Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"Male hooded seals have a fleshy sac above the nostrils that they can inflate. It grows as the animal gets older, and looks a lot like a hood over the nose—thus the name ""hooded seal."" The seals can also inflate the strip of flesh that separates the nostrils. Blown up, it looks like a red balloon. Males use these structures to attract females, or perhaps to threaten other males, or both. They mate with several females, and protect each female and her offspring from other males while the pups are nursing. Nursing lasts only four days, and in that time, the pup doubles its birth weight, gaining 7 kg per day, mostly in blubber, by feeding on milk that is twice as rich in fat as whipping cream. After four days, the mother leaves her pup, who lives on the stored fat for several weeks, until it is old enough to swim and catch fish to eat."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Erxleben, J.C.P., 1777.  Systema regni animalis per classes, ordines, genera, species, varietas, cum synonymia et historia animalium.  Classis I, Mammalia,  1:590.  Wegand, Leipzig, 636 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Hooded Seal: A large Atlantic-Arctic seal with a 'balloon' on the face of the males
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Silver gray with larger irregular black blotches; Dark on face and top of foreflippers; Males have large inflatable nose (hood) and extrudable membrane in nostril
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Hooded Seals are found at high latitudes within the North Atlantic; seasonally they extend their range north into the Arctic Ocean, as well as south into the North Sea in the Northeast Atlantic. They breed on pack ice and are associated with it much of the year, though they spend significant periods of time pelagically, without hauling out (Lavigne and Kovacs 1988, Folkow and Blix 1999). There are four major pupping areas: near the Magdalen Islands in the Gulf of St Lawrence, north of Newfoundland in an area known as the “Front,” the Davis Strait (Sergeant 1974) and in the West Ice in the Greenland Sea near the island of Jan Mayen. Hooded Seals wander extensively sometimes; young animals have come ashore as far south as Portugal and the Canary Islands in Europe and south into the Caribbean in the West Atlantic (Kovacs and Lavigne 1986). They are increasingly common in recent years on Sable Island and along the New England coast (Harris et al. 2001, Lucas and Daoust 2002). They have also been found outside the Atlantic in the eastern Beaufort Sea and an adult female stranded in southern California in 1992 (Dudley 1992, Rice 1998, Kovacs 2002). Since the mid 1990s large numbers of vagrant Hooded Seals have been found away from the Arctic in some years; the numbers of these sightings are increasing for unknown reasons (Mignucci-Giannoni and Haddow 2002, Harris and Gupta 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Hooded seals are generally found from 47° to 80° N latitude. They occur along the eastern coast of North America north of Maine. Hooded seals also reach the western tip of Europe, along the coast of Norway. They are mainly concentrated around Bear Island, Norway, Iceland, and northeast Greenland. In rare cases they have been found in Siberia.

Biogeographic Regions: nearctic (Native ); arctic ocean (Native ); atlantic ocean (Native )

Other Geographic Terms: holarctic

  • Kovacs, K., D. Lavigne. 1986. Cystophora cristata. Mammalian Species, 258: 1-9. Accessed November 29, 2009 at http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/default.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Gulf of St. Lawrence, North West Atlantic, Northern North Atlantic, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, St. Lawrence Estuary, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Usual distribution limited to arctic and subarctic North Atlantic, from Newfoundland to southern Greenland, Svalbard, and Novaya Zemlya (Russia); occasionally south to Portugal and Florida, with additional erratic occurrences far from usual range. Whelping areas include Gulf of St. Lawrence, the "Front" off southeastern Labrador, middle of Davis Strait, and West Ice near Jan Mayen Island (a few pups have been born on the coasts of Norway and Maine). Summer molting areas are in Denmark Strait off southeastern Greenland and on the pack ice of the Greenland Sea north of Jan Mayen Island (Reeves et al. 1992). Occurrences in the northern Gulf of Maine region increased greatly during the 1990s (McAlpine et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Hooded seals have blue-gray pelage with black spots over the body. The front of the face is black and this coloration extends posteriorly to just behind the eyes. Their limbs are rather small in proportion to their body, but are powerful nonetheless, making these seals excellent swimmers and divers. Hooded seals exhibit marked sexual dimorphism. Males are slightly longer than females, and reach 2.5 m in length; females average 2.2 m. The more significant difference between the sexes is weight. Males weigh up to 300 kg while females only weigh up to 160 kg. Also unique to males is the inflatable hood and nasal septum.

Hooded seals get their name from the inflatable “hood” on the top of the heads of males. The hood is not present until males are about 4 years old. When the hood is deflated, it hangs down over the upper lip. Males inflate this red, balloon-like nasal septum until it protrudes out of one nostril. Males use this nasal sac for aggressive display and also to get the attention of females.

Hooded seals have many characteristics that differentiate them from other phocids. They have the largest nostrils in the family. The skull is short with a wide snout. They also have a palate that projects posteriorly further than any other seal. One-third of the nasal bone extends beyond the edge of the maxilla. Their incisor formula is unique, with two upper and one lower incisor. The teeth are small and the tooth row is narrow. The dental formula is I 2/1, C 1/1, PC 5/5. Hooded seals have light and dark bands of cementum in the canines that can be used to determine age.

At birth the coloring of young is silver on the dorsal side, without spots, and blue-gray on the ventral side, which accounts for their nickname ”bluebacks.” Young are 90 to 105 cm in length when born and average 20 kg. Around age 1, differences between males and females can be observed; males begin growing larger in weight and length.

Range mass: 160 to 300 kg.

Range length: 2.2 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • 2007. "Cystophora cristata, Hooded Seal" (On-line). MarineBio. Accessed November 29, 2009 at http://marinebio.org/species.asp?id=304.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 250 cm

Weight: 40000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are almost twice as heavy as females.

Length:
Range: 2.3-2.9 m males; 2-2.3 m females

Weight:
Average: 250 kg males; 180 kg females
Range: up to 435 kg males; up to 350 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: medium size seal, male has inflatable red nasal sac, adult is mottled bluish-grey with a black face. Pups are white but quickly moult to blue coat on back, dark face and white underbelly "bluebacks"
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Hooded Seals are a markedly sexually dimorphic ice-breeding pinniped. Adult male hooded seals average 2.5 m in length and 300 kg (Kovacs and Lavigne 1986), with large animals reaching over 400 kg (Kovacs 2002). Adult females are smaller, averaging 2.2 m and 160 kg, but can reach 300 kg (Kovacs and Lavigne 1992). Pups are born at approximately 1 m in length and 24 kg (Kovacs and Lavigne 1992).

Hooded Seals pup on pack ice in mid March. The breeding season for this polygynous species is very short, usually lasting only about 2.5 weeks, and mating takes place in the water (Boness et al. 1988, Kovacs 1990). This species has the shortest lactation period for any mammal, with most pups being weaned in four days (Bowen et al. 1985). Pups weigh an average of 48 kg at weaning in the Northwest stocks (Kovacs and Lavigne 1992, Lydersen et al. 1997). The short reproductive period is energetically advantageous to both males and females, with relative losses in body mass being small for both sexes compared to other phocid seals (Kovacs and Lavigne 1992, Kovacs et al. 1996).

Hooded Seals moult in July, with each breeding stock congregating at a separate, traditional site, north of their whelping areas. If mixing does occur, the degree to which this takes place is unknown. Following the moulting period each stock disperses in the North Atlantic; movement patterns are only documented for the Greenland Sea stock (Folkow and Blix 1995, 1999, Folkow et al. 1996). Apart from the breeding and moulting periods where Hooded Seals form loose aggregations in specific areas, it is thought that hooded seals live quite solitary lives. However, little is in fact known about them outside the periods when they congregate. Groups of females with young animals have been seen at the northern ice edge in summer, but it is not known whether the groups were socially facilitated or solely the result of concentrations of prey (Kovacs pers. Obs.). Hooded seal longevity is 25-30 years (Kovacs 2002).

Hooded Seals are very capable divers that spend extensive periods at sea without hauling out (Folkow and Blix 1999). Most of their dives are from 100-600 m in depth and last 5-25 minutes, however, very deep dives to over 1,000 m and dives lasting almost an hour have been recorded (Folkow et al. 1996, Lydersen et al. Unpubl. Data). Hooded Seals feed on a wide variety of fish and invertebrates, including species that occur throughout the water column. Examples of typical prey are Parathemisto, Greenland halibut, members of the cod family such as Polar and Atlantic Cod, redfishes (Sebastes spp.), sand eels, herring, capelin, squid (e.g. Gonatus fabricii), and shrimp (Haug et al. 2004, 2007).

Polar Bears and Killer Whales are known Hooded Seall predators (Lavigne and Kovacs 1988); Greenland Sharks might also take young Hooded Seals.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hooded seals are found in coastal areas of Atlantic and Arctic Oceans. They are successful divers that spend much of their time in the water. They usually dive to a depth of 600 m but can go as deep as 1000 m. When they are on land they usually occur in areas with significant ice cover or made up of ice packs. They migrate annually in order to stay in areas where there is drifting pack ice.

Range depth: 100 to 1000 m.

Average depth: 600 m.

Habitat Regions: polar ; terrestrial ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

large ice packs and in deep waters of the Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

pack ice areas
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.308 - 26.745
  Nitrate (umol/L): 0.266 - 8.491
  Salinity (PPS): 32.419 - 36.478
  Oxygen (ml/l): 4.626 - 8.214
  Phosphate (umol/l): 0.052 - 0.762
  Silicate (umol/l): 1.470 - 5.416

Graphical representation

Temperature range (°C): -0.308 - 26.745

Nitrate (umol/L): 0.266 - 8.491

Salinity (PPS): 32.419 - 36.478

Oxygen (ml/l): 4.626 - 8.214

Phosphate (umol/l): 0.052 - 0.762

Silicate (umol/l): 1.470 - 5.416
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Pelagic; normally in deep water or hauled out on heavy drift ice (Reeves and Ling 1981). Rarely on land or shore-fast ice except in Gulf of St. Lawrence (Kovacs and Lavigne 1986). Pups are born usually at center of large ice floe (Reeves and Ling 1981), in traditional breeding areas. Pupping habitat generally is transient and unstable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central and western North Atlantic-Arctic; Associated with edge of pack ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

After breeding, populations in eastern Canada migrate north and reach western Greenland by late spring. Within a few weeks many migrate southward, later joining large molting assemblies east of Greenland in July and August. (Katona et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hooded seals eat a variety of marine prey, especially fish, such as redfish, herring, polar cod, and flounder. They also feed on octopus and shrimp. Some research indicates that during the winter and autumn hooded seals feed more on squid and switch to primarily fish in the summer, especially polar cod. Pups first begin feeding near the shore and eat mainly squid and crustaceans. When Arctic algae and phytoplankton bloom, their energy is transferred to fatty acids. These food sources are eaten by herbivores and make their way up the food chain to the top predators like the hooded seal. The fatty acids that begin at the bottom of the food chain are then stored in the blubber of the seals. This blubber is sustained throughout the autumn and winter and used as an energy resource in the summer during the molting and breeding season when fasting occurs.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

  • Haug, T., K. Nilssen, L. Lindblom, U. Lindstrom. 2007. Diets of hooded seals (Cystophora cristata) in coastal waters and drift ice waters along the east coast of Greenland. Marine Biology Research, Vol. 3 Issue 3: 123-133.
  • Falk-Petersen, S., T. Haug, H. Hop, K. Nilssen, A. Wold. 2009. DEEP-SEA RESEARCH PART II-TOPICAL STUDIES IN OCEANOGRAPHY. DEEP-SEA RESEARCH PART II-TOPICAL STUDIES IN OCEANOGRAPHY, Vol. 56 Issue 21-22: 2080-2086.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats redfish, Greenland turbot, octopus, squid, herring, capelin, shrimp, and mussels (Katona et al. 1983). Pelagic feeder; may dive deeply when feeding. Pups initially feed near ice edge on crustaceans and squid (Kovacs and Lavigne 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Squid and fish (cod, redfish, halibut); Deep long feeding dives
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Hooded seals often find themselves the host of parasitic worms, such as heartworms, Dipetalonema spirocauda. Often these parasites result in shortened lifespans. Hooded seals are predators of many fishes, such as polar cod, squid, and various crustaceans. They are preyed on by sharks, orcas, and polar bears.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In recent times, the major predators of hooded seals have been humans. The sealing industry began in the 18th century and these mammals were hunted for 150 years without any restrictive laws. More than 500,000 seals (hooded and harp seals) were caught per year between 1820 and 1860. At first, sealing was popular because there was a demand for oil and leather. After the 1940s, seals began to be hunted for their fur and one of the most prized species was the hooded seal, considered four times more valuable than other seals. A quota to limit hunting was introduced in 1971 and was set at 30,000.

Natural predators of hooded seals include sharks, polar bears, and killer whales. Polar bears mainly feed on harp and bearded seals but will hunt hooded seals when they are breeding on ice and are more visible, vulnerable targets.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: No exact figures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Estimates range from 300,000 to 750,000 worldwide. In the late 1980s, 60,000 pups were born at the West Ice, suggesting a total population there of perhaps 250,000 seals one year old or older. Mid-1980s data indicate a population of about 300,000 (60,000 pups born annually) at the Front off Newfoundland. In 1990, more than 2000 pups were born in the Gulf of St. Lawrence. Davis Strait population was estimated at 18,600 pups and 93,000 seals one year old or older in the mid-1980s (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Solitary throughout most of year. Polar bears sometimes kills large numbers of young.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Hooded seals are able to make vocalizations such as roars that can be heard easily on land. However, their most important form of communication is produced from the hood and septum. They are able to produce pulses ranging from 500 to 6 Hz, these sounds can be heard on land and in the water. They are often seen moving their inflated hood and nasal septum up and down, which can create sounds described as “pings” and “whooshes”. This method of communication can serve as male display for females but also serve as threats.

Communication Channels: visual ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Intermittently active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Size at birth 0.9-1m (3-3.3 ft), 11kg (25 lbs); Sexual maturity at 5-7 years; Females have pups every year; Short (4 day) nursing period on extremely fat milk; Longevity about 35 year; Behavior; Solitary except when breeding and molting; Vocal on ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The expected maximum lifespan of hooded seals is 35 years. In this sexually dimorphic species the differences in body size among males and females result in differences in longevity. In hooded seals males are larger and have shorter lifespans. The mortality rate of adults is 7 to 15% a year. One cause of death is known to be infections from the parasitic heartworm, Dipetalonema spirocauda. Before there were restrictions on hunting, humans were the main cause of death in hooded seals. Captive hooded seals have been reported to die from tuberculosis and cranial infections.

Typical lifespan

Status: wild:
35 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The total gestation time, of approximately 11.5 months, includes a 4 months period of delayed implantation (Ronald Nowak 2003). In the wild, these animals have been estimated to live more than 35 years (David Macdonald 1985). Little is known about their longevity in captivity, though.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During the short time that the mother is giving birth and nursing her pup, several males will be in close proximity to her in order to obtain mating rights. At this time many males will aggressively threaten each other using their inflated nasal sac and even push each other out of the breeding area. Males do not typically defend personal territories; they only defend the area where there is a receptive female. A successful male will then mate with the female in the water. Once returning to land he will search for another female. Mating occurs typically through April and June.

Mating System: polygynous

Females reach the age of sexual maturity between 2 and 9 years old and it is estimated that most females give birth to their first young at around 5 years of age. Males reach sexual maturity a little later around 4 to 6 years old but often do not mate until much later. Females give birth to one young at a time through March and April. The gestation period is 240 to 250 days. During this time the fetus - unlike those of other seals - sheds its lanugo (a covering of fine soft hair that is replaced thicker pelage) in the uterus. These young are precocial and at birth are able to move about and swim with ease. They are independent and left to fend for themselves immediately after they have been weaned.

Breeding interval: Hooded seals breed once a year.

Breeding season: Hooded seals breed from April to June.

Range number of offspring: 1 to 1.

Range gestation period: 240 to 250 days.

Range birth mass: 10 to 30 kg.

Range weaning age: 5 to 12 days.

Range age at sexual or reproductive maturity (female): 2 to 9 years.

Average age at sexual or reproductive maturity (female): 3.2 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 1.

Hooded seals have the shortest nursing period of any mammal, from 5 to 12 days. The milk of the female is rich in fat, which makes up about 60 to 70% of its content and allows the pup to double in size during its short nursing period. During this same period, the mother loses 7 to 10 kg each day. Females are protective of their pup during their short weaning interval. They fight potential predators, including other seals and humans. Males do not invest energy in defending their young. Since young are precocial at birth and already able to crawl and swim, little is done to help raise them.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • 2007. "Cystophora cristata, Hooded Seal" (On-line). MarineBio. Accessed November 29, 2009 at http://marinebio.org/species.asp?id=304.
  • 2009. "Cystophora cristata" (On-line). IUCN Red List of Threatened Species. Version. Accessed November 20, 2009 at http://www.redlist.org/apps/redlist/details/6204/0.
  • 2001. "Seal Conservation Society" (On-line). Hooded Seal. Accessed December 01, 2009 at http://www.pinnipeds.org/species/hooded.htm.
  • Kovacs, K., D. Lavigne. 1986. Cystophora cristata. Mammalian Species, 258: 1-9. Accessed November 29, 2009 at http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/default.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Single pup is born mid-March to mid-April (peak in second half of March). Breeds near end of lactation period, which lasts only about 4 days. In any given area, breeding season spans only 2-2.5 weeks. One to several males may be on ice floe with female and pup; these groupings are widely scattered (loose aggregations). Females sexually mature usually in 3-4 years; more than 90% of adult females are pregnant each year. Males sexually mature in 4-6 years but do not do much breeding until several years older. Few live beyond their late 20s. Polygynous mating system.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cystophora cristata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0245-06|AY377144|Cystophora cristata| AATCGATGATTATTTTCTACTAATCATAAGGATATTGGCACTCTTTATCTGCTGTTTGGTGCATGAGCTGGTATAGTGGGCACTGCCCTT---AGTCTCTTAATCCGCGCAGAACTGGGACAACCCGGCGCCCTGCTGGGAGAT---GATCAAATTTATAACGTAATTGTCACTGCCCATGCATTTGTAATAATTTTCTTCATGGTGATGCCTATTATAATTGGCGGTTTTGGGAACTGACTAGTACCCCTAATA---ATCGGCGCTCCTGATATAGCATTCCCCCGAATAAACAATATGAGTTTCTGACTCTTGCCACCATCCTTCCTGCTACTACTGGCCTCCTCTATAGTGGAAGCGGGTGCCGGGACCGGATGAACCGTCTATCCTCCCTTAGCTGGCAACTTAGCTCATGCGGGAGCATCTGTAGACCTA---ACGATTTTCTCCCTTCATTTGGCAGGTGTATCGTCTATCCTCGGAGCTATCAACTTCATTACTACCATCATTAACATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTATTCGTATGATCCGTACTAATCACAGCAGTGCTCTTACTACTATCACTACCAGTTCTAGCAGCT---GGCATTACTATGCTACTCACAGACCGAAATCTGAACACAACATTCTTCGACCCTGCTGGAGGAGGCGATCCTATCCTATATCAACACCTGTTCTGATTCTTCGGACATCCCGAGGTATATATCCTAATCCTACCAGGATTCGGAATAATCTCACACATCGTTACCTACTATTCAGGGAAAAAA---GAACCTTTTGGTTACATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTTATTGTATGAGCTCACCACATATTCACTGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cystophora cristata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2b

Version
3.1

Year Assessed
2008

Assessor/s
Kovacs, K. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Hooded Seals in the northwest Atlantic breeding areas are currently either stable or increasing modestly. However, the northeast Atlantic stock has declined by 85-90 % over the last 40-60 years. The cause of the decline is unknown, but very recent data suggests that it is on-going (30% within 8 years), despite the protective measures that have been taken in the last few years. Although the Hooded Seal is thought to be panmictic, the precipitous decline in the eastern stock (from over half a million to 70 000) over a period of a few decades warrants that the hooded seal be classified as Vulnerable.

IUCN Evaluation of the Hooded Seal, Cystophora cristata
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Generation time in Hooded Seals is approximately 10 years. Hooded Seals have experienced a dramatic decline over the last three generations (30 years) in the northeast Atlantic stock but the causes are not clearly reversible, nor understood (global decline is, however, not > 50%).

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under Al.

Hooded Seals in the northeast Atlantic have experienced a dramatic decline over the past 40-60 years (the precise time-frame is not known). This stock has been reduced by 85-90% since World War II. It is currently in decline, the causes of which are unknown (the decline may not be reversible). The northwest Atlantic stock of hooded seals is stable or increasing moderately in recent decades. Overall, the global population has declined by approximately 35-40% and thus this species should be considered Vulnerable.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1

There is concern that Hooded Seal will be negatively impacted by climate-change induced alternations to sea ice extent and character, as well as potential changes in the ecosystem that will affect its food supply. The relatively restricted distribution and some degree of overlap in diet with commercial fisheries add to the risk factor for this species.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

It is suspected that a population reduction will occur in the next 100 years for Hooded Seals due to climate-change induced alterations to the physical and biological resources upon which this species depends. A marked reduction has already been observed in the northeast Atlantic for unknown reasons. The decline has not ceased and may not be reversible.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Hooded Seals is >20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Hooded Seals is > 2,000 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN
(b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.

(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
Both segments of the hooded seal population exceed 10,000 mature individuals.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)

C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR
or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%

(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
Both segments of the hooded seal population exceed 1,000 mature individuals.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no population viability analysis conducted on hooded seals.

Listing recommendationThe relatively restricted distribution of Hooded Seals, their dependence on sea ice for breeding, moulting and resting and the observed, significant, declines for unknown reasons in the northeast Atlantic stock suggest that upgrading of this species to Vulnerable is warranted under criterion A2b. The observation of increased numbers of vagrant Hooded Seals well beyond their normal range, on both sides of the North Atlantic, suggests that the global population of Hooded Seals is experiencing change throughout the species range, despite the contrasting population trends in the west and east.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Hooded seals were hunted in high numbers starting in the 18th century. The popularity of their pelts, especially of the “bluebacks”, which are pup pelts, resulted in a rapid decline of populations. After World War II the hunt for hoodeds seals increased, resulting in concern that they would become endangered. In 1958 laws were introduced, followed by quotas in 1971. Recent efforts include treaties and agreements, banning of hunting in areas such as the Gulf of St. Lawrence, and bans on importation of seal products. Despite these measures hooded seal populations are still on the decline for unknown reasons.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Widespread distribution in arctic and subarctic North Atlantic; relatively abundant (several hundred thousand individuals); relatively secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Aerial surveys carried out at all three whelping areas in the Northwest Atlantic in 2005 produced an estimate of 116,900 pups born. The whole population, modelled based on the pup counts, produced an estimate of 592,000 individuals (Waring et al. 2005). This suggests a moderate increase both in pup production and population size between the mid 1980s and 2005 (Hammill and Stenson 2006, 2007). Hooded Seals in the northeast Atlantic are showing an opposite trend. Pup production estimated for the Greenland Sea stock (West ice, near Jan Mayen) in 2005 was 15 250 pups, which in turn produces an estimate of total population size of about 70,000 animals (Øigård and Haug 2007, Salberg et al. 2008). This population estimate for the northeast Atlantic stock is 10-15% of the level observed some 60 years ago. Pup production estimated for this hooded seal whelping area in 1997 was 24,000. The cause of the significant, on-going decline in this population is unknown. But, concern for the apparent problems facing this stock has lead to the closure of hunting in recent years and the listing of this stock in the Norwegian Red List as Vulnerable (www.artsdatabanken.no).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Hooded Seals were subjected to intense commercial hunting in the 19th and 20th centuries. Harvests were often conducted in association with Harp Seal harvests and commercial fisheries for Greenland Sharks. Norway, the former Soviet Union, Canada, and Greenland have all been involved in the commercial harvests of this species. Following World War II the hunt was primarily focused on pups because of their highly prized blue-back pelt, however, many adult females were taken when defending their pups (Lavigne and Kovacs 1988). The number of Hooded Seals in the northwest Atlantic is relatively well known. Pup production estimates have been repeatedly conducted, and TAC (total allowable catch) adjusted through time (e.g. Sergeant 1976, Hay et al. 1985, Bowen et al. 1987, Hammill et al. 1992, Stenson et al. 1996). Since 1998 TAC has been set at 10,000 seals per year, but catches are in fact only a few hundred animals (ICES 2006). Hooded Seals have also been harvested commercially in the Greenland Sea for centuries. The hunt increased substantially after World War II, to levels that were clearly not sustainable; regulatory measures were introduced in 1958 to reduce effort, and quotas were imposed in 1971 (Sergeant 1976, ICES 2006). Based on catch per unit effort analyses and mark-recapture pup production estimates it was assumed that the stock increased from the 1960s through to the 1990s at an unknown rate (Ulltang and Øien 1988). Aerial survey attempts in 1994 failed to produce an estimate (Øritsland and Øien 1995). Recent modelling efforts suggest that a very substantial decrease in population abundance took place from the late 1940s up to the early 1980s (ICES 2006). Aerial surveys in recent years suggest that this downward trend is continuing. Total pup production was estimated to be 24 000 in 1997 and this number dropped to 15 250 in 2005 (Salberg et al. 2008).

Hooded Seals are also taken by native people of Greenland and Canada for subsistence purposes every year (Kovacs 2002). By-catch of Hooded Seals in coastal net fisheries has been reported from the United States, from trawl fisheries off Norway and Newfoundland, and salmon drift nets used off Greenland (Woodley and Lavigne 1991, Reeves et al. 1992, Waring et al. 2005). Competition for food with commercial fisheries and other predators has been suggested as a factor that may limit population growth or lead to declines (Reijnders et al. 1993).

Impacts of oil spills on Hooded Seals have not been reported; however, as an ice breeding species, they might be at risk of mortality from spills during the pupping season when newborn and newly weaned pups could be fouled (St. Aubin 1990). Hooded Seals have been exposed to morbillivirus (Duignan et al. 1997), but did not suffer fatalities during the mass die-offs of Harbour Seals in European waters from phocine distemper virus in 1998 and 2002. Subsequent testing of a variety of Arctic seals revealed antibodies to the virus in 18-24% percent of the Hooded Seals sampled indicating exposure to the virus (Harkonen et al. 2006).

The Hooded Seal is a pack ice species, which is dependent on ice as a substrate for pupping, moulting, and resting and as such is vulnerable to reduction in extent or timing of pack ice formation and retreat (Tynan and DeMaster 1997, Johnston et al. 2005, Learmonth et al. 2006, Kovacs and Lydersen 2008, Laidre et al. 2008). The productivity of the ice edge ecosystem is also dependent on the dynamics and seasonality of arctic ice, and alterations to the cycle of formation and retreat could have negative effects on important Hooded Seal prey such as Arctic Cod. Decreases in sea ice cover could also lead to more shipping and development of extraction based industries in the Arctic which in turn could negatively affect Hooded Seals through increased exposure to contaminants and pollution, increased disturbance and increased risk of shipping accidents and spills (Pagnan 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Substantial numbers die in fishing gear off the coast of Norway. Other threats include over-exploitation and pollution by pesticides and heavy metals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Numerous conservation measures, international management plans, harvest quotas, and agreements and treaties, have been developed for the conservation of Hooded Seals dating back to the 1870s. Moulting seals in the Denmark Strait have been protected since 1961. Harvest quotas at Jan Mayen began in 1971. Hunting was banned in the Gulf of St Lawrence in 1972 and quotas were placed on the rest of the Canadian harvest beginning in 1974. A European Economic Community ban on importation on seal products in 1985 reduced the harvest of blueback Hooded Seals through the loss of the primary market for the furs (Lavigne and Kovacs 1986, Reeves et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Effects of parasites on survival.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Individuals protected in part by the Marine Mammal Protection Act.

Needs: Worldwide ban on hunting.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative effects of hooded seals on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hooded seals have played an important role in subsistence for the natives of Greenland and Canada who hunt these seals for a source of food. They have also provided valuable goods including leather, oil, and fur. However excessive demand of these goods have negatively impacted populations of hooded seals.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long history of commercial exploitation; pups and adults hunted chiefly for pelts but also for meat and oil (Katona et al. 1983, Reeves et al. 1992). Harvests formerly were in the 10,000s; now greatly reduced due to EEC import ban (Reeves et al. 1992). Still harvested in summer by Greenlanders, for food for humans and dogs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hooded seal

The hooded seal (Cystophora cristata) is an arctic pinniped found only in the central and western North Atlantic ranging from Svalbard in the east to the Gulf of St. Lawrence in the west.

Contents

Naming

The generic name means "bladder-bearer" in Greek, from the peculiar inflatable bladder on the head of the adult male – this bladder hangs between his eyes and down over his upper lip in the deflated state. In addition, he can inflate a large balloon-like sac from one of his nostrils. This is done by shutting one nostril valve and inflating a membrane which then protrudes from the other nostril.[3]

The bulge

The bulge develops when the seal is four years old. The male can blow up this bulge, so that it is the size of its head.

Size

Adult males are 2.6 metres (8 ft 6 in) long on average, and weigh 300–410 kg (660–900 lb). Sexual dimorphism is obvious from birth and females are much smaller: 2.03 metres (6 ft 8 in) long and weighing 145–300 kg (320–660 lb).[4][5] The colour is silvery; the body is scattered with dark, irregular marks. The head is darker than the rest of the body, and without marks.

Life cycle

In April through June, after the breeding season, this species travels long distances to feed and eventually gather together again in separate moulting areas on the ice from June through August. After moulting, it disperses widely again to feed in the late summer and autumn before returning to the breeding areas in late winter.

Breeding

There are four major breeding areas: the Gulf of St. Lawrence, the "Front" east of Newfoundland, Davis Strait (between Greenland and northern Canada) and the West Ice near Jan Mayen.

Offspring

Hooded seal pup (next to researcher) on ice in the Gulf of St. Lawrence

Pups are about 1 metre (3 ft 3 in) long at birth and weigh about 24 kilograms (53 lb). They are born on the ice from mid-March to early April with a well-developed blubber layer and having shed their pre-natal coat. They are born with a slate blue-grey coat (giving them the name "blueback"), with a pale cream color on the belly, which they will moult after about 14 months. Nursing of the pup lasts for an average of only 4 days, the shortest lactation period of any mammal, during which the pup doubles in size, gaining around 7 kg/day. This is possible because the milk that they drink has a fat content of 60%.[6] The female pup will mature between ages 3 and 6, whereas the male pup will mature between ages 5 and 7.

Lifespan

The hooded seal can live to about age 30 to 35.

References

  1. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001030. 
  2. ^ Kovacs, K. (2008). Cystophora cristata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 2009-01-28.
  3. ^ Hooded Seal (Cystophora cristata), a Weird Animal. Drawfluffy.com. Retrieved on 2011-09-16.
  4. ^ Hooded Seals, Cystophora cristata. marinebio.org
  5. ^ Hooded seal images. arkive.org
  6. ^ Iverson, SJ; Oftedal, OT; Bowen, WD; Boness, DJ; Sampugna, J (1995). "Prenatal and postnatal transfer of fatty acids from mother to pup in the hooded seal". Journal of comparative physiology. B, Biochemical, systemic, and environmental physiology 165 (1): 1–12. PMID 7601954. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: A cladistic analysis of mtDNA data yielded three clades among northern seals: Phoca-Pusa-Halichoerus, Cystophora-Pagophilus, and Erignathus (Perry et al. 1995). Each clade may be regarded as a tribe of the subfamily Phocinae. The magnitude of the differences among Phoca, Pusa, and Halichoerus was on the same order as that between species and subspecies within the genus Odocoileus. Because Cystophora is the closest relative of Pagophilus, the latter cannot be regarded as congeneric with Phoca; the differences between the two are great enough to justify placing them in separate genera (Perry et al. 1995).

Evidently there is substantial genetic mixing among populations in Newfoundland, Denmark Strait, and Jan Mayen (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!