of seals that can give birth to twin pups.[3] Birth of the pup only takes around one to four minutes. The pups take their first swim around one to two weeks old. They can hold their breath for five minutes, enabling them to dive to depths of 100 m (330 ft). After six to seven weeks, they are weaned and begin to hunt independently.[6] The average lifespan of a Weddell seal is about 30 years.[9]

Diving[edit]

Diving seals

After dropping away from a breathing hole in the ice, the seals become negatively buoyant in the first 30 to 50 m, allowing them to dive with little effort as they make a “meandering descent".[10]

They can also stay under water around 80 minutes. Such deep dives involve foraging sessions, as well as searching for cracks in the ice sheets that can lead to new breathing holes. The seals can remain submerged for such long periods of time because of high concentrations of myoglobin in their muscles.[11]

Weddell seals' metabolism is relatively constant during deep-water dives, so another way to compensate for functioning with a lack of oxygen over an extended period of time must exist. Seals, unlike other mammals (such as humans), can undergo anaerobic metabolism for these extended dives, which causes a build-up of lactic acid in the muscles. The lactic acid does not enter the bloodstream, however, until after the animal has surfaced. This is done by constricting the capillaries from the muscles to the veins, but a longer recovery time is needed, though, which in the long run may be less efficient than quicker, aerobic metabolic dives.

These seals also compensate for prolonged lack of available oxygen by increasing their oxygen-carrying capacity, which done by having more red blood cells per unit volume of blood, as well as having more blood relative to other mammals. Typical oxygen concentration levels in human blood at sea level are about 15 ml/kg, where as Weddell seals can have 60 ml/kg. They can also release oxygenated blood from their spleens into the rest of their bodies, acting as an oxygen reserve. Muscle cells also contain more myoglobin, which has a high affinity for oxygen.

Other circulatory adjustments include reducing their heart rate, and blood buffering, which prevents the pH of the blood from decreasing too much. Low pH in the blood sends a signal to the brain that it needs oxygen before it actually needs oxygen. This can be observed after holding one's breath for a long time, and then exhaling, relieving the need to breathe for a few more seconds.

Diet and predation[edit]

Video of a Weddell seal in Antarctica
Video of a Weddell seal in Antarctica

Weddell seals eat an array of fish, krill, squid, bottom-feeding prawns, cephalopods, crustaceans, and sometimes penguins and other seals.[12] A sedentary adult eats around 10 kg (22 lb) a day, while an active adult eats over 50 kg (110 lb) a day.[6]

Scientists believe Weddell seals rely mainly on eyesight to hunt for food when light is available. However, during the Antarctic winter darkness, when no light is available under the ice where the seals forage, they rely on other senses, primarily the sense of touch from their vibrissae or whiskers, which are not just hairs, but very complicated sense organs with more than 500 nerve endings that attach to the animal’s snout. The hairs allow the seals to detect the wake of swimming fish and use that to capture prey.[10]

Weddell seals have no natural predators when on fast ice. At sea or on pack ice, they become prey for killer whales and leopard seals, which prey primarily on juveniles and pups.[6] The Weddell seal is protected by the Antarctic Treaty and the Convention for the Conservation of Antarctic Seals.

Habitat[edit]

The Weddell seal's natural habitat is ocean and sea ice surrounding Antarctica.

References[edit]

  1. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Gelatt, T. & Southwell, C. (2008). Leptonychotes weddellii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 January 2009.
  3. ^ a b c Todd, B. (2002). Seals and sea lions. New Zealand: Reed Publishing Ltd.
  4. ^ a b Fyler, C. A.; Reeder, T. W.; Berta, A.; Antonelis, G.; Aguilar, A.; Androukaki (2005), "Historical biogeography and phylogeny of monachine seals (Pinnipedia: Phocidae) based on mitochondrial and nuclear DNA data", Journal of Biogeography 32 (7): 1267–1279, doi:10.1111/j.1365-2699.2005.01281.x 
  5. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5.  Check date values in: |date= (help)
  6. ^ a b c d e f g Westerskov, K. (1997). Seals of the blizzard: The Weddell Seals of Antarctica. Australia: Omnibus Books.
  7. ^ a b c d e Shirihai, H. & Jarrett, B. (2006). Whales, dolphins and seals: A field to the marine mammals of the world. London: A & C Black Publishers Ltd.
  8. ^ Peter Saundry. 2010. Weddell Seal. eds. C. Michael Hogan and Cutler Cleveland .Encyclopedia of Earth. National Council for Science and the Environment, Washington DC.
  9. ^ "Weddell Seal Leptonychotes weddelli". National Geographic. Retrieved 2013-09-25. 
  10. ^ a b Peter Rejcek (August 27, 2010). "Scientists track seal predation behavior through the dark of Antarctica". The Antarctic Sun. Retrieved May 30, 2012. 
  11. ^ Zapol, W. M., Hill, R.D., Qvist, J., Falke, K., Schneider, R. C., Liggins, G. C. & Hochachka, P. W. (September 1989). "Arterial gas tensions and hemoglobin concentrations of the freely diving Weddell seal". Undersea Biomedical Research 16 (5): 363–373. PMID 2800051. Retrieved 2008-07-22. 
  12. ^ Riedman, M. (1990). The pinnipeds: Seals, sea lions, walruses. Berkeley: University of California Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!