Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Biology

Grey seals breed during winter. They are less shy and more curious than the harbour seal. Young, grey seals must stay out of water until they have gained weight and moulted and for this reason they remain in a raised location for the first few weeks of their life. 

 Grey seals feed mainly on mackerel, young cod and other round fish, but also on cephalopods and crustaceans, in contrast to harbour seals which eat more flatfish.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

"Some 15,000 gray seal pups are born annually on a 25-mile-long sand bar on an island off the coast of Nova Scotia. This is far from the seals' feeding grounds, and both males and females fast during the mating and birthing season. The pups gain huge amounts of weight, in the form of blubber, when they are nursing. The female's milk contains 10 to 15 times as much fat as in human milk. The blubber keeps them warm and becomes their energy supply for 3-4 weeks after weaning and before they can hunt for their own food."

Links:
Mammal Species of the World
  • Original description: Fabricius, 1791.  Skrivter Naturhist.  Selskabet Copenhagen, 1(2):167.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomy

Morphology
Grey seals are large and robust.The pelage colour and pattern can differ with age, sex and during moulting. Their colouring can range from grey, tan and brown to orange and reddish (on neck, undersides and flippers) (Jefferson et al, 2008). The top of the coat is usually darker than below, and darker, blotchy pigments usually break up the base colour. Grey seals have an annual moult and prior to this their coats appear paler and duller. Newborn grey seals are creamy white. They have specialised hair that lasts 2–4 weeks before it is replaced with adult hair that has subtle markings (Jefferson et al, 2008).The males are larger and have a thicker neck and broader head than the females, with a large muzzle. It is the distinctive shape of the large, wide muzzle that identifies it from other seal species (Jefferson et al, 2008)
  • the species name, grypus, means hook-nosed and refers to the nose profile of the adult male
  • Halichoerus means sea pig in Greek (Perrin et al, 2009)
The nostrils are almost parallel to each other and the eyes are small, widely spaced and are further back from the nose than in other seals, because of the large muzzle. (Jefferson et al, 2008)

Phylogeny
There are 2 sub species of grey seal:The Halichoerus grypus grypus populations are from the western and eastern north-Atlantic and Halichoerus grypus macrorhynchus are from the Baltic Sea. The differences between the 2 subspecies are seen in the skull (Jefferson et al, 2008).

Look-alikes
The grey seal is often confused with the habour seal as they can share a single haul out site.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Grey seals feed on a wide range of fish species, and also take crustaceans, cephalopods and the occasional seabird. When feeding they can dive to depths of 30 to 70 metres (3). In autumn females congregate at traditional pupping sites, called rookeries. At birth the pups weigh 14 kilograms, but as the mother's milk contains 60 percent fat, they rapidly put on weight and develop the blubber layer essential for maintaining body temperature when at sea (4). Males come ashore at the pupping sites to mate; they compete for sole access to a group of females (3), and successful dominant males can secure access to up to as many as ten females (3). After mating the seals disperse. The pups stay in the rookery surviving on their blubber reserves until after the moult, they then go to sea and may disperse over large distances (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Size
Adult males can grow up to 2.3m long and weigh 170–310 kg. Females can grow up to 2m and weigh 105–186 kg. Within the Atlantic subspecies, seals from Canada are slightly larger than European grey seals (Jefferson et al, 2008).

Reproduction
Male grey seals mate with multiple females - they are polygynous - and they will occasionally fight for a mate. They deter other males from accessing the females by threatening them with open mouth displays, hisses and vocalisations which may end up in a fight that can last up to an hour (Perrin et al, 2009).Breeding is on land between late September and early March, and differs through populations and locations. The populations around the British Isles are the earliest to breed and the Canadian populations and those in the Baltic Sea are the last (Jefferson et al, 2008).The female seal gives birth to a single pup that is weaned within 15–20 days. In that time it increases 4-fold in weight. After weaning, it remains on land without eating for 2–4 weeks before venturing into the oceans (Jefferson et al, 2008). The female’s milk is very rich and has a high fat content. The period of maternal care is very short so it is essential that the pup forms a good bond with the mother to obtain the maximum amount of milk before weaning, otherwise the chance of survival is low (Anderson et al, 1979). There is evidence that the survival rate of grey seal pups is related to the density of the population on the haul out sites (Anderson et al, 1979). If a pup is born into a high-density population, the chance of it being separated from its mother is increased. It is therefore more likely to die from being crushed in a fight or from starvation (Cassini, 1999).Female grey seals often go back to the same spot to breed year after year (Boness and James, 1979; Pomeroy et al, 1994). They sometimes return to breed at the site where they themselves were born (Pomeroy et al, 1994).Nearly half the world’s grey seal population breeds around the UK, and 90 percent of these are in Scotland (Special Committee on Seals (SCOS), 2009).

Life expectancy
Males can live for over 20 years and females can live for over 30 years (SCOS, 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

There are 2 subspecies of grey seal - Halichoerus grypus grypus and Halichoerus grypus macrorhynchus.They live in the north Atlantic and Baltic seas respectively.The grey seal lives in coastal waters, where it dives for food and comes ashore onto ‘haul out sites’ to rest, mate and give birth.Female seals feed their young for only 3 weeks, but their milk is rich in fat. In this short time, the seal pup can quadruple in size.In some parts of the world, grey seal numbers are increasing. This is because one of its major predators, an Atlantic shark species, is over-exploited by humans. But the seal still faces threats from hunters, pollutants and viruses.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The grey seal is a medium sized, robust bodied, seal with a rectangular horse-like head and small widely separated eyes. The nostrils form a W-pattern due to them being parallel and wide apart. They have a long muzzle, wide at the end, with a fleshy area around the whiskers that obscures the lower jaw. In adult males the top of the muzzle is convex, whereas in adult females and pups it is flat. Adults can grow up to 2.3 m long, with newborn pups being ca 1 m long. Adult males are much bigger and heavier than females, have a bigger broader head and are also darker in colour. The coat is dark grey on the back and light grey underneath and has irregular pattern of spots or blotches.Can be confused with other smaller seals, but Halichoerus grypus has a characteristic head shape which makes them relatively easy to identify.

 The grey seal is listed in Annex II of the EC Habtats Directive. The Baltic Sea population of grey seal is listed under Appendix II of the Bonn Convention on the Conservation of Migratory Species of Wild Animals. The grey seal population of the British Isles represents about 38% of the world population, of which ca 90% breed in Scotland (Duck, 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Grey seals are the larger of Britain's two species of breeding seal (2). The coat colour varies from grey to brown to silver, often with blotches (4). Males (bulls) can be distinguished from females by the pattern of darker and lighter fur colour. In males, the continuous background colour is dark, but in females is it light. Juveniles are born with a creamy white natal coat (6). The nostrils are parallel (4), and the 'Roman' nose is characteristic, especially in males (7); the scientific name derives from the Greek for 'hooked-nose sea-pig' (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Grey Seals have a cold temperate to sub-Arctic distribution in North Atlantic waters over the continental shelf (Hall 2002). There are three populations isolated both geographically and by timing of reproduction (Bonner 1981); mtDNA variations are large between these three breeding areas, though the Baltic and East Atlantic populations are much closer to one another than to the West Atlantic population (Boskovic et al. 1996). In the western Atlantic, the population is centred in north-eastern North America from the Gulf of Maine to southern Labrador, including the Gulf of St Lawrence. The eastern Atlantic population is concentrated around the United Kingdom (UK) and Ireland but is also found around Iceland, the Faroe Islands, and along the European mainland coast from the Kola Peninsula south to southern Norway, and from Denmark to Brittany in France. The Baltic Sea stock is confined to the Baltic Sea (Bonner 1981, Hall 2002). Vagrants are known from as far south as New Jersey in the western Atlantic and Portugal in the eastern Atlantic (Rice 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The grey seal (Halichoerus grypus) occurs in temperate and subarctic waters on both sides of the North Atlantic ocean resulting in three distinct populations. The western Atlantic population is found in the Canadian maritime provinces located from Cape Chidley on the Labrador coast to Nova Scotia. Grey seals located on the southwestern coasts of Iceland, on the Faeroe Islands and the British Isles comprise the eastern Atlantic population. In addition, the eastern Atlantic population extends further onto the coasts of Norway, northwestern Russia, and even French, Dutch, Gernman and Portugal coasts. The third population is found in the Baltic Sea.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

cold temperate to subarctic North Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Danish Exclusive Economic Zone, De Panne, Dutch Exclusive Economic Zone, European waters (ERMS scope), German Exclusive Economic Zone, Gulf of Maine, Gulf of St. Lawrence, North West Atlantic, Norwegian Exclusive Economic Zone, Orkney, Polish Exclusive Economic Zone, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, St. Lawrence Estuary, United Kingdom Exclusive Economic Zone, Wimereux, Zeebrugge, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Temperate and subarctic regions of the North Atlantic Ocean. Three distinct populations, centered on the Baltic Sea (most common in the northeastern Gulf of Finland, the archipelago separating the Gulf of Bothnia from the Baltic proper, and off southeastern Sweden), eastern North Atlantic (mainly Iceland to northern Norway, with the largest rookeries in the British Isles), and western North Atlantic from Labrador to Massachusetts. In the western North Atlantic, principal breeding/birthing areas are Sable Island, the Basque Islands, Camp Island east of Nova Scotia, Amet Island in Northumberland Strait, Deadman Island in the Gulf of St. Lawrence southwest of the Magdalen Islands, and newly forming pack ice in the eastern portion of Northumberland Strait and between eastern Prince Edward Island and western Cape Breton Island; a few females may give birth south to Muskeget and Tuckernuck islands in Nantucket Sound, Massachusetts, and on Monomoy Island south of Cape Cod (Reeves et al. 1992). Major spring molting sites include Anticosti Island in the Gulf of St. Lawrence and Sable Island. See Reeves et al. (1992) for further details on distribution in the Baltic region and eastern North Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The grey seal is found on both sides of the north Atlantic in temperate and sub arctic waters (6). Three distinct populations occur; the western Atlantic population, the north-eastern or Baltic population which is endangered, and the eastern Atlantic population (3) which is centred around British coasts, particularly around Scotland (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

At birth, grey seal pups weigh approximately 16 kg and have long, creamy white fur which is shed after the first three weeks of life. They fatten quickly on the rich milk from their mothers, and by moulting age have nearly quadrupled in body mass. At this time the young seals show coat patterns which differentiate the sexes. The female grey seal is silver-grey in colour, with small scattered dark spots, while the males are a dark grey with silver grey spots. The three populations of grey seals differ in exact colorings (grey, brown, silver), however the patterns are similar among the individual sexes -- female grey seals have dark spots on a lighter background while the males have a lighter spotting on a dark background fur, but both sexes in the three populations have a relatively dark back and lighter belly.

In addition to coat markings, the nose of a grey seal can distinguish a male from a female. The male grey seal has a long-arched roman nose which is the basis for its Latin name, Halichoerus grypus, meaning the hooked-nose sea pig. The shoulders of the male are massive with the overall bulk supplemented by a buildup of scar tissue from fighting during breeding seasons. The average adult male reaches his maximum size of 2.2 meters long and 220 kg at 11 years of age. The female is smaller and does not attain full size until approximately 15 years of age, reaching an average weight of 150 kg and length of 1.8 meters (measured from nose to tail). She has a more narrow, short nose and a straight profile to the dorsal surface of the head.

Range mass: 150 to 220 kg.

Range length: 1.8 to 2.2 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 300 cm

Weight: 290000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are 15% larger and 30% heavier than females.

Length:
Average: 2.3 m males; 2 m females
Range: 2-2.7 m males; 1.6-2.2 m females

Weight:
Average: 271 kg males; 207 kg females
Range: 240-320 kg males; 150-260 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Grey seal males attain 1.7 m in length and a weight of 120 kilos, whereas females are smaller reaching just 1.5 m and 90 kilos. Sexual dimorphism here is more pronounced than in any other seal species. The male is darker possessing light spots and an elongated snout. In contrast, females are lighter with darker spots.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morphology

Distinguishing characteristics: medium size seal, long head ("horsehead"), W-shaped nostrils, coat is mottled, female has light coat with dark spots, male has dark coart with light spots (when wet looks grey or dark).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Grey Seals are a large sexually dimorphic phocid. Western Atlantic Grey Seals are significantly larger than eastern Atlantic animals. In the UK, adult males are on average 2 m long and weigh 233 kg, with a maximum of 310 kg. Adult females average 1.8 m and 155 kg. At birth, pups are 90-105 cm, with male pups averaging 15.8 kg and female pups averaging 14.8 kg in weight (Bonner 1981). Weaning weights average 40 kg for males and 35.8 -39.6 kg for females. In the western Atlantic adult males average 2.25 m and 300-350 kg with maximum weights over 400 kg. Adult females average 2 m and 150-200 kg with maximum weights over 250 kg (Mansfield 1988, Hall 2002). Pups are heavier at birth than pups born in the UK and are 25% heavier at weaning. Male pups average 56.2 kg and females 51.6 kg, measured for pups born on the ice near Amet Island (Haller et al. 1996). Male pups weigh 51.6 and females weigh 50.5 kg for those born on land at Sable Island (Baker et al. 1995). Baltic Grey Seal pups weigh about 12 kg at birth, but weaning mass differs between (Jussi et al. 2008) 48.3 (± 8.1 kg) for pups born on ice to 37.4 (± 7.8 kg) for pups on land.

Lactation lasts around 15-18 days on average, with ice breeders having slightly shorter lactation periods; weaning is abrupt (Kovacs 1987, Haller et al. 1996). Pre-weaning mortality of Grey Seal pups varies widely between colonies, usually between 5 and 20% but can be as high as 30%. Pup mortality rates are influenced by habitat quality, birth site, quality of maternal care, injuries resulting from male-male aggression and to a lesser extent predation by Greater and Lesser Black-backed Gulls (Larus marinus and L. fuscus) on weakened, unprotected, pups, or pups born on the periphery of a colony (Baker and Baker 1988, Twiss et al. 2003).

In the Baltic pre-weaning mortality is low for pups born on ice, but varies between 5 and 30% on land, depending on pupping density (Jussi et al. 2008). Main predators are White-tailed Eagles (Haliaeetus albicilla) and Greater Black-backed Gulls.

In the UK, females give birth on land and show considerable site fidelity (Pomeroy et al. 1994). Mothers typically stay with their pups until weaning, but are rarely more than a few meters away from water (Twiss et al. 1994). In the Gulf of St Lawrence, lactating females that give birth on the ice spend about 72% of their time hauled out, nursing the pup every 2-3 hours. They are hauled out significantly more in darkness than during daylight hours. From the time of birth until weaning, females lose about 5.7 kg per day (Lydersen et al. 1994). Females in the UK lose an average of 65 kg over the lactation period (Fedak and Anderson 1982), whereas the somewhat larger females in the West Atlantic lose an average of 75 kg (Haller et al. 1996). Females come into estrus around the time of weaning (Boness et al. 1982). Females are at their lowest weight following the moulting period, averaging 126.2 kg; by the beginning of the next pupping period they again average 210 kg (Beck et al. 2000).

Adult male Grey Seals do not typically come ashore until the first pups are born, unlike most other pinnipeds where males arrive before the females (Bonner 1981). Their average age when first returning to their breeding colonies is 9-10 years (Manske et al. 2002). Males spend large amounts of time out of the water fasting during the breeding season. Some males go to sea for periods of 2-3 days while others remain hauled out for the entire breeding season (Lidgard et al. 2003). Males do not defend a fixed territory, but stay near a particular group of females. Breeding age males lose less weight per day than lactating females, but because they are ashore for an average of 36 days, up to an extreme of 57days, they can experience considerable loss of mass (Anderson and Fedak 1985, Tinker et al. 1995).

Pupping dates differing significantly between populations: peak dates in the western Atlantic are in January; in eastern Atlantic peak dates vary between September and December in different subpopulations; and in the Baltic Sea peak pupping is in late February to early March, which coincides with the annual maximum ice coverage. The differences in pupping seasons probably keep the groups reproductively isolated (Bonner 1981). Pups are born on land in the eastern North Atlantic, and can be born on either on ice or land in the western North Atlantic and the Baltic (Bonner 1981, Baker et al. 1995). Pups are born with a woolly white lanugo that is moulted around the time of weaning. Pups usually stay on land from birth until the moult is finished, although some pups on small exposed beaches often swim for short periods even before moulting (Kovacs 1987). During the post weaning fast pups lose up to 25% of their body weight (Mansfield, 1988). In the United Kingdom, adult females moult from mid-January to mid-February, and males moult from mid-February through until early April. In Canada, the moult is later in the spring (Bonner 1981). Peak moulting season for Baltic seals is the last week of May to the second week in June.

Grey Seals are shallow, short-duration divers. Most adult diving is shallower than 120 m and less than 8 min. Females dives are on average slightly longer (5.5 min.) than those of males (4.9 min.), although males tend to dive a little bit deeper (57 m compared to 49 m). In the Gulf of St Lawrence, maximum dives recorded were 412 m for males, and 354 m for females (Beck et al. 2003). Typically in the United Kingdom, dives are shorter and shallower (average 4-10 min., max. 30 min.). In European waters gray seals are primarily demersal feeders, diving to the sea bed during most dives (usually 60 m, but down to 200 m in some areas; Thompson et al. 1991).

Grey Seals are not long-distance migrants. In Europe, they often haulout on land, especially on outlying islands and remote coastlines exposed to the open sea. Tracking of individual seals has shown that they can feed up to several hundred kilometres offshore during short foraging trips lasting 2.3 days on average (McConnell et al. 1999). Individual Grey Seals, based at specific haulout sites, often make repeated trips to the same region offshore but will occasionally move to a new haulout and begin foraging in a new region. Movements of Grey Seals between haul-outs in the North Sea and the Shetland Isles, Outer Hebrides and Faeroe Islands have been recorded. During foraging trips Grey Seals often target areas with fine gravel/coarse sandy sea-bed sediments, which are the preferred habitat of sandeels, an important part of the Grey Seal’s diet. Satellite telemetry data from Canada shows that Grey Seals there perform much longer foraging trips and often travel much larger distances than European seals. In the Baltic Sea, Grey Seals make short trips, spending roughly 75% of their time within 50 km of haulout sites (Sjoberg and Ball 2000).

Grey Seal diet varies by location, though they are largely demersal or benthic feeders, (Hall 2002). In some areas, the food consumed can be over 70% sandeels (Ammodytes sp.). In Iceland, where 15 species make up the majority of the diet, the most common stomach contents by weight are Atlantic Cod (Gadus morhua) 24%, sandeels 23%, catfish (wolf-fish, Anarhichas lupus) 15%, and saithe (Pollachius virens) 11% (Hauksson and Bogason 1997). At the Faroes, adults feed on cod and catfish, subadults feed on sandeels and saithe and juveniles consume sandeels (Mikkelsen et al. 2002). In the United Kingdom, sandeels, cod and Dover Sole (Solea solea) accounted for 56% of the diet by weight. Gray seals also eat other flatfish, including Dab (Limanda limanda), Flounder (Platichthys plessus) and plaice (Pleuronectes platessa) (Prime and Hammond 1990). In the Outer Hebrides, gadids account for 40% or more of the diet (ling (Molva molva), Atlantic Cod and Whiting (Merlangius merlangus)); sandeels are less important in this area (Hammond et al. 1994). In Canada, 15 species of fish occur regularly in the diet (Mansfield 1988). Atlantic Cod, Herring (Clupea herringus) and Capelin (Mellotus villosus) account for 72% of prey by weight (Murie and Lavigne 1992).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The habitat of the grey seal differs among each individual group of seals. Some are found along rocky continental coasts, while others are comfortable on isolated islands. There are also many grey seal populations around that haul out on icebergs and ice shelves.

Habitat Regions: temperate ; polar ; terrestrial ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: coastal ; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7621 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1658 samples.

Environmental ranges
  Depth range (m): 0 - 27
  Temperature range (°C): 0.718 - 21.498
  Nitrate (umol/L): 0.748 - 10.275
  Salinity (PPS): 31.182 - 35.521
  Oxygen (ml/l): 5.180 - 8.784
  Phosphate (umol/l): 0.241 - 0.855
  Silicate (umol/l): 0.987 - 5.009

Graphical representation

Depth range (m): 0 - 27

Temperature range (°C): 0.718 - 21.498

Nitrate (umol/L): 0.748 - 10.275

Salinity (PPS): 31.182 - 35.521

Oxygen (ml/l): 5.180 - 8.784

Phosphate (umol/l): 0.241 - 0.855

Silicate (umol/l): 0.987 - 5.009
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Generally in coastal waters off rocky shores. Also often in estuaries. Rests ("hauls out") on exposed rocky coasts and remote islands. Spends much time on land during spring molt. Young are born on rocky mainland shores, small offshore islands, sand bars, land-fast ice, or sea caves. The largest colonies tend to be on remote uninhabited islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Halichoerus grypus feeds in inshore benthic habitats, on a wide variety of fishes and invertebrates. Grey seals use remote islands, bays and caves as 'haul out' areas to give birth to their pups or between foraging trips for food. The main breeding sites are shown on the above map.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Grey seals usually haul out on uninhabited offshore islands, but occasionally on quiet mainland beaches (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Does not make distinct, long-distance migrations. Juveniles especially may disperse widely after breeding season.

See Lavigueur and Hammill (1993) for information on seasonal movements in the Gulf of St. Lawrence.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Halichoerus grypus is an opportunistic feeder consuming between four and six percent of its body weight in one feeding per day. The diet consists of a large variety of fish and the occasional crustaceans and mollusks. According to King, at least 29 different species of fish have been recorded as being eaten by these seals. Fish taken include nearly any species found at pelagic and midwater levels as well as bottom dwelling fish at depths of seventy or more meters.

The feeding methods of the grey seal vary among populations, however they are most often social feeders. Social feeding reduces the opportunity for the prey to escape thereby increasing the feeding efficiency. When small fish are caught by the seal, they are usually consumed underwater and are swallowed whole. However, when large fish are captured, they are brought to the surface and held in the prehensile front flippers. The fish head is then bitten off and discarded, while the remainder of the fish is broken into small pieces able to be swallowed.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically on various fishes (herring, cod, capelin, pleuronectids, skates, etc.) and smaller quantities of crustaceans and molluscs (chiefly squid and octopus). In the Gulf of St. Lawrence, the average size of fishes eaten is about 18 cm. Young and adults have similar diets, though newly weaned young often eat shrimp and crabs. Fasts during breeding season. Feeds little or not at all during spring molt. Forages on the bottom at depths of up to at least 70 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These seals are also hosts for a parasitic roundworm called cod worm (Pseudoterranova decipiens), that infects cod and other commercially harvested fish.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Parasitic Ecology

The Grey seal may suffer parasitic as well as bacterial attacks; either circumstance may weaken the individual and may be a cause for stranding on land, sometimes with resulting death. In a number of locations humans carry out rescue efforts to foster such weakened animals, when it is clear that the seal is likely to die without intervention. An example parasite which the Grey seal may host is a roundworm known as codworm (Pseudoterranova decipiens), a species that infects cod and certain other commercially harvested fish. This parasite in its larval stage typically resides in musculature or body cavities of juvenile cod and other benthophagous fishes. The Grey seal may also acquire this parasite by eating sculpins, who in tern have consumed cod.

Studies at Sable Island in Nova Scotia and other locations imply that the breeding season can be an important time for spread of the codworm parasite. It is thought that pups lack resistance to this parasite, and their concentrations in breeding areas are correlated with incidence of marine transmission to certain fisheries. For example several thousand pups may be born at Sable Island annually and the subsequent incidence of cod worm is correlated temporally with dispersal patterns of the pups, with the seal breeding grounds at the epicenter, according to Anderson.
  • * Encyclopedia of Earth. Authors; Encyclopedia of Life; Peter Saundry. 2011. "Grey seal". Topic ed. C.Michael Hogan. Ed.-in-Chief. Cutler J.Cleveland http://www.eoearth.org/article/Grey_seal .
  • * Anderson, R.C. 2000. "Nematode parasites of vertebrates: their development and transmission", CAB International, 672 pages ISBN: 0851994210
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Difficult to estimate because preferred areas continually change due to ocean currents and storms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population in the early 1990s was close to 200,000, with nearly half breeding in Great Britain (Reeves et al. 1992). In Canada, pup production was estimated as more than 12,000/year in the mid-1980s; in 1990, more than 11,000 were born on Sable Island; total population in the western north Atlantic is 85,000-115,000 (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious on land when molting. After weaning, young become somewhat nomadic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution ecology

Grey seals live in cold-temperate coastal regions, sub-arctic environments and pack ice. The grey seal is found on both sides of the north-Atlantic, including Greenland and Iceland, western Russia, Norway, the British Isles, Ireland, France and the Baltic Sea (Jefferson et al, 2008).

Abundance
The worldwide population of grey seals is estimated at about 380,000 (Jefferson et al, 2008). The Atlantic population is healthy and growing. This is partly due to the human over-exploitation of an Atlantic shark species which is a predator to the seal. This has enabled the population to grow. However the Baltic seal population is still recovering from hunting in the early 1900s (Jefferson et al, 2008). In the UK, seal populations are monitored by aerial photography and direct counts from boats or the shore (Sea Mammal Research Unit, 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Grey seals are coastal mammals and live in large groups. When they are not in the water they are found on rocky ledges, beaches or on pack ice (Jefferson et al, 2008). These haul out sites and are usually quiet areas very close to the water's edge, with good access to the open sea (Pomeroy et al, 2000). The seals rely on haul out sites to rest, breed, moult and give birth.Grey seals can dive down to 300 metres for up to 30 minutes, although they are more likely to dive for 1–10 minutes, with an average depth of 60 metres or less (Jefferson et al, 2008). To rest in the sea, the animals position themselves vertically in the water column with their head poking out of the water (Jefferson et al, 2008). Off the British coasts and in the Baltic Sea, their journeys out to sea are usually less than 50km from their haul out sites and last 2–5 days (Sjöberg et al, 1995; McConnell et al, 1999).

Feeding
Grey seals use almost the whole water column to obtain their food - they feed from the ocean floor to the surface and in between. The seals even take seabirds. Their prey includes:
  • whiting
  • smelt
  • skate
  • lumpfish
  • pollock
  • cod
  • haddock
  • plaice
  • salmon
  • cephalapods
  • molluscs (Jefferson et al, 2008)
Their food requirements depend on the size of the animal and the nutritional richness of the prey. It is estimated that on average, 7kg of cod or 4kg of sand eels per day are consumed (Special Committee on Seals (SCOS), 2009). Up to 70 percent of the grey seals' diet can consist of sand eels (Perrin, 2009).Individuals normally forage within 100km of their haul out site, but tracking has shown that they can feed up to several hundred kilometres away (SCOS, 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Intermittently active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Their lifespan ranges from 15 to 25 years, with the oldest recorded wild female grey seal living to be 46 years of age.

Range lifespan

Status: wild:
46 (high) years.

Typical lifespan

Status: wild:
15 to 25 years.

Average lifespan

Sex: male

Status: captivity:
43.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 42.9 years (captivity) Observations: After a 100 days period of delayed implantation, the active gestation lasts 240 days (Ronald Nowak 2003). In the wild, it has been estimated that females live up to 46 years (David Macdonald 1985), which is dubious. Record longevity in captivity is 42.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

An interesting case demonstrates a breeding difference between populations. Land-breeding gray seals are polygynous, with males competing to monopolize matings with as many as 7 females. Ice-breeding seals do not appear to be polygynous. Due to the instability of the early January ice, little is known of their habits. However, initial research indicates that a more monogamous system exists.

Mating System: monogamous ; polygynous

The breeding season of the grey seal varies greatly, occurring anywhere from mid-December to October, depending upon the location of the population. Breeding rookeries are formed on various types of habitat including sandy beaches, rocky islands, coasts, caves, and ice. During the months prior to the breeding season, seals actively feed. The females do so to grow for the future developing fetus and to build the fat reserves which will sustain them and the calf for the fasting which follows the birth, usually lasting for three weeks. The males also actively feed, because they too will fast for the breeding season, however their fasting will typically last for up to six weeks. The males ordinarily enter the rookeries once the females give birth and try to gain sole access to groups of females. Territory-related fighting occurs during the breeding season, although it is relatively minor compared to other seal species. Fighting in grey seal communities differs among populations, but generally increases as does the density of females. The successful males are able to mate with up to ten females, depending upon locality and density of the females.

Sixteen percent of female grey seals are sexually mature on their third birthday and give birth to their first young one year later. This figure rises to seventy-one percent by the fourth year and eighty-nine percent by the fifth year of life. The males also become sexually mature at age three, but due to competition for females, rarely mate before they are eight years old.

Once impregnated and following a gestation period of eleven months, females usually give birth a day after coming ashore at the rookery. Grey seals are attentive mothers and defend their pups against predation and intrusion. The pup is nursed for approximately 2 weeks after it is born, gaining around 1.5 kg per day. Once the pup is weaned, the female mates with one or more males and then leaves the pup at the rookery. The pup will remain on land, living off of its blubber reserves until it has fully molted, at which point it will feed at sea. The young seals generally disperse in many different directions from the rookery and are known to wander to distances of over 1,000 km.

Breeding season: The breeding season of the grey seal varies greatly, occurring anywhere from mid-December to October.

Average number of offspring: 1.

Average gestation period: 11 months.

Average weaning age: 14 days.

Average time to independence: 14 days.

Range age at sexual or reproductive maturity (female): 3 (low) years.

Range age at sexual or reproductive maturity (male): 3 to 8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 14000 g.

Average gestation period: 240 days.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: single pups are born during late December-early February, with a peak in mid-January. In the British Isles, most births occur in fall. Young are weaned in 2-3 weeks. Weaned pups may fast on land or ice for 1-4 weeks before beginning to feed at sea. Mates around time of weaning. Bulls may monopolize 4-6 cows if cows are not widely dispersed. Gestation lasts about 1 year, including delayed implantation period of 3-4 months. Most females are sexually mature at 5 years (Can. J. Zool. 70:1604), sometimes a year or two sooner. Males become sexually mature at 4-8 years but, because of social interactions with dominant older males, are not likely to breed successfully until at least 10 years old. Few live longer than 30-35 years. Recent genetic data from North Rona Island off Scotland indicate a surprisingly high level of mate fidelity (in 30% of cases, pups born in consecutive years to a particular female were full siblings); resident dominant males sired relatively few of the pups (Amos et al., 1995, Science 268:1897-1899).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoerus grypus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0710-06|X72004|Halichoerus grypus| GATCGATGGTTATTTTCCACAAATCATAAGGATATCGGCACTCTTTATTTGCTGTTTGGCGCATGAGCTGGAATAGCAGGCACCGCCCTT---AGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATTGTCACCGCCCATGCATTTGTAATAATTTTCTTCATAGTAATGCCTATCATAATTGGCGGCTTTGGGAACTGACTAGTGCCCTTAATA---ATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGTTTCTGACTTTTACCGCCATCCTTTCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGGACCGGGTGAACCGTTTATCCTCCCCTAGCTGGGAACCTGGCTCATGCAGGGGCATCTGTAGATCTA---ACGATTTTCTCCCTCCACTTAGCGGGTGTATCATCTATTCTTGGGGCTATCAACTTCATCACTACTATCATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTGTGATCCGTATTAATCACGGCAGTACTCCTGCTATTGTCACTACCAGTCCTAGCAGCT---GGCATCACCATGCTACTCACAGACCGAAACCTGAATACAACATTCTTCGACCCTGCCGGAGGAGGTGATCCTATCCTGTATCAACATCTATTCTGATTCTTCGGACATCCCGAAGTGTATATTCTAATCCTACCAGGATTCGGAATAATCTCACACATTGTTACCTACTATTCAGGGAAAAAA---GAACCTTTTGGCTATATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTCATTGTATGAGCCCACCATATATTCACTGTAGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Halichoerus grypus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Thompson, D. & Härkönen, T. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its large population, which is increasing in most areas of study, the Grey Seal should be considered to be Least Concern.

IUCN Evaluation of the Grey Seal, Halichoerus grypus
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Age-structure data from Grey Seal populations in the late 1970s indicated a generation time of approximately 14 years. Abundance is well known as all major populations are monitored regularly. Subpopulations in the Gulf of St Lawrence and Iceland have declined over last decade but by less than 50%. However, the three main sub populations globally (East Atlantic, West Atlantic, Baltic) have all increased over the past 30 years.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under Al.

A population reduction of Grey Seals has not been observed, estimated, inferred, or suspected in the past 30 years.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

At present there are no indications that the Grey Seal population is likely to decline in the future. The continued growth of the Canadian and North Sea populations during periods of intense over fishing of several of their important prey species suggests that the populations are robust. Major regime shifts in the north Atlantic could lead to population declines.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Grey Seals has not been observed, estimated, inferred, or suspected in the past 30 years and there are no indications that a decline is likely.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Grey Seals is > 1,500,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Grey Seals is > 1,500,000 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN
The Grey Seal population is not severely fragmented and number of breeding locations >> 10.

(b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.

No recorded declines in (i),(ii),(iii),(iv), overall increase in (v) with local declines in Iceland and possibly in Gulf of St Lawrence.

(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

No extreme fluctuations in any of: (I),(ii), (iii) or (iv)

C. Small population size and decline
Number of mature individuals: CR
Annual pup production is approximately 100,000 indicating an adult female population >100,000.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future) — N/A
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100% — N/A
(b) Extreme fluctuations in the number of mature individuals. — N/A

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The number of mature individuals is certainly > 100,000. AOO is > 1,500,000 km² and the number of locations is > 50.

E. Quantitative Analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

Long- term continuing increases in total population and most subpopulations suggest very low likelihood of extinction within 3 generations.

Listing recommendationContinuing, well documented increases in overall population and most subpopulations, low levels of localized hunting and widespread conservation measures in most range states and current population size based on pup production estimates is >400,000. Continued declines in Icelandic waters give cause for concern, but globally, Grey Seals should be classified as Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The grey seal species as a whole is under no special conservation status. In fact, many countries allow either monitored or unlimited hunting of the seals. For nearly a decade, from 1982 until 1993, Norway, Iceland and Canada offered bounties and local culls for the grey seal. Many fisherman believe that this species competes with them for fish, and seals damage nets and traps. Recently the species has been given great legal protection in Europe, and fewer culls are being authorized.

The Baltic Sea population of this species is much smaller than the two Atlantic population, probably due to hunting and pollution of its habitat. It has greater legal protection.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Wide distribution in the North Atlantic Ocean; relatively high population estimates, but apparently declining in some parts of range; local threats from over-exploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation status
Grey seals are listed as being of least concern on the International Union for Conservation of Nature (IUCN) red list of threatened species (IUCN, 2010).Grey seals are now protected, although controlled hunting still occurs in some areas. Regular counts of grey seal populations suggest they are increasing (Perrin, 2009).Under the Conservation of Seals Act 1970, the Natural Environment Research Council is under obligation to the UK government to provide advice on the British seal populations (Special Committee on Seals, 2009).

Threats
Grey seals face several threats.Historically, populations of grey seals have suffered pressures from hunting and poaching. Some Atlantic populations were targeted because they were thought to be damaging commercial fishery stocks, either directly or indirectly (Jefferson et al, 2008). Grey seals can also become entangled in fishing nets.

Another danger of being a coastal species is the threat from industrial and agricultural pollutants appearing in the food chain. These can affect the seals' immune systems and within the Baltic populations has been linked to decline in reproduction (Jefferson et al, 2008). Phocine distemper virus (PDV) is carried in all grey seal populations, although they are not significantly affected (Harkonen et al, 2006; Barrett et al, 1995) by the disease and are less sensitive than harbour seals. Grey seals make a more efficient antibody response than harbour seals to virus proteins (Duignan, 1997). However, grey seals may contribute to transporting the disease to harbour seal populations as they often share the same haul out sites (Harkonen et al, 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Protected in Europe under Annex II and V of the EC Habitats Directive, and Appendix III of the Bern Convention (3). In Britain it is protected under the Conservation of Seals Act 1970 (closed season from 1 September until 31st December) (4), and listed under Schedule 3 of the Conservation Regulations (1994) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Grey Seal numbers are increasing at most locations, but are declining in a few localities. The Grey Seal population in the UK is one of the most intensively monitored large mammal populations in the world. Pup production of all the major breeding colonies is monitored regularly, annually in the UK and less frequently but regularly in Canada and other range states. However, because of differences in estimation methods and changes in population dynamics it is difficult to estimate the total global population size. For ease of comparison the most recent pup production estimates for all Atlantic populations are given in Table 1 in the linked PDF document, which forms an integral part of this assessment.

Baltic Grey Seals alternate between land- and ice-breeding, and the proportion of pups born on land vary from 5% to 95%, so it is not easy to use typical pup production counts to enumerate Grey Seals in the Baltic. Surveys in the Baltic count the number of seals hauled out during peak moulting season (late May-to early June), which represents approximately 80% of total population size (Hiby et al. 2007). Counted numbers hauled out in 2007 was estimated at 22,000.

Pup production figures can be used to derive approximate total population estimates. In Canada the “all age” population is approximately 250 000 divided into two main herds, one largely located in the southern Gulf of St Lawrence and the other at Sable Island (DFO 2006). The Sable Island colony has been increasing at a rate of 13% per year, but has recently showed signs of slowing (Bowen et al. 2007). The Gulf of St Lawrence population is decreasing (Hammill et al. 2007). In the UK the different subpopulations show differing dynamics (SCOS 2006). In the Hebrides and Northern Isles pup production has stabilized while in the central and Southern North Sea production is still increasing exponentially. The total population is estimated to be between 117,000 and 171,000 at the start of the breeding season, i.e. excluding pups. Overall the UK population is increasing at approximately 2.5% p.a. (SCOS 2007).

Total population estimates for other regions are: USA - 7,300 – increasing (Waring et al. 2005); Iceland – 11,600 – declining (Hauksson 2007); Norway - 3,100 – trend unknown (Wiig 1986); Ireland - 2,000 – increasing; Russia - 1,000-2,000- unknown; Baltic Sea - 22,000- increasing (2007, Helcom portal).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Grey Seals have been important in subsistence harvests in coastal areas within their range throughout history. They have been hunted in the Baltic Sea for more than 10,000 years (Harkonen et al. 2005). Commercial harvesting has been ongoing in many areas for hundreds of years, and at times Grey Seals have been important to local economies (Mansfield 1988). Over-harvesting in the Baltic in the early 20th century led to a large decline; this population once numbered somewhere between 80,000 and 100,000, but was reduced to about 20,000 in the 1940s. A further decline to 1,500-2,000 seals was caused by high loads of PCB (Harding and Härkönen 1999).

Government culls, bounties and licensed kills for protection of fishing gear have been put into effect in many countries and continue to be used to control Grey Seal numbers and reduce their impact on commercially important coastal fisheries (i.e. salmonid fisheries). Grey Seals feed on a number of commercial species, and by damaging nets and traps they are in direct conflict with fisheries. They also are vectors for parasites that can have an impact on the economy of some fisheries (see ICES 2005).

Entanglement in commercial fishing nets causes by-catch mortality in most parts of the Grey Seals’ range (Woodley and Lavigne 1991). By-catch levels are approximately 300 per year in Swedish fisheries in the Baltic (ICES 2005). A Norwegian study from 1975-1998 reported the death of 259 seals, representing 7% of the tagged animals, primarily juveniles less than a year old (Bjorge et al. 2002). Among 528 deaths of tagged seals in the UK, 148 were attributable to fishing nets. However, this may overestimate the rate of entanglement-related mortality due to the high rate of tag returns from fisheries. Woodley and Lavigne (1991) suggested that 1-2% of animals less than a year old die in fishing gear. Finally, in the United States’ Northeast sink-gillnet fishery there was an average annual mortality of 141 Grey Seals reported for the period 1999 to 2003 (Waring et al. 2005).

Grey Seals are known carriers of the morbillivirus, known as phocine distemper virus (PDV), in all populations (Ross et al. 1992, Duignan et al. 1995, Harkonen et al. 2006). However, they have suffered almost no mortality from the disease, in marked contrast to Harbour Seals. Harkonen et al. (2006) report Grey Seal mortality of approximately 230 (equal to 1% of the harbour seal mortality) in the 1988 epizootic in Europe and the death of 30 Grey Seal pups in the Baltic were attributed to PDV. Because Grey Seal haulout with Harbour Seals in the Wadden Sea and are known to travel more widely than the sedentary Harbour Seal, it is presumed that they had a role in the outbreak and spread of the 2002 epizootic of PDV in Harbour Seals (Harkonen et al. 2006).

Grey Seals are exposed to agricultural pollutants through the food chain in their coastal ranges. PCBs and DDT contaminant loads are extremely high in Baltic Grey Seals, despite the fact that tissue burdens have declined since the 1970s. Analysis of samples collected from 1996 to 1998 indicated that Grey Seals still have a very heavy load of contaminants when compared to other seals outside the Baltic (ICES 2005).

Health effects on Grey Seals have been suggested to be linked to their high exposures to PCBs and DDT. Baltic Grey Seal have a relatively high rate of colonic ulcers associated with hookworm infestations, which are sometimes fatal. This condition occurs in Baltic Ringed Seals as well, but is not found elsewhere in either species (ICES 2005). Uterine stenosis and a host of other pathologies in other organs have been attributed to long-term exposure to environmental toxics, particularly in older Baltic Grey Seals. These are specifically linked to reproductive and population declines for this subspecies and are conditions not seen in other populations (Bergman et al. 2001). However, no negative effects have been attributed to heavy metal contaminants in Baltic Grey Seals (Bergman et al. 2001, ICES 2005).

Grey Seals live close to human population centres and shipping lanes and spend much of their time in the vicinity of favourite haulout locations. Spilled oil from vessel accidents and other sources have fouled gray seal sites since at least the 1940s (St. Aubin 1990). Despite numerous records of oiled animals and occasional reports of dead animals coated in oil, or animals having ingested oil, it has not been determined whether these mortalities are attributable to contact with oil in this species (St. Aubin 1990).

Grey Seals are generalist predators and their population has increased in recent decades during periods of declines of some commercial fish stocks that are important Grey Seal prey. The risks of over-fishing induced declines of fish stocks on gray seals are unclear at this time. One potential threat is the risk of a demand for larger culls and control of Grey Seal populations to help rebuild fisheries stocks that are affected by, or are presumed to be affected by, gray seals.

The potential effects of climate change on Grey Seals are not well known. Although not a high Arctic species, some Grey Seals pup on ice and are seasonally associated with ice in parts of their range (Bonner 1981). It is unknown how decreases in sea-ice cover might affect Grey Seals, although Learmonth et al. (2006) identify the Grey Seal as a species that will probably undergo a decrease in its range because of climate change. Since Baltic Grey Seal pup mortality on land breeding sites is considerably greater compared with pups born on ice, and weaning weights much lower on land, a scenario with less ice will reduce the mean long-term growth rate in this population (Jussi et al. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Baltic population is much smaller than it was in the early 1990s, due to overexploitation and slow recovery caused in part by pollution-related reproductive declines (see Reeves et al. 1992). In many areas, entanglement in fishing nets results in mortality, especially of juveniles. Some hauling-out habitat has been lost to development.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

In 1914 the UK grey seal population was thought to number just 500, and the Grey Seals Protection Act was introduced that year (9). The Sea Mammal Research unit estimated that the British grey seal population numbered 124,300 in the year 2000, representing 40% of the world population (2). The population is increasing, which has led to highly controversial (7) concerns by fishermen that they pose a threat to fish stocks (9). Although protected between 1 September and 31st December by the Conservation of Seals Act (1970), they can still legally be shot during this time if they are damaging fishnets (4), furthermore illegal shooting continues (3). Grey seals are sensitive to disturbance by people and dogs, particularly when lactating. They are also susceptible to oil and chemical pollution and often become tangled up in fishing nets, which may be fatal (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Numerous countries have invoked protective measures to limit Grey Seal harvests, culls, disturbance and by-catch (Bonner 1981, ICES 2005). Pollutant loads in Baltic Grey Seals have declined following regulations banning the use and discharge of toxic pollutants such as DDT and PCBs beginning in the 1970s. Although the prevalence of colonic ulcers has increased over the last decades, the reproductive health of female Grey Seals has improved as has the population level in the Baltic (Bergman et al. 2001). Establishment of coastal marine reserves for seals in Norway have been more effective in protecting harbour seals than Grey Seals because the latter are more likely to travel outside the areas closed to fisheries and become entangled in nets (Bjorge et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Life-history information; determine the amount of competition between its associated species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Individuals protected by the Marine Mammal Protection Act.

Needs: Protect from hunting; land purchase of hauling out areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Several important grey seal sites in EC member countries have been proposed as Special Areas of Conservation. In August 1999 the location of the world's third largest island-based grey seal breeding colony, the uninhabited island of Linga Holm in the Orkney Islands was purchased by the Scottish Wildlife Trust as a sanctuary for grey seals (3). It has been suggested that human access to breeding sites could be restricted. This has occurred at Berry Head in Devon, where video monitors have been used to show the breeding seals to visitors, so pressures on the breeding site are reduced (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Grey seals are widely believed by commercial fisherman to be a pest. They may remove fish from nets, become tangled in nets, damage traps, and feed on farmed fish. These seals are also hosts for a parasitic roundworm called codworm (Pseudoterranova decipiens), that infects cod and other commercially harvested fish.

There is some dispute about the large-scale impacts of grey seals on the Atlantic fisheries, but they are at least occasionally a problem in local situations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past, grey seal pups were killed and harvested on a large commercial scale for their skins. There have been no recent large-scale hunts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Perceived to compete with fisheries for commercially valuable fishes (e.g., cods, herrings, salmon). May remove or mutilate fishes in nets and traps, often damaging gear in the process. May interfere with lobster trapping by opening traps and eating the bait. Serves as primary reservoir of codworm, the removal of which increases the cost of producing marketable cod and other fishes. Population control measures through bounty and culling schemes continue to be advocated by fishermen.

Has been exploited intensively (commerical and subsistence use) throughout the range (see Reeves et al. 1992). In Canada, bounty kills and culls of perhaps 2000 seals/year occurred from the 1960s to the 1980s. Commonly displayed in zoos and aquaria. Has been used in important studies of diving physiology and sleep.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey seal

The grey seal (Halichoerus grypus, meaning "hooked-nosed sea pig") is found on both shores of the North Atlantic Ocean. It is a large seal of the family Phocidae or "true seals". It is the only species classified in the genus Halichoerus. Its name is spelled gray seal in the US; it is also known as Atlantic grey seal and the horsehead seal.[3]

Contents

Appearance

It is a large seal, with the bulls reaching 2.5–3.3 m (8.2–11 ft) long and weighing 170–310 kg (370–680 lb); the cows are much smaller, typically 1.6–2.0 m (5.2–6.6 ft) long and 100–190 kg (220–420 lb) in weight. Individuals from the western Atlantic are often much larger, with males reaching 400 kg (880 lb) and females weighing up to 250 kg (550 lb).[4] It is distinguished from the harbor seal by its straight head profile with nostrils that are well apart, and fewer spots on its body. Bull Greys have larger noses and a more convex profile than common seal bulls. Males are generally darker than females, with lighter patches and often scarring around the neck. Females are silver grey to brown with dark patches.

Ecology and distribution

In Great Britain and Ireland, the grey seal breeds in several colonies on and around the coasts. Notably large colonies are at Donna Nook (Lincolnshire), the Farne Islands off the Northumberland Coast (about 6,000 animals), Orkney and North Rona off the north coast of Scotland, Lambay Island off the coast of Dublin and Ramsey Island off the coast of Pembrokeshire. In the German Bight, colonies exist off the islands Sylt and Amrum and on Heligoland.[5]

In the Western North Atlantic, the grey seal is typically found in large numbers in the coastal waters of Canada and south to about New Jersey in the United States. In Canada, it is typically seen in areas such as the Gulf of St. Lawrence, Newfoundland, the Maritimes, and Quebec. The largest colony in the world is at Sable Island, NS. In the United States it's found year round off the coast of New England, in particular Maine and Massachusetts, and slightly less frequently in the Middle Atlantic States. Its natural range extends south to Virginia.

An isolated population exists in the Baltic Sea,[2] forming the H. grypus balticus subspecies. One case of occurrence was registered in the Black Sea near the coasts of Ukraine[6]

Balitc Sea. On the beach in Niechorze ( Poland )

During the winter months grey seals can be seen hauled out on the rocks, islands, and shoals not far from shore, and occasionally coming ashore to rest. In the spring the recently weaned pups and yearlings occasionally strand on beaches after becoming "lost."

Diet

The grey seal feeds on a wide variety of fish, mostly benthic or demersal species, taken at depths down to 70 m (230 ft) or more. Sand eels (Ammodytes spp) are important in its diet in many localities. Cod and other gadids, flatfish, herring[7] and skates[8] are also important locally. However, it is clear that the grey seal will eat whatever is available, including octopus[9] and lobsters.[10] The average daily food requirement is estimated to be 5 kg (11 lb), though the seal does not feed every day and it fasts during the breeding season.

Reproduction

Cow and bull gray seals mating, Donna Nook, Lincolnshire, U.K. Nov 2007

The pups are born in autumn (September to November) in the eastern Atlantic and in winter (January to February) in the west, with a dense, soft silky white fur; at first they are small and shrivelled-looking, but they rapidly fatten up to look like over-filled barrels, from the extremely fat-rich milk they receive from their mothers. Within a month or so, they shed the pup fur and grow the dense waterproof adult fur, and soon leave for the sea to learn to fish for themselves. In recent years, the number of grey seals has been on the rise in the west and in Canada there have been calls for a seal cull.

Status

In the United States grey seal numbers are increasing rapidly. Up until 1962, Maine and Massachusetts had bounties on seals so that only a few isolated colonies of grey seals remained in Maine. Then in 1972 Congress passed the Marine Mammal Protection Act that prevented harming or harassing seals, and grey seal populations rebounded. For example there is a large breeding colony near Cape Cod, Massachusetts, where pups rebounded from a handful in 1980 to more than 2,000 in 2008. By 2009, thousands of grey seals there had taken up residence on or near popular swimming beaches when Great White Sharks started hunting them close to shore.[11] Also grey seals are seen increasingly in New York and New Jersey waters, and it's expected that they will establish colonies further south.

In the UK seals are protected under the Conservation of Seals Act 1970, however it does not apply to Northern Ireland. In the UK there have also been calls for a cull from some fishermen, claiming that stocks have declined due to the seals.

The population in the Baltic Sea has increased about 8% per year between 1990 and the mid-2000s with the numbers becoming stagnant since 2005. As of 2011 hunting grey seals is legal in Sweden and Finland with 50% of the quota being used. Other anthropogenic causes of death include the drowning in fishing gear.[12]

Subspecies

There are two recognized subspecies of this seal:[1]

References

  1. ^ a b Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001036. 
  2. ^ a b Thomspon, D. & Harkonen, T. (2008). Halichoerus grypus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 January 2009.
  3. ^ Mowat, Farley, Sea Of Slaughter, Atlantic Monthly Press Publishing, First American Edition, 1984.
  4. ^ Gray Seal (marine mammals) . what-when-how.com
  5. ^ Hahn, Melanie (13 January 2010). "Kegelrobben-Geburtenrekord auf Helgoland" (in German). Nordseewolf Magazin. http://www.nordseewolf.de/magazin/13-01-2010/kegelrobben-geburtenrekord-auf-helgoland/. Retrieved 20 November 2011. 
  6. ^ Kovtun O.O. (2011) Rare sightings and video-recording of the grey seal, Halichoerus grypus (Fabricius, 1791), in coastal grottoes of the eastern Crimea (Black Sea). Marine Ecological Journal, 10(4):22. (in Russian)
  7. ^ Stenman, Olavi (2007). "How does hunting grey seals (Halichoerus grypus) on Bothnian Bay spring ice influence the structure of seal and fish stocks?". International Council for the Exploration of the Sea. http://www.ices.dk/products/AnnualRep/ASCproceedings/2007/Annual%20Science%20Conference%202007/CM-2007/C/C1207.pdf. Retrieved 20 November 2011. "Analysis of fish otolithes and other hard particles in the alimentary tract showed clearly that the herring (Clupea harengus) was the most important item of prey." 
  8. ^ Savenkoff, Claude; Morissette, Lyne; Castonguay, Martin; Swain, Douglas P.; Hammill, Mike O.; Chabot, Denis; Hanson, J. Mark (2008). "Interactions between Marine Mammals and Fisheries: Implications for Cod Recovery". In Chen, Junying; Guo, Chuguang. Ecosystem Ecology Research Trends. Nova Science Publishers. p. 130. ISBN 978-1-60456-183-8. http://books.google.com/books?id=AH9JghsCN0gC&pg=PA130&lpg=PA130&dq=Grey+seal+skates&source=bl&ots=klm07X1WVW&sig=w9LQ-5TZz5ehmhXWqVcznXWWMUE&hl=de&ei=1xPJTtG2FM-E-wbiuck8&sa=X&oi=book_result&ct=result&resnum=2&ved=0CCkQ6AEwAQ#v=onepage&q=Grey%20seal%20skates&f=false. 
  9. ^ "Grey seal". Wales Nature & Outdoors. BBC Wales. 25 February 2011. http://www.bbc.co.uk/wales/nature/sites/species/mammals/grey_seals.shtml. Retrieved 20 November 2011. 
  10. ^ "The Grey Seal". Ask about Ireland. http://www.askaboutireland.ie/reading-room/environment-geography/flora-fauna/flora-and-fauna-of-wexfor/fauna-of-the-wexford-slob/the-grey-seal/. Retrieved 20 November 2011. 
  11. ^ Once again, coastal waters getting seals’ approval Boston Globe, October, 2009.
  12. ^ Bäcklin, Britt-Marie; Moraeus, Charlotta; Kunnasranta, Mervi; Isomursu, Marja (2 September 2011). "Health Assessment in the Baltic grey seal (Halichoerus grypus)". HELCOM Indicator Fact Sheets 2011. HELCOM. http://www.helcom.fi/BSAP_assessment/ifs/ifs2011/en_GB/BalticGreySeal. Retrieved 18 November 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Boskovic et al. (1996) examined mtDNA variation among seals from the Gulf of St. Lawrence, Sable Island, Nova Scotia, Norway, and the Baltic Sea. They found no shared haplotypes between the western Atlantic group and the eastern Atlantic group. MtDNA data indicated little or no geogrpahic separation between animals breeding in the Gulf of St. Lawrence and those breeding on Sable Island.

A cladistic analysis of mtDNA data yielded three clades among northern seals: Phoca-Pusa-Halichoerus, Cystophora-Pagophilus, and Erignathus (Perry et al. 1995). Each clade may be regarded as a tribe of the subfamily Phocinae. The magnitude of the differences among Phoca, Pusa, and Halichoerus was on the same order as that between species and subspecies within the genus Odocoileus. Because Cystophora is the closest relative of Pagophilus, the latter cannot be regarded as congeneric with Phoca; the differences between the two are great enough to justify placing them in separate genera (Perry et al. 1995).

Mouchaty et al. (1995) examined the cytochrome b gene and found a close phylogenetic relationship between P. hispida and Halichoerus grypus, which, they noted, merits further study.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!