Overview

Brief Summary

Biology

Active in the day, the Mediterranean monk seal feeds on a variety of fish and cephalopods (such as squid and octopus) (9). Individuals reach sexual maturity at five to six years of age, and mating occurs between September and November, when females haul-out in caves to give birth to a single pup that weighs between 16 and 18 kilograms (2). While the suckling time may be up to four months, the female will remain with her pup for up to three years (11). The social organisation of the Mediterranean monk seal is not known, but groups tend to form in breeding caves (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Mediterranean monk seal is one of the most endangered mammals in the world (5). The description of this species by Aristotle was the first known written description of a pinniped (a group that includes seals, sea lions and walrus) (2), and the head of a monk seal appeared on one of the first ever coins, around 500 BC (5). Adults have a brown or grey coat, which becomes paler on the undersurface (2) and males often feature a white patch on the belly (5). Old males are darker in colour and often become black, but retain the ventral white patch. Newborn infants are black and woolly with a white or yellow patch on the belly, the shape of which can sometimes be used to determine the sex of an individual (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Mediterranean Monk Seals were once widely and continuously distributed in the Mediterranean and Black Seas, and in the North Atlantic waters from Morocco to Cabo Blanco, including the Canary Islands, Madeira Islands and the Azores (Johnson et al. 2006). A few individuals have been recorded in Senegal, the Gambia and the Cape Verde Islands at the southern end, as well as in Portugal and Atlantic France at the northern end of the species' distribution (Johnson et al. 2006), but the origin of these individuals is unknown.

Today the distribution of the Mediterranean Monk Seal is highly fragmented and consists of 34 isolated subpopulations. In the Mediterranean Sea, the stronghold of the species is at islands in the Ionian and Aegean Seas (Adamantopoulou et al. 1999), and along the coasts of mainland Greece, Cyprus, and western and southern Turkey (Glsoy et al. 2004; Gc et al. 2004, 2009; MOm 2007; Nikolaou pers. comm). In the Turkish Black Sea, Mediterranean Monk Seals are believed to be extinct since 1997 (Kira and Savas 1996, Kira 2011); some individuals still survive in the Sea of Marmara (Inanmaz et al. 2014). In the North Atlantic, two subpopulations exist: one at Cabo Blanco (also known as Cap Blanc) at the border of Mauritania and Western Sahara (Gonzles and Fernandez de Larrinoa 2012, Martnez-Jauregui et al. 2012), and one at the Archipelago of Madeira (Pires et al. 2008). An unknown number of Monk Seals might still survive at the Mediterranean coasts of eastern Morocco (and perhaps Algeria) (Mo et al. 2011), but without ongoing systematic monitoring and conservation actions the status and fate of this subpopulation is in question.

The extent of occurrence for Mediterranean Monk seals is approximately 5,000,000 km and the area of occupancy is 315,000 km.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Monachus monachus, also known as the Mediterranean Monk Seal, is found around the Mediterranean Sea region and the Northwest African Coast. There are populations that are located in Mauritania/Western Sahara, Greece, and Turkey. Small numbers have also been seen in Morocco, Algeria, Libya, the Portuguese Desertas Islands, Croatia, and Cyprus.

Biogeographic Regions: palearctic (Native ); ethiopian (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Mediterranean, Northwest African Coast and Black Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Once widespread throughout the Mediterranean, the Black Sea and the northwestern coast of Africa, this monk seal has suffered a devastating decline (2). It is now restricted to a handful of small and scattered colonies in the Ionian and Aegean Seas and the southern coast of Turkey in the Mediterranean, as well as scattered populations on the coasts of the western Sahara and Mauritania, and the Desertas Islands, Madeira (2). It is thought that just two of these populations are viable, in Greece and northwest Africa (6). The species has not been seen in the Black Sea for over five years (7). Although no reliable estimates of total population size exist, it is thought to number between just 400 to 500 individuals (6) (8), and is declining (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adult Mediterranean monk seals can be any color from dark brown or black to light grey. They are usually light gray along the belly. Pups have a black woolly coat and a white or yellow patch on the belly. They molt at about 4-6 weeks and their black woolly coat is replaced by a silvery gray coat that can darken over time.

Adult males are on average about 2.4m in length and females are slightly shorter. Males weigh about 315 kg and females weigh about 300 kg.

Average mass: 300-315 kg.

Average length: 2.4 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average mass: 275000 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Mediterranean Monk Seals are medium-sized phocids that reach 2.3-2.8 m in length (Gilmartin and Forcada 2002). Based on seals examined after a mass mortality at Cabo Blanco, average adult lengths were estimated at 2.42 m in females and 2.51 m in males. Pups up to 3 months of age averaged 1.08 m with a range of 0.74-1.38 m (Samaranch and Gonzalez 2000). In the eastern Mediterranean, newborn pups averaged 102.6 cm in length (i.e., total length from the snout to the end of the hind flippers; N = 8, SD = 10.74) and 15.5 kg in weight (N = 3, SD = 1.5; Dendrinos 2011). Adults weigh from 240-300 kg, and newborns 15-26 kg (Boulva 1979, Gilmartin and Forcada 2002), with records of a male reaching 400 kg and a pregnant female reaching 302 kg (Sergeant et al. 1978).

Adult females moult an average of 134 days after parturition, and sometimes begin the moult prior weaning their pup (Pastor and Aguilar 2003). In males, the process of developing the mature pelage pattern is gradual; it involves at least two annual moults and can be completed by the age of 4 years (Badosa et al. 2006). Mediterranean Monk Seal pups at the Cabo Blanco region moult on average 64 days after birth in the case of females and on average 82 days in the case of males; the molt occurs partly in the water and takes an average of 15 days to be completed (Badosa et al. 2006). In the eastern Mediterranean in contrast the first molt occurred 19-57 days postpartum (N = 16; Mean 37.5 days, SD = 9.85; Dendrinos 2011).

Mediterranean Monk Seals once hauled out on open beaches (Johnson and Lavigne 1999b, Johnson 2004) but today they use marine caves with sea entrances for hauling out, resting and pupping throughout their range. In recent years in areas where conservation measures are in place and/or human activity is low, such as the protected areas at Cabo Blanco (Gilmartin and Forcada 2002, Fernandez de Larrinoa et al. 2007, P. Fernandez de Larrinoa pers. comm.), the Desertas Islands Nature Reserve (Pires and Neves 2000) and the island of Gyaros (Dendrinos et al. 2008), Monk Seals are frequently observed to haul out on open beaches. On some occasions even births on open beaches have been recorded in these areas.

Most marine caves used by Mediterranean Monk Seals for resting and pupping possess a set of common geophysical characteristics, that include an entrance above or below water level, an entrance corridor, and a dry surface/area, where the seals haul out (Dendrinos et al. 2007b). Seal preferences regarding the use of a cave as a resting or pupping site are influenced by these parameters (Karamanlidis et al. 2004). Cave selection (i.e., usage frequency and intensity) may also be influenced by changes in the internal morphology of a cave, as has been seen to occur at Cabo Blanco (Gonzlez et al. 1997) or the state of the tide (only in the Atlantic populations, as tides in the Mediterranean are negligible) (Pires et al. 2007).

A major difference in the terrestrial habitat of Mediterranean Monk Seals occupying the area of Cabo Blanco and the rest of their range is the number of marine caves used by the species. Whereas in Cabo Blanco, the entire Monk Seal population uses a small number (<5) of marine caves for resting and pupping (Marchessaux and Muller 1987, Francour et al. 1990, Gonzlez et al. 1997, Martnez-Jauregui et al. 2012) in the archipelago of Madeira (Karamanlidis et al. 2004) and in the eastern Mediterranean this number is much higher (Gc et al. 2004; MOm 2007, 2008, 2009). In a study that covered 250 km of coastline inhabited by Monk Seals in the Cilician Basin region of southern Turkey, 282 caves were searched. Of these, 39 showed evidence of Monk Seals, including three that were used for pupping and 16 that were actively being used at the time of the survey (Gc et al. 2004). Similarly, in Greece more than 500 caves have been found to be occupied by the species and more than 100 to be used for pupping (MOm 2007, 2008, 2009). Monk Seal activity in the marine caves in the eastern Mediterranean is highest in autumn and winter and coincides with the pupping season of the species (Gc et al. 2004, Dendrinos 2011).

In the Cabo Blanco region prior to the mass die off in 1997, most pups were born from summer to early winter, with a small peak of births in October; 84% of the births took place in only two caves separated by 1.1 km (Gazo et al. 1999, Pastor and Aguilar 2003). Following the mass die-off a change in the reproductive parameters of the colony was registered (Gonzlez et al. 2002): currently births are recorded from April to November, with a clear peak in September (Cedenilla et al. 2007). In all other parts of the species range, pupping appears to be even more synchronous. In the archipelago of Madeira most pups have been recorded in the months October and November (i.e., 38 out of 48 recorded from 1989 to 2012; Pires et al. 2008, R. Pires pers. comm). The same pupping season was recorded for 11 pups born at Turkeys Cilician Basin and for more than 220 pups born in Greece from 1990 to 2014 (Dendrinos et al. 1994, 1999; Dendrinos 2011).

Pups begin to catch fish toward the end of their lactation period (Pastor and Aguilar 2003). Pups are weaned when they are about four months old, with up to five months reported (Pastor and Aguilar 2003, Aguilar et al. 2007). Fostering and milk stealing are not uncommon and have been recorded at Cabo Blanco (Aguilar et al. 2007), Madeira (Pires 2004), and in Greece (Karamanlidis et al. 2012). At the Cabo Blanco colony, in 26.6% of the suckling episodes observed in motherpup pairs of known identity, pups suckled from females other than their mothers. Some females nursed more than one pup, at least occasionally, and in some cases a pup was fostered long-term by an unrelated female (Aguilar et al. 2007). Pups enter the water and begin diving during their first week and from that point onwards spend 55-74% of their time at sea (Dendrinos 2011). Three pups tagged with time depth recorders spent more time at sea and diving at night than during the day; most dives were to the bottom for relatively long periods, probably indicating foraging. The mean depth of dive was 11.6 m and its mean length was 149 seconds (Gazo et al. 2006). In the Northern Sporades Islands in Greece, two rehabilitated weaned pups dived on average to greater depths and even managed to dive to a depth of 200 m (Dendrinos et al. 2006, 2007a).

Generation length for this species is 11.2 years (Pacifici et al. 2013). Female Mediterranean Monk Seals probably become sexually mature at 3-4 years of age. One female at Cabo Blanco became pregnant at 2.1 years and gave birth at 3.1 years, the youngest age known for this species (P. Fernandez de Larrinoa pers. comm.). Females can give birth in successive years. Although birthing is not strictly seasonal, individual females have been documented to give birth close to the same time in successive years, within a 15 day span (Pastor and Aguilar 2003). The annual reproductive rate in Mediterranean Monk Seals at Cabo Blanco prior to the mass die-off was extremely low, at 0.25-0.43 pups to each sexually mature female (Gazo et al. 1999, 2000). Since the mass die-off event the population appears to be recovering and currently annual reproductive rates average 0.76 pups/adult female (P. Fernandez de Larrinoa pers. comm.). Females caring for pups will go to sea to feed for up to 17 hours, with an average time of 9 hours (Gazo and Aguilar 2005). Females tend to forage longer further into nursing.

Prior to the mass mortality event, pup survival at Cabo Blanco was extremely low; just under 50% of the pups born annually managed to survive their first two months, and most mortalities occurred in the first two weeks. This very low survival rate was associated with mortality caused by severe storms, and high swells and tides, but impoverished genetic variability and inbreeding might also have been factors (Gazo et al. 2000). Currently, annual pup survival has increased considerably and numbers 65% (54-76%, depending on weather conditions; P. Fernandez de Larrinoa pers. comm.). In Greece annual pup survival appears to be even higher (Dendrinos 2011); this is most likely due to the fact that lactating females and their pups have a higher number of suitable caves to choose from when seeking refuge from severe weather conditions.

Compared to most other pinnipeds, little is known about the diving capacities and behavior of Mediterranean Monk Seals. The maximum depth and duration of diving for one lactating female were 78 m and 15 minutes, respectively (Gazo and Aguilar 2005) and 100 m for an adult male (P. Fernandez de Larrinoa pers. comm.). However, diving behaviour of Monk Seals at Cabo Blanco appears to be constricted by the topographic features of the marine environment in the region, as Monk Seals in the Mediterranean Sea (which is much deeper than the Cabo Blanco region) have been recorded to dive much deeper. Maximum dive depths for a rehabilitated male and a female juvenile Monk Seal were 196 m (Dendrinos et al. 2007a) and 205 m (MOm unpublished data), respectively. Neves (1998) observed two types of diving in shallow near-shore waters, which are thought to be associated with spot resting and transit feeding. When spot resting, seals dove as though headed into a current for 8-12 minutes, surfaced at about the same location, and usually repeated this pattern for approximately three hours. Underwater observations by divers indicate that while doing this seals rest at the bottom of the sea (R. Pires pers. comm). Transit feeding dives lasted 5-7 minutes, during which the seal moved continuously along a shoreline apparently foraging. A similar behaviour has been observed in Turkey, where adult Monk Seals dove for approximately 6.5 minutes and rested at the surface for approximately one minute (Kira et al. 2002). Monk seals in the eastern Mediterranean have been recorded to travel long distances, for example ~288 km in three months with a maximum straight distance travelled of ~78 km (Adamantopoulou et al. 2011).

Stomach content analysis of dead Monk Seals has revealed that they have a heterogeneous diet consisting of bony fishes, cephalopods, and crustaceans. In Greece, Monk Seals are known to eat more than 530 prey species (50% cephalopods, 48% fishes, 1.5% non-cephalopod molluscs, 0.4% crustaceans; Pierce et al. 2011). The common octopus (Octopus vulgaris ~34%) and bony fish from the family Sparidae (~28%) were identified in Monk Seal stomachs most frequently (Pierce et al. 2011). In the Atlantic, at the Desertas Islands off Madeira, visual observations of Monk Seals with prey at the surface included seals eating Golden-grey Mullet (Liza aurata), Parrot Fish (Sparisoma cretense), Barred Hogfish (Bodianus scrofa), Salema (Sarpa salpa), Cuttlefish (Sepia officinalis) and Crabs (Pachygrapsus spp.). Other prey reported includes Eels (Anguilla spp.), Limpets (Patella spp.) and Rays (Raja spp.) (Neves 1998). In Cabo Blanco, stomach content analyses indicated that 71.3% of prey items by weight were cephalopods and 68.3% were Octopus. Fish species were mainly from the families Sparidae, Scianidae and Haemulidae (Muoz Caas et al. 2012). Collectively, results from stomach content (Marchessaux 1989, Neves 1998, Salman et al. 2001, Karamanlidis et al. 2011, Pierce et al. 2011, Muoz Caas et al. 2012) and stable isotope analyses (Pinela et al. 2010, Karamanlidis et al. 2014b) studies suggest that Monk Seals forage primarily on the continental shelf along the coast.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mediterranean monk seals are usually found along coastal waters, especially on the coastlines of islands. They are sometimes found in caves with submarine entrances when the female is giving birth and just to get away from other disturbances, such as boats.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usually found in coastal waters (9). Many of the traditional sandy haul-out beaches have been developed for tourism, and the species now tends to haul-out and pup in secluded, remote caves (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Mediterranean monk seals are diurnal. They feed in shallow coastal waters on a large variety of fish. This includes eels, sardines, tuna, lobsters, flatfish, and mullets. They also feed on cephalopods such as octopuses.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

When communicating with each other they make very high pitched sounds. This is done mainly while in the water to let each other know if something is wrong or if danger is approaching.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

These seals live up to 30 years of age.

Typical lifespan

Status: wild:
30 (high) years.

Average lifespan

Status: captivity:
23.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals, but one specimen lived 23.7 years old in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mediterranean monk seals mate during the months of September-November. Mating usually takes place in the water. They reproduce very slowly starting at the age of 4. The time between births is 13 months, and the gestation period is 11 months. Pups are born about 80-100 cm long and weigh 17-24 kg.

Sexual maturity is reached at about 4-6 years of age.

When females give birth, they go on the beach or in caves. A female will usually remain on the beach or in the cave nursing and protecting the pup for up to six weeks. During this time, the female must live off of stored fat because she never leaves the pup, not even to feed herself. The pup may remain with its mother for as long as 3 years even after weaning.

Breeding season: Mediterranean monk seals mate during the months of September-November.

Average number of offspring: 1.

Average gestation period: 11 months.

Range weaning age: 6 (high) weeks.

Range age at sexual or reproductive maturity (female): 4 to 6 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 19000 g.

Average gestation period: 289 days.

Average number of offspring: 1.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monachus monachus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AATCGATGATTGTTTTCCACAAATCACAAAGATATTGGTACTCTCTATCTATTGTTTGGCGCATGAGCTGGTATAGTAGGTACCGCTCTCAGTCTTTTAATCCGCGCAGAACTAGGACAGCCTGGCGCTTTACTAGGAGAT---GATCAAATTTACAATGTAATCGTCACCGCTCATGCATTCGTAATAATCTTCTTCATGGTAATACCTATCATAATTGGAGGCTTCGGAAACTGGTTAGTGCCCTTAATAATTGGCGCTCCTGACATAGCATTTCCCCGGATAAATAATATGAGCTTCTGGCTCCTACCACCATCTTTTCTATTACTACTAGCTTCCTCCATAGTAGAAGCAGGCGCAGGAACAGGATGAACCGTTTATCCTCCCTTAGCCGGTAATCTAGCCCATGCAGGAGCATCCGTAGATCTAACAATCTTCTCTCTTCACCTGGCAGGTGTATCATCCATTCTTGGAGCTATTAATTTTATTACCACTATTATTAACATAAAACCTCCTGCAATATCTCAATATCAAATTCCCTTATTCGTATGATCTGTACTAATTACAGCAGTACTTCTACTACTATCATTACCAGTCCTAGCAGCTGGTATTACTATACTACTAACAGATCGAAACTTAAACACAACATTCTTTGATCCTGCTGGAGGAGGTGATCCCATTCTATACCAACATCTATTTTGGTTCTTCGGACATCCTGAAGTATACATCCTAATTCTACCAGGATTTGGAATGATTTCACATATTGTCACTTACTACTCAGGTAAAAAAGAACCTTTTGGCTATATAGGAATAGTCTGAGCAATAATGTCTATTGGCTTCCTAGGCTTTATTGTATGAGCCCATCATATATTTACCGTAGGAATAGATGTTGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Monachus monachus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2015

Assessor/s
Karamanlidis, A. & Dendrinos, P.

Reviewer/s
Littnan, C. & Trillmich, F.

Contributor/s
Fernandez de Larrinoa, P., Gc, C., Kira, C., Paravas, V. & Pires, R.

Justification

Historically, the Mediterranean Monk Seal was reduced to small numbers as a consequence of commercial seal hunting and human persecution. This produced a severe bottleneck that significantly reduced genetic variability. For most of the twentieth century, numbers continued to decline mostly as a consequence of human invasion of habitat and adverse fishing interactions. This resulted in the fragmentation of the species into many subpopulations and the disappearance of several of them. There is evidence for recent small increases in Mediterranean Monk Seals at each of the main three identified subpopulations, but their numbers remain very small. The number of mature individuals in the eastern Mediterranean (the largest subpopulation) is likely fewer than 250, and 100-200 occurring in the other known subpopulations.

Monk Seals continue to be exposed to a number of substantial threats, including habitat loss and deterioration, displacement and persecution. Unpredictable threats from disease and toxic algal blooms (red tides) also pose a threat to the remaining small population, as exemplified by the mass mortality at Cabo Blanco when more than 200 animals died in one mass-mortality event in 1997.

With the advantage of new data being available for this species, it is now thought that the previous assessment (Critically Endangered A2abc: Aguilar and Lowry 2008) was an overestimate of the scale of decline in the global population over the previous 33 years, since most of the reduction in population size likely happened more than three generations ago. Endangered (EN C2a(i)) would have been a more appropriate assessment at that time. It is clear that the population size has been reduced to below the IUCN threshold for EN under criterion C: currently the population contains 350-450 mature individuals, with less than 250 mature animals in the largest subpopulation. There is evidence of recent small increases in each of the main three subpopulations, however it is not clear when this increasing trend began or whether this trend is likely to continue into the future. Continuing decline in population size is therefore retained as a precautionary approach for this assessment. It is important to monitor the situation over the next five years to establish whether the population is genuinely increasing and whether this increase is likely to continue into the future. Maintaining and adding to conservation measures that are already in place for this species will help to secure its future. The species is here listed as Endangered (EN C2a(i)), and reassessment of its status in five years time is recommended.

History
  • 2013
    Critically Endangered (CR)
  • Critically Endangered (CR)
  • 1996
    Critically Endangered (CR)
  • 1994
    Endangered (E)
  • 1990
    Endangered (E)
  • 1988
    Endangered (E)
  • 1986
    Endangered (E)
  • 1965
    Very rare and believed to be decreasing in numbers
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fewer than 500 individuals of Mediterranean monk seals remain in the world today. They have been killed by fisherman who see them as competition, and many have been lost due to being caught in fishermans' nets. Pollution and boat traffic are also a problem for this species. Pollution comes mainly from human waste. This waste gets into the water in which the seals live and into the food that they eat. The problem with boat traffic is from a lot of boats being in the same area that the seals occupy, resulting at worst in collisions between seals and boats

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Monachus monachus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Extinct.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) by the IUCN Red List 2007 (1). Listed on Appendix I of CITES (3) and Appendices I and II of the Convention on Migratory Species (CMS, or Bonn Convention) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The once abundant Mediterranean Monk Seal has disappeared from most of its former range, with the majority of the decline in the global population seen over the last century having occurred more than three generations ago.

Conservation measures introduced over the last 30 years have helped to stem the decline, and there is now evidence of recent small increases in all known subpopulations. However at present it is not clear whether these increases are likely to continue into the future. The Mediterranean Monk Seal population remains very small and still faces many threats (see the Threats section below). It is regarded as one of the most endangered pinniped species in the world, with approximately 600-700 animals in the population (an estimated 350-450 of these are mature individuals). The population has also been fragmented into 34 subpopulations:
  • The largest subpopulation is located in the eastern Mediterranean Sea and numbers 350-450 individuals (including mature and immature individuals). It is estimated that 300400 live in Greece (MOm 2007, 2008, 2009) and about 100 in Turkey (Glsoy et al. 2004). Based on data from the closest extant relative of the Mediterranean Monk Seal (i.e., the Hawaiian Monk Seal) the number of mature individuals in the eastern Mediterranean is likely fewer than 250.
  • Approximately 220 seals currently inhabit the second largest subpopulation at the Cabo Blanco area. Recent monitoring efforts have individually identified at least 116 adult and sub-adult Monk Seals in this subpopulation (i.e., >3 years old; Martnez-Jauregui et al. 2012). Maximum counts of seals hauled-out at one time was 146 in 2009, and 159 individual adult seals were identified at the end of 2013 (CBD Habitat, P. Fernandez de Larrinoa pers. comm). In the early 1990s this subpopulation was estimated at about 317 seals but a mass mortality event in 1997 reduced numbers to nearly a third (Forcada et al. 1999, Forcada and Aguilar 2000). Martnez-Jauregui et al. (2012) estimated that there were 85 adult seals at Cabo Blanco in 2007.
  • The third subpopulation is located in the archipelago of Madeira and numbers approximately 40 seals (Pires et al. 2008, R. Pires pers. comm). Once restricted to the remote Desertas Islands (Neves and Pires 1999), Monk Seals have recently recolonized the main island of Madeira (Pires 2011), where suitable habitat for the species still exists (Karamanlidis et al. 2003). There are even strong indications of pupping on the island (R. Pires pers. comm).
  • The number of Mediterranean Monk Seals that might still survive at the Mediterranean coasts of eastern Morocco (and perhaps Algeria) is unknown (Mo et al. 2011).
The subpopulations at Cabo Blanco in the Atlantic (Martnez-Jauregui et al. 2012) and at the island of Gyaros in the eastern Mediterranean (Karamanlidis et al. 2013) are the only large extant aggregations of the species that still preserve the structure of a colony; the other subpopulations in the eastern Mediterranean are composed of loose groups of extremely reduced size (usually less than 20 individuals).

Monk Seals continue to be exposed to a number of substantial threats, as exemplified by the mass mortality at Cabo Blanco when more than 200 animals died in one mass-mortality event in 1997 (Martnez-Jauregui et al. 2012). Such unpredictable threats could rapidly impact any or all of the subpopulations in future.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The Mediterranean Monk Seal is one of the most endangered pinniped species, and one of the most endangered Evolutionarily Distinct and Globally Endangered (EDGE) mammals on Earth (Isaac et al. 2007, EDGE web site).

Mediterranean Monk Seals have a long history of interaction with humans that includes exploitation for subsistence needs, commercial harvest, and persecution as a competitor for fisheries resources or because it produced actual and perceived damage to fishing gear (Johnson and Lavigne 1999b, Stringer et al. 2008). Once abundant, Monk Seals were written about and illustrated in the literature and depictions of classical antiquity (Johnson 2004). Along the coast of northwest Africa, they became the target of a commercial harvest for skins and oil by the Portuguese as early as the 15th century (Isrels 1992).

Reasons for population decline declines in the 20th century include: increased human pressure displacing seals from their habitat; destruction/alteration of suitable habitat; continued mortality due to deliberate aggression by fishermen to eliminate a competitor, even in countries and areas where the species is legally protected; fisheries by-catch; and a mass die-off at the Cabo Blanco Monk Seal colony.

Habitat deterioration, destruction, and fragmentation have played a significant role in the plight of the Mediterranean Monk Seal. Once an open beach dweller, the species has been persecuted by humans for centuries and forced to occupy increasingly marginal habitat. The gradual process from occupying open beaches to being displaced and forced into increasingly marginal habitat (i.e., smaller and more unsuitable marine caves) has been thoroughly documented (Johnson and Lavigne 1999a). This threat is still in place today, particularly in the eastern Mediterranean (MOm 2007, Notarbartolo di Sciara et al. 2009, Kira et al. 2013). An alarming decline in pupping success has been recorded in the most important pupping location of the species in southern Turkey (where up to seven pup births have been recorded) due to increased human activity (i.e., industrial development, including the construction of a thermal and nuclear power plant and a marine terminal). Critical Monk Seal habitat has been affected by increased tourism activities throughout Turkey, even in protected areas such as the Olympos Beydaglar National Park, and the Kas, Kekova Specially Protected Area. Tourists and scuba divers in these areas appear to frequently visit Monk Seal shelters. Although some resting activity of Mediterranean Monk Seals continues, no pupping activity has been recorded in these caves (Gc et al. 2009). With human populations and coastal activities increasing around the Mediterranean, so do potential threats to the species habitat.

Interactions with fisheries are of great conservation concern, throughout the species range (Glsoy and Savas 2003, Glsoy 2008, Karamanlidis et al. 2008, Hale et al. 2011, Gonzlez and Fernandez de Larrinoa 2013). Deliberate killing of Monk Seals mainly by fishermen was responsible for one-third of all mortalities of 79 stranded animals in Greece (1991-1995) and is considered the single most important source of mortality for this species in the eastern Mediterranean (Androukaki et al. 1999). Deliberate killing, hunting, and capturing live animals for exhibition purposes were the main cause for the population reduction of the species in Turkey until 1980 (Kira et al. 2013).

Mediterranean Monk Seals have been entangled in a wide variety of fishing gear including set-nets, trawl nets, and long-lines (Johnson and Karamanlidis 2000) and entanglement remains a major source of mortality in the eastern Mediterranean Sea, especially for sub-adult animals (Karamanlidis et al. 2008, Kira et al. 2013). Adverse fishing interactions are also considered as one of the probable causes for the lack of recovery of the Cabo Blanco population after commercial sealing ended in the region. Currently, illegal industrial and artisanal fishing is one of the main threats to the survival of the colony, mainly for sub-adult seals (Gonzlez and Fernandez de Larrinoa 2013). In comparison, the effect of negative seal-fisheries interactions in the archipelago of Madeira is considered to be lower. Traps, purse seines, and illegally used gill nets are the main fishing gear posing a threat to the species in the region (Hale et al. 2011). However, concurrent with the recent expansion of the species range to the island of Madeira, signs of animosity towards the species by fishermen have been recorded, that potentially could pose a future threat (R. Pires pers. comm).

A Morbillivirus was isolated from Mediterranean Monk Seals after the mass mortality at Cabo Blanco in 1997. The virus most closely resembled a Dolphin Morbillivirus that was previously implicated in the 1991 mass mortality of Striped Dolphins in the Mediterranean Sea (Osterhaus et al. 1992, van de Bildt et al. 1999). However, although this virus was already circulating in Monk Seals prior to the mass mortality, there is some doubt as to whether it was responsible for the deaths that occurred. Indeed, the active virus was found in pups that went into a rehabilitation center because their mothers had died, and none of them showed clinical signs and all survived the event without specific treatment. Dinoflagellate-produced saxitoxins were found in tissues from animals that died during the die-off and the suddenness of death of the animals and the general clinical symptoms suggest that the cause of death was from the toxins rather than a Morbillivirus epidemic (Hernandez et al. 1998). Toxic algal blooms (red tides) are favored by oceanographic conditions near Cabo Blanco and were reported from nearby Morocco during a 25-year period leading up to the mass mortality. Toxic algal blooms are unpredictable and following the catastrophic loss of Monk Seals in 1997 must be considered a serious threat to the species in the region (Reyero et al. 2000, UNEP 2005).

Potentially, limited availability of food sources, genetic inbreeding, and pollution could constitute a threat to the survival of the species. Currently, not enough information is available to fully evaluate the magnitude of these threats, however there is no indication that they are significantly affecting the population at present.

In southern Turkey an important monk seal colony almost disappeared in the 1990s, when industrial-scale fishing in the area reduced the available fish sources and negative interactions of artisanal fishermen with monk seals (i.e., deliberate killings) increased. However, a series of regulations enforced to protect fish sources alleviated the problems and helped the local monk seal population to resume pupping in the area (Gc et al. 2004).

Genetic analyses of mitochondrial and nuclear DNA (Pastor et al. 2004, Pastor et al. 2007, Karamanlidis et al. 2014a) have shown that, as a consequence of severe population bottlenecks and population/habitat fragmentation, all sub-populations have suffered a dramatic decrease in genetic variability over the last few centuries. The genetic diversity of Mediterranean Monk Seals is among the lowest found in pinnipeds; it is comparable to Hawaiian Monk Seals and Northern Elephant Seals. The potential consequences of the loss of genetic variability and genetic inbreeding are still hard to evaluate for the Mediterranean Monk Seal, however potential consequences of genetic inbreeding include congenital defects leading to stillborn pups, something that has been recorded in several small Monk Seal populations (Bareham and Furreddu 1975, Pastor et al. 2004, MOm, unpublished data). Additionally, low fitness and increased susceptibility to disease may be an effect of genetic erosion that can compromise a population and lead to extinction.

Contaminant burdens have always been suspected to be a threat to the Mediterranean Monk Seal and thus monitoring pollutants has been considered a high priority (Boulva 1979, Reijnders et al. 1993). However, information is only available on organochlorine pollutants, which were analysed in the blubber of individuals collected during the 1990s from the Cabo Blanco and the Greek subpopulations. Residue levels were found to be very low in the former subpopulation and moderate to high in the latter (Yediler et al. 1993; Borrell et al. 1997, 2007); currently, efforts are underway to more fully evaluate the effects of pollution on the Mediterranean Monk Seal through the analysis of more recent samples from the eastern Mediterranean (Marsili et al. 2014, Zaccaroni et al. 2014).

Mediterranean Monk Seals are at an unknown, but suspected high, level of risk from oil tanker and other ship accidents, spills, and groundings. This results from increased tanker traffic in the area, and a greater chance for accidents, disturbance, and collisions near important habitat. Four accidents or spills have occurred near Monk Seal habitat in the recent past, including a supertanker that spilled oil off Morocco in 1989 (Isrels 1992), an oil spill in the Madeira Islands in 1990 (UNEP 2005), and the grounding of a bulk carrier near Cabo Blanco in 2003 (UNEP 2005). None of these spills or accidents had any known impacts on Monk Seals, but they highlight the threat of significant impacts from a major maritime accident near an important Monk Seal site (UNEP 2005). In contrast, a ship accident that occurred at avu Island near Bodrum in southwest Turkey in 1996 directly affected Monk Seals and their habitat (Kira 1998). A clean-up operation lasting until 1997 effectively restored the habitat to its original quality. In response to this accident regulatory measures have been taken in Turkey to reduce the threat from oil spills (Kira and Guclusoy 2007).

More recently, the arrival of Lessepsian fishes in the eastern Mediterranean Sea, such as the toxic Pufferfish (Lagocephalus sceleratus), could have a negative impact on Monk Seals in the region. The Pufferfish has been implicated in the death of a Monk Seal at Cyprus (A. Gc pers. comm). Additional risks to Mediterranean Monk Seals come from political instability in some parts of their range, the challenge of implementing effective conservation for a species in a complex multi-national environment, weak enforcement of agreements and international laws, collapse of occupied pupping caves, and reduction of the carrying capacity of the environment as a consequence of fishing overexploitation (Aguilar 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mediterranean monk seals are highly sensitive to disturbance and humans have extensively used both the sea and beaches of their habitat for centuries, causing the population to collapse (2). The main threats facing this species are deliberate killing by fishermen who perceive the species as a competitor for fish, entanglement in fishing gear, disturbance and habitat loss through development and tourism, disease, and the effects of toxic algal blooms (2). In 1997, two thirds of the seals in the largest population, located at Cap Blanc, Mauritania, were lost due to the accumulation of toxins in fish following an algal bloom (5) (10). These shy creatures have taken to hauling out in caves to give birth, rather than on developed beaches, and the collapse of such caves is a further threat to the survival of the species (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Mediterranean Monk Seal is legally protected throughout its range through numerous national laws and regional and international treaties, as well as European Union regulations. Legislative measures and research, management, and conservation actions to effectively protect important Mediterranean Monk Seal populations are currently in place in the following areas: the Desertas Islands Nature Reserve in the Madeira Archipelago, the National Marine Park of Alonnisos, Northern Sporades Islands, the marine protected area in Northern KarpathosSaria and the 3-mile no-take zone at the Island of Gyaros in Greece, the no-fishing area of the Cap Blanc Peninsula and the participative reserve that has been created to protect the pupping caves of the Cabo Blanco Monk Seal population. In Turkey similar actions are carried out in five coastal locations in the country: Foa, Karaburun, Alaat-Sigacik, the Bodrum Peninsula, and the Cilician coasts (Kira et al. 2013).

Additionally, the species is explicitly mentioned in 102 Natura 2000 sites within the European Union (82 sites in Greece, 10 in Italy, five in Spain, three in Portugal, and two in Cyprus). According to the Councils Directive 92/43EEC on the conservation of natural habitats of wild fauna and flora the Mediterranean Monk Seal is considered as a species of community importance. Based on the above Directive, Natura 2000 sites are legally considered by EU member states as Protected Areas.

Throughout the range of the species, widespread action has been taken to sensitize the local human population towards Monk Seal conservation, to protect breeding caves, to restrict fishing gear and relocate the most adverse fishing practices, to develop monitoring programs and intervention protocols, and to increase on-site capability to rehabilitate sick and injured individuals, particularly pups. Numerous agreements, conventions, and treaties (on a regional, national, and international level) are in force to protect Monk Seals, and many workshops and conferences have brought together scientists and managers to discuss Monk Seal conservation issues and problems. Furthermore, numerous international bodies and fora, including the Regional Activity Center for Specially Protected Areas and the General Fisheries Commission for the Mediterranean, have put forward initiatives and proposals in order to ameliorate existing threats and mitigate pressures from relevant sectors (i.e., fisheries, bycatch, etc.). Isrels (1992) summarized 30 years of this conservation history, and provided details on accomplishments and failures to meet objectives. Currently, there is a UNEP/Mediterranean Action Plan (first issued in 1978 and revised in 1988) in force for the conservation and management of Monk Seals in the Mediterranean and an Action Plan for the recovery of the Monk Seal in the eastern Atlantic under the Migratory Species of Wild Animals Convention (Bonn Convention) (Gonzlez et al. 2006). In the context of the plan a list of actions have been implemented, such as the establishment of mechanisms to coordinate and finance the conservation, the population monitoring and study, habitat protection and environmental education.

In Greece, the National strategy and action plan for the conservation of the Mediterranean Monk Seal in Greece, 2009-2015 (Notarbartolo di Sciara et al. 2009) describes in detail actions that have to be carried out in the country by 2015 in order to safeguard the future of the species. Similarly, in Turkey the National Monk Seal Committee has drafted a National Action Plan for the Conservation of Mediterranean Monk Seal Monachus monachus in Turkey that has been approved by the Turkish Ministry of Forest and Water Works (Kira et al. 2013).

Recently a new Regional Strategy for the Conservation of the Mediterranean Monk Seal has been adopted also by the UNEP parties (Notarbartolo di Sciara 2013).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The IUCN Species Survival Commission Seal Specialist Group has devised an Action Plan for the conservation of the species, the aims of which include the involvement of local fishermen, research into the status of the species and the development of a captive breeding programme (7). A Greek National Programme for the Protection of the Monk Seal has been established, aiming to prevent human-induced mortalities of the species and to restore and maintain a viable self-supporting population (6). Some experts believe that the removal of pups from a population, to supply a captive programme, could severely affect breeding within the wild population, and injure the pups concerned (7). Captive breeding is usually recommended for mammal species of such low numbers as this and with threats continuing in the wild, but concerns that removing young seals from the wild will not severely affect breeding in the wild and will not injure or negatively affect survival of the captured young must be adequately addressed (11). It is clear that determined action is urgently required if this reclusive, beleaguered species is to escape total extinction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The only way that Mediterranean monk seals affect humans negatively is that compete with fishermen. These seals are mainly harmless otherwise.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the past the Mediterranean monk seal was killed for its skin and body parts, which were said to provide protection against a variety of medical problems. The seal has also been killed for food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mediterranean monk seal

The Mediterranean monk seal (Monachus monachus) is a pinniped belonging to the Phocidae family. At some 450–510 (fewer than 600[2]) remaining individuals, it is believed to be the world's rarest pinniped species, and one of the most endangered mammals in the world.[1]

It is present in parts of the Mediterranean Sea as well as eastern Atlantic Ocean waters around the Tropic of Cancer.

Physical appearance[edit]

This species of monk seal grows from approximately 80 cm long at birth up to an average of 2.4 m (7.95 ft) as adults. Males weigh an average of 315 kg (695 lbs) and females weigh 300 kg (660 lbs), overall weigh ranging from 240 to 400 kg (530–880 lbs).[1][3][4][5] They are thought to live up to 45 years old;[3] the average life span is thought to be 20 to 25 years old and reproductive maturity is reached at around age four.

The monk seals' pups are about a meter long and weigh around 15–18 kilograms, their skin being covered by 1–1.5 centimeter-long, dark brown to black hair. On their bellies, there is a white stripe, which differs in color between the two sexes. This hair is replaced after six to eight weeks by the usual short hair adults carry.[3]

Pregnant Mediterranean monk seals typically use inaccessible undersea caves while giving birth, though historical descriptions show they used open beaches until the 18th century. There are eight pairs of teeth in both jaws.

Believed to have the shortest hair of any pinniped, the Mediterranean monk seal fur is black (males) or brown to dark grey (females), with a paler belly, which is close to white in males. The snout is short broad and flat, with very pronounced, long nostrils that face upward, unlike their Hawaiian relative, which tend to have more forward nostrils. The flippers are relatively short, with small slender claws. Monk seals have two pairs of retractable abdominal teats, unlike most other pinnipeds.

Reproduction[edit]

A colony on Cabo Blanco in 1945 prior to the mass die-off.

Very little is known of this seal's reproduction. Scientists have suggested that they are polygynous, with males being very territorial where they mate with females. Although there is no breeding season since births take place year round, there is a peak in October and November. This is also the time when caves are prone to wash out due to high surf or storm surge, which causes high mortality rates among monk seal pups, especially at the key Cabo Blanco colony. According to the IUCN species factsheet, "pup survival is low; just under 50% survive their first two months to the onset of their moult, and most mortalities occurred in the first two weeks. Survival of pups born from September to January is 29%. This very low survival rate is associated with mortality caused by severe storms, and high swells and tides, but impoverished genetic variability and inbreeding may also be involved. Pups born during the rest of the year had a survival rate of 71%".

In 2008, lactation was reported in an open beach, the first such record since 1945, which could suggest the seal could begin feeling increasingly safe to return to open beaches for breeding purposes in Cabo Blanco.[6]

Pups make first contact with the water two weeks after their birth and are weaned at around 18 weeks of age; females caring for pups will go off to feed for an average of nine hours.[1] Most individuals are believed to reach maturity at four years of age. The gestation period lasts close to a year. However, it is believed to be common among monk seals of the Cabo Blanco colony to have a gestation period lasting slightly longer than a year.

Diet[edit]

Mediterranean monk seals are diurnal and feed on a variety of fish and mollusks, primarily octopus, squid, and eels, up to 3 kg per day. They are known to forage mostly at depths of 150–230 feet,[1] but some have been observed by the NOAA in a submersible at a known feeding ground at a depth of 500 feet. Monk seals prefer hunting in wide-open spaces, enabling them to use their speed more effectively. They are successful bottom-feeding hunters; some have even been observed lifting slabs of rock in search of prey.

Habitat[edit]

The habitat of this pinniped has changed over the years. In ancient times, and up until the 20th century, Mediterranean monk seals had been known to congregate, give birth, and seek refuge on open beaches. In more recent times, they have left their former habitat and now only use sea caves for such things; and more often than not, these caves are rather inaccessible to humans due to underwater entries, and because the caves are often positioned along remote or rugged coastlines.

Scientists have confirmed this is a recent adaptation, most likely due to the rapid increase in human population, tourism, and industry, which have caused the destruction of animals' habitat. Because of these seals' shy nature and sensitivity to human disturbance, they have slowly adapted to try to avoid contact with humans completely within the last century, and, perhaps, even earlier. The coastal caves are, however, dangerous for newborns, and are causes of major mortality among pups.

Status[edit]

This earless seal's former range extended throughout the Northwest Atlantic Africa, Mediterranean and Black Sea, coastlines, including all offshore islands of the Mediterranean, and into the Atlantic and its islands: Canary, Madeira, Ilhas Desertas, Porto Santo... as far west as the Azores. Vagrants could be found as far south as Gambia and the Cape Verde islands, and as far north as continental Portugal and Atlantic France.[1]

Several causes have provoked a dramatic population decrease over time: on one hand, commercial hunting (especially during the Roman Empire and Middle Ages) and, during the 20th century, eradication by fishermen, who used to consider it a pest due to the damage the seal causes to fishing nets when it preys on fish caught in them; and, on the other hand, coastal urbanization and pollution.[1]

The species has gone extinct in the Sea of Marmara due to pollution and heavy ship traffic from the Dardanelles and the Bosporus. In addition, the last report of a seal in the Black Sea dates to the late 1990s.[citation needed]

Nowadays, its entire population is estimated to be less than 600 individuals scattered throughout a wide distribution range, which qualifies this species as Critically Endangered. Its current very sparse population is one more serious threat to the species, as it only has two key sites that can be deemed viable. One is the Aegean Sea (250–300 in Greece and some 100 in Turkey) and the other is the Western Saharan portion of Cabo Blanco (around 200 individuals which may support the small, but growing, nucleus in the Desertas Islands – approximately 20 individuals[1]). There may be some individuals using coastal areas among other parts of Western Sahara, such as in Cintra Bay.[7]

These two key sites are virtually in the extreme opposites of the species' distribution range, which makes natural population interchange between them impossible. All the other remaining subpopulations are composed of less than 50 mature individuals, many of them being only loose groups of extremely reduced size – often less than five individuals.[1]

These other remaining populations are in Madeira and the Desertas Islands (both in the Atlantic Ocean) with a total of 30 to 35 individuals,[8] and southwestern Turkey and the Ionian Sea (both in the eastern Mediterranean). The species status is virtually moribund in the western Mediterranean, which still holds tiny Moroccan and Algerian populations, associated with rare sightings of vagrants in the Balearic Islands,[9] Sardinia, and other western Mediterranean locations, including Gibraltar.
The last sightings of the Mediterranean Monk seal were made on May 2007 and on April 2010 in Sardinia, where a seal was even photographed, the increasing of the sightings in Sardinia, suggest that the seal has repopulated the Central eastern Sardinian coasts, preserved since 1998 by the National Park of Golfo of Orosei [10][11][12]

Cabo Blanco 1997 die off[edit]

Cabo Blanco, in the Atlantic Ocean, is the largest surviving single population of the species, and the only remaining site that still seems to preserve a colony structure.[1] In the summer of 1997, two-thirds of its seal population were wiped out within two months, extremely compromising the species' viable population. While opinions on the precise causes of this epidemic remain divided (the most likely cause being a morbilivirus or, more likely, a toxic algae bloom,[1]) the mass die-off emphasized the precarious status of a species already regarded as critically endangered throughout its range.

While still far below the early 1997 count, numbers in this all-important location have started a slow-paced recovery ever since. Currently, the population in this location is estimated at 200 individuals, down from some 310 in 1997, but still the largest single colony by far. The threat of a similar incident, which could wipe out the entire population, remains.[13]

Preservation[edit]

Damage inflicted on fishermen's nets and rare attacks on off-shore fish farms in Turkey and Greece are known to have pushed local people towards hunting the Mediterranean monk seal, but mostly out of revenge, rather than population control. Preservation efforts have been put forth by civic organizations, foundations, and universities in both countries since as early as the 1970s. For the past 10 years[citation needed], many groups have carried out missions to educate locals on damage control and species preservation. Reports of positive results of such efforts exist throughout the area.[14]

In the Aegean Sea, Greece has allocated a large area for the preservation of the Mediterranean monk seal and its habitat. The Greek Alonissos Marine Park, that extends around the Northern Sporades islands, is the main action ground of the Greek MOm organisation.[15] MOm is greatly involved in raising awareness in the general public, fundraising for the helping of the monk seal preservation cause, in Greece and wherever needed. Greece is currently investigating the possibility of declaring another monk seal breeding site as a national park, and also has integrated some sites in the NATURA 2000 protection scheme. The legislation in Greece is very strict towards seal hunting, and in general, the public is very much aware and supportive of the effort for the preservation of the Mediterranean monk seal.

The complex politics concerning the covert opposition of the Greek government towards the protection to the monk seals in the eastern Aegean in the late 1970s is described in a book by William Johnson.[16] Oil companies apparently may have been using the Monk Seal Sanctuary project as a stalking horse to encourage greater cooperation between the Greek and Turkish governments as a preliminary to pushing for oil extraction rights in a geopolitically unstable area. According to Johnson, the Greek secret service, the YPEA, were against such moves and sabotaged the project to the detriment of both the seals and conservationists, who, unaware of such covert motivations, sought only to protect the species and its habitat.

One of the largest groups among the foundations concentrating their efforts towards the preservation of the Mediterranean monk seal is the Mediterranean Seal Research Group (Turkish: Akdeniz Foklarını Araştırma Grubu) operating under the Underwater Research Foundation (Turkish: Sualtı Araştırmaları Derneği) in Turkey (also known as SAD-AFAG). The group has taken initiative in joint preservation efforts together with the Foça municipal officials, as well as phone, fax, and email hotlines for sightings.[17]

Preservation of the species requires both the preservation of land and sea, due to the need for terrestrial haul-out sites and caves or caverns for the animal to rest and reproduce. Even though responsible scuba diving instructors hesitate to make trips to known seal caves, the rumor of a seal sighting quickly becomes a tourist attraction for many. Irresponsible scuba diving trips scare the seals away from caves which could become habitation for the species.

Conservation[edit]

Under the auspices of the Convention on Migratory Species of Wild Animals (CMS), also known as the Bonn Convention, the Memorandum of Understanding (MoU) concerning Conservation Measures for the Eastern Atlantic Populations of the Mediterranean Monk Seal was concluded and came into effect on 18 October 2007. The MoU covers four range States (Mauritania, Morocco, Portugal and Spain), all of which have signed, and aims at providing a legal and institutional framework for the implementation of the Action Plan for the Recovery of the Mediterranean Monk Seal in the Eastern Atlantic.

Sightings[edit]

On Coaling Island in September 2012, possibly the first record in the Strait of Gibraltar

In June 2009, there was a report of a sighting off the island of Giglio, in Italy.[18] On 7 January 2010, fishermen spotted an injured Mediterranean monk seal off the coasts of Tel Aviv, Israel. When zoo veterinarians arrived to help the seal, it had slipped back into the waters. Members of the Israel Marine Mammal Research and Assistance Center arrived at the scene and tried to locate the injured mammal, but with no success. This was the first sighting of the species in the region since Lebanese authorities claimed to have found a population of 10–20 other seals on their coasts 70 years earlier.[19] In addition, the seal was also sighted a couple of weeks later in the northern kibbutz of Rosh Hanikra.[20]

In April 2010, there was a report of a sighting off the island of Marettimo, in the Egadi Islands off the coast of Italy, in Trapani Province.[21]

In November 2010, a Mediterranean monk seal, supposedly aged between 10 and 20, had been spotted in Bodrum, Turkey.[22]

On 31 December 2010, the BBC Earth news[23] reported that the MOM Hellenic Society[24] had located a new colony of seals on a remote beach in the Aegean Sea. The exact location was not communicated so as to keep the site protected. The society was appealing to the Greek government to integrate the part of the island on which the seals live into a marine protected area.

On 8 March 2011, the BBC Earth news [25] reported that a pup seal had been spotted on 7 February while monitoring a seal colony on an island in the southwestern Aegean Sea. Soon after, it showed signs of weakness and it was taken to a rehabilitation centre to try to save it. The aim is to release it back into the wild as soon as it is strong enough.

In April, 2011, a monk seal was spotted in Egyptian coast after long absence of the species from the nation.[26]

On 24 June 2011, the Blue World Institute of Croatia [27] filmed an adult female underwater in the northern Adriatic, off the island of Cres and a specimen of unverified sex on 29 June 2012.[28] On 2 May 2013 a specimen was seen on the southernmost point of Istrian peninsula near the town of Pula.[29] On 9 September 2013, in Pula a male specimen swam to a busy beach and entertained numerous tourists for five minutes before swimming back to the open sea.[30] In summer 2014 sightings in Pula have occurred almost daily and Monk seal stayed multiple times on crowded city beaches, sleeping calm for hours just few meters away from humans.[31][32] To prevent accidents and preserve Monk seal, local city council acquired special educational boards and installed on city beaches.[33] Despite clear instructions, an incident occurred with a tourist harassing a seal. The whole event was filmed.[34] Less than a month later on August 25, 2014 this female Monk seal was found dead in the Mrtvi Puć bay near Šišan, Croatia. Experts said it was natural death caused by her old age.[35]

In 2012, a Mediterranean Monk Seal, was spotted in Gibraltar on the jetty of the private boat owners club at Coaling Island.[36] The specimen was very likely a seal who must have swam far out of its comfort zone and found itself in Gibraltar.

Recently, in the week of 22–28 April 2013, what is believed to have been a monk seal was viewed in Tyre, southern Lebanon; photographs have been reported among many local media.[37]

A study by the Italian Ministry of the Environment in 2013 confirmed the presence of monk seals in marine protected area in the Egadi Islands.[38]

In September and October 2013, there were a number of sightings of an adult pair in waters around RAF Akrotiri in British Sovereign Base waters in Cyprus.

In November 2014 an adult monk seal was seen inside the Limassol port of Cyprus.

Notes[edit]

  1. ^ a b c d e f g h i j k Aguilar, A. & Lowry, L. (2008). Monachus monachus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 January 2009. Listed as Critically Endangered (CR A2abc; C2a(i); E)
  2. ^ "MOm Website". Mom.gr. Retrieved 2012-11-06. 
  3. ^ a b c "MOm Website". Mom.gr. Retrieved 2012-11-06. 
  4. ^ "Mediterranean Monk Seal Fact Files: Biology: External appearance and anatomy". Monachus-guardian.org. Retrieved 2012-11-06. 
  5. ^ "Mediterranean Monk Seal (Monachus monachus) - Office of Protected Resources - NOAA Fisheries". Nmfs.noaa.gov. 2005-11-18. Retrieved 2012-11-06. 
  6. ^ "Mediterranean Monk Seal News II - Monachus Guardian 11 (2): November 2008". Monachus-guardian.org. Retrieved 2012-11-06. 
  7. ^ Tiwari M., Aksissou M., Semmoumy S., Ouakka K. (2006). "Morocco Footprint Handbook". Footprint Travel Guides. p. 265. Retrieved 2014-12-27. 
  8. ^ "MOm Website". Mom.gr. Retrieved 2012-11-06. 
  9. ^ "TMG Latest News: 20 June 2008". Monachus-guardian.org. 2008-06-20. Retrieved 2012-11-06. 
  10. ^ http://www.ecoblog.it/post/3403/sardegna-rispunta-la-foca-monaca
  11. ^ http://www.centrostudinatura.it/news/default.asp?id=119
  12. ^ http://gruppodinterventogiuridico.blog.tiscali.it/2010/04/17/torna-la-foca-monaca-e-forse-non-e-mai-andata-via/
  13. ^ "Mediterranean Monk Seal Fact Files: Overview". Monachus-guardian.org. 1978-05-05. Retrieved 2012-11-06. 
  14. ^ "WWF - Oh no! The page you are looking for has gone extinct". Panda.org. Retrieved 2012-11-06. 
  15. ^ "MOm Website". Mom.gr. Retrieved 2012-11-06. 
  16. ^ Johnson, William (1988-03-31). The Monk Seal Conspiracy. Heretic Books. ISBN 0-946097-23-2. 
  17. ^ [1][dead link]
  18. ^ "Avvistato Esemplare Di Foca Monaca A Giglio Campese | Isola-Del-Giglio | News". Giglionews.it. Retrieved 2012-11-06. 
  19. ^ Rinat, Zafrir (2010-01-08). "Critically endangered seal spotted off Israel coast - Israel News | Haaretz Daily Newspaper". Haaretz.com. Retrieved 2012-11-06. 
  20. ^ צפריר רינת 20.01.2010 18:11 עודכן ב: 18:17 (2010-01-20). "כלב ים נזירי - מין נדיר ביותר - נצפה שוב בחופי ישראל, הפעם בנהריה - מדע וסביבה - הארץ". Haaretz.co.il. Retrieved 2012-11-06. 
  21. ^ "La foca monaca torna dopo 50 anni - Corriere della Sera". Corriere.it. Retrieved 2012-11-06. 
  22. ^ "Bodrum'da fok müjdesi - Doğal Hayat". ntvmsnbc.com. 1970-01-01. Retrieved 2012-11-06. 
  23. ^ Gill, Victoria (31 December 2010). "Refuge of endangered seals found". BBC News. 
  24. ^ "MOm Website". Mom.gr. Retrieved 2012-11-06. 
  25. ^ Gill, Victoria (7 March 2011). "Rare baby seal rescued in Greece". BBC News. 
  26. ^ GIUSEPPE (2011). "Monk seal sightings in Egypt". Retrieved 2015-02-18. 
  27. ^ from Blue World Institute 1 year ago (2011-06-26). "Sredozemna medvjedica snimljena uz zapadnu obalu Cresa - Monk seal observed and filmed on Cres, 24.6.2011. on Vimeo". Vimeo.com. Retrieved 2012-11-06. 
  28. ^ "Sredozemna medvjedica na Cresu, 29.6.2012" (in Croatian). Plavi-svijet.org. Retrieved 2012-11-06. 
  29. ^ "Sredozemna medvjedica na Galebovim stijenama, 2.5.2013" (in Croatian). http://regionalexpress.hr/. Retrieved 2013-05-03. 
  30. ^ http://www.24sata.hr/neobicno/snimili-ljepoticu-kraj-pule-kao-da-nas-je-sve-dosla-pozdraviti-331777
  31. ^ http://www.index.hr/black/clanak/turiste-ne-dira-sto-ne-smiju-uznemiravati-sredozemnu-medvjedicu-opkolili-je-na-plazi/759779.aspx
  32. ^ http://www.24sata.hr/zanimljivosti/sredozemna-medvjedice-dosla-meu-kupace-i-malo-odmorila-380131
  33. ^ http://www.glasistre.hr/vijesti/pula_istra/postavljena-edukativna-tabla-o-sredozemnoj-medvjedici-450428
  34. ^ http://www.index.hr/vijesti/clanak/objavljena-snimka-makedonski-ilegalac-uznemiravao-sredozemnu-medvjedicu-na-plazi-u-puli/763027.aspx
  35. ^ http://regionalexpress.hr/site/more/uginula-sredozemna-medvjedica/
  36. ^ "Your Gibraltar TV 'Seal Spotted at Coaling Island'". Retrieved 20 September 2013. 
  37. ^ http://www.lebanonfiles.com/news/538303
  38. ^ http://www.legambiente.it/contenuti/comunicati/soddisfazione-di-legambiente-il-ritorno-della-foca-monaca-alle-egadi-un-evento-

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!