Articles on this page are available in 2 other languages: Spanish (2), Dutch (1) (learn more)

Overview

Brief Summary

Young hooded seals have a typically shaped seal head, but as adults, they have strangely shaped noses that hang over their mouth. Males can blow large red balloons out of their nose. They use the ballooons to impress the females and score above other male competitors. Hooded seals live in cold, deep water around the pack ice, but sometimes wander into the North Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

"Male hooded seals have a fleshy sac above the nostrils that they can inflate. It grows as the animal gets older, and looks a lot like a hood over the nose—thus the name ""hooded seal."" The seals can also inflate the strip of flesh that separates the nostrils. Blown up, it looks like a red balloon. Males use these structures to attract females, or perhaps to threaten other males, or both. They mate with several females, and protect each female and her offspring from other males while the pups are nursing. Nursing lasts only four days, and in that time, the pup doubles its birth weight, gaining 7 kg per day, mostly in blubber, by feeding on milk that is twice as rich in fat as whipping cream. After four days, the mother leaves her pup, who lives on the stored fat for several weeks, until it is old enough to swim and catch fish to eat."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Erxleben, J.C.P., 1777.  Systema regni animalis per classes, ordines, genera, species, varietas, cum synonymia et historia animalium.  Classis I, Mammalia,  1:590.  Wegand, Leipzig, 636 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Hooded Seal: A large Atlantic-Arctic seal with a 'balloon' on the face of the males
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Silver gray with larger irregular black blotches; Dark on face and top of foreflippers; Males have large inflatable nose (hood) and extrudable membrane in nostril
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Usual distribution limited to arctic and subarctic North Atlantic, from Newfoundland to southern Greenland, Svalbard, and Novaya Zemlya (Russia); occasionally south to Portugal and Florida, with additional erratic occurrences far from usual range. Whelping areas include Gulf of St. Lawrence, the "Front" off southeastern Labrador, middle of Davis Strait, and West Ice near Jan Mayen Island (a few pups have been born on the coasts of Norway and Maine). Summer molting areas are in Denmark Strait off southeastern Greenland and on the pack ice of the Greenland Sea north of Jan Mayen Island (Reeves et al. 1992). Occurrences in the northern Gulf of Maine region increased greatly during the 1990s (McAlpine et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Hooded Seals are found at high latitudes within the North Atlantic; seasonally they extend their range north into the Arctic Ocean, as well as south into the North Sea in the Northeast Atlantic. They breed on pack ice and are associated with it much of the year, though they spend significant periods of time pelagically, without hauling out (Lavigne and Kovacs 1988, Folkow and Blix 1999). There are four major pupping areas: near the Magdalen Islands in the Gulf of St Lawrence, north of Newfoundland in an area known as the “Front,” the Davis Strait (Sergeant 1974) and in the West Ice in the Greenland Sea near the island of Jan Mayen. Hooded Seals wander extensively sometimes; young animals have come ashore as far south as Portugal and the Canary Islands in Europe and south into the Caribbean in the West Atlantic (Kovacs and Lavigne 1986). They are increasingly common in recent years on Sable Island and along the New England coast (Harris et al. 2001, Lucas and Daoust 2002). They have also been found outside the Atlantic in the eastern Beaufort Sea and an adult female stranded in southern California in 1992 (Dudley 1992, Rice 1998, Kovacs 2002). Since the mid 1990s large numbers of vagrant Hooded Seals have been found away from the Arctic in some years; the numbers of these sightings are increasing for unknown reasons (Mignucci-Giannoni and Haddow 2002, Harris and Gupta 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Hooded seals are generally found from 47° to 80° N latitude. They occur along the eastern coast of North America north of Maine. Hooded seals also reach the western tip of Europe, along the coast of Norway. They are mainly concentrated around Bear Island, Norway, Iceland, and northeast Greenland. In rare cases they have been found in Siberia.

Biogeographic Regions: nearctic (Native ); arctic ocean (Native ); atlantic ocean (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Hooded seals have blue-gray pelage with black spots over the body. The front of the face is black and this coloration extends posteriorly to just behind the eyes. Their limbs are rather small in proportion to their body, but are powerful nonetheless, making these seals excellent swimmers and divers. Hooded seals exhibit marked sexual dimorphism. Males are slightly longer than females, and reach 2.5 m in length; females average 2.2 m. The more significant difference between the sexes is weight. Males weigh up to 300 kg while females only weigh up to 160 kg. Also unique to males is the inflatable hood and nasal septum.

Hooded seals get their name from the inflatable “hood” on the top of the heads of males. The hood is not present until males are about 4 years old. When the hood is deflated, it hangs down over the upper lip. Males inflate this red, balloon-like nasal septum until it protrudes out of one nostril. Males use this nasal sac for aggressive display and also to get the attention of females.

Hooded seals have many characteristics that differentiate them from other phocids. They have the largest nostrils in the family. The skull is short with a wide snout. They also have a palate that projects posteriorly further than any other seal. One-third of the nasal bone extends beyond the edge of the maxilla. Their incisor formula is unique, with two upper and one lower incisor. The teeth are small and the tooth row is narrow. The dental formula is I 2/1, C 1/1, PC 5/5. Hooded seals have light and dark bands of cementum in the canines that can be used to determine age.

At birth the coloring of young is silver on the dorsal side, without spots, and blue-gray on the ventral side, which accounts for their nickname ”bluebacks.” Young are 90 to 105 cm in length when born and average 20 kg. Around age 1, differences between males and females can be observed; males begin growing larger in weight and length.

Range mass: 160 to 300 kg.

Range length: 2.2 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 250 cm

Weight: 40000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are almost twice as heavy as females.

Length:
Range: 2.3-2.9 m males; 2-2.3 m females

Weight:
Average: 250 kg males; 180 kg females
Range: up to 435 kg males; up to 350 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: medium size seal, male has inflatable red nasal sac, adult is mottled bluish-grey with a black face. Pups are white but quickly moult to blue coat on back, dark face and white underbelly "bluebacks"
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Pelagic; normally in deep water or hauled out on heavy drift ice (Reeves and Ling 1981). Rarely on land or shore-fast ice except in Gulf of St. Lawrence (Kovacs and Lavigne 1986). Pups are born usually at center of large ice floe (Reeves and Ling 1981), in traditional breeding areas. Pupping habitat generally is transient and unstable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

large ice packs and in deep waters of the Atlantic Ocean
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

pack ice areas
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Hooded Seals are a markedly sexually dimorphic ice-breeding pinniped. Adult male hooded seals average 2.5 m in length and 300 kg (Kovacs and Lavigne 1986), with large animals reaching over 400 kg (Kovacs 2002). Adult females are smaller, averaging 2.2 m and 160 kg, but can reach 300 kg (Kovacs and Lavigne 1992). Pups are born at approximately 1 m in length and 24 kg (Kovacs and Lavigne 1992).

Hooded Seals pup on pack ice in mid March. The breeding season for this polygynous species is very short, usually lasting only about 2.5 weeks, and mating takes place in the water (Boness et al. 1988, Kovacs 1990). This species has the shortest lactation period for any mammal, with most pups being weaned in four days (Bowen et al. 1985). Pups weigh an average of 48 kg at weaning in the Northwest stocks (Kovacs and Lavigne 1992, Lydersen et al. 1997). The short reproductive period is energetically advantageous to both males and females, with relative losses in body mass being small for both sexes compared to other phocid seals (Kovacs and Lavigne 1992, Kovacs et al. 1996).

Hooded Seals moult in July, with each breeding stock congregating at a separate, traditional site, north of their whelping areas. If mixing does occur, the degree to which this takes place is unknown. Following the moulting period each stock disperses in the North Atlantic; movement patterns are only documented for the Greenland Sea stock (Folkow and Blix 1995, 1999, Folkow et al. 1996). Apart from the breeding and moulting periods where Hooded Seals form loose aggregations in specific areas, it is thought that hooded seals live quite solitary lives. However, little is in fact known about them outside the periods when they congregate. Groups of females with young animals have been seen at the northern ice edge in summer, but it is not known whether the groups were socially facilitated or solely the result of concentrations of prey (Kovacs pers. Obs.). Hooded seal longevity is 25-30 years (Kovacs 2002).

Hooded Seals are very capable divers that spend extensive periods at sea without hauling out (Folkow and Blix 1999). Most of their dives are from 100-600 m in depth and last 5-25 minutes, however, very deep dives to over 1,000 m and dives lasting almost an hour have been recorded (Folkow et al. 1996, Lydersen et al. Unpubl. Data). Hooded Seals feed on a wide variety of fish and invertebrates, including species that occur throughout the water column. Examples of typical prey are Parathemisto, Greenland halibut, members of the cod family such as Polar and Atlantic Cod, redfishes (Sebastes spp.), sand eels, herring, capelin, squid (e.g. Gonatus fabricii), and shrimp (Haug et al. 2004, 2007).

Polar Bears and Killer Whales are known Hooded Seall predators (Lavigne and Kovacs 1988); Greenland Sharks might also take young Hooded Seals.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hooded seals are found in coastal areas of Atlantic and Arctic Oceans. They are successful divers that spend much of their time in the water. They usually dive to a depth of 600 m but can go as deep as 1000 m. When they are on land they usually occur in areas with significant ice cover or made up of ice packs. They migrate annually in order to stay in areas where there is drifting pack ice.

Range depth: 100 to 1000 m.

Average depth: 600 m.

Habitat Regions: polar ; terrestrial ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.308 - 26.745
  Nitrate (umol/L): 0.266 - 8.491
  Salinity (PPS): 32.419 - 36.478
  Oxygen (ml/l): 4.626 - 8.214
  Phosphate (umol/l): 0.052 - 0.762
  Silicate (umol/l): 1.470 - 5.416

Graphical representation

Temperature range (°C): -0.308 - 26.745

Nitrate (umol/L): 0.266 - 8.491

Salinity (PPS): 32.419 - 36.478

Oxygen (ml/l): 4.626 - 8.214

Phosphate (umol/l): 0.052 - 0.762

Silicate (umol/l): 1.470 - 5.416
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central and western North Atlantic-Arctic; Associated with edge of pack ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

After breeding, populations in eastern Canada migrate north and reach western Greenland by late spring. Within a few weeks many migrate southward, later joining large molting assemblies east of Greenland in July and August. (Katona et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats redfish, Greenland turbot, octopus, squid, herring, capelin, shrimp, and mussels (Katona et al. 1983). Pelagic feeder; may dive deeply when feeding. Pups initially feed near ice edge on crustaceans and squid (Kovacs and Lavigne 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Hooded seals eat a variety of marine prey, especially fish, such as redfish, herring, polar cod, and flounder. They also feed on octopus and shrimp. Some research indicates that during the winter and autumn hooded seals feed more on squid and switch to primarily fish in the summer, especially polar cod. Pups first begin feeding near the shore and eat mainly squid and crustaceans. When Arctic algae and phytoplankton bloom, their energy is transferred to fatty acids. These food sources are eaten by herbivores and make their way up the food chain to the top predators like the hooded seal. The fatty acids that begin at the bottom of the food chain are then stored in the blubber of the seals. This blubber is sustained throughout the autumn and winter and used as an energy resource in the summer during the molting and breeding season when fasting occurs.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

  • Haug, T., K. Nilssen, L. Lindblom, U. Lindstrom. 2007. Diets of hooded seals (Cystophora cristata) in coastal waters and drift ice waters along the east coast of Greenland. Marine Biology Research, Vol. 3 Issue 3: 123-133.
  • Falk-Petersen, S., T. Haug, H. Hop, K. Nilssen, A. Wold. 2009. DEEP-SEA RESEARCH PART II-TOPICAL STUDIES IN OCEANOGRAPHY. DEEP-SEA RESEARCH PART II-TOPICAL STUDIES IN OCEANOGRAPHY, Vol. 56 Issue 21-22: 2080-2086.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Squid and fish (cod, redfish, halibut); Deep long feeding dives
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Hooded seals often find themselves the host of parasitic worms, such as heartworms, Dipetalonema spirocauda. Often these parasites result in shortened lifespans. Hooded seals are predators of many fishes, such as polar cod, squid, and various crustaceans. They are preyed on by sharks, orcas, and polar bears.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

In recent times, the major predators of hooded seals have been humans. The sealing industry began in the 18th century and these mammals were hunted for 150 years without any restrictive laws. More than 500,000 seals (hooded and harp seals) were caught per year between 1820 and 1860. At first, sealing was popular because there was a demand for oil and leather. After the 1940s, seals began to be hunted for their fur and one of the most prized species was the hooded seal, considered four times more valuable than other seals. A quota to limit hunting was introduced in 1971 and was set at 30,000.

Natural predators of hooded seals include sharks, polar bears, and killer whales. Polar bears mainly feed on harp and bearded seals but will hunt hooded seals when they are breeding on ice and are more visible, vulnerable targets.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: No exact figures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Estimates range from 300,000 to 750,000 worldwide. In the late 1980s, 60,000 pups were born at the West Ice, suggesting a total population there of perhaps 250,000 seals one year old or older. Mid-1980s data indicate a population of about 300,000 (60,000 pups born annually) at the Front off Newfoundland. In 1990, more than 2000 pups were born in the Gulf of St. Lawrence. Davis Strait population was estimated at 18,600 pups and 93,000 seals one year old or older in the mid-1980s (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Solitary throughout most of year. Polar bears sometimes kills large numbers of young.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

fish, crustaceans, squid
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Hooded seals are able to make vocalizations such as roars that can be heard easily on land. However, their most important form of communication is produced from the hood and septum. They are able to produce pulses ranging from 500 to 6 Hz, these sounds can be heard on land and in the water. They are often seen moving their inflated hood and nasal septum up and down, which can create sounds described as “pings” and “whooshes”. This method of communication can serve as male display for females but also serve as threats.

Communication Channels: visual ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Intermittently active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Size at birth 0.9-1m (3-3.3 ft), 11kg (25 lbs); Sexual maturity at 5-7 years; Females have pups every year; Short (4 day) nursing period on extremely fat milk; Longevity about 35 year; Behavior; Solitary except when breeding and molting; Vocal on ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The expected maximum lifespan of hooded seals is 35 years. In this sexually dimorphic species the differences in body size among males and females result in differences in longevity. In hooded seals males are larger and have shorter lifespans. The mortality rate of adults is 7 to 15% a year. One cause of death is known to be infections from the parasitic heartworm, Dipetalonema spirocauda. Before there were restrictions on hunting, humans were the main cause of death in hooded seals. Captive hooded seals have been reported to die from tuberculosis and cranial infections.

Typical lifespan

Status: wild:
35 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The total gestation time, of approximately 11.5 months, includes a 4 months period of delayed implantation (Ronald Nowak 2003). In the wild, these animals have been estimated to live more than 35 years (David Macdonald 1985). Little is known about their longevity in captivity, though.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Single pup is born mid-March to mid-April (peak in second half of March). Breeds near end of lactation period, which lasts only about 4 days. In any given area, breeding season spans only 2-2.5 weeks. One to several males may be on ice floe with female and pup; these groupings are widely scattered (loose aggregations). Females sexually mature usually in 3-4 years; more than 90% of adult females are pregnant each year. Males sexually mature in 4-6 years but do not do much breeding until several years older. Few live beyond their late 20s. Polygynous mating system.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the short time that the mother is giving birth and nursing her pup, several males will be in close proximity to her in order to obtain mating rights. At this time many males will aggressively threaten each other using their inflated nasal sac and even push each other out of the breeding area. Males do not typically defend personal territories; they only defend the area where there is a receptive female. A successful male will then mate with the female in the water. Once returning to land he will search for another female. Mating occurs typically through April and June.

Mating System: polygynous

Females reach the age of sexual maturity between 2 and 9 years old and it is estimated that most females give birth to their first young at around 5 years of age. Males reach sexual maturity a little later around 4 to 6 years old but often do not mate until much later. Females give birth to one young at a time through March and April. The gestation period is 240 to 250 days. During this time the fetus - unlike those of other seals - sheds its lanugo (a covering of fine soft hair that is replaced thicker pelage) in the uterus. These young are precocial and at birth are able to move about and swim with ease. They are independent and left to fend for themselves immediately after they have been weaned.

Breeding interval: Hooded seals breed once a year.

Breeding season: Hooded seals breed from April to June.

Range number of offspring: 1 to 1.

Range gestation period: 240 to 250 days.

Range birth mass: 10 to 30 kg.

Range weaning age: 5 to 12 days.

Range age at sexual or reproductive maturity (female): 2 to 9 years.

Average age at sexual or reproductive maturity (female): 3.2 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 1.

Hooded seals have the shortest nursing period of any mammal, from 5 to 12 days. The milk of the female is rich in fat, which makes up about 60 to 70% of its content and allows the pup to double in size during its short nursing period. During this same period, the mother loses 7 to 10 kg each day. Females are protective of their pup during their short weaning interval. They fight potential predators, including other seals and humans. Males do not invest energy in defending their young. Since young are precocial at birth and already able to crawl and swim, little is done to help raise them.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cystophora cristata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTTTCTACTAATCATAAGGATATTGGCACTCTTTATCTGCTGTTTGGTGCATGAGCTGGTATAGTGGGCACTGCCCTTAGTCTCTTAATCCGCGCAGAACTGGGACAACCCGGCGCCCTGCTGGGAGAT---GATCAAATTTATAACGTAATTGTCACTGCCCATGCATTTGTAATAATTTTCTTCATGGTGATGCCTATTATAATTGGCGGTTTTGGGAACTGACTAGTACCCCTAATAATCGGCGCTCCTGATATAGCATTCCCCCGAATAAACAATATGAGTTTCTGACTCTTGCCACCATCCTTCCTGCTACTACTGGCCTCCTCTATAGTGGAAGCGGGTGCCGGGACCGGATGAACCGTCTATCCTCCCTTAGCTGGCAACTTAGCTCATGCGGGAGCATCTGTAGACCTAACGATTTTCTCCCTTCATTTGGCAGGTGTATCGTCTATCCTCGGAGCTATCAACTTCATTACTACCATCATTAACATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTATTCGTATGATCCGTACTAATCACAGCAGTGCTCTTACTACTATCACTACCAGTTCTAGCAGCTGGCATTACTATGCTACTCACAGACCGAAATCTGAACACAACATTCTTCGACCCTGCTGGAGGAGGCGATCCTATCCTATATCAACACCTGTTCTGATTCTTCGGACATCCCGAGGTATATATCCTAATCCTACCAGGATTCGGAATAATCTCACACATCGTTACCTACTATTCAGGGAAAAAAGAACCTTTTGGTTACATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTTATTGTATGAGCTCACCACATATTCACTGTAGGAATGGACGTCGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cystophora cristata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Widespread distribution in arctic and subarctic North Atlantic; relatively abundant (several hundred thousand individuals); relatively secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2b

Version
3.1

Year Assessed
2008

Assessor/s
Kovacs, K. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Hooded Seals in the northwest Atlantic breeding areas are currently either stable or increasing modestly. However, the northeast Atlantic stock has declined by 85-90 % over the last 40-60 years. The cause of the decline is unknown, but very recent data suggests that it is on-going (30% within 8 years), despite the protective measures that have been taken in the last few years. Although the Hooded Seal is thought to be panmictic, the precipitous decline in the eastern stock (from over half a million to 70 000) over a period of a few decades warrants that the hooded seal be classified as Vulnerable.

IUCN Evaluation of the Hooded Seal, Cystophora cristata
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Generation time in Hooded Seals is approximately 10 years. Hooded Seals have experienced a dramatic decline over the last three generations (30 years) in the northeast Atlantic stock but the causes are not clearly reversible, nor understood (global decline is, however, not > 50%).

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under Al.

Hooded Seals in the northeast Atlantic have experienced a dramatic decline over the past 40-60 years (the precise time-frame is not known). This stock has been reduced by 85-90% since World War II. It is currently in decline, the causes of which are unknown (the decline may not be reversible). The northwest Atlantic stock of hooded seals is stable or increasing moderately in recent decades. Overall, the global population has declined by approximately 35-40% and thus this species should be considered Vulnerable.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1

There is concern that Hooded Seal will be negatively impacted by climate-change induced alternations to sea ice extent and character, as well as potential changes in the ecosystem that will affect its food supply. The relatively restricted distribution and some degree of overlap in diet with commercial fisheries add to the risk factor for this species.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

It is suspected that a population reduction will occur in the next 100 years for Hooded Seals due to climate-change induced alterations to the physical and biological resources upon which this species depends. A marked reduction has already been observed in the northeast Atlantic for unknown reasons. The decline has not ceased and may not be reversible.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR < 100 km²; EN < 5,000 km²; VU < 20,000 km²

The EOO of Hooded Seals is >20,000 km².

B2. Area of occupancy (AOO): CR < 10 km²; EN < 500 km²; VU < 2,000 km²

The AOO of Hooded Seals is > 2,000 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN < 5; VU < 10

(b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.

(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR < 250; EN < 2,500; VU < 10,000

Both segments of the hooded seal population exceed 10,000 mature individuals.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)

C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR < 50; EN < 250; VU < 1,000

or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%

(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR < 50; EN < 250; VU < 1,000 AND/OR restricted area of occupancy typically: AOO < 20 km² or number of locations < 5

Both segments of the hooded seal population exceed 1,000 mature individuals.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no population viability analysis conducted on hooded seals.

Listing recommendation — The relatively restricted distribution of Hooded Seals, their dependence on sea ice for breeding, moulting and resting and the observed, significant, declines for unknown reasons in the northeast Atlantic stock suggest that upgrading of this species to Vulnerable is warranted under criterion A2b. The observation of increased numbers of vagrant Hooded Seals well beyond their normal range, on both sides of the North Atlantic, suggests that the global population of Hooded Seals is experiencing change throughout the species range, despite the contrasting population trends in the west and east.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hooded seals were hunted in high numbers starting in the 18th century. The popularity of their pelts, especially of the “bluebacks”, which are pup pelts, resulted in a rapid decline of populations. After World War II the hunt for hoodeds seals increased, resulting in concern that they would become endangered. In 1958 laws were introduced, followed by quotas in 1971. Recent efforts include treaties and agreements, banning of hunting in areas such as the Gulf of St. Lawrence, and bans on importation of seal products. Despite these measures hooded seal populations are still on the decline for unknown reasons.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Aerial surveys carried out at all three whelping areas in the Northwest Atlantic in 2005 produced an estimate of 116,900 pups born. The whole population, modelled based on the pup counts, produced an estimate of 592,000 individuals (Waring et al. 2005). This suggests a moderate increase both in pup production and population size between the mid 1980s and 2005 (Hammill and Stenson 2006, 2007). Hooded Seals in the northeast Atlantic are showing an opposite trend. Pup production estimated for the Greenland Sea stock (West ice, near Jan Mayen) in 2005 was 15 250 pups, which in turn produces an estimate of total population size of about 70,000 animals (Øigård and Haug 2007, Salberg et al. 2008). This population estimate for the northeast Atlantic stock is 10-15% of the level observed some 60 years ago. Pup production estimated for this hooded seal whelping area in 1997 was 24,000. The cause of the significant, on-going decline in this population is unknown. But, concern for the apparent problems facing this stock has lead to the closure of hunting in recent years and the listing of this stock in the Norwegian Red List as Vulnerable (www.artsdatabanken.no).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Substantial numbers die in fishing gear off the coast of Norway. Other threats include over-exploitation and pollution by pesticides and heavy metals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Hooded Seals were subjected to intense commercial hunting in the 19th and 20th centuries. Harvests were often conducted in association with Harp Seal harvests and commercial fisheries for Greenland Sharks. Norway, the former Soviet Union, Canada, and Greenland have all been involved in the commercial harvests of this species. Following World War II the hunt was primarily focused on pups because of their highly prized blue-back pelt, however, many adult females were taken when defending their pups (Lavigne and Kovacs 1988). The number of Hooded Seals in the northwest Atlantic is relatively well known. Pup production estimates have been repeatedly conducted, and TAC (total allowable catch) adjusted through time (e.g. Sergeant 1976, Hay et al. 1985, Bowen et al. 1987, Hammill et al. 1992, Stenson et al. 1996). Since 1998 TAC has been set at 10,000 seals per year, but catches are in fact only a few hundred animals (ICES 2006). Hooded Seals have also been harvested commercially in the Greenland Sea for centuries. The hunt increased substantially after World War II, to levels that were clearly not sustainable; regulatory measures were introduced in 1958 to reduce effort, and quotas were imposed in 1971 (Sergeant 1976, ICES 2006). Based on catch per unit effort analyses and mark-recapture pup production estimates it was assumed that the stock increased from the 1960s through to the 1990s at an unknown rate (Ulltang and Øien 1988). Aerial survey attempts in 1994 failed to produce an estimate (Øritsland and Øien 1995). Recent modelling efforts suggest that a very substantial decrease in population abundance took place from the late 1940s up to the early 1980s (ICES 2006). Aerial surveys in recent years suggest that this downward trend is continuing. Total pup production was estimated to be 24 000 in 1997 and this number dropped to 15 250 in 2005 (Salberg et al. 2008).

Hooded Seals are also taken by native people of Greenland and Canada for subsistence purposes every year (Kovacs 2002). By-catch of Hooded Seals in coastal net fisheries has been reported from the United States, from trawl fisheries off Norway and Newfoundland, and salmon drift nets used off Greenland (Woodley and Lavigne 1991, Reeves et al. 1992, Waring et al. 2005). Competition for food with commercial fisheries and other predators has been suggested as a factor that may limit population growth or lead to declines (Reijnders et al. 1993).

Impacts of oil spills on Hooded Seals have not been reported; however, as an ice breeding species, they might be at risk of mortality from spills during the pupping season when newborn and newly weaned pups could be fouled (St. Aubin 1990). Hooded Seals have been exposed to morbillivirus (Duignan et al. 1997), but did not suffer fatalities during the mass die-offs of Harbour Seals in European waters from phocine distemper virus in 1998 and 2002. Subsequent testing of a variety of Arctic seals revealed antibodies to the virus in 18-24% percent of the Hooded Seals sampled indicating exposure to the virus (Harkonen et al. 2006).

The Hooded Seal is a pack ice species, which is dependent on ice as a substrate for pupping, moulting, and resting and as such is vulnerable to reduction in extent or timing of pack ice formation and retreat (Tynan and DeMaster 1997, Johnston et al. 2005, Learmonth et al. 2006, Kovacs and Lydersen 2008, Laidre et al. 2008). The productivity of the ice edge ecosystem is also dependent on the dynamics and seasonality of arctic ice, and alterations to the cycle of formation and retreat could have negative effects on important Hooded Seal prey such as Arctic Cod. Decreases in sea ice cover could also lead to more shipping and development of extraction based industries in the Arctic which in turn could negatively affect Hooded Seals through increased exposure to contaminants and pollution, increased disturbance and increased risk of shipping accidents and spills (Pagnan 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Effects of parasites on survival.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Individuals protected in part by the Marine Mammal Protection Act.

Needs: Worldwide ban on hunting.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Numerous conservation measures, international management plans, harvest quotas, and agreements and treaties, have been developed for the conservation of Hooded Seals dating back to the 1870s. Moulting seals in the Denmark Strait have been protected since 1961. Harvest quotas at Jan Mayen began in 1971. Hunting was banned in the Gulf of St Lawrence in 1972 and quotas were placed on the rest of the Canadian harvest beginning in 1974. A European Economic Community ban on importation on seal products in 1985 reduced the harvest of blueback Hooded Seals through the loss of the primary market for the furs (Lavigne and Kovacs 1986, Reeves et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Long history of commercial exploitation; pups and adults hunted chiefly for pelts but also for meat and oil (Katona et al. 1983, Reeves et al. 1992). Harvests formerly were in the 10,000s; now greatly reduced due to EEC import ban (Reeves et al. 1992). Still harvested in summer by Greenlanders, for food for humans and dogs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative effects of hooded seals on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Hooded seals have played an important role in subsistence for the natives of Greenland and Canada who hunt these seals for a source of food. They have also provided valuable goods including leather, oil, and fur. However excessive demand of these goods have negatively impacted populations of hooded seals.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hooded seal

The hooded seal (Cystophora cristata) is a large phocid found only in the central and western North Atlantic, ranging from Svalbard in the east to the Gulf of St. Lawrence in the west. The seals are typically silver-grey in color, with black spots that vary in size covering most of the body.[3] Hooded seal pups are known as "blue-backs" because their coats are blue-grey on the back with whitish bellies, though this coat is shed after 14 months of age when the pups molt.[4]

Naming[edit]

The generic name Cystophora means "bladder-bearer" in Greek, from the species' unusual sexual ornament – a peculiar inflatable bladder on the head of the adult male. This bladder hangs between the eyes and down over the upper lip in the deflated state. In addition, the hooded seal can inflate a large balloon-like sac from one of its nostrils. This is done by shutting one nostril valve and inflating a membrane, which then protrudes from the other nostril.[5]

Size[edit]

Adult males are 2.6 metres (8 ft 6 in) long on average, and weigh 300–410 kg (660–900 lb). Sexual dimorphism is obvious from birth and females are much smaller: 2.03 metres (6 ft 8 in) long and weighing 145–300 kg (320–661 lb).[6][7] The colour is silvery; the body is scattered with dark, irregular marks. The head is darker than the rest of the body, and without marks.

Distribution and habitat[edit]

Hooded seals live primarily on drifting pack ice and in deep water in the Arctic Ocean and North Atlantic. Although some drift away to warmer regions during the year, their best survival rate is in colder climates. They can be found on four distinct areas with pack ice: near Jan Mayen Island (northeast of Iceland); off Labrador and northeastern Newfoundland; the Gulf of St. Lawrence; and the Davis Strait (off midwestern Greenland).[4][6] Males appear to be localized around areas of complex seabed, such as Baffin Bay, Davis Strait, and the Flemish cap, while females concentrate their habitat efforts primarily on shelf areas, such as the Labrador Shelf.[8] Hooded seals are known to be a highly migratory species that often wander long distances, as far west as Alaska and as far south as the Canary Islands and Guadeloupe.[6] Prior to the mid 1990s, hooded seal sightings in Maine and the east Atlantic were rare, but began increasing in the mid 1990s. From January 1997 to December 1999, a total of 84 recorded sightings of hooded seals occurred in the Gulf of Maine, one in France and one in Portugal. From 1996 to 2006, five strandings and sightings were noted near the Spanish coasts in the Mediterranean Sea. There is no scientific explanation for the increase in sightings and range of the hooded seal.[9][10]

Diet[edit]

The diet of the hooded seal is composed primarily of various amphipods (crustaceans), eeuphausiids (krill), and fish, including Atlantic Argentine, Capelin, Greenland Halibut, Cod, Herring, and Redfish.[4][11] They also are known to eat squid, starfish, and mussels.[4] Relative to the other species, hooded seals consume 3 times the proportion of redfish; percentages of capelin were similar in relation to closely related species.[11] Capelin is considered a more common choice of sustenance during the winter season. Their diet is considered to be rich in lipids and fatty acids.[12]

Behavior[edit]

Hooded seals tend to feed in relatively deep waters ranging from 100–600 m (330–1,970 ft), and dive from 5 to 25 minute durations. However, some dives can go deeper than 1,016 m (3,333 ft) and as long, or longer, than 52 minutes. Diving is rather continuous, with approximately 90% of their time spent submerged during the day and night, although dives during the day are generally deeper and longer. Dives during the winter are also deeper and longer than those in the summer. It is known that the hooded seal is generally a solitary species, except during breeding and moulting seasons. During these two periods, they tend to fast as well. The seals mass annually near the Denmark strait around July, at the time of their moulting periods, to mate.[13][14] Hooded seals are a relatively unsocial species compared to other seals, and they are typically more aggressive and territorial. They demonstrate aggression by inflating the "hood" (which is explained in the "Nasal Cavity" section below). They frequently migrate and remain alone for most of the year, except during mating season.[4][6]

Nasal cavity[edit]

The hooded seal is known for its uniquely elastic nasal cavity located at the top of its head, also known as the hood.[4] Only males possess this display-worthy nasal sac, which they begin to develop around the age of four.[15] The hood begins to inflate as the seal makes its initial breath prior to going underwater. It then begins to repetitively deflate and inflate as the seal is swimming. The purpose of this happening is for agnostic signaling, meaning that it occurs when the seal feels threatened and attempts to ward off hostile species when competing for resources such as food and shelter.[16] It also serves to communicate their health and superior status to both other males and females they are attempting to attract.[15] In sexually mature males, a pinkish balloon-like nasal membrane comes out of the left nostril to further aid it in attracting a mate. This membrane, when shaken, is able to produce various sounds and calls depending on whether the seal is underwater or on land. Most of these acoustic signals are used in agnostic situation (about 79%), while about 12% of the signals are used for sexual purposes.[17]

Breeding and life cycle[edit]

There are four major breeding areas for the hooded seal: the Gulf of St. Lawrence; the "Front" east of Newfoundland; Davis Strait (between Greenland and northern Canada); and the West Ice near Jan Mayen. Male hooded seals are known to have several mates in a single mating season, following the hypothesis that they are polygynous. While some males will defend and mate with just one female for long periods of time, others will be more mobile and tend to mate with multiple females for shorter periods of time, generating maximum offspring within the population.[18]

Throughout all areas, the hooded seals whelp in late March and early April and molt from June to August.[9] The four recognized herds are generally sorted into two distinct populations: a Northeast (NE) Atlantic population and a Northwest (NW) Atlantic population. It is estimated that 90% of the total NW population give birth on the "Front". The NE herd whelping (giving birth) around Jan Mayen generally disperse into the sea after they breed in March. From April through June, after the breeding season, this species travels long distances to feed and then eventually gather together once again. Although some individuals return to the same area of ice in July to undergo moulting, the majority of the herd moult further North. After moulting, the species disperses widely again to feed in the late summer and autumn before returning to the breeding areas again in late winter.[19][20][21]

Offspring[edit]

Hooded seal pup (next to researcher) on ice in the Gulf of St. Lawrence

Pups are about 1 metre (3 ft 3 in) long at birth and weigh about 24 kilograms (53 lb). They are born on the ice from mid-March to early April with a well-developed blubber layer and having shed their pre-natal coat. They are born with a slate blue-grey coat (giving them the name "blueback"), with a pale cream color on the belly, which they will moult after about 14 months. Nursing of the pup lasts for an average of only 4 days, the shortest lactation period of any mammal, during which the pup doubles in size, gaining around 7 kg/day. This is possible because the milk that they drink has a fat content of 60%.[22] The female pup will mature between ages 3 and 6, whereas the male pup will mature between ages 5 and 7.

Early development[edit]

Researchers find that due to a pup's differing needs in regards to sustaining work and foraging while under water compared to adults, the skeletal and cardiac muscles develop differently. Studies show that cardiac blood flow provides sufficient O2 to sustain lipolytic pathways during dives, remedying their hypoxic challenge. Cardiac tissue is found to be more developed than skeletal muscles at birth and during the weaning period, although neither tissue is fully developed by the end of the weaning period.[23] Because pups are born with fully developed hemoglobin stores (found in blood), but their myoglobin levels (found in skeletal tissue) are only 25–30% of adult levels. These observations conclude that pup muscles are less able to sustain both aerobic ATP and anaerobic ATP production during dives than adults are. This is due to the large stores of oxygen, either bound to hemoglobin or myoglobin, which the seals rely on to dive for extended periods of time.[24] This could be a potential explanation for pups’ short weaning period as diving is essential to their living and survival.[23]

Lifespan[edit]

The hooded seal can live to about age 30 to 35.[6]

Threats and conservation practices[edit]

Prior to the 1940s, adult hooded seals were primarily hunted for their leather and oil deposits. More recently, the main threats are hunting, including subsistence hunting, and bycatch. Seal strandings are not considered a large threat to Hooded Seal populations but are highly researched. Seal pups are hunted for their blue and black pelts and many mothers are killed in the process, attempting to protect their young. Hunting primarily occurs in areas of Greenland, Canada, Russia, and Norway.[4][25] Overall, northwest Atlantic Hooded Seal populations are stable or increasing whereas the northeast Atlantic populations have declined by 85–90% within the last 60 years.[25]

It was believed by the scientific community that sonar was leading to mass stranding of Hooded Seals. After multiple sonar tests on captive seals, ranging from 1 to 7 kHz, it became evident that it had little effect on the subjects. The first test on each subject yielded differing results, ranging from reduced diving activity and rapid exploratory swimming. A difference was only noted for all subjects on their initial exposure.[26]

Conservation practices, brought about by international cooperation and the formation of the Northwest Atlantic Fisheries Organization (NAFO) led to Hooded Seal population increases. It is now required to hold a license to hunt Hooded Seals in international waters and each license is set a quota. Total allowable catch of hooded seals are set at 10,000 annually.[4]

The Hooded Seal is protected under the Marine Mammal Protection Act of 1972.[27]

References[edit]

  1. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Kovacs, K. (2008). Cystophora cristata. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2009-01-28.
  3. ^ Kovacs, Kit. "Hooded Seal". Noerwegian Polar Institute. 
  4. ^ a b c d e f g h "Hooded Seal (Cystophora cristata)". National Marine Fisheries Service. 
  5. ^ Hooded Seal (Cystophora cristata), a Weird Animal. Drawfluffy.com. Retrieved on 2011-09-16.
  6. ^ a b c d e "Hooded Seals, Cystophora cristata". Marinebio. Retrieved 24 October 2013. 
  7. ^ Hooded seal images. arkive.org
  8. ^ Andersen, J. M.; Wiersma, Y. F.; Stenson, G. B.; Hammill, M. O.; Rosing-Asvid, A.; Skern-Maurizen, M. (2012). "Habitat selection by hooded seals (Cystophora cristata) in the Northwest Atlantic Ocean". ICES Journal of Marine Science (free full text) 70: 173. doi:10.1093/icesjms/fss133.  edit
  9. ^ a b Harris, D. E.; Lelli, B.; Jakush, G.; Early, G. (2001). "Hooded Seal (Cystophora cristata) Records from the Southern Gulf of Maine". Northeastern Naturalist 8 (4): 427. doi:10.1656/1092-6194(2001)008[0427:HSCCRF]2.0.CO;2. JSTOR 3858446.  edit
  10. ^ Bellido, J. J.; Castillo, J. J.; Farfán, M. A.; Martín, J. J.; Mons, J. L.; Real, R. (2009). "First records of hooded seals (Cystophora cristata) in the Mediterranean Sea". Marine Biodiversity Records 1. doi:10.1017/S1755267207007804.  edit
  11. ^ a b Tucker, S.; Bowen, W. D.; Iverson, S. J.; Blanchard, W.; Stenson, G. B. (2009). "Sources of variation in diets of harp and hooded seals estimated from quantitative fatty acid signature analysis (QFASA)". Marine Ecology Progress Series 384: 287. doi:10.3354/meps08000.  edit
  12. ^ Falk-Petersen, S.; Haug, T.; Hop, H.; Nilssen, K. T.; Wold, A. (2009). "Transfer of lipids from plankton to blubber of harp and hooded seals off East Greenland". Deep Sea Research Part II: Topical Studies in Oceanography 56 (21–22): 2080. doi:10.1016/j.dsr2.2008.11.020.  edit
  13. ^ Folkow, L. P.; Blix, A. S. (1999). "Diving behaviour of hooded seals (Cystophora cristata) in the Greenland and Norwegian Seas". Polar Biology 22: 61. doi:10.1007/s003000050391.  edit
  14. ^ "Cystophora cristata Hooded Seal". Animal Diversity Web. Retrieved 24 October 2013. 
  15. ^ a b Witmer, Lawrence (2001). "A nose for all reasons". Natural History 110 (5): 65. 
  16. ^ Frank, RJ.; Ronald, K. (1982). "Some underwater observations of hooded seal, Cystophora cristata (Erxleben), behaviour". Aquatic Mammals 92: 67–68. 
  17. ^ Ballard, K. A.; Kovacs, K. M. (1995). "The acoustic repertoire of hooded seals (Cystophora cristata)". Canadian Journal of Zoology 73 (7): 1362. doi:10.1139/z95-159.  edit
  18. ^ Kovacs, K. M. (1990). "Mating strategies in male hooded seals (Cystophora cristata)?". Canadian Journal of Zoology 68 (12): 2499. doi:10.1139/z90-349.  edit
  19. ^ Andersen, J. M.; Wierma, Y. F.; Stenson, G.; Hammill, M. O.; Rosing-Asvid, A. (2009). "Movement Patterns of Hooded Seals (Cystophora cristata) in the Northwest Atlantic Ocean During the Post-Moult and Pre-Breed Seasons". Journal of Northwest Atlantic Fishery Science 42: 1. doi:10.2960/j.v42.m649.  edit
  20. ^ Bowen, W. D.; Myers, R. A.; Hay, K. (1987). "Abundance Estimation of a Dispersed, Dynamic Population: Hooded Seals (Cystophora cristata) in the Northwest Atlantic". Canadian Journal of Fisheries and Aquatic Sciences 44 (2): 282. doi:10.1139/f87-037.  edit
  21. ^ Folkow, L. P.; Mårtensson, P. E.; Blix, A. S. (1996). "Annual distribution of hooded seals (Cystophora cristata) in the Greenland and Norwegian seas". Polar Biology 16 (3): 179. doi:10.1007/BF02329206.  edit
  22. ^ Iverson, SJ; Oftedal, OT; Bowen, WD; Boness, DJ; Sampugna, J (1995). "Prenatal and postnatal transfer of fatty acids from mother to pup in the hooded seal". Journal of comparative physiology. B, Biochemical, systemic, and environmental physiology 165 (1): 1–12. doi:10.1007/bf00264680. PMID 7601954. 
  23. ^ a b Burns, J. M.; Skomp, N; Bishop, N; Lestyk, K; Hammill, M (2010). "Development of aerobic and anaerobic metabolism in cardiac and skeletal muscles from harp and hooded seals". Journal of Experimental Biology 213 (5): 740–8. doi:10.1242/jeb.037929. PMID 20154189.  edit
  24. ^ Geiseler, Samuel J.; Blix, Arnoldus S.; Burns, Jennifer M. and Folkow, Lars P. (2013). "Rapid postnatal development of myoglobin from large liver iron stores in hooded seals". J Exp Biol. 
  25. ^ a b "Cystophora cristata (Hooded Seal)". IUCN Red List. IUCN. Retrieved 25 October 2013. 
  26. ^ Kvadsheim, P. H.; Sevaldsen, E. M.; Folkow, L. P.; Blix, A. S. (2010). "Behavioural and Physiological Responses of Hooded Seals (Cystophora cristata) to 1 to 7 kHz Sonar Signals". Aquatic Mammals 36 (3): 239. doi:10.1578/AM.36.3.2010.239.  edit
  27. ^ "Marine Mammal Protection Act". NOAA Fisheries. NOAA. Retrieved 25 October 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: A cladistic analysis of mtDNA data yielded three clades among northern seals: Phoca-Pusa-Halichoerus, Cystophora-Pagophilus, and Erignathus (Perry et al. 1995). Each clade may be regarded as a tribe of the subfamily Phocinae. The magnitude of the differences among Phoca, Pusa, and Halichoerus was on the same order as that between species and subspecies within the genus Odocoileus. Because Cystophora is the closest relative of Pagophilus, the latter cannot be regarded as congeneric with Phoca; the differences between the two are great enough to justify placing them in separate genera (Perry et al. 1995).

Evidently there is substantial genetic mixing among populations in Newfoundland, Denmark Strait, and Jan Mayen (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!