Overview

Brief Summary

Biology

Monk seals are predominately solitary although females with young may be observed near each other due to limited areas offering the preferred habitat type for pupping (8). Females are sexually mature at around five to six years of age and tend to give birth to a single pup; the majority of births occur between March and June (4). Females suckle their young for around six weeks (8). Males become extremely aggressive during the breeding season and groups of males can sometimes kill females or juveniles in what is known as 'mobbing' during this time (2). Hawaiian monk seals have a similar fat content to their relatives that inhabit cooler, polar waters and have developed behavioural adaptations to cope with the warmth of their tropical habitat; they are mainly nocturnal, spending the day hauled out on sandy beaches often wallowing in wet sand by the waters edge (5). Monk seals feed on a variety of marine animals from fish, including eels, to cephalopods such as octopus and squid (4). They forage at depths of up to 100 metres, but are known to dive to 500 metres, and may travel large distances to foraging locations (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Hawaiian monk seals are the only true seals to be found year-round in tropical waters (2). After the annual moult, this monk seal is a silvery grey colour on the back, with cream colouring on the throat, chest and underside (4). Over time the coat looks brown above and yellow below; males, and some females, turn almost black with age (2). Certain individuals may have a red or green tinge or spots due to algal growth (4). Pups measure about one metre at birth and have a silky black coat, which moults after around a month into the silvery adult-like fur (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Hawaiian monk seals occur throughout the Hawaiian Island chain. Their six main reproductive sites are in the northwestern Hawaiian Islands at Kure Atoll, Midway Atoll, Pearl and Hermes Reef, Lisianski Island, Laysan Island, and French Frigate Shoals (National Marine Fisheries Service 2007). While sightings were previously rare in the main Hawaiian Islands, monk seals are now regularly seen there and births have been documented on all of the major islands (Baker and Johanos 2004). Sightings outside of the main range have occurred at Johnston Atoll, Palmyra Atoll, and Wake Island (Ragen and Lavigne 1999).

Hawaiian monk seals are non-migratory, and tend to remain near the atoll where they were born. However, some seals will relocate temporarily or permanently to other sites in the island chain, and long distance wanderers have been recorded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Hawaiian monk seals are endemic to the Hawaiian Archipelago and are found primarily in the tropical waters of the northwestern Hawaiian island chain. Reproductive sites include Kure atoll, Midway atoll, Pearl and Hermes Reef, Lisianski Island, and French frigate shoals. Small populations also occur on Necker and Nihoa and breeding populations have been found on the main Hawaiian islands, also known as the windward Hawaiian Islands (Baker and Johannos, 2004; Antonelis et al., 2003).

Biogeographic Regions: pacific ocean (Native )

Other Geographic Terms: island endemic

  • Antonelis, G., J. Baker, T. Johanos, R. Braun, A. Harting. 2003. "Hawaiian monk seals (Monachus Schauinslandi): Status and Conservation Issues" (On-line pdf). Accessed August 02, 2010 at http://www.botany.hawaii.edu/faculty/duffy/arb/543/06.pdf.
  • Baker, J. 2004. Abundance of Hawaiian monk seals in the main Hawaiian islands. Biological Conservation, 116/1: 103-110.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Hawaiian Islands
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: This species occurs in the Hawaiian Islands. The six main reproductive sites in the northwestern Hawaiian Islands are Kure Atoll, Midway Islands, Pearl and Hermes Reef, Lisianski Island, Laysan Island, and French Frigate Shoals (NMFS 2007). Smaller breeding subpopulations occur on Necker Island and Nihoa Island, and monk seals have been observed at Gardner Pinnacles and Maro Reef. (NMFS 2007). Monk seals are now also found throughout the main Hawaiian Islands, where births have been documented on most of the major islands (Baker and Johanos 2004). Additional sightings and at least one birth have occurred at Johnston Atoll (NMFS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (HI)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The main reproductive and foraging sites are on and around the largely uninhabited and remote Northwestern Hawaiian Islands of French Frigate Shoals, Laysan Island, Lisianski Island, Pearl and Hermes Reef, Midway Atoll and Kure Atoll. Monk seals also breed in lower numbers at Necker and Nihoa Islands in the Northwestern Hawaiian Islands and in the main Hawaiian Islands,, and have also been seen at a few sites outside of the Hawaiian Archipelago (6) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Hawaiian monk seals exhibit sexual dimorphism, with females being larger than males. Females have an average length of 2.25 m and an average weight of 203 kg. Males have an average length of 2.1 m and an average weight of 169 kg. After birth, Hawaiian monk seals are covered in black lunago (fetal hair), which they molt upon weaning. As juveniles, they are silvery gray, with darker hair on their dorsal side and white hair on their ventral side (National Marine Fisheries Service, 2007). Adults have brown pelage that is slightly gray on their backs and gradually fades to yellow and then white near the ventral surface of the animal. They have broad, flat, and moderately small heads with large black eyes. Unlike other pinnipeds, their nostrils are located on top of their short snout.

Range mass: 169 to 203 kg.

Range length: 2.1 to 2.25 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • National Marine Fisheries Service, 2007. Recovery Plan for the Hawaiian Monk Seal (Monachus schauinslandi). Second Revision. Silver Springs, MD: National Marine Fisheries Service.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 215 cm

Weight: 170000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

No other native pinnipeds occur in the range of this species. Differs from the California sea lion, which could occur as an escape, in much shorter limbs, hind limbs that cannot be turned forward or used effectively for terrestrial locomotion, and absence of external ear pinnae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adult Hawaiian monk seals reach lengths of about 2.1 to 2.4 m and weigh 170-240 kg with females being somewhat longer and heavier than males. Pups are about 1 m and 16-18 kg at birth and when weaned 6 weeks later they weigh 50-100 kg (Kenyon 1981, Antonelis et al. 2003).

Monk seals are generally solitary, both on land and at sea. Even when seals gather together on land, they are not normally gregarious and only mothers and pups and recently weaned seals regularly make physical contact. On land, Hawaiian monk seals haul-out and breed on substrates of sand, coral or volcanic rock. Sandy beaches with shallow protected water near shore appear to be preferred for pupping (Westlake and Gilmartin 1990).

At-sea movements and habitat use of Hawaiian monk seals have been investigated using satellite-linked dive recorders and animal-born video cameras that have been put on seals in the northwestern Hawaiian Islands. Results show that they forage within atolls, in the shallow waters surrounding atolls and islands and farther offshore at submerged banks and reefs (Stewart et al. 2006). Seals carrying cameras searched for and preyed on benthic fish and invertebrates in areas of rubble and consolidated bottom material, along areas of transition of benthic habitat types, and also in deepwater coral beds (Parish et al. 2000, 2002).

Most dives that have been recorded have been less than 150 meters deep, although some individuals dove to more than 550 m (Stewart et al. 2006). Monk seals are known to eat a variety of fishes, eels, cephalopods and crustaceans (Goodman-Lowe 1998).

While the habitats of the Hawaiian monk seal are distributed over thousands of kilometers, the terrestrial habitat available for their use in the northwestern Hawaiian Islands is very limited. The total area of emergent land is only about 13.5 km² and only a fraction of that is suitable for use by seals (Ragen and Lavigne 1999).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hawaiian monk seals utilize terrestrial and marine habitats. Sandy beaches are used for parturition, nursing, molting, and resting. The most common parturition sites are on sandy beaches with exposed protective reefs, which limit shark access and provide shelter from large surf (Atonelis et al., 2003). Hawaiian monk seals use protected waters to teach weaned pups to capture prey. They use vegetation along the beach perimeter to protect themselves from ultraviolet rays, wind, and rain, and may also use terrestrial vegetation as shelter while they sleep (Gilmartin, 1983). Hawaiian monk seals spend the majority of their time in the ocean resting, interacting with each other, and foraging. They spend much of their time at depths of about 100 m and less, although some have been observed foraging at depths of over 300 meters (Parish et al., 2002).

Range depth: 300 (high) m.

Average depth: 100 m.

Habitat Regions: tropical ; terrestrial ; saltwater or marine

Aquatic Biomes: reef

  • Gilmartin, W. 1983. Recovery Plan for the Hawaiian Monk Seal, Monachus schauinslandi. Silver Springs, MD: National Marine Fisheries Service.
  • Parrish, F., K. Abernathy, G. Marshall, B. Buhleier. 2002. Hawaiian monk seals (Monachus Schauinslandi) foraging in deep water coral beds. Mammal Science, 18: 244-258.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: This seal occurs mainly in waters around islands, but it is also known to travel long distances in the open ocean. Often it is found around submerged reefs and atolls, or on sandy beaches; rocky ledges or gravel beaches sometimes are used as haulouts.

Birthing sites usually are on coral sand beaches backed by Scaevola shrubs, into which a female may take her pup for shelter at night. Births also occur on beaches lacking shrub cover and on rocky beaches (Necker Island). Primary features of pupping locations are very shallow water adjacent to the shoreline (may protect against shark attack) (Westlake and Gilmartin 1990) and stable substrate (Reeves et al. 1992). Human activity may cause females to shift to less favorable sites. Mating presumably occurs in the water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found on the coral atolls and rocky islands of the Northwest Hawaiian Islands, in tropical waters (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

One tagged pup traveled from Laysan Island to Johnston Atoll, 1,013 kilometers distant, within a period of less than 5 months (Reeves et al. 1992)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hawaiian monk seals primarily prey upon teleost fishes, which make up roughly 80% of their diet. They appear to prefer fish belonging to the families Muranidae (marine eels), Labridae (wrasses), Holocentridae (squirrelfishes and soldierfishes), Balistidae (triggerfishes) and Scaridae (parrotfishes). Except for the beardfish family (Polymixiidae), which consists of deep sea benthic fishes, all fishes consumed by Hawaiian monk seals are shallow reef fishes (Goodman-Lowe, 1998). The remainder of the their diet consists of cephalopods and crustaceans, with the majority of consumed cephalopods being octopi. Hawaiian monk seals prey upon diurnal and nocturnal species of teleosts and cephalopods; however, juveniles tend to prey more heavily on nocturnal species (Goodman-Lowe, 1998). They primarily forage in shallow reefs (less than 100 m) near their natal atoll and foraging takes place near or at the sea floor. Individuals foraging in precious coral beds (Corallium rubrum) at depths of over 300 m have been recorded, where prey-capture rates may be higher (Parrish et al., 2002).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Molluscivore )

  • Goodman-Lowe, G. 1998. Diet of the Hawaiian monk seal (Monachus Schauinslandi) from the Northwestern Hawaiian Islands during 1991 to 1994. Marine Biology, 132: 535-546.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: When near breeding and resting beaches, monk seals forage benthically and feed on fishes and invertebrates both within atoll lagoons and in deeper water up to at least 500 meters (see NMFS 2007); diet includes wide variety of fishes, cephalopods, and crustaceans..

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Hawaiian monk seals prey upon 40 species of marine animals that live in the coral reef ecosystem, including many species of teleost fish, cephalopods, and crustaceans.

  • Gilmartin, W., J. Forcada. 2002. Monk Seals. Pp. 756-759 in W Perrin, W Bernd, J Thewissen, eds. Encyclopedia of Marine Mammals, 1st Edition. San Diego, CA: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The main predator of Hawaiian monk seals is the tiger shark (Galeocerdo cuvier), and shark predation is believed to be a significant contributing factor to pup mortality. Although male Hawaiian monk seals are known to commit infanticide, sharks are thought to be the main threat to pup survival. Seals avoid potential predators by nesting on beaches protected by exposed reefs and by feeding and resting in underwater reef caves.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: This species is represented by a single metapopulation (NMFS 2007). The different subpopulations exhibit varying degrees of demographic independence, with some having considerable levels of independence and other areas having higher degrees of subpopulation interaction (NMFS 2007)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

250 - 1000 individuals

Comments: Current (2006) population size is approximately 1,200 (NMFS 2007), but not all of these are mature individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

This species is generally solitary on land and in the sea; groups may gather on favored beaches.

Shark predation is an important mortality factor. See Kenyon (1981) for a review of mortality factors such as sharks, entanglement in fishing gear, disease. Injuries sustained from adult males apparently contribute significantly to mortality in adult females (Hiruki et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Hawaiian monk seals communicate using vocalizations, including those between mothers and nursing pups.

Communication Channels: acoustic

Perception Channels: acoustic

  • Job, D., D. Boness, J. Francis. 1995. Individual variation in nursing vocalizations of Hawaiian monk seal pups, Monachus schauinslandi (Phocidae, Pinnipedia), and lack of maternal recognition. Canadian Journal of Zoology, 73: 975-983.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Hawaiian monk seals live for 25 to 30 years in the wild. The lifespan of captive individuals is unknown.

Average lifespan

Status: wild:
25 years.

Average lifespan

Status: wild:
30.0 years.

  • Gerrodette, T., W. Gilmartin. 1990. Demographic consequences of changed pupping and hauling sites of the Hawaiian monk seal. Conservation Biology, 4/4: 423-430. Accessed February 10, 2011 at http://swfsc.noaa.gov/publications/CR/1990/9015.PDF.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, these animals are believed to live up to 30 years (David Macdonald 1985). Little is known about their longevity in captivity, though one wild born specimen was still living in captivity at about 22.8 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Copulation in Hawaiian monk seals is rarely observed but usually takes place about 1 to 5 km off shore. Although little is known about the reproductive success or the mating system used by these animals, sexual dimorphism in conjunction with open water mating suggests polygyny (Weckerly, 1998). As in other pinnipeds, males likely mount females by biting their backs and grasping them with their foreflippers (Antonelis et al., 2003).

Mating System: polygynous

Hawaiian monk seals are monestrous and give birth to a single pup each year during an extended birthing season, which begins in March, peaks in April, and ends in August (Boness et al., 1998). Females leave the ocean to give birth on beaches close to their most recent breeding site. Birthing takes place after an 11-month gestation period, which contains a 3-month period of delayed implantation. Females are solely responsible for rearing offspring, which takes about 40 days. While rearing their pups, females fast and may lose hundreds of pounds. Pups weigh between 14 and 17 kg at birth and between 50 and 100 kg at weaning (National Marine Fisheries Service, 2007). Females wean pups by suddenly abandoning them and returning to the ocean, after which they wait 3 to 4 weeks before mating again (Boness et al., 1998). Hawaiian monk seals are one of three pinniped species that commonly foster pups, the other two being grey seals (Halichoerus grypus) and northern elephant seals (Mirounga angustirostris; Boness et al., 1998). Both genders reach sexual maturity between the ages of 5 and 10 years old. Pups weaned at higher weights generally have a greater chance of survival and become sexually mature at an earlier age.

Breeding interval: Hawaiian monk seals breed once yearly

Breeding season: February to March

Average number of offspring: 1.

Average gestation period: 11 months.

Range birth mass: 14 to 17 kg.

Range weaning age: 5 to 6 weeks.

Range age at sexual or reproductive maturity (female): 5 to 10 years.

Range age at sexual or reproductive maturity (male): 5 (low) years.

Average age at sexual or reproductive maturity (male): 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); delayed implantation

Average gestation period: 335 days.

Average number of offspring: 1.

Females are the only sex that invest in pup development. Pup fostering, which only occurs in 2 other pinniped species (gray seals, Halichoerus grypus and northern elephant seals, Mirounga angustirostris), takes place when females rear their young in close proximity to one another and may occur when pups are separated from their mothers. Most females tolerate nursing attempts by orphaned pups. Although pup fostering appears to result in little to no reward for adopting mothers, fostered pups clearly benefit from their foster mother's care (Boness et al., 1998).

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Antonelis, G., J. Baker, T. Johanos, R. Braun, A. Harting. 2003. "Hawaiian monk seals (Monachus Schauinslandi): Status and Conservation Issues" (On-line pdf). Accessed August 02, 2010 at http://www.botany.hawaii.edu/faculty/duffy/arb/543/06.pdf.
  • Boness, D., C. Mitchell, L. Honigman, S. Austin. 1998. Fostering Behavior and the Effect on Female Density in Hawaiian Monk Seals, Monachus Schauinslandi. Journal of Mammalogy, 79/3: 1060-1069.
  • National Marine Fisheries Service, 2007. Recovery Plan for the Hawaiian Monk Seal (Monachus schauinslandi). Second Revision. Silver Springs, MD: National Marine Fisheries Service.
  • Weckerly, F. 1998. Sexual-Size Dimorphism: Influence of Mass and Mating Systems in the Most Dimorphic Mammals. Journal of Mammalogy, 79:1: 52. Accessed September 08, 2010 at http://www.jstor.org/stable/1382840.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Polygynous. Pupping season is long, late December to mid-August; births occur mainly March-June, with a peak in May (Westlake and Gilmartin 1990). Gestation lasts about 1 year. In one study, about 1/3 of the females bred in consecutive years. Mother stays with pup during 5-6 week nursing period. Pups generally stay ashore until weaned. Relatively low reproductive rate; females are sexually mature at 5-9 years, and only 60-70% of the adult females give birth in a given year (Reeves et al. 1992). Few live beyond 20-25 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monachus schauinslandi

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0242-06|AY377141|Monachus schauinslandi| AATCGATGATTATTTTCCACAAATCACAAAGACATCGGCACTCTCTATCTATTGTTCGGTGCATGGGCTGGTATAGTAGGCACTGCTCTT---AGCCTTTTAATTCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GATCAAATTTACAACGTGATCGTCACCGCTCACGCATTCGTAATAATCTTTTTTATAGTCATACCTATTATAATCGGAGGCTTTGGAAACTGATTAGTTCCTCTAATA---ATCGGAGCTCCCGATATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTACCACCATCTTTCCTATTACTACTGGCTTCCTCTATAGTAGAAGCAGGTGCAGGAACAGGATGAACCGTTTATCCTCCTTTAGCTGGTAATCTGGCCCATGCAGGAGCATCTGTAGACCTA---ACAATTTTTTCTCTGCACTTAGCAGGTGTATCATCCATTCTTGGAGCTATTAATTTTATCACCACAATTATTAACATAAAACCTCCTGCAATATCTCAATACCAAATTCCCTTGTTCGTATGATCTGTACTAATTACAGCAGTCCTCCTACTACTATCGCTACCAGTCTTAGCAGCC---GGCATTACTATATTACTTACAGATCGAAATCTAAATACAACATTCTTCGATCCTGCTGGAGGAGGTGACCCTATTTTATATCAGCACTTATTCTGATTCTTCGGACATCCTGAGGTATACATCCTAATTCTACCAGGATTCGGAATGATTTCACACATCGTCACCTACTACTCAGGAAAAAAA---GAACCTTTCGGCTATATAGGAATAGTCTGAGCAATAATATCTATCGGCTTCTTGGGCTTCATTGTATGAGCCCACCATATATTTACTGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monachus schauinslandi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A3ce+4ce

Version
3.1

Year Assessed
2008

Assessor/s
Lowry, L. & Aguilar, A. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its relatively small population size, ongoing precipitous decline in numbers in spite of considerable conservation effort, and continuing threats from a variety of sources, the Hawaiian Monk Seal should be upgraded to Critically Endangered (CR).

IUCN Evaluation of the Hawaiian Monk Seal, Monachus schauinslandi
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Most Hawaiian Monk Seals occur in the northwestern Hawaiian Islands (NWHI), and their population biology has been studied in detail there since 1983. In recent years, monk seals have been seen in increasing numbers in the main Hawaiian Islands (MHI), but the number of animals is relatively small and data about them are limited. In this evaluation, assessments of past abundance and projections of future abundance will therefore be based solely on the NWHI.

Based on the age distribution of the population and age-specific reproductive rates, the generation time for Hawaiian Monk Seals is 15 years. A comparison of the only available historical count (916 seals in 1958) to the most recent comparable count (293 seals in 2007) indicates a decline of 68% over 49 years. However, the causes for the reduction are not clearly reversible or understood, and have not ceased, so this criterion is not applicable.


A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

An estimate of the reduction in Hawaiian monk seal abundance in the past 49 years is 68% based on direct observation. While that interval is slightly more than three generations, the degree of reduction over the past 45 years has certainly been more than 50%. The causes of the reduction have not ceased, are not fully understood, and may not be reversible. This meets criterion A2(a) for Endangered.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A detailed stochastic simulation model of the population projects that the population will decline 96% from its current (2007) abundance within the next 45 years (from 935 to 37). The likely causes of this decline will be changes in habitat quality, and effects of pathogens, competitors, or predators. This meets criterion A(3)(c and e) for Critically Endangered (CR).

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Monk seal abundance in the NWHI declined 37% (from 1,488 to 935) from when detailed population monitoring began (1983) to the present (2007). A future population reduction is projected based on continuing low juvenile survival and the age/sex structure of the remaining population. Projecting from 2007 to 2028 (three generations from the initial count) predicts a likely reduction in population size to 201, 86% lower than the 1983 estimate. The likely causes of the future decline will be changes in habitat quality, and effects of pathogens, competitors, or predators. This meets criterion A(4)(c and e) for Critically Endangered (CR).

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
EOO for Hawaiian Monk Seals is > 20,000 km²

B2. Area of occupancy (AOO): CR
AOO for Hawaiian Monk Seals is > 2,000 km²

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The number of mature Hawaiian Monk Seal in the NWHI was 546 in 2007. The number of mature seals in the MHI has not been directly enumerated, but is estimated to be about 45 if the age structure in the MHI is similar to the NWHI. An estimate of the total number of mature individuals is then 591.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)

The Hawaiian monk seal population in the NWHI has declined by 37% in the past 24 years (1983-2007; 1.6 generations). This meets criterion C1 for Endangered.

C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90?100%; EN = 95?100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The number of mature individuals in the Hawaiian Monk Seal population was approximately 591 in 2007. This meets the criterion for Vulnerable.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

A formal quantitative analysis of the probability of extinction of Hawaiian Monk Seals has not been conducted.

Listing recommendation ? The Hawaiian Monk Seal population is greatly reduced in size from historical levels, has been declining in abundance since at least 1958, and will without question continue to decline for some time into the future. The causes for the decline are only partially understood, have not ceased, and may not be reversible. The number of mature individuals within the population is currently only about 600. The total number of animals in the northwestern Hawaiian Islands, their core range, could drop to about 200 within the next 20 years. The Hawaiian Monk Seal qualifies for listing as Vulnerable under IUCN criterion D, for Endangered under criteria A2a and C1, and CR (Critically Endangered) under criteria A3ce and A4ce. Hawaiian Monk Seals should be listed as Critically Endangered (CR).

History
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Endangered
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Hawaiian monk seals have been on the United States Fish and Wildlife Service’s endangered species list since November 23, 1976 and are listed as critically endangered on the IUCN Red List of Threatened Species. They have been in decline for over 20 years, and as of 2007, only 1200 individuals remained in the wild. Experts estimate that fewer than 1000 individuals will remain in the wild by the end of 2012. Efforts by the National Marine Fisheries Service to stabilize population numbers include keeping tourists away from known reproductive sites, moving aggressive males to new breeding grounds, and implementing a captive care program, which provides females with nutritional supplements. The goal of the captive care program is to increase the survival rate of female juvenile seals, which have an extremely low survival rate. Hawaiian monk seals are vulnerable to introduced disease, inbreeding depression, low genetic diversity, human disturbance, and competition with fisheries. In addition to the U.S. Fish and Wildlife Service’s Endangered Species Act, they are also protected under the Marine Mammal Protection Act.

Hawaiian monk seals are intolerant of human disturbance on beaches used for birthing and resting, and pup mortality is often higher at disturbed sites. Hawaiian monk seals began declining in the mid to late 1800’s, when they were hunted for their meat and skins. Currently, populations are declining due to over fishing and seals becoming hooked or entangled in fishing gear (Antonelis et al., 2003).

US Federal List: endangered

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Small range in Hawaiian Islands; small number of major pupping sites; low declining numbers of breeding females, despite intensive management in recent decades, threatened by very low survival of juveniles and subadults due to starvation (believed to be principally related to food limitation), entanglement of seals in marine debris, and predation; human interactions in the main Hawaiian Islands, including recreational fishery interactions, mother-pup disturbance on popular beaches, and exposure to disease, are negatively affecting the population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/23/1976
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Monachus schauinslandi , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Monk seals in the northwestern Hawaiian Islands are well studied, with nearly all animals individually identifiable (through natural marks or flipper tags) and observed each year (Baker 2006). Less is known about the population biology of seals in the main Hawaiian Islands. The status of the Hawaiian monk seal through to 2006 was reviewed in detail in the recently revised Recovery Plan for the species (National Marine Fisheries Service 2007). For this IUCN review process, the Plan?s data were updated to include all information from 2007 and additional analyses were conducted by scientists from the National Marine Fisheries Service?s Pacific Islands Fisheries Science Center (Albert Harting, Thea Johanos-Kam, and Jason Baker, personal communication).

Female monk seals first give birth at five to ten years old. Births occur during all months of the year, with a peak in March-April. Age specific fecundity rates for mature animals are relatively low, 50-70%, and appear to differ among atolls (Harting et al. 2007). Males in this polygynous species patrol the water adjacent to rookeries, or haul-out near females with pups. Male dominated sex ratios have occurred at some colonies, and that has resulted in mobbing of estrus females that have been severely injured or killed in such events (NMFS 2007).

The generation time for Hawaiian monk seals, estimated as the average age of reproducing individuals, is 15 years. The best estimate of the total number of seals of all age classes in the northwestern Hawaiian Islands in 2007 is 935, with 546 of them being sexually mature. Adding to this a minimum estimate of 77 seals of all ages in the main Hawaiian Islands (not including Niihau) indicates a total population size of approximately 1,012, of which approximately 591 are sexually mature (assuming the age structure is similar in the northwestern and main Hawaiian Islands).

The earliest information on monk seal abundance comes from 1958 (Kenyon and Rice 1959, Rice 1960). These early data were not an estimate of total population size. They were counts of animals (not including pups) on beaches at a particular time, summed. Seals that were not hauled out at the time researchers visited the islands were not enumerated. Comparing the 1958 count (916 animals) to a beach count using similar methods in 2007 (293) suggests that the population has declined by 68% in 49 years.

Since 1983 the abundance of monk seals in the northwestern Hawaiian Islands has been estimated each year by having researchers spend enough time at each atoll to individually identify and count all, or nearly all, seals using that location. The total abundance estimate for 1983 was 1,488, which when compared to the total abundance estimate of 935 for 2007 indicates a decline of 37% in 24 years.

Since 1999 the population has been declining at a rate of 4.1% per year. Because detailed data are available on survival, reproduction, and age-structure of the population it is possible to use a stochastic simulation model (Harting 2002) to project likely abundances in the future. Using the model to project abundance three generations forward from the 1983 estimate (to 2028) predicts an overall reduction of 86% (from 1,488 to 201). Projecting abundance three generations forward from the most recent estimate (from 2007 to 2052) predicts a decline of 96% (from 935 to 37). These projections are derived using estimates of demographic rates from recent years and assume that those rates are representative of future conditions. Any changes in those rates (whether positive or negative) will of course alter the predicted trajectories.

Based on recorded births of pups, monk seal numbers in the main Hawaiian Islands appear to have increased in recent years (Baker and Johanos 2004). However, the number of animals in the main Islands is small, and the current status of the species depends primarily on the situation in the northwestern Hawaiian Islands.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 30-70%

Comments: Population size in the northwestern Hawaiian Islands is declining, while range and population size in the main Hawaiian Islands are increasing; overall the population is declining (NMFS 2007). Modeling predicts that the population will fall below 1,000 animals in the next five years (NMFS 2007). During the period 1998-2006, the nonpup population at the six major reproductive sites in the northwestern Hawaiian Islands declined by an average of 3.9 percent per year (NMFS 2007).

Global Long Term Trend: Decline of 50-70%

Comments: The species declined by about 50 percent between the late 1950s and the mid-1970s, and beach counts of nonpups (juveniles, sub-adults and adults) declined by 66 percent between 1958 and 2006 (NMFS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Recovery of Hawaiian monk seals has been affected to an unknown degree by disturbance from military activities in the northwestern Hawaiian Islands including the alteration, development and occupation of bases on several key islands that started before World War II (Ragen and Lavigne 1999). However, the military has left the area and the vast majority of monk seals live where they are isolated from most direct human contact. The only permanent structures remaining in the northwestern Hawaiian Islands are U.S. Fish and Wildlife Service facilities at Tern Island and Midway Atoll and remnants of former Coast Guard facilities at Kure Atoll.

Current threats to monk seals are thoroughly reviewed and analyzed in NMFS (2007). The most crucial threats in the northwestern Hawaiian Islands at this time are: 1) food limitation that could be due to changes in oceanographic conditions, competition with fisheries, or competition with other predators; 2) entanglement in marine debris, largely fragments of net and line discarded by North Pacific fisheries; and 3) predation by sharks, especially on pre-weaned and recently weaned pups. An emerging threat in this region may be the loss of terrestrial habitat due to sea level increases resulting from global warming (Baker et al. 2006). The situation in the main Hawaiian Islands is somewhat different, with the main threats there being: 1) interactions with recreational fishing gear especially hookings and entanglements in gillnets; 2) possible transmission of diseases from domestic pets and livestock to seals; and 3) disturbance of seals that haul out on beaches heavily used by people.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Primary threats in the northwestern Hawaiian Islands are 1) food limitation that could be due to changes in oceanographic conditions, competition with fisheries, or competition with other predators; 2) entanglement in marine debris, and 3) predation by sharks, especially on pre-weaned and recently weaned pups. An emerging threat in this region may be the loss of terrestrial habitat due to sea level increases resulting from global warming (Baker et al. 2006). Primary threats on main Hawaiian Islands are 1) interactions with recreational fishing gear, 2) possible transmission of diseases from domestic pets and livestock to seals, and 3) disturbance of seals that haul out on beaches heavily used by people. [NMFS 2007]

Potential disease outbreaks could have a devastating effect due to the currently small population size and limited geographic range. Due to low juvenile survival and an aging, breeding female population, the breeding female population is declining and birth rates will continue to decline.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

During the 1800s, Hawaiian monk seals were persecuted for their meat, hides and oil; their habitat was also disturbed by bird guano and feather collectors (6). Despite protection, numbers of these seals continue to decline; an average decline of 3% a year occurred between 1985 and 1999 (6). A lack of food resources, especially around French Frigate Shoals has been cited as the cause of high juvenile mortality and the presence of severely emaciated individuals (7). In addition, entanglement in marine debris that accumulates in these islands from vast areas of the Pacific, as well as disturbance, further threatens this species (6). Non-human threats such as predation by sharks and the prevalence of violent 'mobbing' behaviour of mature males, also play a part in the decline of monk seal numbers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Hawaiian monk seal has been listed as endangered under the U.S. Endangered Species Act since 1976. That law contains a number of provisions to protect the seals and their critical habitat. They are also covered by a general prohibition against unpermitted taking by the U.S. Marine Mammal Protection Act of 1973. It is listed on CITES Appendix I.

Virtually all of the land and waters in the northwestern Hawaiian Islands is included in one or more protected areas (the Northwestern Hawaiian Islands State Marine Refuge, the Kure Atoll State Wildlife Refuge, the Hawaiian Islands National Wildlife Refuge, the Midway Atoll National Wildlife Refuge, the Northwestern Hawaiian Islands Coral Reef Ecosystem Reserve and the Papahanaumokuakea Marine National Monument) where human activities that could effect the seals or their habitats are either prohibited or strictly controlled.

Numerous efforts have been undertaken to identify sources of mortality for monk seals and to take management actions to mitigate factors that may be causing the continued population decline and preventing recovery (NMFS 2007). Important management efforts include: 1) cleaning up of marine debris and toxic chemicals; 2) minimizing human activities that could disturb seals hauled out on beaches; 3) removal of sharks suspected to be preying on seals; 4) translocation of adult males to adjust the sex ratio where mobbing was a problem; and 5) regulating fisheries to reduce the likelihood of direct and indirect interactions. In spite of these efforts the population has continued to decline. With the current low abundance, low survival rates, and declining trend there is a real chance that this species will go extinct in the foreseeable future. For that reason plans are being made to develop a facility where young seals can be cared for in captivity for a period of time in hopes that when they are released back to the wild they may have a better chance for survival.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: Main Hawaiian Islands could support a larger population of seals if appropriate management actions were in place (NMFS 2007).

Biological Research Needs: See management information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: See management information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Hawaiian monk seal has been listed on the United States Endangered Species List since 1976 and the National Marine Fisheries Service (NMFS) is responsible for the management of the population (7). Major colonies are surveyed annually and beach counts help to give an indication of the state of each breeding population (7); flipper tagging has been carried out since the early 1980s (6). The Northwest Hawaiian Islands lobster fishery was closed in 2000, and this may help to increase prey availability (6). In 2000, the Northwestern Hawaiian Islands Coral Reef Ecosystem Reserve was established, which should help to protect the habitat of this unique seal (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Present day Hawaiian monk seal populations represent a fraction of their historical abundances. Although recovery efforts are now underway, the total cost of these efforts over the next 50 years is estimated to be about 385 million dollars. Also, in compliance with the National Marine Fisheries Service recovery plan for Hawaiian monk seals, important feeding and reproductive sites, typically beaches, have been closed to public access. Finally, they occasionally remove fish from commercial trolling lines.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Currently, Hawaiian monk seals have little to no economic importance. However, during the mid-19th century, when Hawaii was first claimed by the United States, Hawaiian monk seals were killed for their skin, oil, and meat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Relatively unwary, exploited historically, mainly by Europeans in ships.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Four key actions are required to alter the trajectory of the Hawaiian monk seal population and to move the species towards recovery (NMFS 2007): 1. Improve the survivorship of females, particularly juveniles, in subpopulations in the northwestern Hawaiian Islands (NWHI). To do this requires the following: maintaining and enhancing existing protection and conservation of habitat and prey base; targeting research to better understand the factors that result in poor juvenile survival; intervening where appropriate to ensure higher survival of juvenile and adult females; continuing actions to protect females from individual and multiple male aggression and to prevent excessive shark predation; and continuing actions to remove marine debris and reduce mortality of seals due to entanglement. 2. Maintain the extensive field presence during the breeding season in the NWHI. Field presence is critical not just to the monitoring and research efforts, but also to carry out the active management and conservation of Hawaiian monk seal subpopulations in these areas. 3. Ensure the continued natural growth of the Hawaiian monk seal in the main Hawaiian Islands (MHI) by reducing threats including interactions with recreational fisheries, disturbance of mother-pup pairs, disturbance of hauled out seals, and exposure to human and domestic animal diseases. This should be accomplished with coordination of all federal, state, local and nongovernment parties, volunteer networks, and increased outreach and education in order to develop a culture of co-existence between humans and seals in the MHI. 4. Reduce the probability of the introduction of infectious diseases into the Hawaiian monk seal population.

NMFS (2007) listed the following 14 categories of actions as necessary for the recovery of the Hawaiian monk seal: 1 Investigate and mitigate factors affecting food limitation 2. Prevent entanglements of monk seals. 3. Reduce shark predation on monk seals. 4. Minimize the risk of exposure to or spread of infectious disease. 5. Conserve Hawaiian monk seal habitat. 6. Reduce Hawaiian monk seal interactions with fisheries. 7. Reduce male aggression toward pups/immature seals and adult females. 8. Reduce the likelihood and impact of human interactions. 9. Investigate and develop response to biotoxin impacts. 10. Reduce impacts from compromised and grounded vessels. 11. Reduce the impacts of contaminants. 12. Continue population monitoring and research. 13. Create and implement a main Hawaiian Islands Hawaiian Monk Seal. Management Plan. 14. Implement the Recovery Plan for the Hawaiian Monk Seal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hawaiian monk seal

The Hawaiian monk seal, Monachus schauinslandi, is an endangered species of earless seal in the Phocidae family that is endemic to the Hawaiian Islands.[2]

They are solitary animals, like some monks. The Hawaiian monk seal is one of two remaining monk seal species; the other is the Mediterranean monk seal. A third species, the Caribbean monk seal, is extinct.[3]

The Hawaiian monk seal is the only seal native to Hawaii.[4]

These monk seals are a conservation reliant endangered species. The small population of about 1,100 individuals is threatened by human encroachment, very low levels of genetic variation, entanglement in fishing nets, marine debris, disease, and past commercial hunting for skins. There are many methods of conservation biology when it comes to endangered species; translocation, captive care, habitat clean up, and educating the public about the Hawaiian monk seal are some of the methods that can be employed.[5][6][7]

Etymology

Known to native Hawaiians as ʻIlio-holo-i-ka-uaua, or "dog that runs in rough water", its scientific name is from Hugo Hermann Schauinsland, a German scientist who discovered a skull on Laysan Island in 1899.[8] Its common name comes from short hairs on its head, said to resemble a monk.[3]

Description

Its grey coat, white belly, and slender physique distinguish them from their cousin, the Harbor seal (Phoca vitulina’’).[3] The monk seal’s physique is ideal for hunting its prey: fish, lobster, octopus and squid in deep water coral beds.[9] When it is not hunting and eating, it generally basks on the sandy beaches and volcanic rock of the Northwest Hawaiian Islands.[10]

The Hawaiian monk seal is part of the Phocidae family, being named so for its characteristic lack of external ears and inability to rotate its hind flippers under the body.[11] The Hawaiian monk seal has a relatively small, flat head with large black eyes, eight pairs of teeth, and short snouts with the nostril on top of the snout and vibrissae on each side.[3] The nostrils are small vertical slits which close when the seal dives underwater. Additionally, their slender, torpedo-shaped body and hind flippers allow them to be very agile swimmers.[12]

Adult males are 300 to 400 pounds (140 to 180 kg) in weight and 7 feet (2.1 m) in length while adult females tend to be slightly larger, at400 to 600 pounds (180 to 270 kg) pounds and 8 feet (2.4 m) feet in length. When monk seal pups are born, they average 30 to 40 pounds (14 to 18 kg) and 40 inches (1.0 m) in length. As they nurse for approximately six weeks, the grow considerably, eventually weighing between 150 to 200 pounds (68 to 91 kg) by the time they are weaned, while the mother loses up to 300 pounds (140 kg).

Monk seals, like elephant seals, shed their hair and the outer layer of their skin in an annual catastrophic molt. During the most active period of the molt, about 10 days for the Hawaiian monk seal,[13] the seal remains on the beach. The hair, generally dark gray on the dorsal side and lighter silver ventrally, gradually changes color through the year with exposure to atmospheric conditions. Sunlight and seawater cause the dark gray to become brown and the light silver to become yellow-brown, while long periods of time spent in the water can also promote algae growth, giving many seals a green tinge. The juvenile coat of the monk seal, manifest in a molt by the time a pup is weaned is silver-gray; pups are born with black pelage. Many Hawaiian monk seals sport scars from shark attacks or entanglements with fishing gear. Maximum life expectancy is 25 to 30 years.

Evolution and migration

Photo of seal on the beach, looking directly at the photographer
Hauled-out seal

The evolutionary history of the monk seal is controversial, including multiple hypotheses for the phylogenetic to other phocids.[14] Due to the absence of fossil records, little evidence indicates that the Hawaiian monk seal is related to other seals in the family.

Based on its prehistoric and unspecialized skeletal and vascular anatomy, the Hawaiian monk seal is considered the most primitive of living seals and that descends from the Caribbean species, M. tropicalis; all three species originated in the North Atlantic separated from its congeners as early as 15 million years ago.[14]

In an effort to inform the public and conserve the seals, the National Oceanic Atmospheric Administration (NOAA) Fisheries Service developed a historical timeline to demonstrate that the Hawaiian islands has been home to the seals for millions of years and that the seals belong there. Evidence points to monk seals migrating to Hawaii between 4-11 million years ago (mya) through an open water passage between North and South America called the Central American Seaway.[citation needed] The Isthmus of Panama closed the Seaway approximately 3 million years ago.

Berta and Sumich ask how this species came to the Hawaiian Islands when its closest relatives are on the other side of the world in the North Atlantic and Mediterranean Sea.[15] No one knows whether the Hawaiian is the oldest or the youngest seal in the Monachus genus.[15] The species may have evolved in the Pacific or Atlantic, but in either case, came to Hawaii long before the first Polynesians.

Ecology

Habitat

A Hawaiian monk seal observed in Kauai.
A Hawaiian monk seal observed in Kauai.

The majority of the Hawaiian monk seal population can be found around the Northwest Hawaiian Islands but a small and growing population lives around the main Hawaiian Islands.[10] These seals spend two-thirds of their time at sea. Early studies (done at Midway Atoll) concluded that they frequently stayed inside the lagoons as opposed to the deep ocean, because of the larger abundance of fish found in their coral reefs.[12] However, recent use of animal-born video imaging, temperature/depth recorders, and satellite telemetry has shown that monk seals actually spend much more time foraging in deeper water outside the reefs at subphotic depths of 300 metres (160 fathoms) or more.[16][17] Hawaiian monk seals breed and haul-out on sand, corals, and volcanic rock; sandy beaches are more commonly used for pupping.[10] Due to the immense distance separating the Hawaiian Islands from other land masses capable of supporting the Hawaiian monk seal, its habitat is limited to the Hawaiian Islands.

Feeding

Hawaiian monk seals mainly prey on teleosts (bony fish), but they also prey on cephalopods, and crustaceans.[9] Both juveniles and sub-adults prey more on smaller octopi species, such as Octopus leteus and O. hawaiiensis, nocturnal octopi species, and eels than the adult Hawaiian monk seals.[9] While, adult seals feed mostly on larger octopi species such as O. cyanea. Hawaiian monk seals have a broad and diverse diet due to foraging plasticity which allows them to be opportunistic predators that feed on a wide variety of available prey.[9]

Predators

Tiger sharks and Galapagos sharks are both predators.[18]

Behavior

Reproduction

Hawaiian monk seals mate in the water during their breeding season, which occurs between December and August.[3] Females reach maturity at age four and bear one pup a year. The fetus takes nine months to develop, with birth occurring in March and June. Pups start around 16 kilograms (35 lb) and are about 1 metre (3 ft 3 in) long.[3] Pups are born with a black coat which they shed at about six weeks and replace it with a gray coat on the back and white on the belly.[12]

Nursing

The pups are born on beaches and nursed for about six weeks. The mother does not eat or leave the pup while nursing. After that time, the mother deserts the pup, leaving it on its own, and returns to the sea to forage for the first time since the pup’s arrival.[12]

Status

A Hawaiian monk seal observed on the North Shore of Oahu.
A Hawaiian monk seal observed on the North Shore of Oahu, near Waimea Bay.

Most seals are on Laysan, Midway, Pearl and Hermes Atoll, French Frigate Shoals, and Lisianski.[19]

The Hawaiian monk seal is critically endangered,[20] although its cousin species the Mediterranean monk seal (M. monachus) is even rarer, and the Caribbean monk seal (M. tropicalis), last sighted in the 1950s, was officially declared extinct in June 2008.[21] The population of Hawaiian monk seals is in decline. In 2010, it was estimated that only 1100 individuals remained. The larger population that inhabits the northwest islands is declining.[citation needed]

Seals nearly disappeared from the main Hawaiian Islands, but the population has begun to recover. The growing population there was approximately 150 as of 2004.[19] Individuals have been sighted in surf breaks and on beaches in Kauaʻi, Niʻihau and Maui. In early June 2010, 2 seals hauled out on Oʻahu's popular Waikiki beach. Seals hauled out at O'ahu's Turtle Bay,[22] and again beached at Waikiki on March 4, 2011, by the Moana Hotel. In 2006, twelve pups were born in the main Hawaiian Islands, rising to thirteen in 2007, and eighteen in 2008. As of 2008 43 pups had been counted in the main Hawaiian islands.[23]

The Hawaiian monk seal was officially designated as an endangered species on November 23, 1976, and is now protected by the Endangered Species Act and the Marine Mammal Protection Act. It is illegal to kill, capture or harass a Hawaiian monk seal. Even with these protections, human activity along Hawaii's fragile coastlines (and in the world at large) still provides many stressors.[24]

Threats

Underwater photo of seal in profile with open eye and an apparent smile
Hawaiian monk seal

Natural factors threatening the Hawaiian monk seal include low juvenile survival rates, reduction of habitat/prey associated with environmental changes, increased male aggression, and subsequent skewed gender ratios.[25] Anthropogenic or human impacts include hunting (during 1800s and 1900s) and the resulting small gene pool, continuing human disturbance, entanglement in marine debris, and fishery interactions.[25] Predation is only one of many threats.

Natural threats

Low juvenile survival rates continue to threaten the species. High juvenile mortality is due to starvation and marine debris entanglement.[6] Another contributor to the low juvenile survival rates is the predation from sharks, including tiger sharks. Most mature monk seals bear scars from shark encounters—many such attacks have been observed.[25]

Reduced prey abundance can lead to starvation. A reduction in habitat associated with environmental changes is one cause.[25] Habitat is shrinking due to erosion in the Northwest Hawaiian Islands, reducing the islands/beaches.[25] Lobsters, the seals' preferred food other than fish, have been overfished. Competition from other apex predators such as sharks, jacks, and barracudas, leaves little for developing pups. The creation of Papahānaumokuākea Marine National Monument which encloses these islands may expand food supplies.

Mobbing is a practice among the seals that involves multiple males attacking one female in mating attempts. Mobbing is responsible for many deaths especially to females.[26]

Mobbing leaves the targeted individual with wounds that increase vulnerability to septicemia, killing the victim via infection.[26] Smaller populations were more likely to experience mobbing as a result of the higher male/female ratio and male aggression. Unbalanced sex-ratios were more likely to occur in slow-growing populations.[27][28]

One infectious pathogen found in Hawaiian waters is ciguatera. Further, postmortem examinations of some seal carcasses revealed gastric ulcerations caused by parasites.[29]

Anthropogenic Impacts

In the nineteenth century, large numbers of seals were clubbed to death by whalers and sealers for meat, oil and skin.[30] U.S. military forces hunted them during World War II, while occupying Laysan Island and Midway.[30]

The Hawaiian monk seal has the lowest level of genetic variability among the 18 pinniped species.[6] This low genetic variability was allegedly due to a population bottleneck caused by intense hunting in the 19th century.[6] This limited genetic variability reduces the species ability to adapt to environmental pressures and limits natural selection thus increasing their risk of extinction.[6] Given the monk seal's small population, the effects of disease could be disastrous.

Monk seals are dying from the toxoplasmosis pathogen in cat feces that enters the ocean in polluted runoff and watewater, a new phenomenon.[31] Over the past ten years, toxoplasmosis killed at least four seals. Other human-introduced pathogens, including leptospirosis, have infected monk seals.[31]

Human disturbances have had immense effects on the populations of the Hawaiian monk seal. Monk seals tend to avoid beaches where they are disturbed; after continual disturbance the seal may completely abandon the beach, thus reducing its habitat size, subsequently limiting population growth. For instance, large beach crowds and beach structures limit the seal’s habitat.[5][25][31] Although the WWII military bases in the northwestern islands were closed, minimal human activities can be enough to disturb the species.[25]

Marine fisheries can potentially interact with monk seals via direct and indirect relationships. Directly the seal can become snared by fishing equipment, entangled in discarded debris, and even feed on fish refuse.[25]

Entanglement can result in mortality because the seals get trapped in marine debris such as fishing nets and cannot maneuver or even reach the surface to breathe.[6] International law prohibits the intentional discarding of debris from ships at sea. Monk seals have one of the highest documented rates of entanglement of any pinniped species.[25]

Conservation

Reversing the population decline hinges on a comprehensive, scientifically sound characterization and mitigation of relevant natural and anthropogenic factors along with better understanding of the species' particular vulnerabilities.[25]

Genetic data analysis is needed because identifying individuals genetically along with confirming maternity and paternity can provide information about male and female reproductive rates which are crucial to wildlife managers.[7]

In 1909, President Theodore Roosevelt created the Hawaiian Islands Reservation that included the Northwest Hawaiian islands. The Reservation later became the Hawaiian Islands National Wildlife Refuge (HINWR) and moved under the jurisdiction of the U.S. Fish and Wildlife Service (USFWS).[25] This marine sanctuary greatly benefited the seals.[citation needed]

To raise awareness of the species' plight, the Hawaiian monk seal was declared Hawaii's official State Mammal on June 11, 2008.[32]

Public outreach and education remain the most powerful tools for promoting the conservation of the Hawaiian monk seal and its habitat.[citation needed]

NOAA cultivated a network of volunteers to protect the seals while they bask or bear and nurse their young. NOAA is funding considerable research on seal population dynamics and health in conjunction with the Marine Mammal Center.

Protecting female pups

One key natural factor affecting the seal populations is the male-biased sex-ratio, which results in increased aggressive behaviors such as mobbing.[27] These aggressive behaviors decrease the number of females in the population. Two programs effectively aid female survival rates.

Project “Headstart” began in 1981, collected and tagged female pups after weaning, and placed them in a large, enclosed water and beach area with food and lacking disturbances.[33] The female pups remain during the summer months, leaving at roughly age three to seven months.

Another project began in 1984 at French Frigate Shoals. It collected severely underweight female pups, placed them in protective care and fed them. The pups were released as yearlings and relocated to the Kure Atoll.[33]

Some habitats are better suited to increase survival probability making relocation a popular and promising method.[7] Although no direct links between infectious diseases and seal mortality rates have been found, unidentified infectious diseases could prove detrimental to relocation strategies.[34] Identification and mitigation of these and other possible factors (e.g., disease) limiting population growth represent ongoing challenges and are the primary objectives of the Hawaiian monk seal conservation and recovery effort.[29]

Draft environment impact statement

In 2011, the National Marine Fisheries Service issued a controversial draft programmatic environmental impact statement intended to improve protections for the monk seal.[35] The plan includes:

  • Expanded surveys using technology such as remote cameras and unmanned, remotely operated aircraft.
  • Vaccination studies and vaccination programs.
  • De-worming program to improve juvenile survival.
  • Relocation to the Northwestern Hawaiian Islands.
  • Diet supplements at feeding stations in the Northwestern Hawaiian Islands.
  • Tools to modify undesirable contact with people and fishing gear in the main Hawaiian Islands.
  • Chemical alteration of aggressive monk seal behavior.

See also

References

  1. ^ Lowry, L. & Aguilar, A. (2008). Monachus schauinslandi. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 January 2009. Listed as Critically Endangered (CR A3ce+4ce)
  2. ^ "Hawaiian Monk Seal, Monachus schauinslandi". monachus-guardian.org. 2006. http://www.monachus-guardian.org/factfiles/hawai01.htm. Retrieved 2011-05-23. 
  3. ^ a b c d e f "Hawaiian Monk Seal (Monachus schauinslandi)". NOAA Fisheries Office of Protected Resources. http://www.nmfs.noaa.gov/pr/species/mammals/pinnipeds/hawaiianmonkseal.htm. Retrieved 2011-03-11. 
  4. ^ Nitta, Eugene; Henderson JR (1993). "A review of interactions between Hawaii's fisheries and protected species". Marine Fisheries Review. 83 55 (2). http://spo.nmfs.noaa.gov/mfr552/mfr55210.pdf. Retrieved 2011-05-23. 
  5. ^ a b Boland, R; Donohue, R (2003). "Marine Debris Accumulation in the Nearshore Marine Habitat of the Endangered Hawaiian Monk Seal, Monachus Schauinslandi". Marine Pollution Bulletin. 11 46: 1385-139. doi:10.1016/S0025-326X(03)00291-1. http://www.sciencedirect.com/science/article/pii/S0025326X03002911. Retrieved 2011-05-23. 
  6. ^ a b c d e f Schultz J; Baker J, Toonen R, Bowen B (2009). "Extremely Low Genetic Diversity in the Endangered Hawaiian Monk Seal (Monachus Schauinslandi)". Journal of Heredity. 1 100 (1): 25–33. doi:10.1093/jhered/esn077. http://jhered.oxfordjournals.org/content/100/1/25.full. Retrieved 2011-05-23. 
  7. ^ a b c Schultz, J; Baker J, Toonen R, Bowen B (2011). "Range-Wide Genetic Connectivity of the Hawaiian Monk Seal and Implications for Translocation". Conservation Biology. 1 25: 124–132. doi:10.1111/j.1523-1739.2010.01615.x. PMID 21166713. 
  8. ^ Reeves, RR; Stewert, BS (2002). National Audubon Society Guide to Marine Mammals of the World. ISBN 978-0-375-41141-0. 
  9. ^ a b c d Goodman-Lowe, GD (1998). "Diet of the Hawaiian Monk Seal (Monachus Schauinslandi) from the Northwestern Hawaiian Islands during 1991 to 1994". Marine Biology. 3 132: 535–46. http://www.csulb.edu/~ggoodman/files/DietHMS.pdf. Retrieved 2011-05-23. 
  10. ^ a b c Baker, J (2004). "Abundance of the Hawaiian Monk Seal in the Main Hawaiian Islands". Biological Conservation. 1 116: 103–10. 
  11. ^ Gilmartin, William; Forcada, J. (2002). "Monk Seals". Encyclopedia of Marine Mammals, eds: 756–759. 
  12. ^ a b c d Kenyon, KW; Rice, DW. "Life History Of the Hawaiian Monk Seal". Pacific Science 13. http://scholarspace.manoa.hawaii.edu/handle/10125/7958. Retrieved 2011-05-23. 
  13. ^ Perrin, William F.; Bernd Wursig; J. G. M. Thewissen (24 November 2008). Encyclopedia of Marine Mammals. Academic Press. p. 741. ISBN 978-0-12-373553-9. http://books.google.com/books?id=2rkHQpToi9sC&pg=PA741. Retrieved 26 May 2011. 
  14. ^ a b Repenning, CA; Ray, CE (1977). "The origin of the Hawaiian monk seal". Proc. Biol. Soc. Wash 89: 667–688. 
  15. ^ a b Berta, Annalisa; Sumich, James L (1999). "Marine Mammals". Evolutionary Biology (Academic Press). 
  16. ^ Parrish, FA; Littnan, CL (2008). "Changing perspectives in Hawaiian monk seal research using animal-borne imaging". Marine Technology Society Journal 41 (4): 30–34. http://www.pifsc.noaa.gov/library/pubs/Parrish_MTSJ_2008.pdf. Retrieved 2011-05-23. 
  17. ^ Parrish, Frank A (1999). "Use of Technical Diving to Survey Forage Habitat of the Endangered Hawaiian Monk Seal.". In: Hamilton RW, Pence DF, Kesling DE, eds. Assessment and Feasibility of Technical Diving Operations for Scientific Exploration. (American Academy of Underwater Sciences). http://archive.rubicon-foundation.org/9003. Retrieved 2011-05-23. 
  18. ^ Bertilsson-Friedman, P (2006). "Distribution and Frequencies of Shark-inflicted Injuries to the Endangered Hawaiian Monk Seal (Monachus Schauinslandi)". Journal of Zoology 268 (4): 361–68. doi:10.1111/j.1469-7998.2006.00066.x. 
  19. ^ a b Ellis, Richard (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. pp. 195. ISBN 0-06-055804-0. 
  20. ^ "The Captive Care and Release Research Project Seeks to Aid Recovery of the Endangered Hawaiian Monk Seal". NOAA. http://www.pifsc.noaa.gov/psd/captivecareproject.php. Retrieved 2011-05-23. 
  21. ^ Associated Press (2008-06-09). "Feds: Caribbean Monk Seal Officially Extinct". Fox News. http://www.foxnews.com/story/0,2933,364241,00.html. Retrieved 2011-05-23. 
  22. ^ Campaign to Protect Turtle Bay (HI)[dead link]
  23. ^ Wianecki, Shannon. "Rough Water Pups". Maui Magazine. http://www.mauimagazine.net/Maui-Magazine/May-June-2009/Rough-Water-Pups. Retrieved 2011-05-23. 
  24. ^ Weber, Gretchen. "A struggle to survive: Environmental threats endanger monk seals". PBS. http://www.pbs.org/kqed/oceanadventures/episodes/kure/oceanscience.html. Retrieved 2011-05-23. 
  25. ^ a b c d e f g h i j k Antonelis, GA; et. al. (2006). "Hawaiian monk seal (Monachus schauins-landi): status and conservation issues". Atoll Res Bull 543: 75–101. 
  26. ^ a b Banish, LD; Gilmartin, WG (1992). "Pathological findings in the Hawaiian monk seal". Journal of Wildlife Diseases 28 (3): 428–434. PMID 1512875. http://www.jwildlifedis.org/cgi/reprint/28/3/428. Retrieved 2011-05-23. 
  27. ^ a b Starfield, AM; Roth JD, Ralls K (1995). "Mobbing in Hawaiian monk seals: the value of simulation modeling in the absence of apparently crucial data". Conserv. Biol 9: 166–174. JSTOR 2386398. 
  28. ^ "Hawaiian Monk Seals". earthtrust.org. http://www.earthtrust.org/wlcurric/seals.html. Retrieved 2011-05-23. 
  29. ^ a b Gilmartin, WG (1983). Recovery plan for the Hawaiian monk seal, Monachus schauinslandi. U.S. Department of Commerce, NOAA, National Marine Fisheries Service. 
  30. ^ a b Ellis, Richard (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. pp. 194. ISBN 0-06-055804-0. 
  31. ^ a b c Dawson, Teresa. "A New Threat to Hawaiian Monk Seals: Cat Parasite Carried by Runoff, Sewage — Environmental Health News". Environmental Health News: Front Page. http://www.environmentalhealthnews.org/ehs/news/hawaiian-monk-seals. Retrieved 2011-03-16. 
  32. ^ Gladden, Tracy. "Hawaiian monk seal is the new state mammal". KHNL NBC 8 Honolulu Hawaii. http://www.khnl.com/Global/story.asp?S=8483697. Retrieved 2011-05-23. 
  33. ^ a b Gerrodette, Tim; Gilmartin William G (1980). "Demographic consequences of changed pupping and hauling sites of the Hawaiian monk seal". Conservation Biology 4: 423–430. JSTOR 2385936. 
  34. ^ Aguirre, A.; T. Keefe, J. Reif, L. Kashinsky, P. Yochem (2007). "Infectious disease monitoring of the endangered Hawaiian monk seal". Journal of Wildlife Diseases 43 (2): 229–241. 
  35. ^ "Fisheries Service to hold hearings on monk seals". The Maui News. September 6, 2011. http://mauinews.com/page/content.detail/id/553154/Fisheries-Service-to-hold-hearings-on-monk-seals.html. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!