Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

Ross seals have a circumpolar distribution in the Southern Ocean surrounding Antarctic. They are usually sighted in summer in dense consolidated pack ice where they haulout to breed, moult and rest. Recent satellite tracking suggests that some Ross seals may move north to the open ocean in autumn (Nordøy and Blix 2001). Vagrants have been reported from South Sandwich, Falkland, Scott, South Orkney, Kerguelen, and Heard Islands, and South Australia (Rice 1998, Thomas 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Ross Seals are unique in that they are the only Antarctic seal whose range is restricted to the Antarctic seas, and they have never been documented in extra-polar regions (Allen 1942). These seals are circumpolar, with most individuals found on the pack ice off the shores of Antarctica, with their range extending no farther than 60° S latitude (King 1990).

Biogeographic Regions: antarctica (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Allen, G. 1942. Extinct and vanishing mammals of the western hemisphere. American Committee for International Wild Life Protection.
  • King, C. 1990. The Handbook of New Zealand Mammals. Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

circumpolar in the Antarctic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ross seals are the smallest seals of the Antarctic region, with a thick neck and a slender body. Members of this species have short body hairs, with the shortest hair and vibrissae of any phocid. They are dark brown on their dorsal surface and their ventral surface is silvery; spots and streaks frequently mark the head, neck, and flank. During the summer, unmoulted seals are tan to brownish, with moult occurring in January. Males average smaller than females, from 168 to 208 cm long and weighting 129 to 216 kg. Females measure from 190 to 250 cm long and weigh between 159 and 204 kg. Ross seals can easily be distinguished from closely related seals by their disproportionately large eyes (70mm in diameter). The large eye sockets in the skull are a good character by which a Ross seal can be identified (King 1990).

Range mass: 150 to 215 kg.

Range length: 168 to 250 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
At maturity, Ross seals are the smallest of the four Antarctic phocids. Based on a small sample of measured animals, Ross seal males reach 1.68-2.09 m in length and 129-216 kg and females are slightly larger at 1.96-2.5 m in length and 159-204 kg. It is estimated that pups are about 1 m and 16 kg at birth; eight suckling pups examined in November were109-138 cm in length and 40-75 kg. Age at sexual maturity is thought to be 3-4 years for females and 2-7 years for males (Ray 1981). Adults reach physical maturity at approximately 9 years of age and can live to at least 20 years (Skinner and Klages 1994).

Most pups are born in November, with a peak from early to mid-November (Southwell et al. 2003). Weaning takes place at about one month, although little is known of the relationship between mother and pup. Nursing pups have been seen swimming between ice floes. Mating is thought to occur in the water, but has not been observed. Ross seals are usually found singly on the ice. Moulting is believed to occur in January, at which time many Ross seals appear to fast (Skinner and Klages 1994). During summer Ross seals exhibit a diel haulout pattern with most seals hauled out on the ice at midday (Ray 1981, Bengtson and Stewart 1997, Southwell 2003). Satellite tracking suggests that some Ross seals may move north to the open ocean in autumn (Nordøy and Blix 2001).

Little is known about the activities of Ross seals in the water, although recent work with one female has revealed that when in the water, diving was continuous with dives averaging 110 m in depth and 6.4 minutes in duration, and were to a maximum of 212 m and up to 9.8 minutes. The seal’s dives were deepest at twilight and shallowest at night, and it hauled out during the day (Bengtson and Stewart 1997). The diet of Ross seals consists of 64% cephalopods, 22% fish, and 14% other invertebrates including some krill (Ray 1981). Skinner and Klages (1994) identified only Antarctic silverfish (Pleurogramma antarcticum) in 20 animals examined; no other fish were present. Several species of squid were also recorded, but many stomachs were empty when the animals were collected in January, suggesting fasting during the post-breeding moulting period.

Killer whales and leopard seals are presumed to be predators of the Ross seal.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Ross seals are associated with areas of medium to dense pack ice (Spettstoesser et al. 2000). The areas in which they dwell are often remote and hard to navigate. This leads to a lack of information about the specific habitats they are prone to utilize. Observational accounts recorded in Spettstoesser et al. (2000) make an initial attempt to determine specific habitat use, however data remain vague and anecdotal.

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

  • Splettstoesser, J., M. Gavrilo, C. Field, C. Field, P. Harrison. 2000. Notes on Antarctic wildlife: Ross Seals, *Ommatophoca rossii*, and emperor penguins, *Aptenodytes forsteri*. New Zealand Journal of Zoology, 27: 137-142.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

in pack ice areas
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1066 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1020 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.726 - -0.291
  Nitrate (umol/L): 22.624 - 30.321
  Salinity (PPS): 33.644 - 33.983
  Oxygen (ml/l): 7.345 - 8.236
  Phosphate (umol/l): 1.416 - 2.135
  Silicate (umol/l): 27.529 - 70.044

Graphical representation

Temperature range (°C): -1.726 - -0.291

Nitrate (umol/L): 22.624 - 30.321

Salinity (PPS): 33.644 - 33.983

Oxygen (ml/l): 7.345 - 8.236

Phosphate (umol/l): 1.416 - 2.135

Silicate (umol/l): 27.529 - 70.044
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Squid beaks and fish remains have been found in the guts of Ross seals (Skinner 1984). Studies have shown the diet to consist of approximately 64% cephalopods, 22% fish, and 14% other invertebrates (Oritsland 1977).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Molluscivore )

  • Oritsland, T. 1977. Food Consumption of Seals in the Antarctic Pack Ice. Pp. 749-768 in G Llano, ed. Adaptation within Antarctic Ecosystems. Washington, D.C.: Smithsonian Institution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The role of Ross seals in the ecosystem has not yet been determined, however, they are important predators on fish and cephalopods.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Ross seals are thought to have no predators since typical seal predators, such as killer whales and leopard seals, are rarely found in habitats utilized by Ross seals (Skinner 1984).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Ommatophoca rossii preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Ross seals use vocalizations to communicate with other seals.

Communication Channels: acoustic

Perception Channels: visual ; acoustic

  • Nowak, R. 1991. Walker's Mammals of the World. Baltimore: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Ross seal males have been known to reach 21 years, while the oldest female known was 19 years old (King 1990).

Range lifespan

Status: wild:
21 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The period of pre-implantation usually takes 3.5 to 4.5 months, increasing the gestation time up to 1 year. In the wild, these animals are believed to live up to 21 years (David Macdonald 1985). Their longevity in captivity has not been studied in detail and hence maximum longevity remains unknown.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Little is known about mating in Ross seals.

Females become sexually mature at 2 to 4 years of age, while males can reproduce for the first time between ages 3 and 4. Ross seals mate in early December, but implantation is delayed until early March. Pupping season occurs in early November, after a 9 month gestation period. A typical male weighs 16.5 kg at birth and nurses for 4 to 6 weeks. Weaning is complete around mid-December, approximately 6 weeks after birth (Skinner 1984). After 15 days of nursing pups reach a weight of about 75 kg.

Breeding season: Breeding occurs in December, pups are born in early November.

Average number of offspring: 1.

Average gestation period: 9 months.

Range weaning age: 4 to 6 weeks.

Range age at sexual or reproductive maturity (female): 2 to 4 years.

Range age at sexual or reproductive maturity (male): 2 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous ; delayed implantation

Average birth mass: 20000 g.

Average gestation period: 228 days.

Average number of offspring: 1.

Young Ross seals develop quickly once born, gaining weight rapidly from their mother's rich milk. Once they are weaned they become independent from their mother.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ommatophoca rossii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0234-06|AY377133|Ommatophoca rossii| AACCGATGACTATTTTCCACAAACCATAAAGATATTGGTACCCTCTACTTATTATTTGGTGCATGAGCCGGAATAGTAGGAACTGCCCTC---AGCCTTTTAATCCGCGCAGAACTAGGGCAACCTGGCGCTTTACTAGGAGAT---GATCAGATTTATAATGTGATTGTTACTGCCCATGCATTCGTAATAATCTTTTTTATAGTAATGCCCATCATAATCGGAGGCTTCGGAAACTGATTAGTGCCCTTAATA---ATTGGCGCTCCTGACATAGCATTCCCCCGAATAAATAATATGAGCTTCTGACTTCTACCCCCATCTTTCCTATTACTACTCGCTTCCTCCATAGTAGAAGCAGGTGCAGGAACAGGATGGACCGTATATCCTCCCTTAGCCGGTAATCTAGCCCATGCAGGAGCATCTGTAGACCTA---ACAATTTTCTCCCTTCACCTAGCAGGTGTATCATCCATTCTTGGGGCTATTAATTTTATCACTACTATTATCAATATAAAACCTCCTGCAATATCTCAATATCAAATTCCCTTATTCGTGTGATCTGTACTAATCACAGCAGTCCTCTTACTATTATCACTACCAGTTCTAGCAGCT---GGCATTACTATACTACTTACAGATCGAAACCTGAATACAACATTCTTCGATCCTGCCGGGGGAGGTGATCCCATTCTATACCAACACCTGTTCTGATTCTTTGGACACCCTGAAGTCTACATCCTGATCCTTCCAGGATTCGGAATAATTTCACATATCGTTACCTATTACTCAGGGAAAAAA---GAACCTTTCGGTTATATAGGGATAGTCTGAGCAATAATATCCATCGGCTTCCTAGGCTTCATCGTATGGGCCCACCACATATTTACTGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ommatophoca rossii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Southwell, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Due to its widespread occurrence and large population size, the Ross Seal should remain classified as Least Concern (LC).

IUCN Evaluation of the Ross Seal, Ommatophoca rossii
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Age-structure data for Ross Seals are limited so the generation time cannot be calculated precisely. With sexual maturity thought to be attained at 2-4 years of age and a maximum longevity at least 20 years, the average age of reproducing individuals should be at least 10 years old. A population reduction of Ross Seals has not been observed, estimated, inferred, or suspected in the past 30 years. However, population abundance is not precisely known and has not been closely monitored.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Ross seals has not been observed, estimated, inferred, or suspected in the past 30 years.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of Ross Seals could occur some time in the future if sea ice habitats decline due to continued climate warming. However, while sea ice extent presently appears to be declining in western Antarctica, it may be increasing in eastern Antarctica, and overall there appears to be no change yet in the extent of Southern Ocean sea ice.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Ross seals has not been observed, estimated, inferred, or suspected in the past 30 years.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
The EOO of Ross Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Ross Seals is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The current abundance of Ross Seals is certainly > 10,000.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The current abundance of Ross Seals is certainly > 1,000. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction for Ross Seals.

Listing recommendationThe most recent circumpolar estimate of Ross Seal abundance indicates a total population size of 130,000. There is no indication of a declining trend in the population, although broad-scale estimates have considerable uncertainty around them, and consequently trend estimates are also uncertain. Ross Seals depend on sea ice for reproduction and could be adversely affected by a reduction in sea ice due to continued climate warming at some time in the future. However, presently there appears to be no consistent circumpolar trend in the extent of Southern Ocean sea ice habitat. The Ross Seal is a widespread and abundant species that does not qualify for any of the threatened categories in the near future, thus, Ross Seals qualify for listing as Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Ross seals are thought to be the least abundant seal in Antarctica and recent estimates suggest that the population may be approximately 220,000. However, these estimates are little more than guesses since so much is still unknown about Ross seal distribution and behavioral patterns. Exploitation of this rare seal species is not likely due to the remoteness of its preferred habitat, yet Ross seals are protected under the Convention for the Conservation of Antarctic Seals (King 1990).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Ross seals typically haulout in dense consolidated pack ice over large geographic areas. Because these areas can usually only be reached by ice-breaking ships or long-range aircraft, it is difficult to estimate population size and trends with high certainty. Published global population estimates range from 20,000-50,000 (Scheffer 1958) up to 220,000 animals (Gilbert and Erickson 1977). However, early estimates were based on very limited sampling and were highly speculative. The most recent global estimate, from analysis of ship and aerial sighting surveys carried out around the Antarctic Continent between 1968 and 1983, provided a point estimate for global Ross seal population size in the pelagic pack ice of the Southern Ocean in the order of 130,000 animals (Erickson and Hanson 1990, Reijnders et al. 1993). No indication of the uncertainty around this estimate was given. A more recent regional survey in the pack-ice off east Antarctica between 64-150ºE indicates that broad-scale estimates are likely to have considerable uncertainty around them. The best estimates for this regional survey were in the order of 50,000, 95% confidence limits ranged from 20 000 to 227 000 (Southwell et al. 2008). Given this uncertainty, only gross changes in Ross seal population size could be confidently detected from repeated surveys.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Ross seals are typically found hauled out singly in dense consolidated pack ice in very low concentrations and can usually only be reached by ice breakers. It has been estimated that as few as 200 sightings of the species were all that were known prior to 1972 (Ray 1981). Small numbers of animals have been collected for commercial purposes, scientific studies and museums, but otherwise interactions with humans have been few. When wandering outside the pack ice zone, Ross seals could come in contact with commercial fishing operations, but there are no reports of interactions to date.

Two of the four species of Antarctic ice seals, Leopard seals and crabeater seals, tested positive for antibodies to canine distemper virus (CDV). Weddell seals were tested and did not have any antibodies and Ross seals were not tested. The susceptibility of Ross seals to CDV is unknown, but it is present in the Antarctic, probably having arrived with sled dogs before the advent of vaccines. A mass mortality of crabeater seals occurred in 1955, and many animals displayed viral illness symptoms prior to death (Bengtson and Boveng 1991).

The effects of global climate change on Antarctic seals are unknown. However, Learmonth et al. (2006) suggest that Ross seal numbers may decline with increasing temperatures if Antarctic sea ice is significantly reduced. Loss of sufficient areas of consolidated ice habitat used for pupping, resting, avoidance of predators and access to preferred foraging areas because of changes from warming could lead to population declines of Ross seals. The effects of loss of large amounts of ice on the Antarctic continent, general climate warming or sea level rises on Antarctic Ocean circulation and productivity and on Antarctic marine resources such as seals are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Ross seals are protected by the Antarctic Treaty and the Convention for the Conservation of Antarctic Seals, and are not listed as threatened or endangered.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Habitat occupied by Ross seals is accessible only by ice breaker or aircraft, therefore they have little direct economic importance. Also, the remote location of their habitat makes them a poor potential tourist attraction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Aside from their role in healthy Antarctic ecosystems, there is no established positive economic importance for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ross seal

The Ross seal (Ommatophoca rossii) is a true seal (family Phocidae) with a range confined entirely to the pack ice of Antarctica. It is the only species of the genus Ommatophoca. First described during James Clark Ross' British Antarctic Expedition in 1841, it is the smallest, least abundant and least well known of the Antarctic pinnipeds. Its distinctive features include disproportionately large eyes, whence its scientific name (Ommato- meaning "eye", and phoca meaning "seal"), and complex, trilling and siren-like vocalizations.

Contents

Taxonomy and evolution

The Ross seal shares a recent common ancestor with the other Antarctic seals, which are together known as the lobodontine seals. These include the crabeater seal (Lobodon carcinophaga), leopard seal (Hydrurga leptonyx) and Weddell seal (Leptonychotes weddelli).[2] These species, collectively belonging to the Lobodontini tribe of seals, share teeth adaptations, including lobes and cusps useful for straining smaller prey items out of the water column. The ancestral Lobodontini likely diverged from its sister clade, the Mirounga (elephant seals) in the late Miocene to early Pliocene, when they migrated southward and diversified rapidly in relative isolation around Antarctica.[2]

Description

Ross seals reach a length of about 1.68–2.09 m (5.5–6.9 ft) and weight of 129–216 kg (280–480 lb); females are slightly larger at 1.96–2.5 m (6.4–8.2 ft).[1] Pups are about 1 m and 16 kg at birth. The coat is colored dark-brown in the dorsal area and silvery-white beneath. At the onset of the Antarctic winter, the coat fades gradually to become light brown. At close range, the Ross seal can be easily identified by its large eyes, which are up to 7 cm in diameter.

The Ross seal is able to produce a variety of complex twittering and siren-like sounds that are performed on ice and underwater, where they carry for long distances.[3] The underwater siren sound can be composed of two harmonically unrelated superimposed tones that are pulsed with the same rhythm. Uniquely, the vocalizations, whether on ice or in water, are made with a closed mouth - emitting no air. The purpose of these sounds is unknown, though their distinctive nature and long range are likely to facilitate either encounters or avoidance of individuals.[3]

Range and population status

Although Weddell seals, crabeater seals and leopard seals are ubiquitous in Antarctic waters, the Ross seal is an uncommon and relatively unknown animal, considered to be the least common pack ice seal. It almost never leaves the Antarctic Ocean, with the very rare exception of stray animals found around sub-Antarctic islands, and uniquely, off the south coast of Australia. Nonetheless, its distribution is circumpolar, with individuals found in low densities - usually singly - in very thick pack ice in all regions of the continent.

The total Ross seal population is estimated at around 130,000 individuals, but there is great uncertainty in this estimate (reported 95% confidence intervals range from 20,000 to 227,000).[4] Thus, very little is known about trends in the population.

Interactions with humans have been limited. They have been collected historically by Antarctic expeditions and for scientific collections. Their range does not generally overlap with commercial fishing.

Feeding and reproductive behavior

The Ross seal feeds primarily on squid and fish, primarily Antarctic silverfish, in the pelagic zone.[5] Ross seals are presumed to be preyed upon by killer whales (Orcinus orca) and leopard seals, large predators that share their Antarctic habitat, though there are no documented observations of predation.

Females give birth to their young on the ice in November. Pups are nursed for only four weeks before weaning. Mating is thought to occur underwater shortly after the pup is weaned, but has never been observed. Ross seals mature sexually at approximately three years of age, and are though thought to live around 20 years in the wild.[5]

References and external links

References

  1. ^ a b Southwell, C. (2008). Ommatophoca rossii. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 January 2009.
  2. ^ a b Fyler, C.A.; Reeder, T.W.; Berta, A.; Antonelis, G.; Aguilar, A.; Androukaki (2005), "Historical biogeography and phylogeny of monachine seals (Pinnipedia: Phocidae) based on mitochondrial and nuclear DNA data", Journal of Biogeography 32: 1267–1279 
  3. ^ a b Watkins, William A.; Carleton Ray, G. (1985), "In-air and underwater sounds of the Ross seal, Ommatophoca rossi", The Journal of the Acoustical Society of America 77 (4): 1598–1600, doi:10.1121/1.392003, http://link.aip.org/link/?JAS/77/1598/1, retrieved 2010-06-06 
  4. ^ Southwell, C.J.; Paxton, C.G.M.; Borchers, D.L.; Boveng, P.L.; Nordøy, E.S.; Blix, A.S.; De La Mare, W.K. (2008), "Estimating population status under conditions of uncertainty: the Ross seal in East Antarctica", Antarctic Science 20 (2): 123–133 
  5. ^ a b Skinner, J.D.; Klages, NTW (1994), "On some aspects of the biology of the Ross seal Ommatophoca rossii from King Haakon VII Sea, Antarctica", Polar Biology 7 (467): 472 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!