Articles on this page are available in 2 other languages: Spanish (16), Dutch (1) (learn more)

Overview

Brief Summary

Biology

This species is gregarious; on land it forms groups to breed, rest and moult that are generally small but may number up to 1,000 individuals (5). Common seals feed mainly on a variety of fish, but squids, whelks, crabs and mussels are also taken. Juveniles feed on shrimps before progressing to the adult diet (2). When feeding, common seals travel up to 50 kilometres from haul-out sites to feed and may stay out at sea for days. They can dive for up to 10 minutes, and reach depths of 50 metres or more (3). With regards to breeding, there is apparently no social organisation, but females often give birth in small groups (7). Females give birth to a single pup at the end of June to early July (8). The pups weigh 11 to 12 kilograms at birth and are able to swim and crawl almost immediately (2). Pups are nursed for about four weeks, after which they may disperse over long distances (5). Around the time that the pup is weaned, females become receptive and copulation occurs. Males frequently engage in underwater displays and fights around this time and can lose up to 25 percent of their body weight (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Harbor Seals live near coastlines and eat a highly varied seafood diet, depending on what is available. They can dive as deep as 450 m and stay under for almost half an hour, but six-minute dives to depths of 30-100 m are more usual. Females usually have one pup a year, and two weeks after the pup is born, mate again. The fertilized egg stays dormant in the uterus for up to three months before it implants in the uterine wall and begins to grow. This is called delayed implantation. Total gestation, including the period of delay, lasts 8-9 months. Instead of being born with the white coat typical of most seals in the family Phocidae, the pups often molt before birth, shedding the very soft white or pale gray coat called a lanugo while they are still in the uterus. Like dogs, Harbor Seals can suffer from heartworm. The disease has been found in North American and European populations.

Links:
Mammal Species of the World
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. p. 38. Tenth Edition, Vol. 1. Laurentii Salvii, Stockholm, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

You wouldn't think so when looking into those beautiful black eyes, but harbour seals are wild predators! Their sharp teeth and streamlined body are perfect for hunting fish. Harbour seals are the most prominent seal speceis in the Wadden Sea. During low tide, they lie on the sandbanks in the sun and to rest. In the summer, they give birth and nurse their young. These seals are called harbour seals because they used to follow schools of fish into harbours.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Harbour seals are good swimmers. The pinipeds serve as rudder. The body and back pinnipeds cause propulsion. The seal is highly adapted to speed with its torpedo-like body and pinna. Observations made from ships revealed that they generally swim just 10 m beneath the water surface and that only rarely will they hunt under –20 m.  Young harbour seals are born on tide-sandbanks between the end of June and mid July, and are required, almost immediately (during high-tide) to be able to swim. 

 In general, harbour seals feed on benthic fish (such as flounder, sole, cod and whiting), but they must largely be quite opportunistic in regard to what they eat. They may also feed on mussels, crabs and cephalopods.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Phoca vitulina, the Harbour or Common seal, is a marine mammal frequently seen around the UK coastline.Harbour seals are vulnerable to viral distemper which is causing mass mortalities, losses were particularly high in 1988 and 2002.Since these seals spend much of their time in water, estimating population numbers is not easy but worryingly, numbers are declining progressively.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Also known as the harbour seal, the common seal is the smaller of the two breeding seals in Great Britain (6). When hauled out it often adopts a characteristic 'head-up, tail-up' posture. The colour is variable, ranging from black-grey to sandy brown with many small spots. The top of the small head is round and the nostrils form a 'V' (2). Males are often darker in colour than females and have a heavier appearance. The white natal coat of the young is shed inside the uterus; pups are therefore born with their first adult coat (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The common seal is present in the eastern Atlantic region with its subspecies Phoca vitulina. It is regularly distributed throughout the entire marine Baltic region and in the marine Atlantic region from the Unite d Kingdom and Ireland to mainland European coasts from Sweden and southwards to France (Brittany) and occasionally as far south as northern Portugal. The Baltic population was close to e x tinction in the 1970s and wide spread declines have occurred in the United Kingdom , Kattegat and Skagerrak , and Wadden Sea populations. The species is vulnerable to fishery bycatch, culling, high pollution loads, disease events, and disturbance to haul out are as.

The overall conservation status in the marine Atlantic region is ‘unfavourable -inadequate’ and dictated largely by the status (decre asing trend and population numbers be low the reference values) of the United Kingdom population which represents more than 50% of the marine region’s population. In the Baltic on the other hand, the overall assessment is ‘unfavourable-bad’ due to the status of the Swedish population which re presents almost half of the Baltic population. The species is listed as ‘least concern’ in the IUCN Red List of threatened species.

The Conservation of Seals Act, 1970, provides a closed season for the Common seal during its pupping season. During this time, it is illegal to kill or take seals without a licence. There is also provision for giving complete protection to seals at al times, if neccesary. During the close season, a license is required to handle seals unless they are sick or injured (SMRU, 2004). The Baltic and Wadden Sea populations are listed under the Bonn Convention (Appendix II).

  • European Environtment Agency (http://biodiversity.eionet.europa.eu/article17)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: budiutamihanjaniputri

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Projects

With the vast coastline of the UK and Europe monitoring seal populations is challenging. Members of the public often participate surveys and along your local coastline you can play an important role in alerting authorities to the occurrence of sickened animals during episodes of viral distemper.Further information about seals and their biology can be found at the Sea Mammal Research Unit.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Harbour seals are usually sexually mature after the first five years of life and can live up to 35 years of age.In UK-waters, harbour seals can sometimes be found alongside the larger grey seal (Halichoerus grypus). Both species are vulnerable to viral distemper caused by PDV (Phocine Distemper Virus) but mortalities in the grey seal are not as pronounced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Common seals have a rounded head with eyes equidistant between the nose and the ears. The nostril slits form a characteristic 'v' shape when viewed from the front. Adult common seals grow up to 1.2 to 2 metres long, and weigh around 65-140 kg. Males are slightly bigger than females. The coat is grey to brownish-grey with a uniform pattern of small darker spots, although the pattern varies geographically. Individuals may live for 20-30 years (SMRU, 2004).May be confused with the grey seal (Halichoerus grypus) that has a much longer muzzle and their nostril slits are nearly parallel.  

Seals are highly adapted to live in water. Their limbs are modified into flippers and they have streamlined bodies. Phoca vitulina can dive to 450 m and remain submerged for up to 30 minutes. The common seal is a strong swimmer and can be seen leaping completely out of the water (porpoising) (Nowak, 2003). Only the head is usually seen when the seal is in water. As well as being fur-coated they have a thick layer of subcutaneous fat or blubber. This keeps them warm and enhances streamlining (SMRU, 2004). Seals are warm-blooded air-breathing mammals but spend a considerable amount of time below the water surface. Common seals give birth to pups in June and July and moult in August. The main threat to seals in the UK and Ireland is organochlorine compounds that may interfere with reproduction (SMRU, 2004).

 The Common or harbour seal has been reported as non-migratory and littoral in distribution and as exhibiting a diurnal haul-out pattern (Evans & Raga, 2001). Common seals in Europe belong to a distinct sub-species. Britain holds around 40% of the world population of the European sub-species (Duck & Thompson, 2003).

 The Conservation of Seals Act, 1970, provides a closed season for the Common seal during its pupping season. During this time, it is illegal to kill or take seals without a licence. There is also provision for giving complete protection to seals at al times, if neccesary. During the close season, a license is required to handle seals unless they are sick or injured (SMRU, 2004). The Baltic and Wadden Sea populations are listed under the Bonn Convention (Appendix II).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Bay of the Wash, Belgian Exclusive Economic Zone, Blankenberge, Bredene, De Haan, Delta area, European waters (ERMS scope), Flemish Banks, Gulf of Maine, Knokke, Koksijde, Middelkerke, Nieuwpoort, North Coast of France, North West Atlantic, Northern Hemisphere, Oostende, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wadden Sea, Wenduine, Westende, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Harbour seals are one of the most widespread of the pinnipeds. They are found throughout coastal waters of the Northern Hemisphere, from temperate to Polar Regions. Five subspecies are recognized: P. v. vitulina occurs in the eastern Atlantic from Brittany to the Barents Sea in north-western Russia and north to Svalbard, with occasional sightings as far south as northern Portugal; P. v. concolor occurs in the western Atlantic from the mid-Atlantic United States to the Canadian Arctic and east to Greenland and Iceland; P. v. mellonae only lives in a few lakes and rivers in northern Quebec, Canada, that drain into Hudson and James Bays (geological changes prohibit these seals from leaving this freshwater habitat); P. v. richardii is found in the eastern Pacific from central Baja California, Mexico to the end of the Alaskan Peninsula and possibly to the eastern Aleutian Islands, and; P. v. stejnegeri ranges from either the end of the Alaskan Peninsula or the eastern Aleutians to the Commander Islands, Kamchatka and through the Kuril Islands to Hokkaido in the western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Phoca vitulina is the most widely distributed pinniped. This species is found in temperate, subarctic, and arctic coastal areas on both sides of the North Atlantic and North Pacific oceans. Five separate subspecies have been identified, each common to a specific coastal region.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Temperate and subarctic regions of the Northern Hemisphere. In the western North Atlantic, breeds at least from Cape Dorset on southwestern Baffin Island to Massachusetts; occurs along west coast of Greenland as far north as Disko Island and Avanersuaq, along the east coast to Ittoqqortormiit (Teilman and Dietz 1994); small numbers occur, mostly in river mouths, in parts of Hudson Strait, Ungava Bay, and Hudson Bay; small local populations inhabit some rivers and lakes of western Hudson Bay, moving as far as 240 km inland; small population occurs in the Lacs des Loups Marins (Seal Lakes) at the headwaters of the Nastapoka River in northern Quebec; large population breeds on Sable Island, 125 km off Nova Scotia; extirpated from Lake Champlain and Lake Ontario; sometimes ranges as far north as Ellesmere Island and as far south as Florida (Reeves et al. 1992, which see for distribution in eastern North Atlantic. In the eastern Pacific, breeds from Bahia San Quintin, Baja California, to Aleutian Islands, Pribilof Islands, and Nome, Alaska; in the western Pacific, Commander Islands south to Hokkaido, Japan (Reeves et al. 1992). In eastern North Atlantic, ranges from Murmansk to the outer Baltic and northern France, United Kingdom south to east Anglia, southern Ireland, Faroes, Spitsbergen, and Iceland (McLaren, in Macdonald 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Harbour seals are mainly founded focused along the north-western coastline of Scotland.Along the English coastline there are large colonies in the Wash and sub-colonies on northern parts of the Norfolk.Across the North Sea there are likely to be some 30,000 animals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The common seal is found from the subtropics to the Arctic around coasts of the North Atlantic and the North Pacific (6). In Europe they occur off Icelandic, Danish, German, Dutch and Icelandic coasts as well as around the UK. The UK supports 45 percent of the European population (five percent of the world population); main centres of population occur in the Moray Firth, The Wash and the Tay Estuary, and the species is fairly widespread around west Scotland, the Northern Isles and the Hebrides (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Harbor seals can be up to 6 feet long and weigh up to 375 pounds, males characteristically being slightly larger than females. The rounded, fusiform body is covered by a coat made of thick, short hairs that range from nearly white with dark spots to black or dark brown with white rings. The dorsal surface is usually more densely covered with spots or rings than the ventral surface.

The limbs of the harbor seal have been modified into flippers. The foreflippers (pectoral flippers) are composed of 5 digits of similar length and webbed together. Claws on the foreflippers are used for scratching, grooming, and defense. The hind flippers also have 5 digits; however, the first and fifth digits are long and stout, while the middle digits are shorter and thinner. The hind flippers propel the seal forward by moving side to side. On land, the harbor seal moves by undulating in a caterpillar-like motion.

Range mass: 50 to 170 kg.

Range length: 2 (high) m.

Sexual Dimorphism: male larger

Average basal metabolic rate: 73.29 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 170 cm

Weight: 136000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly larger than females.

Length:
Average: 1.8 m males; 1.5 m females

Weight:
Average: 130 kg males; 105 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Harbour seals can reach up to 1.6 m in length and weigh about 120 kilos. Their colour varies from grey to brown with black marks. A characteristic feature is their V-shaped nostrils.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morphology

Distinguishing Characteristics: small in size in relation to seals, dog-like face, v-shaped nostrils, colour varies from white to tan to dark brown to red (molttled):
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Phoca vitulina
Catalog Number: USNM A3648
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): Collector Unknown
Locality: Deception Island, South Shetland Islands, Weddell Sea, South Atlantic Ocean
  • Type: Peale. 1848. U.S. Exploring Expedition, 8 (Mam. And Ornith.). 30, pl. 31.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adult males are up to 1.9 m long and weigh 70-150 kg, females 1.7 m and 60-110 kg. At birth, pups are 65-100 cm and 8-12 kg (Burns 2002).

Harbour seals are mainly found in the coastal waters of the continental shelf and slope, and are also commonly found in bays, rivers, estuaries and intertidal areas. On land, harbor seals are usually extremely wary and shy unless habituated to human activities and noise sources in their vicinity. It is almost impossible to approach them when they are ashore without stampeding them into the water. Most harbour seal haul-out sites are used daily, based on tidal cycles and other environmental variables, although foraging trips can last for several days. Although generally considered a non-migratory species with a high degree of site fidelity to a haul out, juvenile dispersal, emigration and establishment of new haul out sites are all possible reasons for long range movements of harbour seals (Burns 2002).

Harbour seals are gregarious at haul-out sites. However, they usually do not lie in contact with each other. They will haul out on rocks, sand and shingle beaches, sand bars, mud flats, vegetation, a variety of man-made structures, glacial ice, and to a very limited extent sea ice in some areas. They usually lie close to the water to permit a rapid escape from threats. Sex and age segregation is common in most populations (Kovacs et al. 1990). At sea, they are most often seen alone, but occasionally occur in small groups. Localized aggregations can form in response to feeding opportunities and concentration of prey.

Male harbour seals become sexually mature when four to five years old. Female harbour seals usually become sexually mature when three to five years old. Gestation lasts 10.5-11 months, including a 2+-month delayed implantation. Throughout the range, the time of birthing varies widely and may follow a latitudinal cline (Temte 1994). Peak pupping date varies from mid March to early September. The mating system is promiscuous, or weakly polygynous, with males defending underwater calling sites (e.g. Van Parijs and Kovacs 2002). Mating usually takes place in the water, with females coming into oestrus around a month after giving birth. Moult follows the pupping and mating season. The timing of onset of moult depends on the age and sex of the animal with yearlings moulting first and adult males last (e.g. Reder et al. 2003). Most harbour seal monitoring programs are based on counts obtained during the moult and are therefore subject to possible biases due to changes in age and sex structure of the population.

Most pups shed their silvery gray lanugo coat in the uterus before birth. Exceptions to this include pups born prematurely, and some that are born early in the breeding season. Pups usually enter the water rapidly after birth, and because of tidal inundation at many sites used for birthing, this often occurs in hours (Burns 2002).

Harbour seals are generalist feeders that take a wide variety of fish, cephalopods, and crustaceans obtained from surface, mid-water, and benthic habitats (e.g. Olesiuk et al 1990, Payne and Selzer 1989). Their diet is highly varied, and animals from different populations and areas show differences and there is also variation associated with seasonal changes in the abundance of prey (e.g. Harkonen 1987, Andersen et al. 2004). Generally, a few species dominate the diet at any one location and time of year. Although primarily coastal, dives to over 500 m have been recorded (Burns 2002). Harbour seals also take many commercially important fish species such as Atlantic cod, many kinds of salmon, herring, and flatfishes to name a few, and this aspect of their foraging puts them into conflict with coastal fisheries.

Longevity is typically 35 years for females and 25 years for males, but is lower in P. v. stejnegeri and P. v. richardii which are reported to live to approximately 20 years for males and 30 years for females. Predators include killer whales, great white and Greenland sharks and possibly other shark species, Steller sea lions and walrus, gulls and ravens and in southerly locales feral dogs and eagles. There is no information on polar bear, brown bear, and wolf predation on harbor seals, but all are possible predators.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Harbor seals bask and sleep on coastal islands, ledges, and beaches and sandbars that are uncovered at low tide. They stay close enough to water to facilitate feeding and mating.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nearshore waters of the Atlantic Ocean and adjoining seas above about 30 degrees latitude
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

temperate to polar
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9881 specimens in 1 taxon.
Water temperature and chemistry ranges based on 896 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.297 - 21.498
  Nitrate (umol/L): 0.240 - 12.040
  Salinity (PPS): 30.381 - 35.656
  Oxygen (ml/l): 5.180 - 8.103
  Phosphate (umol/l): 0.205 - 1.202
  Silicate (umol/l): 0.987 - 22.664

Graphical representation

Temperature range (°C): 0.297 - 21.498

Nitrate (umol/L): 0.240 - 12.040

Salinity (PPS): 30.381 - 35.656

Oxygen (ml/l): 5.180 - 8.103

Phosphate (umol/l): 0.205 - 1.202

Silicate (umol/l): 0.987 - 22.664
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal waters to about 10 miles offshore, bays, harbors, coastal rivers, lakes. Most common in protected areas such as bays or inlets, much less numerous along simple open coastlines. Some frequently occur in freshwater bodies connected to the ocean. Resident year-round in freshwater in Lacs des Loups Marins (Quebec; Smith, 1996 COSEWIC report) and possibly in Lake Iliama (Alaska). Rests on isolated mudbanks, rocky or sandy shores, intertidal ledges, reefs, islands; sometimes piers and log rafts; also on ice in some areas (Scheffer 1958, Boulva and McLaren 1979, Johnson and Jeffries 1977, Burns and Gol'tsev 1984, Hoover 1988).

Pups are born on shore, often in an intertidal area; secluded sites and areas beyond strong wave action.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The common seal lives mainly along shorelines and in estuaries. It is commonly seen resting on sandbanks, easily accessible beaches, reefs and protected tidal rocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common seals seem to prefer sheltered waters. They haul out on a range of habitats such as rocky shores, sand and gravel beaches, mudflats and sand bars. Preferred haul out sites are protected against land predators and strong winds or waves, are close to food sources and enable direct access to deep water (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In some areas, makes seasonal migrations of up to at least several hundred kilometers. Many seals that summer in Bay of Fundy and Maine apparently migrate southward to winter in southern New England (Rosenfeld et al. 1988). In southern California, adults remain close to the Channel Islands year-round (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet varies with the season and region. Their food consists of crustaceans, mollusks, squid, and a variety of fish. Harbor seals do not chew their food; they either tear it into chunks or swallow it whole. Their molars allow them to crush hard objects like shells and crustaceans. Adults consume around 4.5 to 8.2 kg of food per day, which is 5-6% of their body weight.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Newly weaned pups eat mainly bottom-dwelling crustaceans. Older individuals feed opportunistically on various fishes and some cephalopods and crustaceans. In southern California, most dives were 17-87 m (sometimes up to several hundred meters).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

Harbor seals are eaten by great white sharks and killer whales.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Hundreds of haulouts worldwide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population probably is at least 500,000. Population in eastern Canada south of Labrador was about 13,000 (and increasing) in the mid-1980s. In 1986, nearly 13,000 were counted at haul-out sites in Maine. Several thousand occur in winter in coastal southern New England. Total population in the North Pacific was estimated at more than 300,000 in 1979, with at least two-thirds of these in Alaska. Post-pupping population in British Columbia was 75,000-88,000 in the late 1980s. California population was estimated at 34,500 in the mid-1990s (NMFS, Federal Gister, 15 March 1996). See Reeves et al. (1992) for information on

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

DMS in the odor landscape of the sea

Dimethyl Sulfide or DMS is present throughout the ocean(1). It’s an important odor component of many fish and shellfish, including clams, mussels, oysters, scallops, crabs and shrimp(2-9). Where does it come from? Usually from the marine plants they feed on.

Many species of plants and algae produce DMS, but not all species produce significant amounts of it. Nearly all of these are marine, and they tend to be in closely related groups with other DMS-producers, including Chlorophyte (green) seaweeds, the Dinophyceae in the dinoflagellates, and some members of the Chrysophyceae and the Bacillariophyceae (two classes of diatoms). Other large groups, like cyanobacteria and freshwater algae, tend not to produce DMS. (10,11)

Why do these groups produce DMS? In algae, most researchers believe a related chemical, DMSP, is used by the algae for osmoregulation- by ensuring the ion concentration inside their cells stays fairly close to the salinity in the seawater outside, they prevent osmotic shock. Otherwise, after a sudden exposure to fresh water (rain at the sea surface, for instance) cells could swell up and explode. In vascular plants, like marsh grasses and sugar cane, it’s not clear what DMS is used for. (12,13)

Freshly harvested shellfish can smell like DMS because DMSP has accumulated in their tissue from the algae in their diet. Some animals, including giant Tridacna clams and the intertidal flatworm Convoluta roscoffensis, harbor symbiotic algae in their tissues, which produce DMSP; this may not be important to their symbioses, but for Tridacna, the high DMS levels can be a problem for marketing the clams to human consumers. After death, DMSP begins to break down into DMS. A little DMS creates a pleasant flavor, but high concentrations offend the human palate.(2,14)

Not all grazers retain DMS in their tissues, though. At sea, DMS is released when zooplankton feed on algae. It’s been shown in the marine copepods Labidocera aestiva and Centropages hamatus feeding on the dinoflagellate Gymnodinium nelson that nearly all the DMS in the consumed algae is quickly released during feeding and digestion.(15) This has a disadvantage for the grazing zooplankton. Marine predators, like procellariiform seabirds, harbor seals, penguins, whale sharks, cod, and coral reef fishes like brown chromis, Creole wrasse and boga, can use the smell of DMS to locate zooplankton to feed on. (8,16,17)

It’s not easy to measure how much DMS is released from the Ocean into the air every year. Recent estimates suggest 13-37 Teragrams, or 1.3-3.7 billion kilograms. This accounts for about half the natural transport of Sulfur into the atmosphere, is the conveyor belt by which Sulfur cycles from the ocean back to land. In the atmosphere, DMS is oxidized into several compounds that serve as Cloud Condensation Nuclei (CCN). The presence of CCN in the air determines when and where clouds form, which affects not only the Water cycle, but the reflection of sunlight away from the Earth. This is why climate scientists believe DMS plays an important role in regulating the Earth’s climate. (12,18)

  • 1) BATES, T. S., J. D. Cline, R. H. Gammon, and S. R. Kelly-Hansen. 1987. Regional and seasonal variations in the flux of oceanic dimethylsulfide to the atmosphere. J. Geophys. Res.92: 2930- 2938
  • 2) Hill, RW, Dacey, JW and A Edward. 2000. Dimethylsulfoniopropionate in giant clams (Tridacnidae). The Biological Bulletin, 199(2):108-115
  • 3) Brooke, R.O., Mendelsohn, J.M., King, F.J. 1968. Significance of Dimethyl Sulfide to the Odor of Soft-Shell Clams. Journal of the Fisheries Research Board of Canada, 25:(11) 2453-2460
  • 4) Linder, M., Ackman, R.G. 2002. Volatile Compounds Recovered by Solid-Phase Microextraction from Fresh Adductor Muscle and Total Lipids of Sea Scallop (Placopecten magellanicus) from Georges Bank (Nova Scotia). Journal of Food Science, 67(6): 2032–2037
  • 5) Le Guen, S., Prost, C., Demaimay, M. 2000. Critical Comparison of Three Olfactometric Methods for the Identification of the Most Potent Odorants in Cooked Mussels (Mytilus edulis). J. Agric. Food Chem., 48(4): 1307–1314
  • 6) Piveteau, F., Le Guen, S., Gandemer, G., Baud, J.P., Prost, C., Demaimay, M. 2000. Aroma of Fresh Oysters Crassostrea gigas: Composition and Aroma Notes. J. Agric. Food Chem., 48(10): 4851–4857
  • 7) Tanchotikul, U., Hsieh, T.C.Y. 2006. Analysis of Volatile Flavor Components in Steamed Rangia Clam by Dynamic Headspace Sampling and Simultaneous Distillation and Extraction. Journal of Food Science, 56(2): 327–331
  • 8) Ellingsen, O.F., Doving, K.B. 1986. Chemical fractionation of shrimp extracts inducing bottom food search behavior in cod (Gadus morhua L.). J. Chem. Ecol., 12(1): 155-168
  • 9) Sarnoski, P.J., O’Keefe, S.F., Jahncke, M.L., Mallikarjunan, P., Flick, G. 2010. Analysis of crab meat volatiles as possible spoilage indicators for blue crab (Callinectes sapidus) meat by gas chromatography–mass spectrometry. Food Chemistry, 122(3):930–935
  • 10) Malin, G., Kirst, G.O. 1997. Algal Production of Dimethyl Sulfide and its Atmospheric Role. J. Phycol., 33:889-896
  • 11) Keller, M.D., Bellows, W.K., Guillard, R.L. 1989. Dimethyl Sulfide Production in Marine Phytoplankton. Biogenic Sulfur in the Environment. Chapter 11, pp 167–182. ACS Symposium Series, Vol. 393. ISBN13: 9780841216129eISBN: 9780841212442.
  • 12) Yoch, D.C. 2002. Dimethylsulfoniopropionate: Its Sources, Role in the Marine Food Web, and Biological Degradation to Dimethylsulfide. Appl Environ Microbiol., 68(12):5804–5815.
  • 13) Otte ML, Wilson G, Morris JT, Moran BM. 2004. Dimethylsulphoniopropionate (DMSP) and related compounds in higher plants. J Exp Bot., 55(404):1919-25
  • 14) Van Bergeijk, S.A., Stal, L.J. 2001. Dimethylsulfonopropionate and dimethylsulfide in the marine flatworm Convoluta roscoffensis and its algal symbiont. Marine Biology, 138:209-216
  • 15) Dacey , J.W.H. and Stuart G. Wakeham. 1986. Oceanic Dimethylsulfide: Production during Zooplankton Grazing on Phytoplankton. Science, 233( 4770):1314-1316
  • 16) Nevitt, G. A., Veit, R. R. & Kareiva, P. (1995) Dimethyl Sulphide as a Foraging Cue for Antarctic Procellariiform Seabirds. Nature 376, 680-682.
  • 17) Debose, J.L., Lema, S.C., & Nevitt, G.A. (2008). Dimethylsulfionoproprianate as a foraging cue for reef fishes. Science, 319, 1356.
  • 18) Charlson, R.J., Lovelock, J.E., Andraea, M.O., Warren, S.G. 1987. Oceanic phytoplankton, atmospheric sulphur, cloud albedo and climate. Nature, 326:655-661
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mainly solitary in water, forms usually small groups when ashore or out of water on exposed rocks (sometimes up to several hundred). Mean maximum distance between haulout sites used by adults in Alaska was 14.7 kilometers; at-sea foraging area size averaged 267 square kilometers for adults and 385 square kilometers for subadults (Small and ver Hoef 2001).

Common causes of mortality include abandonment or orphaning of pups and predation by sharks, killer whales, and sometimes other mammals. Also, outbreaks of disease (influenza, distemper) sometimes kill hundreds or thousands of individuals in a local or regional population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Using special tagging devices it is possible to record the movements of animals.Adults are capable of dispersing widely throughout the North Sea but more usually stay 5-20km around their haul-out sites, diving and locally foraging for food.British and Danish populations often intermingle and in so doing sometimes spread viral distemper.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Activity pattern governed by tides and weather. Usually rests on shore or on rocks exposed during low tide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
34.0 years.

Average lifespan

Status: wild:
40.0 years.

Average lifespan

Sex: male

Status: wild:
26.0 years.

Average lifespan

Sex: female

Status: wild:
32.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 47.6 years (captivity) Observations: In the wild, these animals are believed to live up to 40 years (Bernhard Grzimek 1990). One wild born specimen was about 47.6 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Pre-mating behavior is exhibited by both males and females, such as rolling, bubble-blowing, and mouthing each other's necks. This behavior ends once mating begins. Males initiate behavior by chasing, playfully biting, and embracing females. Females respond, and the act of copulation usually takes place in the water. One male may mate with multiple females. Harbor seals return to the same breeding grounds every year.

Mating System: polygynous

It is believed that males become sexually mature once a weight of around 75 kg is achieved; females mature at about 50 kg. This occurs between 3 and 7 years of age for males and at 2 to 6 years for females. While the mating season varies between the different subspecies, it generally occurs from late spring through fall. About 6 weeks after they give birth to their previous year's pups, the females come into estrus. The gestation period lasts between 9 and 11 months, and usually only 1 pup is born each year.

Breeding season: While the mating season varies between the different subspecies, it generally occurs from late spring through fall.

Average number of offspring: 1.

Range gestation period: 9 to 11 months.

Range age at sexual or reproductive maturity (female): 2 to 6 years.

Range age at sexual or reproductive maturity (male): 3 to 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 11000 g.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Local birth season exhibits high degree of geographic variation, lasts 1-2 months within a particular area. Births occur mainly in May-June in Gulf of Alaska, Nova Scotia, and Newfoundland; June-July farther north in western Atlantic; February-March in Baja California. Lactation lasts 2-6 weeks (average about 3-4 weeks), followed within a few days by ovulation and mating, then blastocyst implantaion 1.5-3 months later. Females continue to forage during lactation period. Young weaned in 2-6 weeks (usually about 4 weeks). Females sexually mature in 3-6 years, males in 3-7 years. Few live beyond 25 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Whiskers reduce drag: harbor seals
 

The highly sensitive whiskers of harbor seals reduce vortex-induced vibrations during swimming thanks to their undulated surface structure.

   
  "Harbor seals (Phoca vitulina) often live in dark and turbid waters,  where their mystacial vibrissae, or whiskers, play an important  role in orientation. Besides detecting and discriminating objects  by direct touch, harbor seals use their whiskers to analyze  water movements, for example those generated by prey fish or  by conspecifics. Even the weak water movements left behind by  objects that have passed by earlier can be sensed and  followed accurately (hydrodynamic trail following). While scanning  the water for these hydrodynamic signals at a swimming speed  in the order of meters per second, the seal keeps its long  and flexible whiskers in an abducted position, largely perpendicular  to the swimming direction. Remarkably, the whiskers of  harbor seals possess a specialized undulated surface structure, the  function of which was, up to now, unknown. Here, we show that  this structure effectively changes the vortex street behind the  whiskers and reduces the vibrations that would otherwise be  induced by the shedding of vortices from the whiskers (vortex-induced  vibrations). Using force measurements, flow measurements and  numerical simulations, we find that the dynamic forces on harbor  seal whiskers are, by at least an order of magnitude, lower than  those on sea lion (Zalophus californianus) whiskers, which do  not share the undulated structure. The results are discussed in  the light of pinniped sensory biology and potential biomimetic applications." (Hanke et al. 2010:2665)

  Learn more about this functional adaptation.
  • Hanke W; Witte M; Miersch L; Brede M; Oeffner J; Michael M; Hanke F; Leder A; Dehnhardt G. 2010. Harbor seal vibrissa morphology suppresses vortex-induced vibrations. Journal of Experimental Biology. 213: 2665-2672.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Whiskers sense prey movement: harbor seals
 

Whiskers of harbor seals detect prey with spectral sensitivity tuned to the frequency range of fish-generated water movement.

     
  "Harbour seals (Phoca vitulina) can use their whiskers to detect minute water movements. The high sensitivity of this sensory system should allow a seal to gain hydrodynamic information resulting from movements of other aquatic animals, such as prey, predators or conspecifics. Our results show that the whiskers of harbour seals form a hydrodynamic receptor system with a spectral sensitivity that is well tuned to the frequency range of fish-generated water movements." (Dehnhardt et al. 1998:235-236)

"Water movements in the wake of fishes persist for several minutes. Here we show that blindfolded seals can use their whiskers to detect and accurately follow hydrodynamic trails generated by a miniature submarine. This shows that hydrodynamic information can be used for long-distance prey location." (Dehnhardt et al. 2001:102)
  Learn more about this functional adaptation.
  • Dehnhardt, G; Mauck, B; Bleckmann, H. 1998. Seal whiskers detect water movements. Nature. 394(6690): 235-236.
  • Dehnhardt, G; Mauck, B; Hanke, W. 2001. Hydrodynamic trail-following in harbor seals (Phoca vitulina). Science. 293(5527): 102-104.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phoca vitulina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGGTTATTTTCCACAAATCATAAGGATATCGGCACTCTTTATTTGCTGTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTCAGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATTGTCACCGCCCATGCATTCGTAATAATTTTCTTCATGGTAATGCCCATCATAATTGGCGGCTTTGGGAACTGACTGGTGCCCCTAATAATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTCTGACTTTTACCACCGTCCTTCCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGAACCGGGTGAACCGTTTATCCTCCCCTAGCTGGGAACCTGGCTCATGCAGGAGCCTCTGTAGATCTAACAATTTTCTCGCTCCACTTGGCAGGTGTATCATCTATTCTTGGAGCTATCAACTTCATCACTACCATCATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTATGATCCGTATTAATCACAGCGGTGCTCCTACTATTGTCACTACCAGTCCTGGCAGCTGGCATCACCATGCTACTCACAGACCGAAACCTGAATACAACATTCTTCGACCCTGCCGGAGGAGGTGATCCTATCCTGTATCAACATCTGTTCTGATTCTTCGGACATCCTGAGGTGTATATTCTAATCCTACCAGGATTCGGAATAATCTCACACATCGTTACCTACTATTCAGGAAAAAAAGAACCTTTTGGTTATATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTCATTGTATGAGCCCACCATATATTTACTGTAGGGATGGACGTCGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phoca vitulina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Thompson, D. & Härkönen, T. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its large and either stable or increasing population, on a global scale the Harbour Seal is considered to be Least Concern. However, for conservation concerns at a somewhat finer spatial scale, it is prudent to assess each of the subspecies separately as some populations are small and declining.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The U.S. Marine Mammal Protection Act of 1972 made it illegal to hunt or harass any marine mammal in U.S. waters. In Canada, Norway, and the United Kingdom, it is legal to shoot harbor seals to protect fisheries or fish farms. Many fish species eaten by harbor seals are also commercially fished, and the seals often become entangled and drown in fishing nets and gear.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Worldwide distribution; high abundance; precipitous decline in some areas, increases in other areas; suspected threats include food shortages resulting from local fisheries management practices, incidental and intentional take, disease, and entanglement in marine debris.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Protected in Britain under the Conservation of Seals Act 1970 (closed season from 1 September until 31st December) (3) and schedule 3 of the Conservation Regulations (1994) (4). Listed as a protected species under Annex II and Annex V of the European Community's Habitats Directive. The eastern Atlantic population is listed under Appendix III of the Bern Convention. Subpopulations in the Baltic and Wadden Seas are listed under Appendix II of the Bonn Convention (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Combining recent estimates yields a world-wide population of 350,000 to 500,000 animals.

P. v. vitulina - Population dynamics of regional subpopulations vary dramatically, with recent large-scale declines in the northern UK populations (Thompson et al. 2001, Lonergan et al. 2007), rapid increases punctuated by major population crashes due to disease events in the Wadden Sea, southern England, Kattegat and Skagerrak populations and gradual increase after near extinction in the 1970s in the Baltic (e.g. Heide-Jorgensen and Harkonen 1988, Harkonen et al. 1999, 2002, 2005, 2006). Populations in Svalbard and the Baltic Sea, are low, both in the hundreds, although they are not considered to be separate subspecies. There are some morphological differences at least in the Svalbard population (Lydersen and Kovacs 2005). Overall the population of P. v. vitulina has increased since the 1970s.

P. v. concolor - Canadian populations declined during the 1970s from approximately 12,000 to 4,000. They have probably been increasing since the early 1980s with the exception of the Sable Island subpopulation that declined from a maximum pup production of 600 in 1989 to <10 p.a. by early 2000s. The Sable Island harbour seal declines are thought to be due to shark predation and competition with grey seals (Lucas and Stobo 2000, Bowen et al. 2003). Populations in West Greenland, Iceland and Norway are depleted as a result of hunting (Bjorge 1987, Hauksson 1992, Teilmann and Dietz 1994, Henriksen et al. 1997). Harbour seals in the eastern USA have increased at 6.6% p.a. since 1981, recovering from results of bounty hunting which ceased in the 1960s (Gilbert et al. 2005). Overall the population of P. v. concolor has been stable or increasing since 1980.

P. v. richardii - Population dynamics of regional subpopulations vary dramatically. Large-scale, long-term declines in Gulf of Alaska from the 1970s to the early 1990s with >60% declines, have apparently stabilized, with the population experiencing slight increases since the early 1990s (Pitcher 1990, Frost et al. 1999, Jemison and Kelly 2001, Boveng et al. 2003, Mathews and Pendleton 2006, Jemison et al. 2006). Long-term population increases from the 1970s up to early 1990s appear to have reached an asymptote in British Columbia, Washington, Oregon, and California. Overall the P. v. richardii populations has been stable or increasing since the early 1990s.

P. v. stejnegeri - Population dynamics of this subspecies are not well documented, but the population in the Kuril Islands appears to have increased slightly from 2,000-2,500 in the early 1960s (Belkin 1964), and again increased to around 3,000-3,500 individuals in 2000 (Trukhin 2002). Similarly, in the Commander Islands the subpopulation increased from around 2,000 in the early 1960s to around 3,000-3,500 in the early 1990s (Burdin et al. 1991) and is thought to be stable. The population in Japan is small, estimated at 350 individuals in late 1980s, having declined due to heavy hunting pressure (Hayama 1988). This population is still thought to be subject to high by-catch rates in trap net fisheries and is shot by fishermen coastally Wada et al. 1991).

P. v. mellonae – This subspecies lives in lakes and rivers of the Ungava Peninsula, Canada. It is thought to number some 120-600 individuals and may be the subspecies most at risk to extinction, due to low population numbers and potential effects of hydro-electric developments (Smith 1997).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Harbour seals live in coastal areas many of which are heavily fished. As a result there are entanglement and by-catch issues which may be significant in some populations e.g. in northern Japan (Burns 2002). Over fishing, oceanographic regime shifts and global climate change may impact food chains harbour seals depend upon for prey.

Historically, there have been organized population reduction programs and bounty schemes in several range states of countries, largely because of perceived. Hunting and/or licensed killing to protect fisheries still occurs in Norway, UK and Iceland and subsistence hunting is allowed in Greenland and the United States (Alaska). In Greenland and Iceland there are indications that hunting is responsible for continuing population declines.

Mass die-offs from viral outbreaks have claimed thousands of harbour seals on both sides of the Atlantic, but most notably in Europe. In 1988 more than 20,000 harbour seals are estimated to have died from a phocine distemper virus (morbillivirus) epidemic in European waters (Dietz et al. 1989, Reijnders 1989). A similar outbreak in 2002 killed approximately 30,000 (Harkonen et al. 2006). Other disease outbreaks occurred both before and after this large epidemic in both Europe and the western North Atlantic, but resulted in much smaller levels of mortality. Influenza from an avian source killed approximately 500 harbour seals in the North-eastern United States in 1979 and 1980 (Burns 2002). Potential for exposure to disease is probably increased by the natural behaviour of this species to haul out on near shore and at coastal mainland sites. As a result terrestrial carnivores, waste from human populations as well as contact with human pets and feral animals associated with human populations creates an increased risk of exposure to communicable diseases.

Because many harbour seals live and feed in close proximity to large populations of humans they are exposed to and can accumulate high levels of industrial and agricultural pollutants in some parts of their range (see Reijnders 1978, 1985, 1986, Aguilar et al. 2002, Wang et al. 2007); while some northern populations have very low contaminant levels (e.g. Wolkers et al. 2004). Immuno-suppression is one affect regularly attributed to exposure to high levels of certain organochlorines and these and other contaminants probably contribute to poor condition and overall fitness of a number of animals in some areas. Both chronic oil spills and discharges and episodic large scale spills cause direct mortality and have long term impacts on harbour seal health and their environment. Some additional examples of threats and impacts to harbour seal populations are given below.

P. v. stejnegeri, of the western Pacific, numbers approximately 7,000 animals. Fishery related mortality in the small Japanese population is a cause for concern (Wada et al. 1991). However, low levels of human activity in the Kurils and protected status within nature reserves in the Commander Islands means that there is no obvious anthropogenic threat to the bulk of the population.

P. v. mellonae numbers only some 120-600 animals which are restricted to the Seal Lakes (Lac des Loups Marin) of the Ungava Peninsula, Canada. This subspecies is at risk due to low population numbers and unknown effects of James Bay II hydroelectric development which may reduce the water level in the seal lakes by 20 cm. This might have impacts on mortality of seals in winter and altered hydrographic conditions could potentially affect the seals’ prey.

P. v. richardii has shown dramatic reductions in the recent past in one large part of its range, Gulf of Alaska and Prince William Sound. Although part of this decline may be related to the effects of the Exxon Valdez disaster, the overall decline in Gulf of Alaska is unexplained.

Subpopulations of P. v. vitulina in the Northern UK have recently declined by around 50% in less than 10years. The cause of this decline is unknown. The Icelandic population has declined by 5% p.a. since 1980, which is thought to be due to direct hunting. Populations in Svalbard and the Baltic Sea, which are both small are protected. Competition with increasing gray seal populations may have been responsible for declines in the mid-latitudes and further increases in grey seal populations seem likely in the North Sea. Rapidly increasing development of offshore wind generated power means that the levels of industrial activity and noise are increasing in the foraging areas of resident harbour seals. To date, there is little information available to assess the potential impacts of such disturbance.

Historical population reductions of P. v. concolor along the USA coast were probably due to hunting that has now ceased. The rapid decline in the Sable Island population may have been due to a combination of shark predation (Lucas and Stobo 2000) and competition with grey seals (Bowen et al. 2003); the continued increase of grey seal populations in Canadian and US waters could produce a more widely spread decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Pacific Ocean: Recent precipitous declines in the numbers of harbor seals observed at some traditional haulout areas indicate that a fairly high level of threat exists to the long-term viability of these populations. These declines have been most recently documented in the Bering Sea region, where comparable declines have also been documented for both fur seals and Steller's sea lions (Pitcher 1990, Fowler 1982, 1985, York and Kozloff 1987, Braham et al. 1980, Merrick et al. 1987, Calkins and Goodwin 1988). The causes for these declines are not fully known, but food shortages, disease, and entanglement in marine debris are primary factors currently being investigated (Pitcher 1990). Large numbers die from entanglement in gill nets in some areas (annually perhaps 5% of the population in California) (Reeves et al. 1992). In some areas, populations are reduced through government-sponsored culls (Norway) or commercial harvest (Iceland).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The population of common seals in the UK cannot be estimated very accurately but humans have historically hunted the common seal in great numbers. The Seal Conservation Act of 1970 gives a degree of protection as shooting is outlawed during the breeding season, however if a seal is deemed to be interfering with fishing nets, it can legally be shot at any time under the 'Fisheries Defence Clause' (5). In 1988 a disease caused by the newly emerged phocine distemper virus killed about 3,000 of the UK's common seals. Such drastic population crashes seem to be a natural occurrence, and little can be done to prevent them (3). Common seals are also susceptible to oil and chemical pollutants (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the United States the harbour seal is protected from all but subsistence hunting by the Marine Mammal Protection Act of 1972, which also prohibits importation of parts or products from all seals. Coastal reserves in Norway which exclude commercial fishing have been shown to reduce harbour seal mortality because of the generally restricted movements of this species along the Norwegian coast. Hunting is now prohibited in the Wadden Sea area (The Netherlands, Germany, Denmark, and Swedish waters) (Reijnders et al 1993), Swedish Baltic, Eire and UK (Harwood 1987). Licensed killing to protect fisheries is allowed in UK, Canada and USA. Illegal hunting probably occurs throughout the harbour seal's range. The harbour seal population in Svalbard is on the national Red List for Norway and is afforded complete protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: 1. Worldwide monitoring of population trends in harbor seals and other sympatric marine mammals. 2. Focused biological research on potential causes of population declines in specific regions. 3. Regional research on global changes and impacts that are in the marine ecosystem, particularly in the Bering Sea. 4. Long-term viability and recovery studies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Protected by the Marine Mammal Protection Act (1972) in the United States, but effective management plans have not been developed (Hoover 1988). Many haulout areas are protected by their designation as marine sanctuaries and wildlife refuges. Open water hatitat, however, is not protected. Protected in British Columbia by the Canadian Federal Fisheries Act (1970).

Needs: 1. Minimize all incidental take and disturbance. 2. Eliminate driftnet fisheries that occur in seal feeding and movement areas. 3. Regulate fisheries take of fish resources known to be important to the maintenance of healthy seal populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A number of key UK pupping and haul-out sites have been suggested as candidate Special Areas of Conservation (9). It has been recommended that human access to breeding sites could be restricted to reduce disturbance. Guidance notes on monitoring techniques for this species have been produced by the Joint Nature Conservation Committee, the Government's wildlife advisor (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Harbor seals often interfere with commercial fisheries, eating the fish that have been caught in nets and becoming trapped in the nets themselves.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Harbor seals are hunted primarily for their skins, oil, and meat. They can also be used in the production of jewelry and trinkets and as meat for mink feeding. Phoca vitulina can also serve as tourist attractions at aquariums and can be used in experimental research.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long subjected to subsistence and bounty hunting and commercial harvest for pelts (see Reeves et al. 1992 for details). Large numbers continue to be killed in some areas (e.g., Iceland, Norway).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Harbor seal

The harbor (or harbour) seal (Phoca vitulina), also known as the common seal, is a true seal found along temperate and Arctic marine coastlines of the Northern Hemisphere. The most widely distributed of pinniped (walruses, eared seals, and true seals), they are found in coastal waters of the northern Atlantic and Pacific oceans, the Baltic and North Seas.

Harbor seals are brown, tan, or gray, with distinctive V-shaped nostrils. An adult can attain a length of 1.85 meters (6.1 ft) and a mass of 132 kilograms (290 lb). Females outlive males (30–35 years versus 20–25 years). Harbor seals stick to familiar resting spots or haulout sites, generally rocky areas (although ice, sand and mud may also be used) where they are protected from adverse weather conditions and predation, near a foraging area. Males may fight over mates underwater and on land. Females bear a single pup, which they care for alone. Pups are able to swim and dive within hours of birth, developing quickly on their mothers' fat-rich milk. Blubber under their skins helps to maintain body temperature.

Their global population is 5–6 million, but subspecies in certain habitats are threatened. Once a common practice, sealing is now illegal in many nations within the animal's range.

Contents

Description

A young harbor seal on the coast of La Jolla, San Diego

Individual harbor seals possess a unique pattern of spots, either dark on a light background or light on a dark. They vary in color from brownish black to tan or grey; underparts are generally lighter. The body and flippers are short, heads are rounded. Nostrils appear distinctively V-shaped. As with other true seals, there is no pinna (ear flap). An ear canal may be visible behind the eye. Including the head and flippers, they may reach an adult length of 1.85 meters (6.1 ft) and a weight of 55 to 168 kg (120 to 370 lb).[3] Females are generally smaller than males.

Population

There are an estimated 5 million to 6 million harbor seals worldwide. While the population is not threatened as a whole, the Greenland, Hokkaidō and Baltic Sea populations are exceptions. Local populations have been reduced or eliminated through disease (especially the phocine distemper virus) and conflict with humans, both unintentionally and intentionally. It is legal to kill seals perceived to threaten fisheries in the United Kingdom, Norway and Canada, but commercial hunting is illegal. Seals are also taken in subsistence hunting and accidentally as bycatch (mainly in bottomset nets). Along the Norwegian coast bycatch accounted for 48% of pup mortality.[4]

Seals in the United Kingdom are protected by the 1970 Conservation of Seals Act, which prohibits most forms of killing. In the United States the Marine Mammal Protection Act of 1972 prohibits the killing of any marine mammals and most local ordinances as well as NOAA instruct citizens to leave them alone unless there is serious danger to the seal. On the East Coast of the US their numbers are increasing steadily as they are reclaiming parts of their range, which naturally extends to North Carolina but the subspecies particular to this area will stray as far south as Florida. Pupping is known to occur in Maine, Massachusetts, Rhode Island, Connecticut, and possibly New York (Long Island.)

Subspecies

There are five subspecies of Phoca vitulina:

  • Western Atlantic common seals, P. v. concolor (DeKay, 1842), inhabit eastern North America. The validity of this subspecies is questionable, and not supported by genetic evidence.[5]
  • Ungava seals, P. v. mellonae (Doutt, 1942), are found in eastern Canada in fresh water (included in P. v. concolor by many authors[who?]).
  • Pacific common seals, P. v. richardsi (Gray, 1864), are located in western North America.
  • Insular seals, Phoca vitulina stejnegeri (J. A. Allen, 1902), are in eastern Asia.
  • Eastern Atlantic common seals, P. v. vitulina (L., 1758), from Europe and western Asia, are one of the most[clarification needed] harbor seal species in the world.

Habitat and diet

Skeleton

Harbor seals prefer to frequent familiar resting sites. They may spend several days at sea and travel up to 50 kilometers in search of feeding grounds, and will also swim some distance upstream into freshwater in large rivers. Resting sites may be both rugged, rocky coasts, such as those of the Hebrides or the shorelines of New England, or sandy beaches.[1] Harbor seals frequently congregate in harbors, sandy intertidal zones,[1] and estuaries in pursuit of prey fish such as menhaden, anchovy, sea bass, herring, mackerel, cod, whiting and flatfish, and occasionally shrimp, crabs, mollusks and squid. Alantic subspecies of either Europe or North America will also exploit deeper dwelling fish of the genus Ammodytes as a food source and Pacific subspecies have been recorded occasionally consuming fish of the genus Oncorhynchus. Although primarily coastal, dives to over 500 m have been recorded.[6] Harbor seals have been recorded to attack, kill and eat several kinds of seabirds.[7]

Behavior and reproduction

A harbor seal colony in Helgoland, Germany

Harbor seals are gregarious animals, though they do not form groups as large as some other seals. When not actively feeding they will haul to rest. They tend to be coastal, not venturing more than 20 kilometers offshore. Both courtship and mating occur underwater. The mating system is not known, but thought to be polygamous. Females give birth once per year, with a gestation period of approximately nine months.

Birthing of pups occurs annually on shore. The timing of the pupping season varies with location,[8] occurring in February for populations in lower latitudes, and as late as July in the subarctic zone. The mothers are the sole providers of care, with lactation lasting four to six weeks. Researchers have found males gather underwater, turn on their backs, put their heads together and vocalize to attract females ready for breeding.[9] The single pups are born well developed, capable of swimming and diving within hours. Suckling for three to four weeks, pups feed on the mother's rich, fatty milk and grow rapidly; born weighing up to 16 kilograms, the pups may double their weight by the time of weaning.

Harbor seals must spend a great deal of time on shore when moulting, which occurs shortly after breeding. This onshore time is important to the life cycle, and can be disturbed when there is substantial human presence.[10] The timing of onset of moult depends on the age and sex of the animal, with yearlings moulting first and adult males last.[11] A female will mate again immediately following the weaning of her pup. Harbor seals are sometimes reluctant to haul out in the presence of humans, so shoreline development and access must be carefully studied in known locations of seal haul out.[citation needed]

Harbor seals in California

A pup nursing at Point Lobos

The California population of subspecies richardsi amounted to approximately 25,000 individuals as of 1984. Pacific harbor seals or Californian harbor seals are found along the entire Pacific coast shoreline of the state. They prefer to remain relatively close to shore in subtidal and intertidal zones, and have not been seen beyond the Channel Islands as a pelagic form; moreover, they will often venture into bays and estuaries and even swim up coastal rivers. They feed in shallow littoral waters on herring, flounder, hake, anchovy, codfish and sculpin.[12]

Breeding occurs in California from March to May, pupping between April and May, depending on local populations. As top level feeders in the kelp forest, harbor seals enhance species diversity and productivity. They are preyed upon by killer whales (orcas) and white sharks.

Considerable scientific inquiry has been carried out by The Marine Mammal Center and other research organizations beginning in the 1980s regarding the incidence and transmission of diseases in harbor seals in the wild, including analysis of phocine herpesvirus.[13] In the San Francisco Bay, some harbor seals are fully or partially reddish in color, possibly caused by an accumulation of trace elements such as iron or selenium in the ocean, or a change in the hair follicles.

See also

References

  1. ^ a b c Thompson, D. & Härkönen, T. (2008). Phoca vitulina. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 January 2009.
  2. ^ Linnæus, Carl (1758) (in Latin). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (10 ed.). Holmiæ (Stockholm): Laurentius Salvius. p. 38. http://www.biodiversitylibrary.org/item/80764#page/48/mode/1up. Retrieved 23 November 2012.
  3. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5.
  4. ^ Bjørge, A.; Øien, N., Hartvedt, S.,Bøthum, G. and Bekkby, T. (2002). "Dispersal and bycatch mortality in grey, Halichoerus grypys, and harbour, Phoca vitulina, seals tagged at the Norwegian coast.". Mar. Mamm. Sci. 18: 963–976. 
  5. ^ Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
  6. ^ Burns, J. J. 2002. Harbor seal and spotted seal Phoca vitulina and P. largha. In: W. F. Perrin, B. Wursig and J. G. M. Thewissen (eds), Encyclopedia of Marine Mammals, pp. 552–560. Academic Press.
  7. ^ "Harbour seal kills and eats duck", Tetrapod Zoology, 6 march 2008
  8. ^ Temte, J. L. 1994. "Photoperiod control of birth timing in harbour seal (Phoca vitulina)". Journal of Zoology (London) 233: 369–384.
  9. ^ Van Parijs, S. M. and Kovacs, K. M. 2002. "In-air and underwater vocalizations of eastern Canadian harbour seals, Phoca vitulina". Canadian Journal of Zoology 80: 1173–1179.
  10. ^ Patrick Sullivan, Gary Deghi and C.Michael Hogan, Harbor Seal Study for Strawberry Spit, Marin County, California, Earth Metrics file reference 10323, BCDC and County of Marin, January 23, 1989.
  11. ^ Reder, S., Lydersen, C., Arnold, W. and Kovacs, K. M. 2003. "Haulout behaviour of High Arctic harbour seals (Phoca vitulina vitulina) in Svalbard, Norway". Polar Biology 27: 6–16.
  12. ^ T.C. Newby, Pacific Harbor Seal, pp 184–191 in D. Haley, ed. Marine Mammals of Eastern North Pacific and Arctic Waters, Pacific Search Press, Seattle WA (1978)
  13. ^ Goldstein, T., Mazet, J.A.K., Gulland, F.M.D., Rowles, T., Harvey, J.T., Allen, S.G., King, D.P., Aldridge, B.M., Stott, J.L., "The transmission of phocine herpesvirus-1 in rehabilitating and free-ranging Pacific harbor seals (Phoca vitulina) in California", Veterinary Microbiology 103:131–141 (2004)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Harbor Seal

The Common Seal (Phoca vitulina), also known as the Harbor (or Harbour) Seal, is a true seal found along temperate and Arctic marine coastlines of the Northern hemisphere. They are found in coastal waters of the northern Atlantic and Pacific Oceans as well as those of the Baltic and North Seas, making them the most wide-ranging of the pinnipeds (walruses, eared seals, and true seals).

Common seals are brown, tan, or gray, with distinctive V-shaped nostrils. An adult can attain a length of 1.85 meters (6.1 ft) and a mass of 132 kilograms (290 lb). Females outlive males (30–35 years versus 20–25 years). Common seals stick to familiar resting spots, generally rocky areas where land predators can't reach them, near a steady supply of fish to eat. Males fight over mates underwater. Females mate with the strongest males, then bear single pups, which they care for alone. Pups are able to swim and dive within hours of birth, and they grow quickly on their mothers' milk. A fatty tissue called blubber keeps them warm.

Their global population is 400,000 to 500,000, and subspecies in certain habitats are threatened. Seal hunting, once a common practice, is now mostly illegal.

Contents

Description

A young Harbor Seal (Phoca vitulina) relaxes off the coast of La Jolla, San Diego.

With each individual possessing a unique pattern of fine, dark spots (or light spots on a dark background in some variants), they vary in colour from brownish black to tan or grey; underparts are generally lighter. The body and flippers are short, with a proportionately large, rounded head. The nostrils appear distinctively V-shaped; as with other true seals, there is no ear flap, or pinna. A relatively large (for a seal) ear canal may be visible behind the eye. Including the head and flippers, they may reach an adult length of 1.85 meters (6.1 ft) and a weight of 55 to 168 kg (120 to 370 lb).[2] Females are generally smaller than males.

Population

With an estimated 400,000 to 500,000 individuals, the population is not threatened as a whole; most subspecies are secure in numbers with the Greenland, Hokkaidō and Baltic Sea populations being exceptions. Local populations have been reduced or eliminated through outbreaks of disease and conflict with humans, both unintentionally and intentionally. While it is legal to kill seals which are perceived to threaten fisheries in the United Kingdom, Norway and Canada, commercial hunting is illegal; the seals are also taken in subsistence hunting and accidentally as bycatch in fishing nets. In the United States stricter protection applies, and it is illegal to kill any seals or any marine mammals, as they fall under the Marine Mammal Protection Act. On the East Coast of the United States their numbers seem to be increasing quite steadily as they are reclaiming parts of their range, and have been seen as far south as Florida.

Female Common Seals have a life span of 30–35 years while male lifespans are usually 20-25. Scientists have suggested that this is due to stresses male seals are subjected to during breeding seasons.

Subspecies

There are four or five subspecies:

  • Western Atlantic Commonmncmcmcmccn, bkjbkj Seal Phoca vitulina concolor (DeKay, 1842). Eastern North America.
  • Ungava Seal Phoca vitulina mellonae (Doutt, 1942). Eastern Canada, freshwater (included in P. v. concolor by many authors)
  • Pacific Common Seal Phoca vitulina richardsi (Gray, 1864). Western North America.
  • Insular Seal Phoca vitulina stejnegeri (Allen, 1902). Eastern Asia. This subspecies is sometimes treated as a separate species, Phoca kurilensis bvbvmnvm or Phoca insularis.
  • Eastern Atlantic Common Seal Phoca vitulina vitulina (Linnaeus, 1758). Europe, western Asia. They are one of the most common seal in the world.

Habitat and diet

A baby nursing at Point Lobos

Characterized as showing a strong degree of site fidelity in their choice of resting sites, they may spend several days at sea and travel up to 50 kilometers in search of feeding grounds, and will also swim some distance upstream into freshwater in large rivers. Resting sites may be both rugged, rocky coasts such as that of the Hebrides or the shorelines of New England, or sandy beaches. They also inhabit sandy intertidal zones; some seals may also enter estuaries in pursuit of their fish prey. Some have even taken to feeding and playing in New York Harbor and Boston Harbor in recent years. The seals frequently choose to congregate in harbours, lending the animals their other common name. The feeding habits have been studied closely in many parts of their range; they are known to prey primarily upon fish such as menhaden, anchovy, sea bass, herring, mackerel, cod, whiting and flatfish, and occasionally upon shrimp, crabs, mollusks and squid. They are able to dive for up to ten minutes, reaching depths of 457 meters (approx 1500 feet) or more, but average dives may be three minutes long at depths of about 20 meters (approx 66 feet) {Carl, 1964}. There are a few cases of harbor seals attacking, killing and eating several kinds of seabirds.[3]

Behavior and reproduction

Harbor Seal resting on ice
A Harbor Seal colony in Helgoland, Germany

While not forming groups as large as some other seals, they are gregarious animals. When not actively feeding, the seals will haul themselves out of the water and onto a preferred resting site. The seals tend to hug the coast, not venturing more than 20 kilometers offshore. Both courtship and mating occurs underwater. The mating system is not known, but thought to be polygamous. Females are thought to give birth once per year, with a gestation period of eleven months.

Birthing of pups occurs annually on shore, beginning in February for populations in lower latitudes, and as late as July in the subarctic zone. The mothers are the sole providers of care with lactation lasting four to six weeks; males occupy themselves with fights between other males. Researchers have found that males gather underwater, turn on their backs, put their heads together and vocalise to attract females ready for breeding. The pups are born singly and well developed, capable of swimming and diving within hours. Suckling for three to four weeks, pups feed on the mother's rich, fatty milk and grow rapidly; born weighing up to 16 kilograms, the pups may double their weight by the time of weaning.

Common Seals must spend a great deal of time on shore when moulting (shedding off their fur), which the seals undergo shortly after breeding. This onshore time is important to the life cycle and can be disturbed when there is substantial human presence (Sullivan, 1989). A female will mate again immediately following the weaning of her pup. This pinniped is sometimes reluctant to haul out in the presence of humans, so that shoreline development and access must be carefully studied in known locations of seal haul out.

Aspects particular to California

Harbor Seals along 17-Mile Drive

The California population of subspecies richardsi amounted to approximately 25,000 individuals as of the year 1984. Pacific common seals or Californian common seals are found along the entire Pacific coast shoreline of the state. They prefer to remain relatively close to shore in sub-tidal and intertidal zones, and have not been seen beyond the Channel Islands as a pelagic form; moreover, they will often venture into bays and estuaries and even swim up coastal rivers.

Frequently they will haul out in small to medium sized groups onto rock outcrops, mudflats, sandy beaches or even fishing piers. Some of the best locations for viewing Common Seals up close are at Cannery Row in Monterey, Moss Landing on Monterey Bay or at Bolinas Lagoon in Marin County. They feed in shallow littoral waters on herring, flounder, hake, anchovy, codfish and sculpin (Newby, 1978).

In California breeding occurs from March to May, and pupping between April and May depending on local populations. There is no indication this species has territorial characteristics in water, and it definitely displays none on land. As top level feeders in the kelp forest, Common Seals enhance species diversity and productivity. They are preyed upon by orcas and white sharks.

Considerable scientific inquiry has been carried out by The Marine Mammal Center and other research organizations beginning in the 1980s regarding the incidence and transmission of diseases in common seals in the wild, including analysis of phocine herpesvirus (Goldstein, 2004). In the San Francisco Bay, some common seals are fully or partially reddish in color. This may be caused by an accumulation of trace elements such as iron or selenium in the ocean or a change in the hair follicle.

Gallery

See also

Notes

  1. ^ Thompson, D. & Härkönen, T. (2008). Phoca vitulina. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 January 2009.
  2. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 
  3. ^ "Harbour seal kills and eats duck", Tetrapod Zoology, 6 march 2008

References and external links