Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

Leopard seals are widely-distributed in Antarctic and sub-Antarctic waters of the southern Hemisphere, occurring from the coast of the Antarctic Continent north throughout the pack ice and at most sub-Antarctic islands. There is a seasonal presence of juveniles at Kerguelen and Macquarie Islands with the greater numbers being sighted in September and October (Borsa 1990, Rounseveld and Eberhard 1980). Vagrants regularly reach warm temperate latitudes. They haulout on ice and on land, often preferring ice floes near shore when these are available (Kooyman 1981, Rice 1998, Bengtson 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Hydrurga leptonyx is most common in the polar and subpolar waters of the Southern Hemisphere, along the coast of Antarctica and on most sub-Antarctic islands. Some individuals can be found on the coasts of South Africa, southern Australia, Tasmania, New Zealand, Lord Howe Island, the Cook Islands, Tierra del Fuego, and the Atlantic coast of South America.

Biogeographic Regions: ethiopian (Native ); neotropical (Native ); australian (Native ); antarctica (Native ); oceanic islands (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Jefferson, T., S. Leatherwood, M. Webber. 1993. Marine Mammals of the World. Rome: United Nations Environment Programme, Food and Agriculture Organization of the United Nations.
  • Nowak, R. 1999. Walker's Mammals of the World, 6th Edition. Baltimore: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone, Southern Hemisphere
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adults of H. leptonyx reach 241-338 cm in length, with females being on average slightly larger than males. The body is streamlined and massive, with a very large head and long, broad foreflippers. Leopard seals swim with long, powerful, simultaneous strokes of the forelimbs, unlike most other phocids which propel themselves by means of side-to-side strokes of the hindlimbs. Coloration is dark above giving way to silvery pale on the sides and below, with varying degrees of spotting. In addition to having well developed canines, the cheek teeth of the leopard seal consist of three tubercles or lobes, similar to those of the crabeater seal, Lobodon carcinophaga. These complex teeth allow the leopard seal to filter krill from the water.

Range mass: 200 to 591 kg.

Range length: 241 to 338 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adult males are 2.8 to 3.3 m long and weigh up to 300 kg. Adult females are 2.9 to 3.6 m, with very large animals possibly reaching 3.8 m, and weights of 260 to upwards of 500 kg. Pups are 1 to1.6 m in length and weigh 30 to 35 kg at birth. The age at sexual maturity is probably 4 years for females and 4.5 years for males. Longevity is estimated to be over 26 years (Kooyman 1981, Rogers 2002).

Pups are born on the ice from early November to late December and the period may be as long as early October to early January (Southwell et al. 2003). Births at South Georgia occur from late August to the middle of September. Pups are probably weaned at four weeks old, and female estrous occurs at or shortly after weaning. Unlike crabeater seals, male leopard seals do not haulout with female-pup pairs. Mating is believed to occur in the water.

At sea and on the ice, leopard seals tend to be solitary. They are well known for their habits of preying upon penguins. However, their diet is in reality highly varied and changes with seasonal and local abundance of prey. Leopard seals will consume krill, fish, squid, penguins, a variety of other types of seabirds, and juvenile seals including crabeater, southern elephant, and fur seals. They also occasionally scavenge from carcasses of whales. Most prey is caught in the water. Penguins are regularly held in the teeth by one end and slung in an arc with a rapid snap of the head and neck and smashed on the surface of the water and torn open. Smaller pieces are then swallowed. Young, newly fledged naïve penguins are most vulnerable, but adult birds are taken as well. Leopard seals patrol and regularly station themselves just off penguin rookeries and wait to ambush and chase penguins transiting to and from the colonies.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leopard seals are most common in Antarctic and sub-Antarctic waters, along the outer edges of the pack ice, hauling out on ice and land.

Habitat Regions: polar ; terrestrial ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 607 specimens in 1 taxon.
Water temperature and chemistry ranges based on 603 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.670 - 1.883
  Nitrate (umol/L): 22.624 - 30.357
  Salinity (PPS): 33.643 - 33.980
  Oxygen (ml/l): 7.524 - 8.209
  Phosphate (umol/l): 1.246 - 2.058
  Silicate (umol/l): 19.880 - 66.028

Graphical representation

Temperature range (°C): -1.670 - 1.883

Nitrate (umol/L): 22.624 - 30.357

Salinity (PPS): 33.643 - 33.980

Oxygen (ml/l): 7.524 - 8.209

Phosphate (umol/l): 1.246 - 2.058

Silicate (umol/l): 19.880 - 66.028
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of the leopard seal is quite variable, and it is the only pinniped in which warm blooded vertebrates make up a large portion of the diet. Crabeater and fur seals (in the genus Arctocephalus) often bear scars from leopard seal attacks. Prey has been estimated at 45 percent krill, 35 percent seals, 10 percent penguins, and 10 percent fish and cephalopods, but proportions will vary along with age, seasonal abundance of food, and location. Leopard seals have also been known to scavenge the carrion of whales and other seals.

Animal Foods: birds; mammals; fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Eats non-insect arthropods)

  • Boveng, P., L. Hiruki, M. Schwartz, J. Bengtson. 1998. Population growth of Antarctic Fur Seals: Limitation by a top predator, the Leopard seal?. Ecology, 79(8): 2863-2877.
  • Kooyman, G. 1981. Leopard Seal-Hydrurga leptonyx. Pp. 261-274 in S Ridgway, R Harrison, eds. Handbook of Marine Mammals. London: Academic Press Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

There are few natural predators of leopard seals. They are top carnivores in Antarctic ecosystems. However, they may occasionally be taken by orcas (Orca orcinus) or large sharks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Hydrurga leptonyx (leopard seal) is prey of:
Odontoceti

Based on studies in:
Antarctic (Marine)

This list may not be complete but is based on published studies.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Hydrurga leptonyx (leopard seal) preys on:
Euphausia superba
Euphausia crystallorophias
Spheniscidae
Procellariidae
Actinopterygii
Aves
Cephalopoda

Based on studies in:
Antarctic (Estuarine)

This list may not be complete but is based on published studies.
  • G. A. Knox, Antarctic marine ecosystems. In: Antarctic Ecology, M. W. Holdgate, Ed. (Academic Press, New York, 1970) 1:69-96, from p. 87.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Leopard seals are capable of producing a variety of vocalizations, which have been correlated with different body movements and postures. The vocalizations have been associated with intraspecific agression, female receptivity, and males searching for mates.

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
26.0 years.

Average lifespan

Sex: male

Status: wild:
23.0 years.

Average lifespan

Sex: female

Status: wild:
26.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The 2 months delayed implantation increases the pregnancy period to 11 months (Ronald Nowak 2003). In the wild, females have been estimated to live for more than 26 years (Bernhard Grzimek 1990). Little is known about their longevity in captivity. One wild born animal was about 17.3 years when it died in captivity (Richard Weigl 2005). Further studies are needed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males are probably serially polygynous.

Mating System: polygynous

Male leopard seals reach sexual maturity around their fourth year, females in their third. Mating occurs in the water from November to February. Gestation lasts around 11 months, but implantation seems to be delayed for about 2 months. Parturition occurs from September to January, with the concentration of births in October and November.

Breeding season: Mating occurs in the water from November to February.

Average number of offspring: 1.

Average gestation period: 11 months.

Range weaning age: 4 (high) weeks.

Range time to independence: 4 (high) weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 30000 g.

Average gestation period: 274 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1461 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

The female gives birth to a single pup weighing about 30 kg and about 160 cm long. Lactation can persist for up to four weeks. The pup's coat is soft and thick, dark grey above with a dorsal stripe, pale on the sides and with black spots below. Males do not seem to participate in parental care.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Nowak, R. 1999. Walker's Mammals of the World, 6th Edition. Baltimore: The Johns Hopkins University Press.
  • Siniff, D., S. Stone. 1985. The role of the Leopard seal Hydrurga leptonyx in the tropho-dynamics of the Antarctic Marine Ecosystems. Pp. 555-560 in W Seigfried, P Condy, R Laws, eds. Antarctic Nutrient Cycles and Food Webs. Berlin: Springer-Verlag.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydrurga leptonyx

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTTTCCACAAACCATAAAGATATTGGTACCCTCTACTTATTATTTGGTGCATGAGCCGGAATAGTAGGAACTGCCCTCAGCCTTTTAATCCGCGCAGAACTAGGGCAACCTGGCGCTTTACTAGGAGAT---GATCAGATTTATAATGTGATTGTTACTGCCCATGCATTCGTAATAATCTTTTTTATAGTAATGCCCATCATAATCGGAGGCTTCGGAAACTGATTAGTGCCCTTAATAATTGGCGCTCCTGACATAGCATTCCCCCGAATAAATAATATGAGCTTCTGACTTCTACCCCCATCTTTCCTATTACTACTCGCTTCCTCCATAGTAGAAGCAGGTGCAGGAACAGGATGGACCGTATATCCTCCCTTAGCCGGTAATCTAGCCCATGCAGGAGCATCTGTAGACCTAACAATTTTCTCCCTTCACCTAGCAGGTGTATCATCCATTCTTGGGGCTATTAATTTTATCACTACTATTATCAATATAAAACCTCCTGCAATATCTCAATATCAAATTCCCTTATTCGTGTGATCTGTACTAATCACAGCAGTCCTCTTACTATTATCACTACCAGTTCTAGCAGCTGGCATTACTATACTACTTACAGATCGAAACCTGAATACAACATTCTTCGATCCTGCCGGGGGAGGTGATCCCATTCTATACCAACACCTGTTCTGATTCTTTGGACACCCTGAAGTCTACATCCTGATCCTTCCAGGATTCGGAATAATTTCACATATCGTTACCTATTACTCAGGGAAAAAAGAACCTTTCGGTTATATAGGGATAGTCTGAGCAATAATATCCATCGGCTTCCTAGGCTTCATCGTATGGGCCCACCACATATTTACTGTAGGAATGGACGTTGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hydrurga leptonyx

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Southwell, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Due to its widespread occurrence and large population size, the Leopard Seal should remain classified as Least Concern.

IUCN Evaluation of the Leopard Seal, Hydrurga leptonyx
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Age-structure data for leopard seals are limited so the generation time cannot be calculated precisely. Sexual maturity thought to be attained at 4-5 years of age and a maximum longevity possibly up to 25 years, the average age of reproducing individuals should be at least 10 years. A population reduction of Leopard Seals has not been observed, estimated, inferred, or suspected in the past 30 years. However, population abundance is not precisely known and has not been closely monitored.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Leopard Seals has not been observed, estimated, inferred, or suspected in the past 30 years.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of Leopard Seals could occur some time in the future if sea ice habitats decline due to continued climate warming. However, while sea ice extent presently appears to be declining in western Antarctica, it may be increasing in eastern Antarctica, and overall there appears to be no change yet in the extent of Southern Ocean sea ice.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under Al.

A population reduction of leopard seals has not been observed, estimated, inferred, or suspected in the past 30 years.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Leopard Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Leopard Seals is > 2,000 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The current abundance of Leopard Seals is certainly > 10,000.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The current abundance of Leopard Seals is certainly > 1,000. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction for Leopard Seals.

Listing recommendationThe most recent circumpolar estimate of leopard seal abundance indicates a total population size of 300,000. There is no indication of a declining trend in the population, although broad-scale estimates have considerable uncertainty around them, and consequently trend estimates are also uncertain. Leopard Seals depend on sea ice for reproduction and could be adversely affected by a reduction in sea ice due to continued climate warming at some time in the future. However, presently there appears to be no consistent circumpolar trend in Southern Ocean sea ice habitat. Leopard Seals are a widespread and abundant species that does not qualify for any of the threatened categories in the near future; they should be listed as Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leopard seal populations are abundant in preferred habitat and the species is not exploited by man. Leopard seals, especially young, seasonally depend on krill, but are less competitive than other krill-feeding species.Leopard seals could, therefore, be one of the first species adversely affected by commercial krill fisheries. The species is currently rated as Lower Risk/Least Concern by the International Union for the Conservation of Nature.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a widespread species and, similar to the other Antarctic seals that inhabit the pack ice, population assessments are very difficult and expensive to conduct and therefore infrequently undertaken. Published global population estimates range from 100,000-300,000 (Scheffer 1958) up to 220,000-440,000 animals (Laws 1984). However, early estimates were based on very limited sampling and were highly speculative. The most recent global estimate, from analysis of ship and aerial sighting surveys carried out around the continent between 1968 and 1983, provided a point estimate for global leopard seal population size in the pelagic pack ice of the Southern Ocean of 300,000 animals (Erickson and Hanson 1990). This estimate is likely to have considerable uncertainty associated with it, and only very large changes in leopard seal population size could be confidently detected from repeated surveys (Southwell et al. In Press).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are currently no threats from human activity throughout the species’ normal range. Small numbers of leopard seals have been taken for research purposes and some were previously killed for dog food, but otherwise there is no current or past significant catch of leopard seals (Reijnders et al 1993).

The effects of global climate change on Antarctic seals are unknown. Learmonth et al. (2006) list the effects of global climate change as unknown on leopard seal. However, loss of sufficient areas of pack ice habitat used for pupping, resting, avoidance of predators, availability of preferred prey such as penguins, other ice seals, krill, and fish that could all possibly decline, could all effect leopard seals directly or indirectly to an unknown degree. The effects of loss of large amounts of ice on the Antarctic continent, general climate warming, or sea level rises on Antarctic ocean circulation and productivity, and on Antarctic marine resources such as seals are unknown.

Two of the four species of Antarctic ice seal, leopard and crabeater, tested positive for antibodies to canine distemper virus (CDV). Weddell seals were tested and did not have any antibodies, and Ross seals were not tested. The effects of an outbreak of this or other diseases on leopard seals either as a disease within this species or repeatedly transmitted to it from an outbreak in a prey species such as the crabeater seal are unknown. Leopard seals are generally solitary except when with a pup or mating, so transmission of disease within the species would likely be slow or only seasonally significant. CDV is believed to have arrived in the Antarctic with sled dogs before the advent of vaccines. A mass mortality of crabeater seals occurred in 1955, with many animals displaying viral illness symptoms prior to death, however, the exact cause of death is unknown (Bengtson and Boveng 1991).

Seasonal tourism in the Antarctic and sub-Antarctic has increased steadily in the last 30 plus years, and is currently at all-time high levels. The effects of increased vessel noise, disturbance from vessels passage and close approach by people in small boats and on land on leopard seal behaviour, distribution, and foraging are unknown. There is also a risk of injury to a small number of animals from collision with boats or crushing from large vessels passing through ice fields.

There are no reports of significant fisheries interactions. Commercial harvest of krill may pose direct or indirect threats to leopard seals, if conducted on a large scale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The leopard seal is not listed as endangered or threatened. Leopard seals are protected by the Antarctic Treaty and the Convention for the Conservation of Antarctic Seals, and any future commercial harvest would be regulated by these international agreements (Reijnders et al. 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of leopard seals on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Only small numbers of leopard seals are taken for scientific research, and have little commercial value.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Leopard seal

The leopard seal (Hydrurga leptonyx), also referred to as the sea leopard, is the second biggest species of seal in the Antarctic (after the southern elephant seal, but with the adult males). It is most common in the Southern Hemisphere along the coast of Antarctica and on most sub-Antarctic islands, but can also be found on the coasts of southern Australia, Tasmania, South Africa, New Zealand, Lord Howe Island, Tierra del Fuego, the Cook Islands, and the Atlantic coast of South America. It can live 26 years, possibly more.[3] Orcas are the only known, albeit infrequent, natural predators of leopard seals.[4]

Along with all of the other earless seals, it belongs to the family Phocidae, and is the only species in the genus Hydrurga. The name hydrurga means "water worker" and leptonyx is the Greek for "small clawed".

Contents

Description[edit]

The skull of the leopard seal

The leopard seal is large and muscular, with a dark grey back and light grey on its stomach. Its throat is whitish with the black spots that give the seal its common name. Females are slightly larger than the males.[5] The overall length of this seal is 2.4–3.5 m (8.4–11.7 ft) and weight is from 200 to 600 kilograms (440 to 1,300 lb). They are about the same length as the northern walrus, but usually less than half the weight.[6][7]

Its front teeth are sharp like those of other carnivores, but its molars lock together in a way that allows them to sieve krill from the water, in the manner of the crabeater seal.

Behaviour[edit]

A leopard seal growling

The leopard seal lives in the cold waters surrounding Antarctica. During the summer months, it hunts among the pack ice surrounding the continent, spending almost all of its time in the water. In the winter, it ranges north to the sub-Antarctic islands. Occasionally, individuals may be spotted on the southern coasts of Argentina, Chile, Australia, and New Zealand, and as far north as the Cook Islands. Juveniles are more often found in the north.

The leopard seal is a solitary creature and comes together in small groups only when it is time to mate. During the mating season, males and females make acoustic calls to each other over distances, with at least the males having individual variability in their vocalising sequence patterns.[8] After a 9-month gestation, the female digs a hole in the ice, and gives birth to a single pup during the Antarctic summer. She protects the pup until it is able to fend for itself.

Leopard seals are not very vocal, although they occasionally make some grunting and growling noises.

The leopard seal is bold, powerful and curious. In the water, there is a fine line between curiosity and predatory behaviour, and it may 'play' with penguins it does not intend to eat. There are also records of leopard seals attacking divers. Paul Nicklen, a National Geographic magazine photographer, captured pictures of a leopard seal bringing live, injured, and then dead penguins to him, possibly in an attempt to teach the photographer how to hunt.

Diet[edit]

Leopard seal feeding on emperor penguin.

The leopard seal is second only to the killer whale (orca) among Antarctica's top predators. Its canine teeth are 2.5 cm (1 in).[9] It feeds on a wide variety of creatures. Smaller seals probably eat mostly krill, but also squid and fish. Larger leopard seals probably switch from krill to more substantial prey, including king, adelie, rockhopper, gentoo, emperor penguins and chinstraps, and less frequently, other seals, such as crabeater seal.

Around the sub-Antarctic island of South Georgia, the Antarctic fur seal (Arctocephalus gazella) is the main prey. Other prey include penguins and fish. Antarctic krill (Euphausia superba), southern elephant seal (Mirounga leonina) pups and seabirds other than penguins have also been found in leopard seal scats in small quantities.[10]

When hunting penguins, the leopard seal patrols the waters near the edges of the ice, almost completely submerged, waiting for the birds to enter the ocean. It is helped in this endeavour by the penguins themselves, which nearly always push one of their own into the water ahead of themselves. It kills the swimming bird by grabbing the feet, then shaking the penguin vigorously and beating its body against the surface of the water repeatedly until the penguin is dead. Previous reports stating the leopard seal skins its prey before feeding have been found to be incorrect. Lacking the teeth necessary to slice its prey into manageable pieces, it flails its prey from side to side to tear and rip it into smaller pieces.

Phylogeny[edit]

The leopard seal is classified under the family Phocidae. Its closest relatives are the Ross seal, crabeater seal and the Weddell seal, which together are known as the lobodontine seals. All these seals descend from the superfamily Pinnipeda, which evolved from bear-like ancestors. They have diverged from other taxa in the order Carnivora.

The leopard seal has many features analogous to other species. For example the forearm and hand bones are similar in structure to those found in many mammal, reptile, and bird species. However, in the leopard seal, the fingers are covered in a web of skin, which they use to propel themselves through the water.

The leopard seals share homologous features with its close relatives, the lobodontine seals. They all have dark fur on the tops of their bodies and lighter fur on their underbellies. Though the colors vary between these species, the colored fur serves the same function, which is camouflage against predators and as it stalks its prey.

Attacks on humans[edit]

Leopard seals are potentially highly dangerous towards humans, but attacks are rarely reported.[11] Examples of aggressive behaviour, stalking and attacks have been documented.[12] Notable incidents include:

  • A large leopard seal attacked Thomas Orde-Lees (1877–1958), a member of Sir Ernest Shackleton's Imperial Trans-Antarctic Expedition of 1914–1917 when the expedition was camping on the sea ice.[11] A large "sea leopard" of about 12 ft (3.7 m) long and 1,100 lb (500 kg) chased Orde-Lees on the ice. He was saved only when another member of the expedition shot the animal.
  • In 1985, Scottish explorer Gareth Wood was bitten twice on the leg when a leopard seal tried to drag him off the ice and into the sea. His companions managed to save him by repeatedly kicking the animal in the head with the spiked crampons on their boots.[11][12]
  • In 2003, a leopard seal dragged snorkeling biologist Kirsty Brown of the British Antarctic Survey nearly 200 ft (61 m) underwater to her death, in what was identified as the first known human fatality from a leopard seal.[11][12]

Leopard seals have shown a particular predilection for attacking the black, torpedo-shaped pontoons of rigid inflatable boats, necessitating researchers to equip their craft with special protective guards to prevent them from being punctured.[12]

See also[edit]

Notes and references[edit]

  1. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Southwell, C. (2008). Hydrurga leptonyx. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 January 2009.
  3. ^ "Leopard Seal Description & Characteristics". The Antarctic Connection. Retrieved 2007-12-10. 
  4. ^ Hill, Anna. (2013) Hydrurga leptonyx. Animal Diversity Web. Accessed February 24, 2013.
  5. ^ Tunstall, T. "Hydrurga leptonyx". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 2009-04-27. 
  6. ^ Nowak, Ronald M (2003). Walker's Marine Mammals of the World. Johns Hopkins University Press: Baltimore, MD. 
  7. ^ Leopard Seals, Hydrurga leptonyx. marinebio.org
  8. ^ Rogers, Tracey L. and Cato, Douglas H. (2002). "Individual Variation in the Acoustic Behaviour of the Adult Male Leopard Seal, Hydrurga leptonyx". Behaviour 139 (10): 1267–1286. doi:10.1163/156853902321104154. JSTOR 4535987. 
  9. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 
  10. ^ Walker, T.R., Boyd, I.L., Mccafferty, D.J., Huin, N., Taylor, R.I., Reid, K. (1998). "Seasonal occurrence and diet of leopard seals (Hydrurga leptonyx) at Bird Island, South Georgia". Antarctic Science 10 (1): 75–81. doi:10.1017/S0954102098000108. 
  11. ^ a b c d Carrington, Damian (2003-07-24). Inquiry into fatal leopard seal attack begins. NewScientist.com. Retrieved on 2013-02-24.
  12. ^ a b c d Owen, James (August 6, 2003). "Leopard Seal Kills Scientist in Antarctica". National Geographic Society. Retrieved 2007-12-10. 

General references[edit]

  • Rogers, Tracey L. (2002). Leopard Seal. In William F. Perrin, Bernd Würsig & J.G.M. Thewissen eds. Encyclopedia of Marine Mammals San Diego: Academic Press. 692–693.
  • National Geographic Magazine, November 2006 Leopard Seals
  • King, Judith E. (1975). Seals leopard on Lord Howe Island. Journal of Mammalogy, 56(1), pp. 251–252
  • Saundry, Peter. (2010) http://www.eoearth.org/wiki/Leopard_seal Leopard Seal]. Encyclopedia of Earth. Topic ed. C.Michael Hogan, ed. in chief Cutler Cleveland, NCSE, Washington DC
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!