Overview

Brief Summary

Biology

Active in the day, the Mediterranean monk seal feeds on a variety of fish and cephalopods (such as squid and octopus) (9). Individuals reach sexual maturity at five to six years of age, and mating occurs between September and November, when females haul-out in caves to give birth to a single pup that weighs between 16 and 18 kilograms (2). While the suckling time may be up to four months, the female will remain with her pup for up to three years (11). The social organisation of the Mediterranean monk seal is not known, but groups tend to form in breeding caves (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Adult Mediterranean monk seals can be any color from dark brown or black to light grey. They are usually light gray along the belly. Pups have a black woolly coat and a white or yellow patch on the belly. They molt at about 4-6 weeks and their black woolly coat is replaced by a silvery gray coat that can darken over time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Mediterranean monk seal is one of the most endangered mammals in the world (5). The description of this species by Aristotle was the first known written description of a pinniped (a group that includes seals, sea lions and walrus) (2), and the head of a monk seal appeared on one of the first ever coins, around 500 BC (5). Adults have a brown or grey coat, which becomes paler on the undersurface (2) and males often feature a white patch on the belly (5). Old males are darker in colour and often become black, but retain the ventral white patch. Newborn infants are black and woolly with a white or yellow patch on the belly, the shape of which can sometimes be used to determine the sex of an individual (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Mediterranean monk seals were once widely and continuously distributed in the Mediterranean, Black and adjacent seas, and in the North Atlantic waters from Morocco to Cap Blanc, including the Canary Islands, Madeira Islands and the Azores (Aguilar 1999). A few individuals, possibly vagrants, have been recorded in Senegal, the Gambia and the Cape Verde Islands in the south end of the distribution range, as well as in Portugal and Atlantic France in the northern end (Ronald and Healey 1982, Israels 1992, Aguilar 1999).

Today the distribution is widespread, but fragmented into an unknown but probably relatively large number of very small breeding subpopulations. In the Mediterranean, the stronghold for the species is on islands in the Ionian and Aegean Seas, and along the coasts of Greece and western Turkey. The two surviving colonies in the south-eastern North Atlantic are at Cabo Blanco (also known as Cap Blanc or Ras Nouadhibou) on the border of Mauritania and Western Sahara, and the small colony at the Desertas Islands in the Madeira Islands group (Aguilar 1999, Gilmartin and Forcada 2002). Many locations where seals are infrequently or regularly seen, or were seen in the recent or historic past, are reported in the literature and catalogued in reviews and status updates, see Sergeant et al. (1978), Israels (1992) and UNEP/MAP (2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Monachus monachus, also known as the Mediterranean Monk Seal, is found around the Mediterranean Sea region and the Northwest African Coast. There are populations that are located in Mauritania/Western Sahara, Greece, and Turkey. Small numbers have also been seen in Morocco, Algeria, Libya, the Portuguese Desertas Islands, Croatia, and Cyprus.

Biogeographic Regions: palearctic (Native ); ethiopian (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arabian Sea, Azores Exclusive Economic Zone, Black Sea, Cabo Blanco, European waters (ERMS scope), Greece, Greek Exclusive Economic Zone, Madeira, Mediterranean Sea, Morocco, North West Africa, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Algeria; Greece; Mauritania; Portugal (Azores - Regionally Extinct, Madeira - Regionally Extinct, Portugal (mainland) - Regionally Extinct); Turkey; Western Sahara; Croatia; Gambia; Libyan Arab Jamahiriya; Montenegro; Romania; Spain (Baleares, Canary Is. - Native, Spain (mainland) - Regionally Extinct); Tunisia; Albania; Bosnia and Herzegovina; Bulgaria; Cape Verde; Cyprus; Egypt; France (Corse, France (mainland)); Georgia; Israel; Italy (Italy (mainland), Sardegna, Sicilia); Lebanon; Malta; Morocco; Russian Federation; Senegal; Slovenia; Syrian Arab Republic; Ukraine; Afghanistan; Atlantic – eastern central;  Mediterranean and Black Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Mediterranean, Northwest African Coast and Black Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Once widespread throughout the Mediterranean, the Black Sea and the northwestern coast of Africa, this monk seal has suffered a devastating decline (2). It is now restricted to a handful of small and scattered colonies in the Ionian and Aegean Seas and the southern coast of Turkey in the Mediterranean, as well as scattered populations on the coasts of the western Sahara and Mauritania, and the Desertas Islands, Madeira (2). It is thought that just two of these populations are viable, in Greece and northwest Africa (6). The species has not been seen in the Black Sea for over five years (7). Although no reliable estimates of total population size exist, it is thought to number between just 400 to 500 individuals (6) (8), and is declining (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Mediterranean monk seals can be any color from dark brown or black to light grey. They are usually light gray along the belly. Pups have a black woolly coat and a white or yellow patch on the belly. They molt at about 4-6 weeks and their black woolly coat is replaced by a silvery gray coat that can darken over time.

Adult males are on average about 2.4m in length and females are slightly shorter. Males weigh about 315 kg and females weigh about 300 kg.

Average mass: 300-315 kg.

Average length: 2.4 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average mass: 275000 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length of male: 240 cm; Length of female: 238 cm; Weight of male: 315 kg; Weight of female: 300 kg 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Mediterranean monk seals are medium-sized phocids that reach 2.3-2.8 m in length (Gilmartin and Forcada 2002). Based on a large number of seals examined after a mass mortality at Cabo Blanco, average adult lengths were estimated at 2.42 m in females and 2.6 m in males. Pups up to 3 months of age averaged 1.08 m with a range of 0.74-1.38 m (Samaranch and Gonzalez 2000). In the Mediterranean, a study on a limited sample size produced somewhat larger lengths for adult females (2.65 m) than for adult males (2.41 m); newborn pups averaged about 99 cm (Boulva 1979). Adults weigh from 240-300 kg, and newborns 15-26 kg (Boulva 1979, Gilmartin and Forcada 2002), with records of a male reaching 400 kg and a pregnant female reaching 302 kg (Sergeant et al. 1978).

In islands or mainland areas devoid of terrestrial predators, Mediterranean monk seals once hauled out on open beaches; it is unclear whether they ever used locations along the northern African coast, where large predators, like lions or hyenas, occurred. Today, they use caves with sea entrances for hauling out and pupping throughout their range, although adults, particularly males, may also sporadically haulout on open beaches (Gilmartin and Forcada 2002). Sea caves used by seals almost always have submerged entrances to avoid entrance by terrestrial predators, but the use of particular caves probably changes periodically if their structure is altered as a consequence of variations in the shape of the inside beach or of rock slides , as has been seen to occur at Cabo Blanco (González et al. 1997). Maximum counts at one cave in the Cabo Blanco colony had up to 89 seals hauled out at one time, and never less than 5 animals present (Gonzalez et al. 1997). In a study that covered 250 km of coastline inhabited by monk seals in the Cilician Basin region of southern Turkey, 282 caves were searched. Of these, 39 showed evidence of monk seals, including 3 that were used for pupping and 16 that were actively being used at the time of the survey. Use of these caves increased in October coincident with the autumn pupping season in Turkey (Gucu et al. 2004). The maximum number of seals from this small Turkish subpopulation found in a cave in at one time was 3 (Gucu et al. 2004). The numbers in caves are highest at low and rising tides.

Pups are born all year-round, but in the Cap Blanc colony most are born from summer to early winter, with a small peak of births in October; 84% of the births took place in only two caves separated by 1.1 km (Gazo et al. 1999, Pastor and Aguilar 2003). In Turkey?s Cilician Basin, 11 newborns observed, 10 of which were born between August and November, and another 6 documented births in Turkey fall in this same time period. While pups may be born throughout the year, this definition may mask more restricted birthing periods on a smaller geographic scale.

Mediterranean monk seal pups moult an average 64 days after birth in the case of females and an average 82 days in the case of males; the moult occurs partly in the water and takes an average of 15 days to be completed (Badosa et al. 2006). Pups begin to catch fish toward the end of their nursing period (Pastor and Aguilar 2003). Pups are weaned when they are around 4 months old, with up to 5 months reported (Pastor and Aguilar 2003, Aguilar et al. 2007). Fostering and milk stealing are common patterns. At the Cabo Blanco colony, in 26.6% of the suckling episodes observed in mother?pup pairs of known identity, pups suckled from females other than their mothers. Some females nursed more than one pup, at least occasionally, and in some cases a pup was fostered long-term by an alien female (Aguilar et al. 2007). Pups enter the water and begin diving during their first week and from that point onwards spend 55-74% of their time at sea. Three pups tagged with time depth recorders spent more time at sea and diving at night than during the day; most dives were to the bottom for relatively long periods, probably indicating foraging. The mean depth of dive was 11.6 m and its mean length was 149 seconds (Gazo et al. 2006).

Females caring for pups will go off to feed for up to 17 hours, with an average time of 9 hours (Gazo and Aguilar 2005). Female Mediterranean monk seals probably become sexually mature at three to four years of age. One female at Cabo Blanco became pregnant at 2.5 years and gave birth at 3.7 years, the youngest age known for this species (Gazo et al. 2000b). In males, the process of developing the mature pelage pattern of bulls is gradual; it involves at least two annual moults and can be completed by the age of 4 years (Badosa et al. 2006). Females can give birth in successive years. Although birthing is not seasonal, individual females have been documented to give birth close to the same time in successive years, within a 15 day span (Pastor and Aguilar 2003). The annual reproductive rate in Mediterranean monk seals is extremely low at 0.25-0.43 pups to each sexually mature female, both in the Cabo Blanco colony and the Turkey coast (Gazo et al. 1999, Gucu et al. 2004).

Pup survival is low; just under 50% survive their first two months to the onset of their moult, and most mortalities occurred in the first two weeks. Survival of pups born from September to January is 29%. This very low survival rate is associated with mortality caused by severe storms, and high swells and tides, but impoverished genetic variability and inbreeding may also be involved. Pups born during the rest of the year had a survival rate of 71% (Gazo, et al. 2000a). Few pups are successfully weaned in the winter. Adult females moult an average of 134 days after parturition, and sometimes begin the moult prior weaning their pup (Pastor and Aguilar 2003).

Little is known about adult diving. The maximum depth and duration of diving for one lactating female was 78 m and 15 minutes, respectively (Gazo and Aguilar 2005). Neves (1998) observed two types of diving in shallow near shore waters, which were thought to be associated with spot feeding and transit feeding. When spot feeding, seals dove as though headed into a current for 8-12 minutes, surfaced at about the same location, and usually repeated this pattern for approximately 3 hours. Transit feeding dives lasted 5-7 minutes, during which the seal moved continuously along a shoreline apparently foraging.

Mediterranean monk seals take a wide variety of prey primarily from shallow water habitats (Sergeant et al. 1978, Kenyon 1981). In the eastern Mediterranean, they have been reported to take fish such as striped red mullet (Mullus surmuletus), seabream (Dentex spp.), bogue (Boops boops), flathead mullet (Mugil cephalus), octopus (Octopus spp.) (Sergeant et al. 1978), and even loggerhead sea turtles (Caretta caretta) (Margaritoulis et al. 1996). Examination of two seals from the Aegean Sea yielded five species of prey; by weight, 94% of the contents were cephalopods including musky octopus (Eledone moschata) and globose octopus (Bathypolypus sponsalis) (Salman et at., 2001). In the Atlantic, at the Desertas Islands off Madeira, visual observations of monk seals with prey at the surface included seals eating golden-grey mullet (Liza aurata), parrot fish (Sparisoma cretense), barred hogfish (Bodianus scrofa), salema (Sarpa salpa), cuttlefish (Sepia officinalis) and crabs (Pachygrapsus spp.). Other prey reported includes eels (Anguilla spp.), limpets (Patella spp.) and rays (Raja spp.) (Neves, 1998).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Mediterranean monk seals are usually found along coastal waters, especially on the coastlines of islands. They are sometimes found in caves with submarine entrances when the female is giving birth and just to get away from other disturbances, such as boats.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Mediterranean monk seals are usually found along coastal waters, especially on the coastlines of islands. They are sometimes found in caves with submarine entrances when the female is giving birth and just to get away from other disturbances, such as boats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Usually found in coastal waters (9). Many of the traditional sandy haul-out beaches have been developed for tourism, and the species now tends to haul-out and pup in secluded, remote caves (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Mediterranean monk seals are diurnal. They feed in shallow coastal waters on a large variety of fish. This includes eels, sardines, tuna, lobsters, flatfish, and mullets. They also feed on cephalopods such as octopuses.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

When communicating with each other they make very high pitched sounds. This is done mainly while in the water to let each other know if something is wrong or if danger is approaching.

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

These seals live up to 30 years of age.

Typical lifespan

Status: wild:
30 (high) years.

Average lifespan

Status: captivity:
23.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals, but one specimen lived 23.7 years old in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mediterranean monk seals mate during the months of September-November. Mating usually takes place in the water. They reproduce very slowly starting at the age of 4. The time between births is 13 months, and the gestation period is 11 months. Pups are born about 80-100 cm long and weigh 17-24 kg.

Sexual maturity is reached at about 4-6 years of age.

When females give birth, they go on the beach or in caves. A female will usually remain on the beach or in the cave nursing and protecting the pup for up to six weeks. During this time, the female must live off of stored fat because she never leaves the pup, not even to feed herself. The pup may remain with its mother for as long as 3 years even after weaning.

Breeding season: Mediterranean monk seals mate during the months of September-November.

Average number of offspring: 1.

Average gestation period: 11 months.

Range weaning age: 6 (high) weeks.

Range age at sexual or reproductive maturity (female): 4 to 6 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 19000 g.

Average gestation period: 289 days.

Average number of offspring: 1.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monachus monachus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0243-06|AY377142|Monachus monachus| AATCGATGATTGTTTTCCACAAATCACAAAGATATTGGTACTCTCTATCTATTGTTTGGCGCATGAGCTGGTATAGTAGGTACCGCTCTC---AGTCTTTTAATCCGCGCAGAACTAGGACAGCCTGGCGCTTTACTAGGAGAT---GATCAAATTTACAATGTAATCGTCACCGCTCATGCATTCGTAATAATCTTCTTCATGGTAATACCTATCATAATTGGAGGCTTCGGAAACTGGTTAGTGCCCTTAATA---ATTGGCGCTCCTGACATAGCATTTCCCCGGATAAATAATATGAGCTTCTGGCTCCTACCACCATCTTTTCTATTACTACTAGCTTCCTCCATAGTAGAAGCAGGCGCAGGAACAGGATGAACCGTTTATCCTCCCTTAGCCGGTAATCTAGCCCATGCAGGAGCATCCGTAGATCTA---ACAATCTTCTCTCTTCACCTGGCAGGTGTATCATCCATTCTTGGAGCTATTAATTTTATTACCACTATTATTAACATAAAACCTCCTGCAATATCTCAATATCAAATTCCCTTATTCGTATGATCTGTACTAATTACAGCAGTACTTCTACTACTATCATTACCAGTCCTAGCAGCT---GGTATTACTATACTACTAACAGATCGAAACTTAAACACAACATTCTTTGATCCTGCTGGAGGAGGTGATCCCATTCTATACCAACATCTATTTTGGTTCTTCGGACATCCTGAAGTATACATCCTAATTCTACCAGGATTTGGAATGATTTCACATATTGTCACTTACTACTCAGGTAAAAAA---GAACCTTTTGGCTATATAGGAATAGTCTGAGCAATAATGTCTATTGGCTTCCTAGGCTTTATTGTATGAGCCCATCATATATTTACCGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monachus monachus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2abc; C2a(i); E

Version
3.1

Year Assessed
2008

Assessor/s
Aguilar, A. & Lowry, L. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Due to its very small, fragmented population structure and declining numbers, the Mediterranean Monk Seal should remain classified as Critically Endangered (CR).

IUCN Evaluation of the Mediterranean Monk Seal, Monachus monachus
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

A population decline has been observed. The causes of population reduction are not reversible, nor well understood, nor have they ceased (see below).

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

In the Mediterranean Monk Seal, sexual maturity is attained in both sexes at an age of about 4 years and longevity is at least 20 years, but there is no information on age structure for any of the subpopulations. As a result, mean generation time cannot be calculated but probably exceeds 10 years.

The current worldwide population is about 350-450 individuals; information on past population numbers is not available, but it is inferred that only twenty years ago they were at least the double of present numbers. According to mark-recapture estimates based on photo identification, the subpopulation at Cabo Blanco, originally the most abundant and the only site that still seems to preserve a colony structure, declined in 1996 from about 317 individuals to 130 as a consequence of exposure to a phytoplanktonic toxin. Several small, fragmented subpopulations have disappeared in the last decade and overall numbers are in the decline except in two well protected areas (Sporades and Desertas Islands), which together shelter together less than 10% of the remaining individuals. Overall abundance trends in the Mediterranean are not available, but mortality caused by adverse fishing interaction continues to be alarmingly high in Greece and Turkey, the main stronghold for the species in this sea. Thus, the species qualifies for Critically Endangered.


B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Mediterranean Monk Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO is difficult to measure given the existence of small, fragmented subpopulations occupying small ranges, but it is probably

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The number of mature individuals is almost certainly

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)

The main subpopulation (that at Cabo Blanco) declined abruptly in 1996 to about one third its original number. Most others subpopulations continue a progressive decline, but the magnitude of these declines are unknown. Thus the Mediterranean Monk Seal qualifies for Critically Endangered under this criterion.

C2. A continuing decline

Overall numbers continue to decline as a consequence of high mortality rates caused by adverse fishing interactions in Greece and Turkey. Thus the Mediterranean Monk Seal qualifies for Critically Endangered under this criterion.

AND (a) and/or (b):

(a i) Number of mature individuals in each subpopulation: CR
All subpopulations, except those of Cabo Blanco and Greece-Turkey are composed of

(a ii) % individuals in one subpopulation: CR = 90?100%; EN = 95?100%; VU = 100%

(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The number of mature individuals is almost certainly

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

Predictive models indicate that probability of extinction in the wild is probably > 50% in 10 years or 3 generations (100 years max.) Thus the Mediterranean Monk Seal qualifies for Critically Endangered under this criterion.

Listing recommendation ? The Mediterranean Monk Seal was historically reduced to negligible population numbers as a consequence of persecution by fishermen and sealing. This produced a severe bottleneck that significantly reduced genetic variability. In the last half century, numbers have continued to decline mostly as a consequence of human invasion of habitat and adverse fishing interaction. The population is heavily fragmented and many small subpopulations have become extinct in the last two decades. In the two main extant subpopulations (Greece-Turkey and Cabo Blanco), the number of mature individuals is certainly lower than 250 and, except in the latter, the original colony social structure has been lost. Reproductive rates are abnormally low in both areas, potentially as a result of inbreeding. This is preventing demographic recovery. Conservation efforts have been mostly been ?only on paper? and adverse fishing interactions continue to produce alarmingly high mortality in the eastern Mediterranean. The only reserve areas that have served to stabilize population numbers or to produce some degree of recovery in the last 20 years are those of the northern Sporades and the Desertas, but these areas together only shelter less than 10% of the total population of the species. Mediterranean Monk Seals qualify for listing as Critically Endangered (CR).

History
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Fewer than 500 individuals of Mediterranean monk seals remain in the world today. They have been killed by fisherman who see them as competition, and many have been lost due to being caught in fishermans' nets. Pollution and boat traffic are also a problem for this species. Pollution comes mainly from human waste. This waste gets into the water in which the seals live and into the food that they eat. The problem with boat traffic is from a lot of boats being in the same area that the seals occupy, resulting at worst in collisions between seals and boats

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Extinct.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Critically Endangered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Monachus monachus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) by the IUCN Red List 2007 (1). Listed on Appendix I of CITES (3) and Appendices I and II of the Convention on Migratory Species (CMS, or Bonn Convention) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Mediterranean monk seal is the most endangered pinniped species in the world, with an estimated total population size of 350-450 animals, with 250-300 in the eastern Mediterranean within the largest subpopulation, of which about 150-200 are in Greece and about 100 in Turkey (Güçlüsoy 2004). Approximately 130 seals currently inhabit the Cabo Blanco area (Western Sahara-Mauritania); in the early 1990s this subpopulation was estimated at about 317 seals but a mass mortality event in 1996 reduced numbers to nearly a third (Forcada et al. 1999, Aguilar 1999). Approximately 20-23 inhabit the Desertas Island, Madeira (Pires and Neves 2001, UNEP/MAP 2005). The subpopulation at Cabo Blanco is the only large extant aggregation of the species and is unique in that it still preserves the structure of a colony (Aguilar 1999); the other subpopulations are composed of loose groups of extremely reduced size (usually less than 5 individuals). A recent review of monk seal occurrences reported from 1999-2005 suggests that at all other locations and countries about 14 additional seals can be accounted for (10 of the 14 in Algeria, plus an unspecified number of vagrants (UNEP/MAP, 2005)).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The Mediterranean monk seal is one of the most endangered species of mammals (IUCN, 1996), and was ranked as a marine mammal species in imminent peril of extinction in a recent analysis (Vanblaricom et al. 2001).

Mediterranean monk seals have a long history of interaction with humans that includes exploitation for subsistence needs, commercial harvest and persecution as a competitor for fisheries resources or because it produced damage to fishing gear. Once abundant, monk seals were written about and illustrated in the literature and depictions of classical antiquity. Along the coast of northwest Africa, they became the target of a commercial harvest for skins and oil by the Portuguese as early as the 15th century (Israels 1992).

Reasons for the recent population decline leading to the species status as critically endangered include increased human pressure displacing seals from their habitat, destruction of caves used for hauling out and breeding, continued mortality due to fisheries by-catch, deliberate aggression by fishermen to eliminate a competitor, even in countries and areas where the species is legally protected, disease, pollution and impoverished genetic diversity (Aguilar 1999).

Interactions with fisheries are of great conservation concern, particularly for the subpopulation in the eastern Mediterranean, where seals are killed through net entanglement and deliberately killings by fishermen. They could also suffer from depletion of fish stocks in this area as well as being harassed by anti-seal methods designed to protect aquaculture facilities. Illegal dynamite fishing might also kill seals (Güçlüsoy 2004, 2004). Monk seals have been entangled in a wide variety of fishing gear including set-nets, trawl nets and long-lines. They seem most vulnerable to set-nets placed on the bottom and can also become entangled in abandoned and discarded nets (Tudela 2004). The deaths of 130 seals over a 10-year period ending in 1999 pointed out the significance of deliberate killing as a source of mortality (Tudela 2004). Deliberate killing of monk seals by humans was responsible for 1/3 of all mortalities of 79 stranded animals in Greece and is considered the single most important source of mortality for this species (Androukaki et al. 1999). Adverse fishing interaction is not a source of concern for the Atlantic subpopulations (Aguilar 1999).

Analyses of 42 DNA microsatellite loci have show that, as a consequence of a severe bottleneck, all subpopulations have suffered a dramatic decrease in genetic variability over the last few centuries. Indeed, the genetic diversity of Mediterranean monk seals is amongst the lowest found in pinnipeds; it is comparable to Hawaiian monk seals and northern elephant seals. The potential consequences of mating between closely-related individuals include congenital defects leading to stillborn pups and a decreased reproductive rate, both of which have been documented in the Cabo Blanco colony. As a consequence, extremely low genetic variability and inbreeding have been pointed out as the main cause for the non-recovery of subpopulations that are not subject to significant human pressure, such as that in Cabo Blanco (Pastor et al. 2004, 2007). Additionally, low fitness and increased susceptibility to disease may be an effect of genetic erosion that can compromise a population and lead to extinction. The mass mortality event of 1997 may have decreased the genetic diversity in the Cabo Blanco seals by 12% (UNEP 2005), and reduced the subpopulation?s genetic diversity to a point where it cannot reproduce fast enough to overcome random events that effect survival (Forcada et al. 1999). Unless this factor is taken into account, usual conservation measures may prove ineffective.

Morbillivirus was isolated from Mediterranean monk seals after the mass mortality at Cabo Blanco in 1997. The virus most closely resembled dolphin morbillivirus (DMV) that was previously implicated in the 1991 mass mortality of striped dolphins in the Mediterranean Sea (Osterhaus et al. 1992, Van de Bildt et al. 1999). Canine distemper virus is present in stray dogs in Aegean Turkey at a level of approximately 9% in the population and this might be a source for future infections of monk seals through contacts in harbours and along shorelines (Gencay et al. 2004). However, although this virus was already circulating in monk seals prior to the mass mortality, there is some doubt as to whether it was responsible for the deaths that occurred. Indeed, the active virus was found in pups that went into a rehabilitation centre because their mothers had died, and none of them showed clinical signs and all survived the event without specific treatment. Dinoflagellate-produced saxitoxins were found in tissues from animals that died during the die-off and the suddenness of death of the animals and the general clinical symptoms suggest that the cause of death was from the toxins rather than a morbillivirus epidemic (Hernández et al. 1998). Toxic algal blooms (red tides) are favoured by oceanographic conditions near Cabo Blanco and were reported from nearby Morocco the south-eastern North Atlantic during a 25-year period leading up to the mass mortality. Toxic algal blooms are unpredictable and following the catastrophic loss of monk seals in 1997 must be considered a serious threat to the species (Reyero et al. 2000, UNEP 2005).

Contaminant burdens have always been suspected to be a threat to the Mediterranean monk seal and thus monitoring pollutants has been considered a high priority (Boulva 1979, Reijnders et al. 1993). However, information is only available on organochlorine pollutants, which were analyzed in the blubber of individuals collected during the 1990s from the Cabo Blanco and the Greek subpopulations. Residue levels were found to be very low in the former subpopulation and moderate to high in the latter (Borrell et al. 1997, 2007); the toxicological implications of these residues at the population level are unknown.

Mediterranean monk seals are at an unknown but suspected high level of risk from oil tanker and other ship accidents, spills and groundings. Animals could be oiled or coated in fuels and lubricants, exposed to other toxic or environment-altering chemicals or products and experience disturbance at haulouts or coastal feeding areas. Mauritania began oil extraction in offshore fields located about 400 km south of Cabo Blanco in 2006. This leads to increased tanker traffic in the area, and a greater chance for accidents, disturbance and collisions near important habitat. Three accidents or spills have occurred near monk seal habitat in the recent past, including a supertanker that spilled oil off of Morocco in 1989 (Israels 1992), an oil spill in the Madeira Islands in 1994 (UNEP 2005), and the grounding of a bulk carrier near Cabo Blanco in 2003 (UNEP 2005). None of these spills or accidents had any known impacts on monk seals, but they underscore the threat of significant impacts from a major maritime accident near an important monk seal site (UNEP 2005).

Human disturbance has also been identified as a primary factor in the decline in numbers of monk seals through displacement of animals from habitat. Traditionally, this was the consequence of expanding human populations and coastal development, but since the 1970s ?eco-tourism?, with organized or spontaneous tours of people seeking out monk seals to view at the few remaining locations, has grown to become one of the most significant hazards faced by monk seals in the eastern Mediterranean (Johnson and Lavigne 1999). Besides disturbance, tourist activities increase the risk of vessel accidents, spills, transmission of disease, and the discharge of pollutants and waste near the seals.

Additional risks to Mediterranean monk seals come from political instability and wars in some parts of their range, the challenge of implementing effective conservation for a species in a complex multi-national environment, weak enforcement of agreements and international laws, collapse of occupied pupping caves and reduction of the carrying capacity of the environment as a consequence of fishing overexploitation (Aguilar 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Mediterranean monk seals are highly sensitive to disturbance and humans have extensively used both the sea and beaches of their habitat for centuries, causing the population to collapse (2). The main threats facing this species are deliberate killing by fishermen who perceive the species as a competitor for fish, entanglement in fishing gear, disturbance and habitat loss through development and tourism, disease, and the effects of toxic algal blooms (2). In 1997, two thirds of the seals in the largest population, located at Cap Blanc, Mauritania, were lost due to the accumulation of toxins in fish following an algal bloom (5) (10). These shy creatures have taken to hauling out in caves to give birth, rather than on developed beaches, and the collapse of such caves is a further threat to the survival of the species (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Mediterranean monk seal is legally protected throughout its range. Two protected areas have been established specifically for monk seals in the Desertas Islands in the Madeira Archipelago and the Northern Sporades Islands National Marine Park in Greece. There are plans to set up additional nature reserves to protect more habitat for monk seals in the region.

Throughout the range of the species, widespread action has been taken to sensitize the local human population towards monk seal conservation, to restrict fishing gear and relocate the most adverse fishing practices, to develop monitoring programs and intervention protocols and to increase on-site capability to rehabilitate sick and injured individuals, particularly pups. Numerous agreements, conventions, and treaties are in force to protect monk seals internationally, and many workshops and conferences have brought together scientist and managers to discuss monk seal conservation issues and problems. Israels (1992) summarizes 30 years of this conservation history, and provides details on accomplishments and failures to meet objectives. Currently, there is in force a UNEP/Mediterranean Action Plan (issued first in 1978 and revised in 1988) for the conservation and management of monk seals in the Mediterranean and a CMS plan for the recovery of the monk seal in the eastern Atlantic (issued in 2005). The species is listed on CITES Appendix I.

However, all of the above actions have been insufficient to change the overall declining trend of this species. Most conservation initiatives occur only on paper and do not translate into real and effective conservation action in the field. As a consequence, most of the small subpopulations that survived three decades ago, when conservation of the species was already identified as being a priority are now extinct (Aguilar 1999). Today, human encroachment of haulout habitat, adverse interactions with fisheries and impoverished genetic variability are the main threats affecting the species. Unless there is urgent ion action, the extinction risk of the species is high (van Blaricom et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The IUCN Species Survival Commission Seal Specialist Group has devised an Action Plan for the conservation of the species, the aims of which include the involvement of local fishermen, research into the status of the species and the development of a captive breeding programme (7). A Greek National Programme for the Protection of the Monk Seal has been established, aiming to prevent human-induced mortalities of the species and to restore and maintain a viable self-supporting population (6). Some experts believe that the removal of pups from a population, to supply a captive programme, could severely affect breeding within the wild population, and injure the pups concerned (7). Captive breeding is usually recommended for mammal species of such low numbers as this and with threats continuing in the wild, but concerns that removing young seals from the wild will not severely affect breeding in the wild and will not injure or negatively affect survival of the captured young must be adequately addressed (11). It is clear that determined action is urgently required if this reclusive, beleaguered species is to escape total extinction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The only way that Mediterranean monk seals affect humans negatively is that compete with fishermen. These seals are mainly harmless otherwise.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past the Mediterranean monk seal was killed for its skin and body parts, which were said to provide protection against a variety of medical problems. The seal has also been killed for food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mediterranean monk seal

The Mediterranean monk seal (Monachus monachus) is a pinniped belonging to the Phocidae family. At some 450-510 (fewer than 600[2]) remaining individuals, it is believed to be the world's second-rarest pinniped (second only to the Saimaa ringed seal),[1] and one of the most endangered mammals in the world.[1]

It is present in parts of the Mediterranean Sea and the eastern Atlantic Ocean waters around the Tropic of Cancer, as well.

Contents

Description

This species of monk seal grows from approximately 80 cm long at birth up to an average of 2.4 m (7.95 ft) as adults. Males weigh an average of 315 kg (695 lbs) and females weigh 300 kg (660 lbs)), overall weigh ranging from 240 to 400 kg (530-880 lbs).[1][3][4][5] They are thought to live up to 45 years old;[3] the average life span is thought to be 20 to 25 years old and reproductive maturity is reached at around age four.

The monk seals' pups are about a meter long and weigh around 15-18 kilograms, their skin being covered by 1-1.5 centimeter-long, dark brown to black hair. On their bellies, there is a white stripe, which differs in color between the two sexes. This hair is replaced after six to eight weeks by the usual short hair adults carry.[3]

Pregnant Mediterranean monk seals typically use inaccessible undersea caves while giving birth, though historical descriptions show they used open beaches until the 18th century. There are eight pairs of teeth in both jaws. Believed to have the shortest hair of any pinniped, the Mediterranean monk seal fur is black (males) or brown to dark grey (females), with a paler belly, which is close to white in males. The snout is short broad and flat, with very pronounced, long nostrils that face upward, unlike their Hawaiian relative, which tend to have more forward nostrils. The flippers are relatively short, with small slender claws. Monk seals have two pairs of retractable abdominal teats, unlike most other pinnipeds.

Reproduction

Very little is known of this seal's reproduction. Scientists have suggested they are polygynous, with males being very territorial where they mate with females. Although there is no breeding season, since births take place year round, there is a peak in October and November. This is also the time when caves are prone to wash out due to high surf or storm surge, which causes high mortality rates among monk seal pups, especially at the key Cabo Blanco colony. According to the IUCN species factsheet, "pup survival is low; just under 50% survive their first two months to the onset of their moult, and most mortalities occurred in the first two weeks. Survival of pups born from September to January is 29%. This very low survival rate is associated with mortality caused by severe storms, and high swells and tides, but impoverished genetic variability and inbreeding may also be involved. Pups born during the rest of the year had a survival rate of 71%".

In 2008, lactation was reported in an open beach, the first such record since 1945, which could suggest the seal could begin feeling increasingly safe to return to open beaches for breeding purposes in Cabo Blanco.[6]

Pups make first contact with the water two weeks after their birth, and are weaned at around 18 weeks of age; females caring for pups will go off to feed for an average of nine hours.[1] Most individuals are believed to reach maturity at four years of age. The gestation period lasts close to a year. However, it is believed to be common among monk seals of the Cabo Blanco colony to have a gestation period lasting slightly longer than a year.

Diet

Mediterranean monk seals are diurnal and feed on a variety of fish and mollusks, primarily octopus, squid, and eels, up to 3 kg per day. They are known to forage mostly at depths of 150–230 feet,[1] but (as a species) have been observed by the NOAA in a submersible at a known feeding ground at a depth of 500m. Monk seals prefer hunting in wide-open spaces, enabling them to use their speed more effectively. They are successful bottom-feeding hunters, and have been observed (as a species) lifting slabs of rock in search of prey.

Habitat

The habitat of this pinniped has changed over the years. In ancient times, and up until the 20th century, Mediterranean monk seals had been known to congregate, give birth, and seek refuge on open beaches. In more recent times, they have left their former habitat and now only use sea caves for such things; and more often than not, these caves are rather inaccessible to humans due to underwater entries, and because the caves are often positioned along remote or rugged coastlines.

Scientists have confirmed this is a recent adaptation, most likely due to the rapid increase in human population, tourism, and industry, which have caused the destruction of animals' habitat. Because of these seals' shy nature and sensitivity to human disturbance, they have slowly adapted to try to avoid contact with humans completely within the last century, and, perhaps, even earlier. The coastal caves are, however, dangerous for newborns, and are causes of major mortality among pups.

Status

This earless seal's former range extended throughout the Northwest Atlantic Africa, Mediterranean and Black Sea, coastlines, including all offshore islands of the Mediterranean, and into the Atlantic and its islands: Canary, Madeira, Ilhas desertas, Porto Santo... as far west as the Azores. Vagrants could be found as far south as Gambia and the Cape Verde islands, and as far north as continental Portugal and Atlantic France.[1]

Several causes have provoked a dramatic population decrease over time: on one hand, commercial hunting (especially during the Roman Empire and Middle Ages) and, during the 20th century, eradication by fishermen, who used to consider it a pest due to the damage the seal causes to fishing nets when it preys on fish caught in them; and, on the other hand, coastal urbanization and pollution.[1]

The species has gone extinct in the Sea of Marmara due to pollution and heavy ship traffic from the Dardanelles and the Bosporus. In addition, the last report of a seal in the Black Sea dates to the late 1990s.[citation needed]

Nowadays, its entire population is estimated to be less than 600 individuals scattered throughout a wide distribution range, which qualifies this species as Critically Endangered. Its current very sparse population is one more serious threat to the species, as it only has two key sites which can be deemed viable. One is the Aegean Sea (250-300 in Greece and some 100 in Turkey) and the other is the Western Saharan portion of Cabo Blanco (some 130 individuals which may support the small, but growing, nucleus in the Desertas Islands –approximately 20 individuals[1]).

These two key sites are virtually in the extreme opposites of the species' distribution range, which makes natural population interchange between these two key sites impossible. All the other remaining subpopulations are composed of less than 50 mature individuals, many of them being only loose groups of extremely reduced size – often less than 5 individuals.[1]

These other remaining populations are in Madeira, with 30 to 35 individuals,[7] and the Desertas Islands (both in the Atlantic Ocean) and southwestern Turkey and the Ionian Sea (both in the eastern Mediterranean). The species status is virtually moribund in the western Mediterranean, which still holds tiny Moroccan and Algerian populations, associated with rare sightings of vagrants in the Balearic Islands,[8] Sardinia, and other western Mediterranean locations.

Cabo Blanco 1997 die off

Cabo Blanco, in the Atlantic Ocean, is the largest surviving single population of the species, and the only remaining site which still seems to preserve a colony structure.[1] In the summer of 1997, two-thirds of its seal population were wiped out within two months, extremely compromising the species' viable population. While opinions on the precise causes of this epidemic remain divided (the most likely cause being a morbilivirus or, more likely, a toxic algae bloom,[1]) the mass die-off emphasized the precarious status of a species already regarded as critically endangered throughout its range.

While still far below the early 1997 count, numbers in this all-important location have started a slow-paced recovery ever since. Currently, the population in this location is estimated at 150 individuals, down from some 310 in 1997, but still the largest single colony by far. The threat of a similar incident that could wipe out the entire population remains.[9]

Preservation

Damage inflicted upon fishermen's nets and rare attacks on off-shore fish farms in Turkey and Greece are known to have pushed local people towards hunting the Mediterranean monk seal, but mostly out of revenge, rather than population control. Preservation efforts have been put forth by civic organizations, foundations, and universities in both countries since as early as the 1970s. For the past 10 years[citation needed], many groups have carried out missions to educate locals on damage control and species preservation. Reports of positive results of such efforts exist throughout the area.[10]

In the Aegean Sea, only Greece has allocated a large area for the preservation of the Mediterranean monk seal and its habitat. The Greek Alonissos Marine Park, that extends around the Northern Sporades islands, is the main action ground of the Greek MOm organisation.[11] MOm is greatly involved in raising awareness in the general public, fundraising for the helping of the monk seal preservation cause, in Greece and wherever needed. Greece is currently investigating the possibility of declaring another monk seal breeding site as a national park, and also has integrated some sites in the NATURA 2000 protection scheme. The legislation in Greece is very strict towards seal hunting, and in general, the public is very much aware and supportive of the effort for the preservation of the Mediterranean monk seal.

The complex politics concerning the covert opposition of the Greek government towards the protection to the monk seals in the eastern Aegean in the late 1970s is described in a book by William Johnson.[12] Oil companies apparently may have been using the Monk Seal Sanctuary project as a stalking horse to encourage greater cooperation between the Greek and Turkish governments as a preliminary to pushing for oil extraction rights in a geopolitically unstable area. According to Johnson, the Greek secret service, the YPEA, were against such moves and sabotaged the project to the detriment both of the seals and conservationists, who, unaware of such covert motivations, sought only to protect the species and its habitat.

One of the largest groups among the foundations concentrating their efforts towards the preservation of the Mediterranean monk seal is the Mediterranean Seal Research Group (Turkish: Akdeniz Foklarını Araştırma Grubu) operating under the Underwater Research Foundation (Turkish: Sualtı Araştırmaları Derneği) in Turkey (also known as SAD-AFAG). The group has taken initiative in joint preservation efforts together with the Foça municipal officials, as well as phone, fax, and email hotlines for sightings.[13]

Preservation of the species requires both the preservation of land and sea, due to the need for terrestrial haul-out sites and caves or caverns for the animal to rest and reproduce. Even though responsible scuba diving instructors hesitate to make trips to known seal caves, the rumor of a seal sighting quickly becomes a tourist attraction for many. Irresponsible scuba diving trips scare the seals away from caves which could become habitation for the species.

Rare Sightings

In June 2009, there was a report of a sighting off the island of Giglio, in Italy.[14] On 7 January 2010, fishermen spotted an injured Mediterranean monk seal off the coasts of Tel Aviv, Israel. When zoo veterinarians arrived to help the seal, it had slipped back into the waters. Members of the Israel Marine Mammal Research and Assistance Center arrived at the scene and tried to locate the injured mammal, but with no success. This was the first sighting of the species in the region since Lebanese authorities claimed to have found a population of 10–20 other seals on their coasts 70 years earlier.[15] In addition, the seal was also sighted a couple of weeks later in the northern kibbutz of Rosh Hanikra.[16]

In April 2010, there was a report of a sighting off the island of Marettimo, in the Egadi Islands off the coast of Italy, near the Province of Trapani.[17]

In November 2010, a Mediterranean monk seal, supposedly aged between 10 and 20, has been spotted in Bodrum, Turkey.[18]

On December 31, 2010, the BBC Earth news[19] reported that the MOm Hellenic Society had located a new colony of seals on a remote beach in the Aegean Sea. The exact location was not communicated so as to keep the site protected. The society was appealing to the Greek government to integrate the part of the island on which the seals live into a marine protected area.

On March 8, 2011, the BBC Earth news [20] reported that a pup seal had been spotted on 7 February while monitoring a seal colony on an island in the southwestern Aegean Sea. Soon after, it showed signs of weakness and it was taken to a rehabilitation centre to try to save it. The aim is to release it back into the wild as soon as it is strong enough.

On June 24, 2011, the Blue World Institute of Croatia [21] filmed an adult female underwater in the northern Adriatic, off the island of Cres.

See also

Notes

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!