Overview

Brief Summary

Biology

Monk seals are predominately solitary although females with young may be observed near each other due to limited areas offering the preferred habitat type for pupping (8). Females are sexually mature at around five to six years of age and tend to give birth to a single pup; the majority of births occur between March and June (4). Females suckle their young for around six weeks (8). Males become extremely aggressive during the breeding season and groups of males can sometimes kill females or juveniles in what is known as 'mobbing' during this time (2). Hawaiian monk seals have a similar fat content to their relatives that inhabit cooler, polar waters and have developed behavioural adaptations to cope with the warmth of their tropical habitat; they are mainly nocturnal, spending the day hauled out on sandy beaches often wallowing in wet sand by the waters edge (5). Monk seals feed on a variety of marine animals from fish, including eels, to cephalopods such as octopus and squid (4). They forage at depths of up to 100 metres, but are known to dive to 500 metres, and may travel large distances to foraging locations (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Hawaiian monk seals are the only true seals to be found year-round in tropical waters (2). After the annual moult, this monk seal is a silvery grey colour on the back, with cream colouring on the throat, chest and underside (4). Over time the coat looks brown above and yellow below; males, and some females, turn almost black with age (2). Certain individuals may have a red or green tinge or spots due to algal growth (4). Pups measure about one metre at birth and have a silky black coat, which moults after around a month into the silvery adult-like fur (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Hawaiian monk seals are endemic to the Hawaiian Archipelago and are found primarily in the tropical waters of the northwestern Hawaiian island chain. Reproductive sites include Kure atoll, Midway atoll, Pearl and Hermes Reef, Lisianski Island, and French frigate shoals. Small populations also occur on Necker and Nihoa and breeding populations have been found on the main Hawaiian islands, also known as the windward Hawaiian Islands (Baker and Johannos, 2004; Antonelis et al., 2003).

Biogeographic Regions: pacific ocean (Native )

Other Geographic Terms: island endemic

  • Antonelis, G., J. Baker, T. Johanos, R. Braun, A. Harting. 2003. "Hawaiian monk seals (Monachus Schauinslandi): Status and Conservation Issues" (On-line pdf). Accessed August 02, 2010 at http://www.botany.hawaii.edu/faculty/duffy/arb/543/06.pdf.
  • Baker, J. 2004. Abundance of Hawaiian monk seals in the main Hawaiian islands. Biological Conservation, 116/1: 103-110.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: This species occurs in the Hawaiian Islands. The six main reproductive sites in the northwestern Hawaiian Islands are Kure Atoll, Midway Islands, Pearl and Hermes Reef, Lisianski Island, Laysan Island, and French Frigate Shoals (NMFS 2007). Smaller breeding subpopulations occur on Necker Island and Nihoa Island, and monk seals have been observed at Gardner Pinnacles and Maro Reef. (NMFS 2007). Monk seals are now also found throughout the main Hawaiian Islands, where births have been documented on most of the major islands (Baker and Johanos 2004). Additional sightings and at least one birth have occurred at Johnston Atoll (NMFS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (HI)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The main reproductive and foraging sites are on and around the largely uninhabited and remote Northwestern Hawaiian Islands of French Frigate Shoals, Laysan Island, Lisianski Island, Pearl and Hermes Reef, Midway Atoll and Kure Atoll. Monk seals also breed in lower numbers at Necker and Nihoa Islands in the Northwestern Hawaiian Islands and in the main Hawaiian Islands,, and have also been seen at a few sites outside of the Hawaiian Archipelago (6) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Hawaiian monk seals exhibit sexual dimorphism, with females being larger than males. Females have an average length of 2.25 m and an average weight of 203 kg. Males have an average length of 2.1 m and an average weight of 169 kg. After birth, Hawaiian monk seals are covered in black lunago (fetal hair), which they molt upon weaning. As juveniles, they are silvery gray, with darker hair on their dorsal side and white hair on their ventral side (National Marine Fisheries Service, 2007). Adults have brown pelage that is slightly gray on their backs and gradually fades to yellow and then white near the ventral surface of the animal. They have broad, flat, and moderately small heads with large black eyes. Unlike other pinnipeds, their nostrils are located on top of their short snout.

Range mass: 169 to 203 kg.

Range length: 2.1 to 2.25 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • National Marine Fisheries Service, 2007. Recovery Plan for the Hawaiian Monk Seal (Monachus schauinslandi). Second Revision. Silver Springs, MD: National Marine Fisheries Service.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 215 cm

Weight: 170000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No other native pinnipeds occur in the range of this species. Differs from the California sea lion, which could occur as an escape, in much shorter limbs, hind limbs that cannot be turned forward or used effectively for terrestrial locomotion, and absence of external ear pinnae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Hawaiian monk seals utilize terrestrial and marine habitats. Sandy beaches are used for parturition, nursing, molting, and resting. The most common parturition sites are on sandy beaches with exposed protective reefs, which limit shark access and provide shelter from large surf (Atonelis et al., 2003). Hawaiian monk seals use protected waters to teach weaned pups to capture prey. They use vegetation along the beach perimeter to protect themselves from ultraviolet rays, wind, and rain, and may also use terrestrial vegetation as shelter while they sleep (Gilmartin, 1983). Hawaiian monk seals spend the majority of their time in the ocean resting, interacting with each other, and foraging. They spend much of their time at depths of about 100 m and less, although some have been observed foraging at depths of over 300 meters (Parish et al., 2002).

Range depth: 300 (high) m.

Average depth: 100 m.

Habitat Regions: tropical ; terrestrial ; saltwater or marine

Aquatic Biomes: reef

  • Gilmartin, W. 1983. Recovery Plan for the Hawaiian Monk Seal, Monachus schauinslandi. Silver Springs, MD: National Marine Fisheries Service.
  • Parrish, F., K. Abernathy, G. Marshall, B. Buhleier. 2002. Hawaiian monk seals (Monachus Schauinslandi) foraging in deep water coral beds. Mammal Science, 18: 244-258.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: This seal occurs mainly in waters around islands, but it is also known to travel long distances in the open ocean. Often it is found around submerged reefs and atolls, or on sandy beaches; rocky ledges or gravel beaches sometimes are used as haulouts.

Birthing sites usually are on coral sand beaches backed by Scaevola shrubs, into which a female may take her pup for shelter at night. Births also occur on beaches lacking shrub cover and on rocky beaches (Necker Island). Primary features of pupping locations are very shallow water adjacent to the shoreline (may protect against shark attack) (Westlake and Gilmartin 1990) and stable substrate (Reeves et al. 1992). Human activity may cause females to shift to less favorable sites. Mating presumably occurs in the water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found on the coral atolls and rocky islands of the Northwest Hawaiian Islands, in tropical waters (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

One tagged pup traveled from Laysan Island to Johnston Atoll, 1,013 kilometers distant, within a period of less than 5 months (Reeves et al. 1992)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Hawaiian monk seals primarily prey upon teleost fishes, which make up roughly 80% of their diet. They appear to prefer fish belonging to the families Muranidae (marine eels), Labridae (wrasses), Holocentridae (squirrelfishes and soldierfishes), Balistidae (triggerfishes) and Scaridae (parrotfishes). Except for the beardfish family (Polymixiidae), which consists of deep sea benthic fishes, all fishes consumed by Hawaiian monk seals are shallow reef fishes (Goodman-Lowe, 1998). The remainder of the their diet consists of cephalopods and crustaceans, with the majority of consumed cephalopods being octopi. Hawaiian monk seals prey upon diurnal and nocturnal species of teleosts and cephalopods; however, juveniles tend to prey more heavily on nocturnal species (Goodman-Lowe, 1998). They primarily forage in shallow reefs (less than 100 m) near their natal atoll and foraging takes place near or at the sea floor. Individuals foraging in precious coral beds (Corallium rubrum) at depths of over 300 m have been recorded, where prey-capture rates may be higher (Parrish et al., 2002).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Molluscivore )

  • Goodman-Lowe, G. 1998. Diet of the Hawaiian monk seal (Monachus Schauinslandi) from the Northwestern Hawaiian Islands during 1991 to 1994. Marine Biology, 132: 535-546.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: When near breeding and resting beaches, monk seals forage benthically and feed on fishes and invertebrates both within atoll lagoons and in deeper water up to at least 500 meters (see NMFS 2007); diet includes wide variety of fishes, cephalopods, and crustaceans..

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Hawaiian monk seals prey upon 40 species of marine animals that live in the coral reef ecosystem, including many species of teleost fish, cephalopods, and crustaceans.

  • Gilmartin, W., J. Forcada. 2002. Monk Seals. Pp. 756-759 in W Perrin, W Bernd, J Thewissen, eds. Encyclopedia of Marine Mammals, 1st Edition. San Diego, CA: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The main predator of Hawaiian monk seals is the tiger shark (Galeocerdo cuvier), and shark predation is believed to be a significant contributing factor to pup mortality. Although male Hawaiian monk seals are known to commit infanticide, sharks are thought to be the main threat to pup survival. Seals avoid potential predators by nesting on beaches protected by exposed reefs and by feeding and resting in underwater reef caves.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: This species is represented by a single metapopulation (NMFS 2007). The different subpopulations exhibit varying degrees of demographic independence, with some having considerable levels of independence and other areas having higher degrees of subpopulation interaction (NMFS 2007)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

250 - 1000 individuals

Comments: Current (2006) population size is approximately 1,200 (NMFS 2007), but not all of these are mature individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

This species is generally solitary on land and in the sea; groups may gather on favored beaches.

Shark predation is an important mortality factor. See Kenyon (1981) for a review of mortality factors such as sharks, entanglement in fishing gear, disease. Injuries sustained from adult males apparently contribute significantly to mortality in adult females (Hiruki et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Hawaiian monk seals communicate using vocalizations, including those between mothers and nursing pups.

Communication Channels: acoustic

Perception Channels: tactile ; acoustic ; chemical

  • Job, D., D. Boness, J. Francis. 1995. Individual variation in nursing vocalizations of Hawaiian monk seal pups, Monachus schauinslandi (Phocidae, Pinnipedia), and lack of maternal recognition. Canadian Journal of Zoology, 73: 975-983.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Hawaiian monk seals live for 25 to 30 years in the wild. The lifespan of captive individuals is unknown.

Average lifespan

Status: wild:
25 years.

Average lifespan

Status: wild:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, these animals are believed to live up to 30 years (David Macdonald 1985). Little is known about their longevity in captivity, though one wild born specimen was still living in captivity at about 22.8 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Copulation in Hawaiian monk seals is rarely observed but usually takes place about 1 to 5 km off shore. Although little is known about the reproductive success or the mating system used by these animals, sexual dimorphism in conjunction with open water mating suggests polygyny (Weckerly, 1998). As in other pinnipeds, males likely mount females by biting their backs and grasping them with their foreflippers (Antonelis et al., 2003).

Mating System: polygynous

Hawaiian monk seals are monestrous and give birth to a single pup each year during an extended birthing season, which begins in March, peaks in April, and ends in August (Boness et al., 1998). Females leave the ocean to give birth on beaches close to their most recent breeding site. Birthing takes place after an 11-month gestation period, which contains a 3-month period of delayed implantation. Females are solely responsible for rearing offspring, which takes about 40 days. While rearing their pups, females fast and may lose hundreds of pounds. Pups weigh between 14 and 17 kg at birth and between 50 and 100 kg at weaning (National Marine Fisheries Service, 2007). Females wean pups by suddenly abandoning them and returning to the ocean, after which they wait 3 to 4 weeks before mating again (Boness et al., 1998). Hawaiian monk seals are one of three pinniped species that commonly foster pups, the other two being grey seals (Halichoerus grypus) and northern elephant seals (Mirounga angustirostris; Boness et al., 1998). Both genders reach sexual maturity between the ages of 5 and 10 years old. Pups weaned at higher weights generally have a greater chance of survival and become sexually mature at an earlier age.

Breeding interval: Hawaiian monk seals breed once yearly

Breeding season: February to March

Average number of offspring: 1.

Average gestation period: 11 months.

Range weaning age: 5 to 6 weeks.

Range age at sexual or reproductive maturity (female): 5 to 10 years.

Range age at sexual or reproductive maturity (male): 5 (low) years.

Average age at sexual or reproductive maturity (male): 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; delayed implantation

Average birth mass: 17000 g.

Average gestation period: 335 days.

Average number of offspring: 1.

Females are the only sex that invest in pup development. Pup fostering, which only occurs in 2 other pinniped species (gray seals, Halichoerus grypus and northern elephant seals, Mirounga angustirostris), takes place when females rear their young in close proximity to one another and may occur when pups are separated from their mothers. Most females tolerate nursing attempts by orphaned pups. Although pup fostering appears to result in little to no reward for adopting mothers, fostered pups clearly benefit from their foster mother's care (Boness et al., 1998).

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Antonelis, G., J. Baker, T. Johanos, R. Braun, A. Harting. 2003. "Hawaiian monk seals (Monachus Schauinslandi): Status and Conservation Issues" (On-line pdf). Accessed August 02, 2010 at http://www.botany.hawaii.edu/faculty/duffy/arb/543/06.pdf.
  • Boness, D., C. Mitchell, L. Honigman, S. Austin. 1998. Fostering Behavior and the Effect on Female Density in Hawaiian Monk Seals, Monachus Schauinslandi. Journal of Mammalogy, 79/3: 1060-1069.
  • National Marine Fisheries Service, 2007. Recovery Plan for the Hawaiian Monk Seal (Monachus schauinslandi). Second Revision. Silver Springs, MD: National Marine Fisheries Service.
  • Weckerly, F. 1998. Sexual-Size Dimorphism: Influence of Mass and Mating Systems in the Most Dimorphic Mammals. Journal of Mammalogy, 79:1: 52. Accessed September 08, 2010 at http://www.jstor.org/stable/1382840.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Polygynous. Pupping season is long, late December to mid-August; births occur mainly March-June, with a peak in May (Westlake and Gilmartin 1990). Gestation lasts about 1 year. In one study, about 1/3 of the females bred in consecutive years. Mother stays with pup during 5-6 week nursing period. Pups generally stay ashore until weaned. Relatively low reproductive rate; females are sexually mature at 5-9 years, and only 60-70% of the adult females give birth in a given year (Reeves et al. 1992). Few live beyond 20-25 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monachus schauinslandi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTTTCCACAAATCACAAAGACATCGGCACTCTCTATCTATTGTTCGGTGCATGGGCTGGTATAGTAGGCACTGCTCTTAGCCTTTTAATTCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GATCAAATTTACAACGTGATCGTCACCGCTCACGCATTCGTAATAATCTTTTTTATAGTCATACCTATTATAATCGGAGGCTTTGGAAACTGATTAGTTCCTCTAATAATCGGAGCTCCCGATATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTACCACCATCTTTCCTATTACTACTGGCTTCCTCTATAGTAGAAGCAGGTGCAGGAACAGGATGAACCGTTTATCCTCCTTTAGCTGGTAATCTGGCCCATGCAGGAGCATCTGTAGACCTAACAATTTTTTCTCTGCACTTAGCAGGTGTATCATCCATTCTTGGAGCTATTAATTTTATCACCACAATTATTAACATAAAACCTCCTGCAATATCTCAATACCAAATTCCCTTGTTCGTATGATCTGTACTAATTACAGCAGTCCTCCTACTACTATCGCTACCAGTCTTAGCAGCCGGCATTACTATATTACTTACAGATCGAAATCTAAATACAACATTCTTCGATCCTGCTGGAGGAGGTGACCCTATTTTATATCAGCACTTATTCTGATTCTTCGGACATCCTGAGGTATACATCCTAATTCTACCAGGATTCGGAATGATTTCACACATCGTCACCTACTACTCAGGAAAAAAAGAACCTTTCGGCTATATAGGAATAGTCTGAGCAATAATATCTATCGGCTTCTTGGGCTTCATTGTATGAGCCCACCATATATTTACTGTAGGAATGGATGTCGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Monachus schauinslandi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Hawaiian monk seals have been on the United States Fish and Wildlife Service’s endangered species list since November 23, 1976 and are listed as critically endangered on the IUCN Red List of Threatened Species. They have been in decline for over 20 years, and as of 2007, only 1200 individuals remained in the wild. Experts estimate that fewer than 1000 individuals will remain in the wild by the end of 2012. Efforts by the National Marine Fisheries Service to stabilize population numbers include keeping tourists away from known reproductive sites, moving aggressive males to new breeding grounds, and implementing a captive care program, which provides females with nutritional supplements. The goal of the captive care program is to increase the survival rate of female juvenile seals, which have an extremely low survival rate. Hawaiian monk seals are vulnerable to introduced disease, inbreeding depression, low genetic diversity, human disturbance, and competition with fisheries. In addition to the U.S. Fish and Wildlife Service’s Endangered Species Act, they are also protected under the Marine Mammal Protection Act.

Hawaiian monk seals are intolerant of human disturbance on beaches used for birthing and resting, and pup mortality is often higher at disturbed sites. Hawaiian monk seals began declining in the mid to late 1800’s, when they were hunted for their meat and skins. Currently, populations are declining due to over fishing and seals becoming hooked or entangled in fishing gear (Antonelis et al., 2003).

US Federal List: endangered

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Small range in Hawaiian Islands; small number of major pupping sites; low declining numbers of breeding females, despite intensive management in recent decades, threatened by very low survival of juveniles and subadults due to starvation (believed to be principally related to food limitation), entanglement of seals in marine debris, and predation; human interactions in the main Hawaiian Islands, including recreational fishery interactions, mother-pup disturbance on popular beaches, and exposure to disease, are negatively affecting the population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/23/1976
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Monachus schauinslandi , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 30-70%

Comments: Population size in the northwestern Hawaiian Islands is declining, while range and population size in the main Hawaiian Islands are increasing; overall the population is declining (NMFS 2007). Modeling predicts that the population will fall below 1,000 animals in the next five years (NMFS 2007). During the period 1998-2006, the nonpup population at the six major reproductive sites in the northwestern Hawaiian Islands declined by an average of 3.9 percent per year (NMFS 2007).

Global Long Term Trend: Decline of 50-70%

Comments: The species declined by about 50 percent between the late 1950s and the mid-1970s, and beach counts of nonpups (juveniles, sub-adults and adults) declined by 66 percent between 1958 and 2006 (NMFS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: Primary threats in the northwestern Hawaiian Islands are 1) food limitation that could be due to changes in oceanographic conditions, competition with fisheries, or competition with other predators; 2) entanglement in marine debris, and 3) predation by sharks, especially on pre-weaned and recently weaned pups. An emerging threat in this region may be the loss of terrestrial habitat due to sea level increases resulting from global warming (Baker et al. 2006). Primary threats on main Hawaiian Islands are 1) interactions with recreational fishing gear, 2) possible transmission of diseases from domestic pets and livestock to seals, and 3) disturbance of seals that haul out on beaches heavily used by people. [NMFS 2007]

Potential disease outbreaks could have a devastating effect due to the currently small population size and limited geographic range. Due to low juvenile survival and an aging, breeding female population, the breeding female population is declining and birth rates will continue to decline.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the 1800s, Hawaiian monk seals were persecuted for their meat, hides and oil; their habitat was also disturbed by bird guano and feather collectors (6). Despite protection, numbers of these seals continue to decline; an average decline of 3% a year occurred between 1985 and 1999 (6). A lack of food resources, especially around French Frigate Shoals has been cited as the cause of high juvenile mortality and the presence of severely emaciated individuals (7). In addition, entanglement in marine debris that accumulates in these islands from vast areas of the Pacific, as well as disturbance, further threatens this species (6). Non-human threats such as predation by sharks and the prevalence of violent 'mobbing' behaviour of mature males, also play a part in the decline of monk seal numbers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Main Hawaiian Islands could support a larger population of seals if appropriate management actions were in place (NMFS 2007).

Biological Research Needs: See management information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Needs: See management information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Hawaiian monk seal has been listed on the United States Endangered Species List since 1976 and the National Marine Fisheries Service (NMFS) is responsible for the management of the population (7). Major colonies are surveyed annually and beach counts help to give an indication of the state of each breeding population (7); flipper tagging has been carried out since the early 1980s (6). The Northwest Hawaiian Islands lobster fishery was closed in 2000, and this may help to increase prey availability (6). In 2000, the Northwestern Hawaiian Islands Coral Reef Ecosystem Reserve was established, which should help to protect the habitat of this unique seal (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Present day Hawaiian monk seal populations represent a fraction of their historical abundances. Although recovery efforts are now underway, the total cost of these efforts over the next 50 years is estimated to be about 385 million dollars. Also, in compliance with the National Marine Fisheries Service recovery plan for Hawaiian monk seals, important feeding and reproductive sites, typically beaches, have been closed to public access. Finally, they occasionally remove fish from commercial trolling lines.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Currently, Hawaiian monk seals have little to no economic importance. However, during the mid-19th century, when Hawaii was first claimed by the United States, Hawaiian monk seals were killed for their skin, oil, and meat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Relatively unwary, exploited historically, mainly by Europeans in ships.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Four key actions are required to alter the trajectory of the Hawaiian monk seal population and to move the species towards recovery (NMFS 2007): 1. Improve the survivorship of females, particularly juveniles, in subpopulations in the northwestern Hawaiian Islands (NWHI). To do this requires the following: maintaining and enhancing existing protection and conservation of habitat and prey base; targeting research to better understand the factors that result in poor juvenile survival; intervening where appropriate to ensure higher survival of juvenile and adult females; continuing actions to protect females from individual and multiple male aggression and to prevent excessive shark predation; and continuing actions to remove marine debris and reduce mortality of seals due to entanglement. 2. Maintain the extensive field presence during the breeding season in the NWHI. Field presence is critical not just to the monitoring and research efforts, but also to carry out the active management and conservation of Hawaiian monk seal subpopulations in these areas. 3. Ensure the continued natural growth of the Hawaiian monk seal in the main Hawaiian Islands (MHI) by reducing threats including interactions with recreational fisheries, disturbance of mother-pup pairs, disturbance of hauled out seals, and exposure to human and domestic animal diseases. This should be accomplished with coordination of all federal, state, local and nongovernment parties, volunteer networks, and increased outreach and education in order to develop a culture of co-existence between humans and seals in the MHI. 4. Reduce the probability of the introduction of infectious diseases into the Hawaiian monk seal population.

NMFS (2007) listed the following 14 categories of actions as necessary for the recovery of the Hawaiian monk seal: 1 Investigate and mitigate factors affecting food limitation 2. Prevent entanglements of monk seals. 3. Reduce shark predation on monk seals. 4. Minimize the risk of exposure to or spread of infectious disease. 5. Conserve Hawaiian monk seal habitat. 6. Reduce Hawaiian monk seal interactions with fisheries. 7. Reduce male aggression toward pups/immature seals and adult females. 8. Reduce the likelihood and impact of human interactions. 9. Investigate and develop response to biotoxin impacts. 10. Reduce impacts from compromised and grounded vessels. 11. Reduce the impacts of contaminants. 12. Continue population monitoring and research. 13. Create and implement a main Hawaiian Islands Hawaiian Monk Seal. Management Plan. 14. Implement the Recovery Plan for the Hawaiian Monk Seal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hawaiian monk seal

The Hawaiian monk seal, Monachus schauinslandi, is an endangered species of earless seal in the Phocidae family that is endemic to the Hawaiian Islands.[2]

The Hawaiian monk seal is one of two remaining monk seal species; the other is the Mediterranean monk seal. A third species, the Caribbean monk seal, is extinct.[3]

The Hawaiian monk seal is the only seal native to Hawaii.[4]

These monk seals are a conservation reliant endangered species. The small population of about 1,100 individuals is threatened by human encroachment, very low levels of genetic variation, entanglement in fishing nets, marine debris, disease, and past commercial hunting for skins. There are many methods of conservation biology when it comes to endangered species; translocation, captive care, habitat cleanup, and educating the public about the Hawaiian monk seal are some of the methods that can be employed.[5][6][7]

Etymology[edit]

Known to native Hawaiians as ʻIlio-holo-i-ka-uaua, or "dog that runs in rough water", its scientific name is from Hugo Hermann Schauinsland, a German scientist who discovered a skull on Laysan Island in 1899.[8] Its common name comes from short hairs on its head, said to resemble a monk.[3] The Hawaiian monk seals are adopted to be Hawaii's state mammal.

Description[edit]

Its grey coat, white belly, and slender physique distinguish them from their cousin, the harbor seal (Phoca vitulina).[3] The monk seal’s physique is ideal for hunting its prey: fish, lobster, octopus and squid in deep water coral beds.[9] When it is not hunting and eating, it generally basks on the sandy beaches and volcanic rock of the Northwest Hawaiian Islands.[10]

The Hawaiian monk seal is part of the Phocidae family, being named so for its characteristic lack of external ears and inability to rotate its hind flippers under the body.[11] The Hawaiian monk seal has a relatively small, flat head with large black eyes, eight pairs of teeth, and short snouts with the nostril on top of the snout and vibrissae on each side.[3] The nostrils are small vertical slits which close when the seal dives underwater. Additionally, their slender, torpedo-shaped body and hind flippers allow them to be very agile swimmers.[12]

Adult males are 300 to 400 pounds (140 to 180 kg) in weight and 7 feet (2.1 m) in length while adult females tend to be, on average, slightly larger, at 400 to 600 pounds (180 to 270 kg) and 8 feet (2.4 m) feet in length. When monk seal pups are born, they average 30 to 40 pounds (14 to 18 kg) and 40 inches (1.0 m) in length. As they nurse for approximately six weeks, the grow considerably, eventually weighing between 150 to 200 pounds (68 to 91 kg) by the time they are weaned, while the mother loses up to 300 pounds (140 kg).

Monk seals, like elephant seals, shed their hair and the outer layer of their skin in an annual catastrophic molt. During the most active period of the molt, about 10 days for the Hawaiian monk seal,[13] the seal remains on the beach. The hair, generally dark gray on the dorsal side and lighter silver ventrally, gradually changes color through the year with exposure to atmospheric conditions. Sunlight and seawater cause the dark gray to become brown and the light silver to become yellow-brown, while long periods of time spent in the water can also promote algae growth, giving many seals a green tinge. The juvenile coat of the monk seal, manifest in a molt by the time a pup is weaned is silver-gray; pups are born with black pelage. Many Hawaiian monk seals sport scars from shark attacks or entanglements with fishing gear. Maximum life expectancy is 25 to 30 years.

Evolution and migration[edit]

Photo of seal on the beach, looking directly at the photographer
Hauled-out seal

The monk seals are members of the Phocidae. In an influential 1977 paper, Repenning and Ray proposed, based on certain unspecialized features, that they were the most primitive living seals.[14] However, this idea has since been entirely superseded.

In an effort to inform the public and conserve the seals, the National Oceanic Atmospheric Administration (NOAA) Fisheries Service developed a historical timeline to demonstrate that the Hawaiian islands has been home to the seals for millions of years and that the seals belong there. Evidence points to monk seals migrating to Hawaii between 4-11 million years ago (mya) through an open water passage between North and South America called the Central American Seaway. The Isthmus of Panama closed the Seaway approximately 3 million years ago.[15]

Berta and Sumich ask how this species came to the Hawaiian Islands when its closest relatives are on the other side of the world in the North Atlantic and Mediterranean Sea.[16] The species may have evolved in the Pacific or Atlantic, but in either case, came to Hawaii long before the first Polynesians.

Ecology[edit]

Habitat[edit]

A Hawaiian monk seal observed in Kauai.
A Hawaiian monk seal observed in Kauai.

The majority of the Hawaiian monk seal population can be found around the Northwest Hawaiian Islands but a small and growing population lives around the main Hawaiian Islands.[10] These seals spend two-thirds of their time at sea. Early studies (done at Midway Atoll) concluded that they frequently stayed inside the lagoons as opposed to the deep ocean, because of the larger abundance of fish found in their coral reefs.[12] However, recent use of animal-born video imaging, temperature/depth recorders, and satellite telemetry has shown that monk seals actually spend much more time foraging in deeper water outside the reefs at subphotic depths of 300 metres (160 fathoms) or more.[17][18] Hawaiian monk seals breed and haul-out on sand, corals, and volcanic rock; sandy beaches are more commonly used for pupping.[10] Due to the immense distance separating the Hawaiian Islands from other land masses capable of supporting the Hawaiian monk seal, its habitat is limited to the Hawaiian Islands.

Feeding[edit]

Hawaiian monk seals mainly prey on bony fish, but they also prey on cephalopods, and crustaceans.[9] Both juveniles and sub-adults prey more on smaller octopus species, such as Octopus leteus and O. hawaiiensis, nocturnal octopi species, and eels than the adult Hawaiian monk seals.[9] While adult seals feed mostly on larger octopi species such as O. cyanea. Hawaiian monk seals have a broad and diverse diet due to foraging plasticity which allows them to be opportunistic predators that feed on a wide variety of available prey.[9]

Predators[edit]

Tiger sharks and Galapagos sharks are both predators of the Hawaiian Monk Seal.[19]

Behavior[edit]

Reproduction[edit]

Hawaiian monk seals mate in the water during their breeding season, which occurs between December and August.[3] Females reach maturity at age four and bear one pup a year. The fetus takes nine months to develop, with birth occurring in March and June. Pups start around 16 kilograms (35 lb) and are about 1 metre (3 ft 3 in) long.

Nursing[edit]

The pups are born on beaches and nursed for about six weeks. The mother does not eat or leave the pup while nursing. After that time, the mother deserts the pup, leaving it on its own, and returns to the sea to forage for the first time since the pup’s arrival.[12]

Status[edit]

A Hawaiian monk seal observed on the North Shore of Oahu.
A Hawaiian monk seal observed on the North Shore of Oahu, near Waimea Bay.

Most seals are on Laysan, Midway, Pearl and Hermes Atoll, French Frigate Shoals, and Lisianski.[20]

The Hawaiian monk seal is critically endangered,[21] although its cousin species the Mediterranean monk seal (M. monachus) is even rarer, and the Caribbean monk seal (M. tropicalis), last sighted in the 1950s, was officially declared extinct in June 2008.[22] The population of Hawaiian monk seals is in decline. In 2010, it was estimated that only 1100 individuals remained. The larger population that inhabits the northwest islands is declining.[23][24]

Seals nearly disappeared from the main Hawaiian Islands, but the population has begun to recover. The growing population there was approximately 150 as of 2004.[20] Individuals have been sighted in surf breaks and on beaches in Kauaʻi, Niʻihau and Maui. In early June 2010, two seals hauled out on Oʻahu's popular Waikiki beach. Seals have hauled out at O'ahu's Turtle Bay,[25] and again beached at Waikiki on March 4, 2011, by the Moana Hotel. Yet another adult came ashore for a rest next to the breakwater in Kapiolani Park Waikiki on the morning of 11 December 2012, after first being spotted traveling west along the reef break from the Aquarium side of the Park. In 2006, twelve pups were born in the main Hawaiian Islands, rising to thirteen in 2007, and eighteen in 2008. As of 2008 43 pups had been counted in the main Hawaiian islands.[26] Since 2012 and possibly earlier, there have been many anecdotal reports of monk seals hauling out on O'ahu's Kaena Point.

The Hawaiian monk seal was officially designated as an endangered species on November 23, 1976, and is now protected by the Endangered Species Act and the Marine Mammal Protection Act. It is illegal to kill, capture or harass a Hawaiian monk seal. Even with these protections, human activity along Hawaii's fragile coastlines (and in the world at large) still provides many stressors.[27]

Threats[edit]

Underwater photo of seal in profile with open eye and an apparent smile
Hawaiian monk seal

Natural factors threatening the Hawaiian monk seal include low juvenile survival rates, reduction of habitat/prey associated with environmental changes, increased male aggression, and subsequent skewed gender ratios.[28] Anthropogenic or human impacts include hunting (during the 1800s and 1900s) and the resulting small gene pool, continuing human disturbance, entanglement in marine debris, and fishery interactions.[28]

Natural threats[edit]

Low juvenile survival rates continue to threaten the species. High juvenile mortality is due to starvation and marine debris entanglement.[6] Another contributor to the low juvenile survival rates is the predation from sharks, including tiger sharks. Most mature monk seals bear scars from shark encounters—many such attacks have been observed.[28]

Reduced prey abundance can lead to starvation. A reduction in habitat associated with environmental changes is one cause.[28] Habitat is shrinking due to erosion in the Northwest Hawaiian Islands, reducing the islands/beaches.[28] Lobsters, the seals' preferred food other than fish, have been overfished. Competition from other apex predators such as sharks, jacks, and barracudas, leaves little for developing pups. The creation of Papahānaumokuākea Marine National Monument which encloses these islands may expand food supplies.

Mobbing is a practice among the seals that involves multiple males attacking one female in mating attempts. Mobbing is responsible for many deaths especially to females.[29]

Mobbing leaves the targeted individual with wounds that increase vulnerability to septicemia, killing the victim via infection.[29] Smaller populations were more likely to experience mobbing as a result of the higher male/female ratio and male aggression. Unbalanced sex-ratios were more likely to occur in slow-growing populations.[30][31]

One infectious pathogen found in Hawaiian waters is ciguatera. Further, postmortem examinations of some seal carcasses revealed gastric ulcerations caused by parasites.[32]

Anthropogenic Impacts[edit]

In the nineteenth century, large numbers of seals were killed by whalers and sealers for meat, oil and skin.[33] U.S. military forces hunted them during World War II, while occupying Laysan Island and Midway.[33]

The Hawaiian monk seal has the lowest level of genetic variability among the 18 pinniped species.[6] This low genetic variability was allegedly due to a population bottleneck caused by intense hunting in the 19th century.[6] This limited genetic variability reduces the species ability to adapt to environmental pressures and limits natural selection thus increasing their risk of extinction.[6] Given the monk seal's small population, the effects of disease could be disastrous.

Monk seals are dying from the toxoplasmosis pathogen in cat feces that enters the ocean in polluted runoff and wastewater, a new phenomenon.[34] Over the past ten years, toxoplasmosis killed at least four seals. Other human-introduced pathogens, including leptospirosis, have infected monk seals.[34]

Human disturbances have had immense effects on the populations of the Hawaiian monk seal. Monk seals tend to avoid beaches where they are disturbed; after continual disturbance the seal may completely abandon the beach, thus reducing its habitat size, subsequently limiting population growth. For instance, large beach crowds and beach structures limit the seal’s habitat.[5][28][34] Although the WWII military bases in the northwestern islands were closed, minimal human activities can be enough to disturb the species.[28]

Marine fisheries can potentially interact with monk seals via direct and indirect relationships. Directly the seal can become snared by fishing equipment, entangled in discarded debris, and even feed on fish refuse.[28]

Entanglement can result in mortality because the seals get trapped in marine debris such as fishing nets and cannot maneuver or even reach the surface to breathe.[6] International law prohibits the intentional discarding of debris from ships at sea. Monk seals have one of the highest documented rates of entanglement of any pinniped species.[28]

Conservation[edit]

Reversing the population decline hinges on a comprehensive, scientifically sound characterization and mitigation of relevant natural and anthropogenic factors along with better understanding of the species' particular vulnerabilities.[28]

Genetic data analysis is needed because identifying individuals genetically along with confirming maternity and paternity can provide information about male and female reproductive rates which are crucial to wildlife managers.[7]

In 1909, President Theodore Roosevelt created the Hawaiian Islands Reservation that included the Northwest Hawaiian islands. The Reservation later became the Hawaiian Islands National Wildlife Refuge (HINWR) and moved under the jurisdiction of the U.S. Fish and Wildlife Service (USFWS).[28] Throughout the 1980s, the National Marine Fisheries Service completed various versions of an Environmental Impact Statement that designated the Northwest Hawaiian Islands as a critical habitat for the Hawaiian monk seal. The designation prohibited lobster fishing in waters less than 10 fathoms in the Northwest Hawaiian Islands and within 20 nautical miles of Laysan Island. The National Marine Fisheries Service designated all beach areas, lagoon waters, and ocean waters out to a depth of 10 fathoms (later 20 fathoms) around the Northwestern Hawaiian Islands, except for one of the Midway group, Sand Island. In 2006, a Presidential Proclamation established the Papahanaumokuakea Marine National Monument, which incorporated the Northwestern Hawaiian Islands Coral Reef Ecosystem Reserve, the Midway Atoll National Wildlife Refuge, the Hawaiian Islands National Wildlife Refuge, and the Battle of Midway National Memorial, thus creating the largest marine protected area in the world and affording the Hawaiian monk seal further protection.[35]

NOAA cultivated a network of volunteers to protect the seals while they bask or bear and nurse their young. NOAA is funding considerable research on seal population dynamics and health in conjunction with the Marine Mammal Center.

From NOAA, several programs and networks were formed in order monk seal. Community programs such as PIRO have helped to improve community standards for the Hawaiian monk seal. The program also creates networks with the Native Hawaiians on the island to network more people in the fight for conservation of the seals. The Marine Mammal Response Network (MMRN) is partnered with NOAA and several other government agencies that deal with land and marine wildlife.[36]

The Recovery Plan for the Hawaiian Monk Seal identifies public outreach and education as a key action for promoting the conservation of the Hawaiian monk seal and its habitat.[35]

To raise awareness of the species' plight, on June 11, 2008, a state law designated the Hawaiian monk seal as Hawaii's official State Mammal .[37]

The task is to identify a manner of alleviation that is possible, cost-effective, and likely to maximize the organic return (in terms of growth potential) until much time has passed and natural conditions allow scientists to observe the effects. .[38]

Protecting female pups[edit]

One key natural factor affecting the seal populations is the male-biased sex-ratio, which results in increased aggressive behaviors such as mobbing.[30] These aggressive behaviors decrease the number of females in the population. Two programs effectively aid female survival rates.

Project “Headstart” began in 1981, collected and tagged female pups after weaning, and placed them in a large, enclosed water and beach area with food and lacking disturbances.[39] The female pups remain during the summer months, leaving at roughly age three to seven months.

Another project began in 1984 at French Frigate Shoals. It collected severely underweight female pups, placed them in protective care and fed them. The pups were released as yearlings and relocated to the Kure Atoll.[39]

Some habitats are better suited to increase survival probability making relocation a popular and promising method.[7] Although no direct links between infectious diseases and seal mortality rates have been found, unidentified infectious diseases could prove detrimental to relocation strategies.[40] Identification and mitigation of these and other possible factors (e.g., disease) limiting population growth represent ongoing challenges and are the primary objectives of the Hawaiian monk seal conservation and recovery effort.[32]

It is also important to consider the mothers who nurse their (female and male) pups. Seal milk is very rich in nutrients which also allows pups to gain weight rapidly. With the rich milk from the mother the pup is more prone to quadruple their initial weight before weaning. The mother seal also loses a tremendous amount of weight while nursing.[41]

Draft environment impact statement[edit]

In 2011, the National Marine Fisheries Service issued a controversial draft programmatic environmental impact statement intended to improve protections for the monk seal.[42] The plan includes:

  • Expanded surveys using technology such as remote cameras and unmanned, remotely operated aircraft.
  • Vaccination studies and vaccination programs.
  • De-worming program to improve juvenile survival.
  • Relocation to the Northwestern Hawaiian Islands.
  • Diet supplements at feeding stations in the Northwestern Hawaiian Islands.
  • Tools to modify undesirable contact with people and fishing gear in the main Hawaiian Islands.
  • Chemical alteration of aggressive monk seal behavior.

See also[edit]

References[edit]

  1. ^ Lowry, L. & Aguilar, A. (2008). Monachus schauinslandi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 January 2009. Listed as Critically Endangered (CR A3ce+4ce)
  2. ^ "Hawaiian Monk Seal, Monachus schauinslandi". monachus-guardian.org. 2006. Retrieved 2011-05-23. 
  3. ^ a b c d e "Hawaiian Monk Seal (Monachus schauinslandi)". NOAA Fisheries Office of Protected Resources. Retrieved 2011-03-11. 
  4. ^ Nitta, Eugene; Henderson JR (1993). "A review of interactions between Hawaii's fisheries and protected species" (pdf). Marine Fisheries Review. 83 55 (2). Retrieved 2011-05-23. 
  5. ^ a b Boland, R; Donohue, R (2003). "Marine Debris Accumulation in the Nearshore Marine Habitat of the Endangered Hawaiian Monk Seal, Monachus Schauinslandi". Marine Pollution Bulletin. 11 46 (11): 1385–139. doi:10.1016/S0025-326X(03)00291-1. Retrieved 2011-05-23. 
  6. ^ a b c d e f Schultz J, J. K.; Baker J; Toonen R; Bowen B (2009). "Extremely Low Genetic Diversity in the Endangered Hawaiian Monk Seal (Monachus Schauinslandi)". Journal of Heredity. 1 100 (1): 25–33. doi:10.1093/jhered/esn077. PMID 18815116. Retrieved 2011-05-23. 
  7. ^ a b c Schultz, J; Baker J; Toonen R; Bowen B (2011). "Range-Wide Genetic Connectivity of the Hawaiian Monk Seal and Implications for Translocation". Conservation Biology. 1 25 (1): 124–132. doi:10.1111/j.1523-1739.2010.01615.x. PMID 21166713. 
  8. ^ Reeves, RR; Stewert, BS (2002). National Audubon Society Guide to Marine Mammals of the World. ISBN 978-0-375-41141-0. 
  9. ^ a b c d Goodman-Lowe, GD (1998). "Diet of the Hawaiian Monk Seal (Monachus Schauinslandi) from the Northwestern Hawaiian Islands during 1991 to 1994" (pdf). Marine Biology. 3 132 (3): 535–46. doi:10.1007/s002270050419. Retrieved 2011-05-23. 
  10. ^ a b c Baker, J; Johanos, Thea C. (2004). "Abundance of the Hawaiian Monk Seal in the Main Hawaiian Islands". Biological Conservation. 1 116: 103–10. doi:10.1016/S0006-3207(03)00181-2. 
  11. ^ Gilmartin, William; Forcada, J. (2002). "Monk Seals". Encyclopedia of Marine Mammals, eds: 756–759. 
  12. ^ a b c Kenyon, KW; Rice, DW (July 1959). "Life History Of the Hawaiian Monk Seal". Pacific Science 13. Retrieved 2011-05-23. 
  13. ^ Perrin, William F.; Bernd Wursig; J. G. M. Thewissen (24 November 2008). Encyclopedia of Marine Mammals. Academic Press. p. 741. ISBN 978-0-12-373553-9. Retrieved 26 May 2011. 
  14. ^ Repenning, CA; Ray, CE (1977). "The origin of the Hawaiian monk seal". Proc. Biol. Soc. Wash 89: 667–688. 
  15. ^ "Historical Timeline of the Hawaiian Monk Seal". National Marine Fisheries Service - Pacific Islands Regional Office. Honolulu, HI, USA: National Marine Fisheries Service, Pacific Islands Regional Office. June 29, 2011. Retrieved November 19, 2012. 
  16. ^ Berta, Annalisa; Sumich, James L (1999). "Marine Mammals". Evolutionary Biology (Academic Press). 
  17. ^ Parrish, FA; Littnan, CL (2008). "Changing perspectives in Hawaiian monk seal research using animal-borne imaging" (pdf). Marine Technology Society Journal 41 (4): 30–34. doi:10.4031/002533207787441944. Retrieved 2011-05-23. 
  18. ^ Parrish, Frank A (1999). "Use of Technical Diving to Survey Forage Habitat of the Endangered Hawaiian Monk Seal". In: Hamilton RW, Pence DF, Kesling DE, eds. Assessment and Feasibility of Technical Diving Operations for Scientific Exploration. (American Academy of Underwater Sciences). Retrieved 2011-05-23. 
  19. ^ Bertilsson-Friedman, P (2006). "Distribution and Frequencies of Shark-inflicted Injuries to the Endangered Hawaiian Monk Seal (Monachus Schauinslandi)". Journal of Zoology 268 (4): 361–68. doi:10.1111/j.1469-7998.2006.00066.x. 
  20. ^ a b Ellis, Richard (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. p. 195. ISBN 0-06-055804-0. 
  21. ^ "The Captive Care and Release Research Project Seeks to Aid Recovery of the Endangered Hawaiian Monk Seal". NOAA. Retrieved 2011-05-23. 
  22. ^ "Feds: Caribbean Monk Seal Officially Extinct". Fox News. Associated Press. 2008-06-09. Retrieved 2011-05-23. 
  23. ^ "Hawaiian Monk Seal Population at a Glance". Pacific Islands Fisheries Science Center of the National Marine Fisheries Service, part of the National Oceanic and Atmospheric Administration. Honolulu, HI, USA. Retrieved November 24, 2012. 
  24. ^ "Hawaiian Monk Seal". Killyleagh, Co. Down, N. Ireland, UK & Kingsbarns, St Andrews, Scotland, UK: Seal Conservation Society. August 2011. Retrieved November 24, 2012. 
  25. ^ donna (2012). "MonkSealMania.blogspot.com: Turtle Bay". Retrieved November 19, 2012. 
  26. ^ Wianecki, Shannon. "Rough Water Pups". Maui Magazine. Retrieved 2011-05-23. 
  27. ^ Weber, Gretchen. "A struggle to survive: Environmental threats endanger monk seals". PBS. Retrieved 2011-05-23. 
  28. ^ a b c d e f g h i j k Antonelis, GA; et al. (2006). "Hawaiian monk seal (Monachus schauins-landi): status and conservation issues". Atoll Res Bull 543: 75–101. 
  29. ^ a b Banish, LD; Gilmartin, WG (1992). "Pathological findings in the Hawaiian monk seal". Journal of Wildlife Diseases 28 (3): 428–434. doi:10.7589/0090-3558-28.3.428. PMID 1512875. Retrieved 2011-05-23. 
  30. ^ a b Starfield, AM; Roth JD; Ralls K (1995). "Mobbing in Hawaiian monk seals: the value of simulation modeling in the absence of apparently crucial data". Conserv. Biol 9: 166–174. doi:10.1046/j.1523-1739.1995.09010166.x. JSTOR 2386398. 
  31. ^ "Hawaiian Monk Seals". earthtrust.org. Retrieved 2011-05-23. 
  32. ^ a b Gilmartin, WG (1983). Recovery plan for the Hawaiian monk seal, Monachus schauinslandi. U.S. Department of Commerce, NOAA, National Marine Fisheries Service. 
  33. ^ a b Ellis, Richard (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. p. 194. ISBN 0-06-055804-0. 
  34. ^ a b c Dawson, Teresa. "A New Threat to Hawaiian Monk Seals: Cat Parasite Carried by Runoff, Sewage — Environmental Health News". Environmental Health News: Front Page. Retrieved 2011-03-16. 
  35. ^ a b "Second Revision of Recovery Plan for the Hawaiian Monk Seal (Monachus schauinslandi)". NOAA PIFSC Hawaiian Monk Seal Research. Honolulu, HI, USA: Pacific Islands Fisheries Science Center of the National Marine Fisheries Service, part of the National Oceanic and Atmospheric Administration. January 28, 2010 [2007]. Retrieved November 24, 2012. 
  36. ^ Protected Resources Division." NOAA. N.p., n.d. Web. 21 Oct. 2013.
  37. ^ Gladden, Tracy. "Hawaiian monk seal is the new state mammal". KHNL NBC 8 Honolulu Hawaii. Retrieved 2011-05-23. 
  38. ^ Antonelis, Baker, Johanos, Braun, Harting, Hawaiian Monk Seal (Monachus schauinslandi): Status and Conservation Issues pgs. 88-89
  39. ^ a b Gerrodette, Tim; Gilmartin William G (1980). "Demographic consequences of changed pupping and hauling sites of the Hawaiian monk seal". Conservation Biology 4 (4): 423–430. doi:10.1111/j.1523-1739.1990.tb00317.x. JSTOR 2385936. 
  40. ^ Aguirre, A.; T. Keefe; J. Reif; L. Kashinsky; P. Yochem (2007). "Infectious disease monitoring of the endangered Hawaiian monk seal". Journal of Wildlife Diseases 43 (2): 229–241. doi:10.7589/0090-3558-43.2.229. PMID 17495307. 
  41. ^ Hawaiian Monk Seal - Hawaiian Islands - U.S. Fish and Wildlife Service." Hawaiian Monk Seal - Hawaiian Islands - U.S. Fish and Wildlife Service. N.p., n.d. Web. 21 Oct. 2013.
  42. ^ "Fisheries Service to hold hearings on monk seals". The Maui News. September 6, 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!