Articles on this page are available in 2 other languages: Chinese (Simplified) (1), Spanish (2) (learn more)

Overview

Brief Summary

Description

Bearded seals have relatively small heads and prominent whiskers. Males and females are similar in size and appearance. They live in the north Pacific and north Atlantic, usually where there is moving ice and open water less than 150-200 m deep. They typically feed near the bottom of the sea on fish, crustaceans, and mollusks. Socially, in a kind of ritualized competition, males gather and vocalize and display to advertise their breeding condition and status, in hopes of attracting receptive females. During the breeding season, the seals produce trill-like calls that last as long as 30 seconds and can carry underwater for distances of 25 km or more. It may be that only males make trill calls: much remains to be learned about bearded seals. Polar bears are their main predator.

Links:
Mammal Species of the World
  • Original description: Erxleben, J.C.P., 1777.  Systema regni animalis per classes, ordines, genera, species, varietas, cum synonymia et historia animalium.  Classis I, Mammalia, 1:590.  Wegand, Leipzig, 636 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The bearded seal Erignathus barbatus is member of the 'true seal' family. Like all true seals, it has a tapering and pointed muzzle, small, clawed pectoral flippers, and relatively small hind flippers that cannot rotate under the body. It has smooth, long whiskers on the muzzle. The bearded seal is a large seal, with a very small head and a short, thick neck. It can reach 1.9 m in length. It has a short muzzle and moderately large eyes. The back is a uniform dark colour and the underside is paler.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Bearded Seal: A large, bottom-feeding, circumpolar ice seal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dark gray/tan, without distinct pattern or spots; Often reddish head and neck (head seems small for body); Square front flippers; Dense thick whiskers on upper lip and cheek
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Belgian Exclusive Economic Zone, European waters (ERMS scope), North West Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Bearded Seals have a patchy circumpolar distribution throughout much of the Arctic and sub-Arctic, south of 85ºN (Kelly 1988). A disjunct population inhabits the Sea of Okhotsk, ranging south to Hokkaido, Japan (Rice 1998). Bearded Seals reach the southern Bering Sea and Bristol Bay to the limit of seasonally ice covered waters regularly (Kelly 1988). They also occupy all of Hudson Bay, are found throughout much of the eastern Canadian Archipelago, both coasts of Greenland and south to southern Labrador. They can also be found along the north shore of Iceland, within the Svalbard Archipelago and across much of the north within the Russian Federation (Kovacs 2002). Bearded Seal vagrants have been reported from many locations outside the Arctic including Portugal in the eastern North Atlantic (van Bree 2000), the Gulf of Saint Lawrence, northern Newfoundland, and Cape Cod, Massachusetts in the western North Atlantic (Gosselin 1994).

The ranges of the two putative subspecies are divided near the central Canadian Arctic in the West and the Laptev Sea in the East, with the Atlantic subspecies barbatus occurring from the central Canadian Arctic east to the central Eurasian Arctic and the Pacific subspecies nauticus occurring from the Laptev Sea east to the central Canadian Arctic, including animals in the Sea of Okhotsk (Rice 1998). Geographical variation does exist in the calls of Bearded Seals across their range, suggesting some population substructure (Risch et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bearded seals, Erignathus barbatus, are found in the Arctic Ocean, where populations are geographically divided into two subspecies, E. barbatus barbatus and E. barbatus nauticus. Erignathus barbatus barbatus occupies portions the Arctic near the Atlantic Ocean, from the eastern seaboard of Canada at the Gulf of Saint Lawrence to the waters around Norway in the western Laptev Sea. Erignathus barbatus nauticus is found in the the Sea of Okhotsk and Bering Sea, and in areas of the Arctic Ocean not occupied by E. barbatus barbatus. Bearded seals have been regularly sighted as far south as the Japanese island of Hokkaido, and there have been sightings in China of E. barbatus nauticus and of E. barbatus barbatus in Portugal. It currently unknown why some animals travel so far south outside their normal range.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native )

Other Geographic Terms: holarctic

  • Reeves, R., B. Stewart, S. Leatherwood. 1992. The Sierra Club Handbook of Seals and Sirenians. San Francisco, CA: Sierra Club Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circumpolar in the Arctic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Arctic. James Bay, along the coast of Labrador and northwards until permanent ice is met.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Arctic and subarctic circumpolar; south to Hokkaido (Japan), Alaska, Hudson Bay, and Newfoundland (now largely or entirely extirpated). Most of the Bering Sea-Chukchi Sea population probably migrates through Bering Strait and winters in the Bering Sea; in winter, the largest concentrations are near St. Lawrence Island, in the ice 60-100 km north of the ice's frontal zone, west of St. Matthew Island, and in the southern Gulf of Anadyr; in summer, scattered acros the broken margin of the multiyear ice that covers much of the continental shelf in the Chukchi and western Beaufort seas (Reeves et al. 1992). In Canada, occurs at high densities in western Hudson Bay and in northern Foxe Basin; relatively abundant in Ungava Bay and Roes Welcome Sound; scattered throughout many of the High Arctic inlets and fiords from July to October; in some years, overwinters in the North Water of Baffin Bay, over deep water; in the Beaufort Sea, high densities occur from Sachs Harbour to Norway Island (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bearded seals on average measure 2.3 m in length and 200 to 250 kg in weight, with females larger than males. Between late fall and early spring, however, they can weigh up to 430 kg. At birth, pups average about 130 cm in length and 34 kg in weight. Adult bearded seals possess straight, evenly-colored light gray to dark brown hair, and their back is darker then the rest of their body. Their flippers and face are generally brick to deep rust in color. In contrast, bearded seal pups are born with lighter colored faces with assorted ribbon-like bands across their back and crown. Pups have soft, fluffy fur that tends to be a silvery blue, light brown or gray.

Bearded seals can be distinguished from other northern seals by their distinctive mustaches as well as their squared flippers. Their front and hind flippers have pronounced, pointed claws. Their head appears proportionally small compared to their long body.

Range mass: 200 to 430 kg.

Average length: 2.3 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Females are slightly longer than males.

Length:
Range: "2-2.6 m "

Weight:
Range: 225-360 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 340 cm

Weight: 410000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Bearded Seals are the largest northern phocid seal. Adults reach lengths of 2-2.5 m and weights of 250-300 kg (Andersen et al. 1999) with females typically being slightly larger than males (Kovacs 2002). In the Bering Sea, males have been recorded to reach 390 kg and females 361 kg (Kelly 1988). Weight fluctuates dramatically during the year and bearded seals are typically at their lowest weight from mid-summer to autumn, after which they regain lost weight lost during breeding and moulting (Andersen et al. 1999).

In Alaskan waters, sexual maturity is reached at 3-6 years in females, with 80% of females having had a pup by age 6. Males reach sexual maturity at 6-7 years (Kelly 1988). Final body size is reached at approximately 9-10 years (McLaren 1958), and they can live 20-25 years (Kovacs 2002).

Bearded Seal pups are born on small floes of annual ice and they swim within hours of birth (Kovacs et al. 1996). Peak birthing occurs between late March and mid-May, varying somewhat across the bearded seal’s range (Kovacs 2002). Pups in the Bering Sea average 132 cm and 34 kg in weight at birth and are weaned in an estimated 12-18 days when they weigh around 85 kg (Kelly 1988). Gjertz et al. (2000) estimated that in Svalbard pups are weaned in approximately 24 days. Prior to weaning their aquatic skills have developed to the degree that they spend about half their time in the water, diving for up to 5.5 minutes to depths of up to 84 m (Lydersen et al. 1994).

Adult females spend over 90% of their time in the water while caring for a dependent pup; about half this time is spent away from the neonate, presumably in foraging dives. Most female dives are relatively short and shallow. On average, there are 3 nursing bouts per day accomplished during the brief times the mother is out of the water. The amount of time mothers spend in the water is thought to be an adaptive response to polar bear predation, making the pair less conspicuous to hunting bears (Krafft et al. 2000).

Mating takes place at the end of lactation similar to other phocid seals. Males court females and display using elaborate downward trilling vocalizations that can travel many kilometers (Cleator et al. 1989). Individual males use distinct songs, and occupy the same territories over a series of consecutive years within constraints imposed by variable ice conditions, or they show a roaming pattern (VanParijs et al. 2001, 2003, 2004). In captivity singing males are attended by other satellite males similar to the male groups that have been observed for Harbour Seals in the wild (Davies et al. 2006).

Bearded Seals feed primarily on or near the bottom and most diving is to depths of less than 100 m (though dives of adults have been recorded up to 300 m and young-of-the-year have been recorded diving down to almost 500 m; Gjertz et al. 2000). They use their elaborate whiskers to search for prey on and in soft bottom substrates (Marshall et al. 2007, 2008). Because of their benthic feeding habits they live primarily in waters overlying the continental shelf, in shallow regions such as the Bering and Barents Seas (Burns 1981, Kovacs 2002). The availability of sea ice is a major habitat determinant for bearded seals. They are typically found in regions of broken free-floating pack ice; in these areas bearded seals prefer to use small and medium sized floes, avoiding large floes (Simpkins et al. 2003). They rarely haul out more than a body length from water and they use leads within shore-fast ice only if suitable pack ice is not available (Kovacs 2002). Bearded Seals naturally occur at quite low densities (e.g., Bengtson et al. 2005); they are typically solitary animals, but will form small, loose aggregations when ice availability is limited, such as at the time of moulting in midsummer.

The diet of Bearded Seals varies by age, location, season, and possibly also changes in prey availability in marine communities (Kelly 1988). Their primary foods live on or near the bottom, but also include some infauna as well as schooling and demersal fish (Burns 1981, Hjelset et al. 1999). In the Kara and Barents seas, the diet is dominated by crustaceans (shrimps) and molluscs (gastropods and bivalves). Cod, other demersal fish, and worms are also regular components of the diet. A wide variety of prey has been reported from the Sea of Okhotsk with crabs and shrimps accounting for 87% of the total intake for animals in the north, and clams, worms, and gastropods making up 40%, 23%, and 12% respectively of the intake for animals in the south near Sakhalin Island. In the Bering and Chukchi Seas, snow crab was the most important prey, followed by the crab Hyas coarctatus, while the reverse was true farther north. Shrimp species, gastropods, and octopus are important in both the northern and southern Bering Sea and the Chukchi Sea. The diet is similar in the Beaufort Sea with the addition of Arctic cod (Boreogadus saida) (Burns 1981). Antonelis et al. (1994) found that 86% of Bearded Seals examined in the central Bering Sea in early spring, had fish in their stomachs. In order of importance these were capelin (Mallotus villosus), codfishes (Gadidae), and eelpouts (Lycodes spp.). Lowry et al. (1980) reported similar findings on percentage of the occurrence of fish in stomachs, but reported that fish as a percent of total volume was 16% from May through September, and dropped to 5% for October through April. In the eastern Canadian Arctic, Bearded Seals in the summer consumed a minimum of 12 fish species, dominated by sculpins (Cottidae) and Arctic cod with fish prey accounting for greater than 90% of the wet weight of the stomach contents (Finley and Evans 1983). At Svalbard, Bearded Seals eat a wide variety of prey (>50% of collected stomachs had 5 or more prey species). Polar cod (Boreogadis saida), sculpins (Cottidae spp.), spider crab (Hyas araneus), and the crustaceans Sabinea sptemcarinatus and Sclerocrangon boreas were the most frequent prey items (Hjelset et al. 1999).

In June, following the pupping and breeding season, Bearded Seals undergo their annual moult. During the moult they spend much of their time hauled out and are reluctant to enter the water (Kovacs et al. 2004). Animals can be found moulting from April to August with a peak in May to June (Burns 1981). Bearded Seals usually haul out on ice when it is available, but will haul out on land in the summer in the Sea of Okhotsk, along the Laptev, White, and Kara Sea coastlines and at Svalbard (Burns 1981, Kovacs et al. 2004).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bearded seals prefer shallow, arctic waters less than 200 meters in depth. They also prefer areas heavy with ice floes or pack ice, as these are areas where adults "haul out." They generally segregate, with one adult per ice floe. Bearded seals ride drifting ice floes for great distances, and their "migration" is thus dependent on the season and distribution of ice floes. Bearded seals follow ice further south during the winter and further north during the summer. Riding drifting ice floes provides access to shallow water, in which they feed. However, they avoid ice floes on which walruses are abundant. Bearded seals rarely choose land over ice floes for hauling out. However, in summertime when ice floes are sparse, they have been known to haul out on land and gravel beaches.

Range depth: 200 (high) m.

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; benthic ; coastal

Other Habitat Features: intertidal or littoral

  • Cameron, M., P. Boveng. 2009. "Seasonal Movements, Habitat Selection, Foraging and Haul-out Behavior of Adult Bearded Seals" (On-line). Accessed May 26, 2010 at ftp://ftp.afsc.noaa.gov/posters/pCameron05_adult-bearded-seal-pups.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 44 specimens in 1 taxon.
Water temperature and chemistry ranges based on 20 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 2.686
  Nitrate (umol/L): 0.703 - 3.700
  Salinity (PPS): 31.490 - 34.692
  Oxygen (ml/l): 7.585 - 9.080
  Phosphate (umol/l): 0.327 - 0.959
  Silicate (umol/l): 1.170 - 6.034

Graphical representation

Temperature range (°C): -1.109 - 2.686

Nitrate (umol/L): 0.703 - 3.700

Salinity (PPS): 31.490 - 34.692

Oxygen (ml/l): 7.585 - 9.080

Phosphate (umol/l): 0.327 - 0.959

Silicate (umol/l): 1.170 - 6.034
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Associated with moving pack (sea) ice; prefers relatively shallow waters (less than 130 m) due to benthic feeding habits. Rests on ice all year, except in the Okhotsk, White, and Laptev seas, where in summer gravel beaches may be used. Spends the most time hauled out during period of spring/summer molt. Individuals may make and maintain multiple breathing holes in thin nonmoving (fast) ice, such as in winter in areas bordering High Arctic polynyas (Burns 1981, Reeves et al. 1992). May range hundreds of kilometers from the nearest open leads in areas of annual ice (Reeves et al. 1992). Juveniles sometimes are found in open water and may enter bays and ascend rivers (Reeves et al. 1992). Pups are born on surface of ice.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The bearded seal is a cold water species usually inhabiting coastal waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumpolar arctic and subarctic, on continental shelf and in coastal waters; Associated mostly with pack ice, sometimes fast ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Individuals annually move great distances, mostly maintaining an association with ice. Northward migration through Bering Strait from mid-April through June more marked than southward migration late fall through winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bearded seals are primarily benthic feeders and dive to a maximum of 200 m to obtain food. They primarily eat local mollusks and crustaceans, and also commonly eat Arctic cod. They have also been known to eat benthic fishes such as sculpins and flatfishes, and also American Plaice (Hippoglossoides platessoides).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Molluscivore )

  • Finley, K. 1983. Summer diet of the bearded seal (Erignathus barbatus) in the Canadian High Arctic. Artic, 36.1: 82-89.
  • Lowry, L., K. Frost, J. Burns. 1980. Feeding of Bearded Seals in the Bering and Chukchi Seas. Artic, 33.2: 330-342.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically; diet varies with location and seal's age, consists primarily of epibenthic invertebrates (crustaceans, molluscs, worms, etc.), schooling demersal fishes, and/or octopuses (Burns 1981, Reeves et al. 1992). Fishes tend to be most important in the Canadian High Arctic, whereas invertebrates are more important in the Bering and Chukchi seas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds mostly at/near the seafloor, also in water column; Prey include fishes, crabs, shrimps, clams
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Bearded seals are important predators of benthic mollusks, crustaceans, fish, and octopi. They compete with other seal species for food; however walruses tend to be their main food competitor. Bearded seals are also a secondary prey to polar bears (ringed seals are primary prey). Bearded seals also serve as prey to killer whales and walruses.

Bearded seals are the only know definitive host of the nematode Pseudoterranova decipiens, which resides in the animal's stomach and intestinal lumen. The parasitic nematode is transmitted when the seal eats the' intermediate host of the parasite, American Plaice (Hippoglossoides platessoides). The bearded seal also hosts the nematode Contracaecum osculatum, which also resides in the stomach.

Numerous trematode species reside in the pancreas and bile duct of the bearded seal, and other parasitic worms reside in the intestine. Abundance of these parasites varies among individual seals.

Protozoan parasites like Sarcocystis species (residing in the tongue) and Giardia species, such as Giardia duodenalis, are often found in the gut of the bearded seal. The protozoan species of Giardia found in bearded seals are not the same species of Giardia that can be transmitted to humans.

Commensal/Parasitic Species:

  • Bishop, L. 1979. PARASITE-RELATED LESIONS IN A BEARDED SEAL, Erignathus barbatus. Journal of Wildlife Diseases, 15: 285-293.
  • Brattey, J., G. Stenson. 1993. Host specificity and abundance of parasitic nematodes (Ascaridoidea) from the stomachs of five phocid species from Newfoundland and Labrador. Canadian Journal of Zoology, 71(11): 2156-2166.
  • Bristow, G., B. Berland. 1992. On the ecology and distribution of Pseudoterranova decipiens C (Nematoda: Anisakidae) in an intermediate host, Hippoglossoides platessoides, in northern Norwegian waters. Internation Journal for Parasitology, 22.2: 203-208.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Bearded seals have two main predators, polar bears and killer whales. Polar bears hunt seals by waiting near a breathing hole for their prey to surface. However, breathing holes of bearded seals usually form domes or caps of ice that they must dig through to reach the surface. This may serve as a defensive strategy, obscuring breathing hole positions and making them more difficult for polar bears to locate. Killer whales do not actively hunt bearded seals, but eat them opportunistically. Although rarely observed, pups of bearded seals are occasionally eaten by walruses. Bearded seals are also taken by humans through subsistence fishing by Native Americans in Canada and Alaska.

Known Predators:

  • Smith, T. 1980. Polar bear predation of ringed and bearded seals in the land-fast sea ice habitat. Canadian Journal of Zoology, 58: 2201-2209.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Erignathus barbatus (bearded seals) preys on:
benthonic invertebrates
Vertebrata

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Difficult to census, but total population probably is more than 500,000, with more than 300,000 off the coast of Alaska (Riedman 1990). Cleator (1996) estimated that a minimum of about 190,000 inhabit Canadian waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Typically solitary, aside from mother-pup association and breeding individuals (Burns 1981). Important prey for polar bear, though probably less so than the ringed seal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Of all the marine animals, male bearded seals are among the most vocally expressive, especially during spring breeding season. Their minute-long songs can be described as sinister and monotone but also harmonious. They are generally characterized as chirps, ascents, sweeps, or grumbles. During their song, bearded seals begin a slow, circular dive while emitting bubbles until resurfacing. It is believed that these songs are typical of courtship routines and or distinguishing breeding territory. Many underwater recordings of marine mammal communication in the Alaskan/Bering Strait region are predominately composed of songs of bearded seals.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

  • Cleator, H., I. Stirling, T. Smith. 1989. Underwater vocalizations of the bearded seal (Erignathus barbatus). Canadian Journal of Zoology, 67.8: 1900-1910.
  • Terhune, J. 1999. Pitch separation as a possible jamming avoidance mechanism in underwater calls of bearded seals (Erignathus barbatus). Canadian Journal of Zoology, 77: 1025-1034.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Size at birth 1.2m (4 ft); Sexual maturity at 5-7 years; Females have pups every year; Short (12-18 day) nursing period; Longevity about 30 years; Behavior; Mostly solitary; Swims with head and upper back above water; Rests on edge of ice floes with head down to escape quickly; Very vocal underwater during breeding season
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Although most bearded seals do not live over 25 years in the wild, some have been recorded to live as long as 31 years.

Range lifespan

Status: wild:
31 (high) years.

Typical lifespan

Status: wild:
25 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The total gestation time includes a 2 months period of delayed implantation (Ronald Nowak 2003). The actual embryonic development takes about 8.5 months. In the wild, these animals have been reported to live up to 31 years (David Macdonald 1985). Their longevity in captivity has not been studied in detail and hence their maximum longevity must be classified as unknown.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Bearded seals are promiscuous, having more than one mate during the breeding season. Males leave after mating, providing no care to pups. Due to their solitary nature, bearded seals do not establish long-term bonds with mating partners. Occasionally, males fight over a female mate. Male bearded seals also sing, which may be a courtship routine and/or a territorial warning during the breading season.

Mating System: polygynandrous (promiscuous)

Bearded seals breed once a year, though this varies with seasonal ocean productivity. They mate between March and June, and males are at peak potency during May. Due to delayed implantation and a long gestation period (11 months), female bearded seals do not give birth until the following summer. During gestation, females gain weight to build up a supply of milk. Females give birth on pack ice between mid-March and May. Unlike their close relative, ringed seals, bearded seals do not use or assemble subnivean birth lairs. Bearded seals give birth to 1 pup, which weighs approximately 34 kg at birth. Within several days, pups enter the water. Weaning occurs in 18 to 24 days, and pups weaned by late summer have ample time to create blubber before the winter. Females reach sexual maturity at 3 to 8 years of age and males at 6 to 7 years.

Breeding interval: Bearded seals breeds approximately once a year.

Breeding season: Bearded seals breeds in March through June.

Average number of offspring: 1.

Average gestation period: 11 months.

Average birth mass: 34 kg.

Range weaning age: 18 to 24 days.

Range age at sexual or reproductive maturity (female): 3 to 8 years.

Range age at sexual or reproductive maturity (male): 6 to 7 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 35000 g.

Average gestation period: 259 days.

Average number of offspring: 1.

Male bearded seals leave females after mating and provide no parental care to pups. Like many arctic seals, female bearded seals give birth to their pups on ice floes. Unlike their close relative ringed seals, however, they do not use or assemble subnivean birth lairs. While weaning her pup, a mother does not leave the ice flow. She does not eat until her pup is weaned and can be left alone.

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Gjertz, I., K. Kovacs, C. Lydersen, Ø. Wiig. 2000. Movements and diving of bearded seal (Erignathus barbatus) mothers and pups during lactation and post-weaning. Polar Biology, 23.8: 559-566.
  • Kirlin, M. 2005. "The Bearded Seal - Mating System" (On-line). Accessed May 08, 2010 at http://www.bio.davidson.edu/people/vecase/Behavior/Spring2005/Kirlin/Mating.html.
  • Kovacs, K., D. Lavigne. 1986. Maternal Investment and Neonatal Growth in Phocid Seals. Journal of Animal Ecology, 55.3: 1035-1051.
  • Kovacs, K., C. Lydersen, I. Gjertz. 1996. Birth-Site Characteristics and Prenatal Molting in Bearded Seals (Erignathus barbatus)”. Journal of Mammology, 77.4: 1085-1091.
  • Nelson, M. 2008. "Bearded Seal" (On-line). ADF&G Wildlife Notebook Series. Accessed May 01, 2010 at http://www.adfg.alaska.gov/index.cfm?adfg=beardedseal.main.
  • Reeves, R., B. Stewart, S. Leatherwood. 1992. The Sierra Club Handbook of Seals and Sirenians. San Francisco, CA: Sierra Club Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Single pups are born mostly from mid-March through early May, peak in April. Pup nurses 12-18 days, then immediately begins independent feeding; generally enters water before weaning. Adults mate mostly during first 3 weeks of May. Gestation lasts about 11 months, including about 2 months before implantation. Males sexually mature usually at 6-7 years, females at 3-8 years; few live longer than 25 years. Adult females breed annually, except perhaps when food resources are in short supply. May congregate during breeding.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Erignathus barbatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTTTCTACAAATCATAAAGATATCGGTACCCTCTACTTACTGTTCGGTGCATGAGCTGGTATAGTAGGCACCGCCCTCAGTCTCTTAATCCGCGCGGAACTAGGACAGCCTGGCGCTCTACTAGGAGAT---GATCAAATCTACAACGTGATTGTCACCGCTCACGCATTTGTAATAATCTTCTTCATGGTGATACCTATTATAATTGGCGGCTTCGGGAACTGACTAGTGCCCCTAATAATTGGCGCTCCTGACATAGCATTCCCTCGAATAAATAATATAAGTTTCTGACTTCTACCACCATCCTTCCTACTACTACTGGCTTCCTCCATAGTAGAAGCAGGTGCCGGAACTGGATGAACCGTCTACCCTCCTCTAGCCGGTAATTTAGCCCATGCAGGAGCATCCGTAGACCTAACAATCTTTTCCCTTCACCTGGCAGGTGTATCGTCCATTCTTGGCGCTATCAACTTTATTACTACCATCATCAACATAAAACCTCCTGCAATATCCCAATATCAAACCCCGCTGTTCGTATGATCCGTATTAATCACAGCAGTACTTCTACTGCTATCACTACCAGTTCTAGCAGCTGGCATCACCATACTACTCACAGACCGAAACCTAAATACAACATTTTTCGACCCTGCAGGAGGAGGTGACCCTATTCTATATCAACACCTATTCTGATTCTTTGGACATCCCGAAGTATATATCTTAATTCTTCCAGGGTTCGGAATAATTTCACACATCGTTACCTATTATTCAGGGAAAAAAGAACCTTTCGGTTATATGGGAATAGTATGAGCAATAATGTCCATCGGCTTCCTGGGTTTCATTGTATGAGCCCACCATATATTCACTGTAGGAATAGACGTTGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Erignathus barbatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Kovacs, K. & Lowry, L. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K., Lowry, L. (Pinniped Red List Authority) & Stuart, S.N. (Global Mammal Assessment Team)

Justification
Due to its large population, broad distribution, variable feeding habits and no evidence of a decline, the Bearded Seal should be classified as Least Concern. However, this species is likely going to be negatively impacted by climate change, and should be monitored over the coming decades.

IUCN Evaluation of the Bearded Seals, Erignathus barbatus
Prepared by Seal Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Similar to most northern phocid seals sexual maturity is reached in bearded seals between 3-5 years of age and maximum longevity is approximately 35 year of age. Thus, the average age of reproducing individuals should be at least 10 years. A population reduction of Bearded Seals has not been observed, estimated, inferred, or suspected in the past 30 years. However, population abundance is poorly known and has not been monitored.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under Al.

A population reduction of Bearded Seals has not been observed, estimated, inferred, or suspected in the past 30 years.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of Bearded Seals is suspected in the future because of predicted reduction in sea ice habitats due to continued climate warming. The likely amount of population reduction has not been projected and is extremely difficult to predict. Because of the bearded seals broad distribution and current abundance (and perhaps also sufficient behavioral flexibility to use a variety of substrates) declines are unlikely to exceed 30% within the next 30 years. However, there is considerable uncertainty regarding this prediction and monitoring is strongly encouraged.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Bearded Seals has not been observed, estimated, inferred, or suspected in the past 30 years.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Bearded Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Bearded Seals is > 2,000 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The current abundance of Bearded Seals is poorly known, but the number of mature individuals is certainly > 10,000.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The current abundance of Bearded Seals is poorly known, but the number of mature individuals is certainly > 1,000. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative Analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction for Bearded Seals.

Listing recommendationPast, poorly documented, estimates of bearded seal abundance suggest a total population size of more than 500,000. Current abundance and population trend are unknown. Based on reports from coastal hunters, and limited catch reporting in the Canadian Arctic Bearded Seals are still thought to be numerous and no major changes in abundance have been reported. Bearded Seals should thus be listed as Least Concern. However, climate warming and reduction in sea ice coverage are occurring and because Bearded Seals depend on sea ice for reproduction they are likely to decline in the decades to come. Because of the potential risk to Bearded Seals associated with global warming and loss of sea this species should be reassessed within a decade.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although bearded seals are not considered threatened, habitat destruction and overfishing of their prey species are their biggest threats. Additionally, global climate change may result in decreased ice floes, which would negatively impact habitat availability for bearded seals.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The size of the global population of Bearded Seals is not known (Kovacs 2002). Crude published estimates for parts of the bearded seal’s range include: 200,000-250,000 in the Sea of Okhotsk, including 60,000-75,000 off eastern Sakhalin Island (1968 to1990) and 250,000-300,000 in the Bering Sea, including 83,000-87,000 in the western Bering Sea (Fedoseev 2000). A minimum estimate for Canadian waters of 190,000 animals was suggested by Cleator (1996), based on data collected over a 35-year period. Angliss and Outlaw (2005) state that there are no current reliable population estimates for the Bering Chukchi stock of Bearded Seals. No estimates exist for the population in the Atlantic Ocean (Reijnders et al. 1993), or the region from the Barents to the Chukchi Sea. Population trends are not known.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Indigenous peoples of the Arctic have hunted Bearded Seals for subsistence for thousands of years, a practice that continues today. However, levels of subsistence harvest are not well known. Subsistence harvests of Bearded Seals in the United States were estimated to be approximately 6,800 in 2000 (Angliss and Outlaw 2005). Subsistence harvest levels are not closely monitored in Canada, but Cleator (1996) estimated that roughly 2,400 bearded seals were taken per year. Approximately 500-1,000 Bearded Seals are taken annually in Greenland (Reijnders et al. 1993). Rates of struck-and-lost are high for bearded seals in most months of the year, likely about 50% for gun-based harvests; these are not generally accounted for in hunting statistics.

The former Soviet Union historically had commercial harvests of Bearded Seals in the Sea of Okhotsk and the Bering, Chukchi, Barents and White Seas, with high harvest levels at times. Harvests grew from 9,000 to 13,000 from 1957 to 1964, and were 8,000 to 10,000 per year for the Bering and Okhotsk Seas combined from 1964-1967 (Reeves et al. 1992). This level of commercial harvesting was very likely unsustainable and in all probability depleted these populations (Kelly 1988). Bearded Seals are now harvested more on a subsistence basis for local use in Russia. Harvests in the Bering Sea of 1881 and 1418 were reported for 1988 and 1989 respectively (Reeves et al. 1992).

Fisheries interactions are low. Logbooks maintained by U.S. fishermen indicate 14 Bearded Seals killed and 31 injured in 1991 in the Bristol Bay, Alaska salmon drift net fishery. There were several incidents of incidental take, serious injury, or mortality in the Alaskan Bering Sea/Aleutian Islands flatfish and pollock trawl fisheries from 1999-2003, when annual mortality was estimated at 1.6 seals (Angliss and Outlaw 2005). Kelly (1988) mentions fisheries for snow/Tanner crabs (Chionoecetes opilio) and pink shrimps (Pandalus borealis), as possible sources of fisheries conflicts in the future, especially if these fisheries are renewed or expanded because both of these species are important foods for Bearded Seals.

Oil spills from offshore extraction and transportation could negatively affect bearded seals through direct contact with oil and damage to foraging areas and stocks of prey, particularly benthic invertebrates, which are vulnerable to oil contamination (Kelly 1988).

Global climate warming is currently causing major reductions in the extent and duration of sea ice cover in the Arctic, creating a threat to many species of marine ice-associated mammals. Pinnipeds, such as the Bearded Seall that are dependant on sea ice for pupping, moulting, resting and access to foraging areas, may be especially vulnerable to such changes (Tynan and DeMaster 1997, Learmonth et al. 2006, Kovacs and Lydersen 2008, Laidre et al. 2008). Stirling and Derocher (1993) suggest that climatic warming could result in more favourable conditions for Bearded, Harp, Harbour Seals and Walruses if it causes sea ice to become less consolidated in winter, and extends the summer open water period.

An increase in human-created noise in the arctic environment could cause marine mammals, including Bearded Seals which are very vocal during their breeding season (VanParijs et al. 2001, 2003), to abandon areas of habitat (Tynan and DeMaster 1997). A reduction in sea ice cover would likely lead to increased human activity in the Arctic in the form of shipping and extractive industries, and an associated greater threat of marine accidents and disturbance of marine mammals (Pagnan 2000).

Harp Seals, Hooded Seals, and Ringed Seals from the Canadian Arctic, where they overlap range with Bearded Seals, were all determined to carry antibodies to phocine distemper virus (PDV), with harp seals constituting the population with the largest percentage (83%) of positive tests. Although the disease has not been identified in Bearded Seals, the opportunity for exposure exists (Duignan et al. 1997).

Important natural predators of Bearded Seals include Polar Bears (Burns 1981), as well as Killer Whales, Walruses, and Greenland Sharks (Kovacs 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Probably the only major threat is regional overexploitation by humans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Bearded Seals are protected by various laws in their range countries. Subsistence hunting by indigenous people of the Arctic is generally for personal use and not regulated unless populations are depleted (e.g., Cleator 1996, Angliss and Outlaw 2005).

Vessel-based commercial hunting in the former Soviet Union ended in 1975; after that time the harvest has taken place at much lower levels (similar to a subsistence harvest). Prior to the end of commercial harvesting, the Soviet Union used a system of quotas to regulate the take of Bearded Seals in an attempt to manage the population (Kelly 1988). Licensed (sport) hunters can shoot bearded seals in Svalbard, outside protected areas and not during the breeding season (Kovacs et al. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of bearded seals on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Bearded seals have been traditionally hunted by the Eskimo people for meat, blubber, and leather. Although Eskimos do not rely exclusively on bearded seals for subsistence, hunting pressure on bearded seals is increasing. Bearded seals are important seal species for many Alaskan villages, as native peoples utilize them for their oil, meat, and skin, which is used to make umiaks (boats) and maklak (boots).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long harvested by some northern natives for meat, blubber, hides, etc.; put to many uses. In recent decades, annual harvest has been several thousand in Canada and Greenland, and a couple thousand (and increasing) in Alaska; in some areas, probably many are shot and lost. "Soviet" harvest lately has been between 1000 and 2000; used for food for humans, dogs, and fur-farm animals. See Reeves et al. (1992) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bearded seal

The bearded seal (Erignathus barbatus), also called the square flipper seal, is a medium-sized pinniped that is found in and near to the Arctic Ocean. It gets its generic name from two Greek words (eri and gnathos) that refer to its heavy jaw. The other part of its Linnaean name means bearded and refers to its most characteristic feature, the conspicuous and very abundant whiskers. When dry, these whiskers curl very elegantly, giving the bearded seal a "raffish" look.[citation needed]

Fossils first described in 2002 indicated that, during the Pleistocene epoch, bearded seals ranged as far south as South Carolina.[3]

Contents

Description

Distinguishing features of this earless seal include square fore flippers and thick bristles on its muzzle. Adults are greyish-brown in colour, darker on the back; rarely with a few faint spots on the back or dark spots on the sides. Occasionally the face and neck are reddish-brown. Bearded seal pups are born with a greyish-brown natal fur with scattered patches of white on the back and head. The bearded seal is unique in the subfamily Phocinae in having two pairs of teats, a feature it shares with monk seals.

Bearded seals reach about 2.1 m (6.9 ft) to 2.7 m (8.9 ft) in nose-to-tail length and from 200 kg (441 lb) to 430 kg (948 lb) in weight.[4] Both sexes are about the same size.

Bearded seals are a primary food source for polar bears and a secondary source for the Inuit of the Arctic coast. The Inuit language name for the seal is ugjuk[5][6] (plural: ugjuit) or oogrook or oogruk. Although the meat would be eaten and the blubber burnt in the kudlik (stone lamp) the Inuit preferred the ringed seal for food and light. The skin of the bearded seal is tougher than regular seal and was used to make shoes, whips, dog sled harnesses, to cover a wooden frame boat, the Umiak and in constructing summer tents known as tupiq.[7]

The body fat content of a bearded seal is 30–40%.[citation needed]

Hunting and diet

Primarily benthic, bearded seals feed on a variety of small prey found along the ocean floor, including clams, squid, and fish. Their whiskers serve as feelers[8] in the soft bottom sediments. Adults tend not to dive very deep, favoring shallow coastal areas no more than 300 m (980 ft) deep. Pups up to one year old, however, will venture much deeper, diving as deep as 450 m (1,480 ft).

Reproduction and lifecycle

Bearded seal pup

Bearded seals give birth in the spring. In the Canadian Arctic, seal pupping occurs in May.[7] Further south, in Alaska, most pups are born in late April.[clarification needed] Pups are born on small drifting ice floes in shallow waters, usually weighing around 30–40 kg. They enter the water only hours after they are born, and quickly become proficient divers. Mothers care for the pups for 18–24 days, during which time the pups grow at an average rate of 3.3 kg per day. During this time, pups consume an average of eight liters of milk a day. By the time they are weaned, the pups have grown to about one hundred kilograms.

Just before the pups are weaned, a new mating cycle takes place. Females ovulate at the end of their lactation period, but remain close to their pups, ready to defend them if necessary. During the mating season, male seals will "sing," emitting a long-drawn-out warbling note that ends in a sort of moan or sigh. This sound may attract females, or may be used by the males to proclaim their territory or their readiness for breeding. Males occupy the same areas from one year to the next.[9]

Like many Arctic mammals, bearded seals employs a reproductive strategy known as delayed implantation. This means that the blastocyst is not implanted for two months after fertilization, most often becoming implanted in July. Thus, the seal's total gestation period is around eleven months, though its active gestation period is nine months.[10]

Bearded seal on ice, Svalbard

Conservation status

On March 28, 2008, the U.S. National Marine Fisheries Service initiated a status review[11] under the Endangered Species Act (ESA) to determine if listing this ice seal species under the ESA is warranted.

Subspecies

There are two recognized subspecies of this seal:[1]

  • Erignathus barbatus barbatus
  • Erignathus barbatus nautica

While the validity of these subspecies has been questioned, and is not yet supported by any molecular data,[3] analysis of the animals' calls does indicate a differentiation between different populations.[12]

References

Erignathus barbatus 1996-08-04.jpg
  1. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Kovacs, K. & Lowry, L. (2008). Erignathus barbatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 January 2009.
  3. ^ a b Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
  4. ^ Erignathus barbatus. The Animal Diversity Web
  5. ^ Ohokak, G.; M. Kadlun, B. Harnum. Inuinnaqtun-English Dictionary. Kitikmeot Heritage Society. Retrieved 2013-03-20. 
  6. ^ "Bearded seal". Asuilaak Living Dictionary. Retrieved 2013-03-20. 
  7. ^ a b Ugjuk — Bearded Seal
  8. ^ Saundry, Peter. 2010. Bearded seal. Encyclopedia of Earth. Topic editor C. Michael Hogan, Ed.in Chief: Cutler Cleveland, NCSE, Washington DC
  9. ^ Nuttal, et al. (2005). Encyclopedia of the Arctic. New York, NY: Routlelege. 
  10. ^ Perry, Judith E. (1983). Seals of the World. Ithaca, NY: Comstock Publishing Associates. p. 103. 
  11. ^ Federal Register /Vol. 73, No. 61 / March 28, 2008 / Proposed Rules. National Marine Fisheries Service
  12. ^ Risch, D., et al. (2006). "Vocalizations of male bearded seals, Erignathus barbatus: classification and geographical variation". Animal Behavior 73 (5): 747–762. doi:10.1016/j.anbehav.2006.06.012. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: A cladistic analysis of mtDNA data yielded three clades among northern seals: Phoca-Pusa-Halichoerus, Cystophora-Pagophilus, and Erignathus (Perry et al. 1995). Each clade may be regarded as a tribe of the subfamily Phocinae. The magnitude of the differences among Phoca, Pusa, and Halichoerus was on the same order as that between species and subspecies within the genus Odocoileus. Because Cystophora is the closest relative of Pagophilus, the latter cannot be regarded as congeneric with Phoca; the differences between the two are great enough to justify placing them in separate genera (Perry et al. 1995). See also Mouchaty et al. (1995) for phylogenetic information.

Two subspecies have been proposed (E. b. barbatus of the Laptev and Barents seas and North Atlantic Ocean, and E. b. nauticus of the Bering and Okhotsk seas and Arctic Ocean; however, "the geographical limits of the putative subspecies are vague, and the morphological distinctions are meager" (Reeves et al. 1992). NMFS (2010) accepted the validity of these two subspecies, and further concluded that E. b. nauticus consists of two distinct population segments (DPSs), the Beringia DPS and the khotsk DPS.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!