Articles on this page are available in 2 other languages: Spanish (16), Dutch (1) (learn more)

Overview

Brief Summary

Biology

This species is gregarious; on land it forms groups to breed, rest and moult that are generally small but may number up to 1,000 individuals (5). Common seals feed mainly on a variety of fish, but squids, whelks, crabs and mussels are also taken. Juveniles feed on shrimps before progressing to the adult diet (2). When feeding, common seals travel up to 50 kilometres from haul-out sites to feed and may stay out at sea for days. They can dive for up to 10 minutes, and reach depths of 50 metres or more (3). With regards to breeding, there is apparently no social organisation, but females often give birth in small groups (7). Females give birth to a single pup at the end of June to early July (8). The pups weigh 11 to 12 kilograms at birth and are able to swim and crawl almost immediately (2). Pups are nursed for about four weeks, after which they may disperse over long distances (5). Around the time that the pup is weaned, females become receptive and copulation occurs. Males frequently engage in underwater displays and fights around this time and can lose up to 25 percent of their body weight (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Harbor Seals live near coastlines and eat a highly varied seafood diet, depending on what is available. They can dive as deep as 450 m and stay under for almost half an hour, but six-minute dives to depths of 30-100 m are more usual. Females usually have one pup a year, and two weeks after the pup is born, mate again. The fertilized egg stays dormant in the uterus for up to three months before it implants in the uterine wall and begins to grow. This is called delayed implantation. Total gestation, including the period of delay, lasts 8-9 months. Instead of being born with the white coat typical of most seals in the family Phocidae, the pups often molt before birth, shedding the very soft white or pale gray coat called a lanugo while they are still in the uterus. Like dogs, Harbor Seals can suffer from heartworm. The disease has been found in North American and European populations.

Links:
Mammal Species of the World
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. p. 38. Tenth Edition, Vol. 1. Laurentii Salvii, Stockholm, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Harbour seals are good swimmers. The pinipeds serve as rudder. The body and back pinnipeds cause propulsion. The seal is highly adapted to speed with its torpedo-like body and pinna. Observations made from ships revealed that they generally swim just 10 m beneath the water surface and that only rarely will they hunt under –20 m. Young harbour seals are born on tide-sandbanks between the end of June and mid July, and are required, almost immediately (during high-tide) to be able to swim.

In general, harbour seals feed on benthic fish (such as flounder, sole, cod and whiting), but they must largely be quite opportunistic in regard to what they eat. They may also feed on mussels, crabs and cephalopods.

  • Stienen, E.W.M.; Van Waeyenberge, J.; Kuijken, E. (2003). Zeezoogdieren in Belgisch mariene wateren [Marine mammals in Belgian marine waters]. Rapport Instituut voor Natuurbehoud, A.2003.152. Instituut voor Natuurbehoud: Brussel, Belgium. 15 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

You wouldn't think so when looking into those beautiful black eyes, but harbour seals are wild predators! Their sharp teeth and streamlined body are perfect for hunting fish. Harbour seals are the most prominent seal speceis in the Wadden Sea. During low tide, they lie on the sandbanks in the sun and to rest. In the summer, they give birth and nurse their young. These seals are called harbour seals because they used to follow schools of fish into harbors.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

Phoca vitulina, the Harbour or Common seal, is a marine mammal frequently seen around the UK coastline.Harbour seals are vulnerable to viral distemper which is causing mass mortalities, losses were particularly high in 1988 and 2002.Since these seals spend much of their time in water, estimating population numbers is not easy but worryingly, numbers are declining progressively.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Also known as the harbour seal, the common seal is the smaller of the two breeding seals in Great Britain (6). When hauled out it often adopts a characteristic 'head-up, tail-up' posture. The colour is variable, ranging from black-grey to sandy brown with many small spots. The top of the small head is round and the nostrils form a 'V' (2). Males are often darker in colour than females and have a heavier appearance. The white natal coat of the young is shed inside the uterus; pups are therefore born with their first adult coat (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The common seal is present in the eastern Atlantic region with its subspecies Phoca vitulina. It is regularly distributed throughout the entire marine Baltic region and in the marine Atlantic region from the Unite d Kingdom and Ireland to mainland European coasts from Sweden and southwards to France (Brittany) and occasionally as far south as northern Portugal. The Baltic population was close to e x tinction in the 1970s and wide spread declines have occurred in the United Kingdom , Kattegat and Skagerrak , and Wadden Sea populations. The species is vulnerable to fishery bycatch, culling, high pollution loads, disease events, and disturbance to haul out are as.

The overall conservation status in the marine Atlantic region is ‘unfavourable -inadequate’ and dictated largely by the status (decre asing trend and population numbers be low the reference values) of the United Kingdom population which represents more than 50% of the marine region’s population. In the Baltic on the other hand, the overall assessment is ‘unfavourable-bad’ due to the status of the Swedish population which re presents almost half of the Baltic population. The species is listed as ‘least concern’ in the IUCN Red List of threatened species.

The Conservation of Seals Act, 1970, provides a closed season for the Common seal during its pupping season. During this time, it is illegal to kill or take seals without a licence. There is also provision for giving complete protection to seals at al times, if neccesary. During the close season, a license is required to handle seals unless they are sick or injured (SMRU, 2004). The Baltic and Wadden Sea populations are listed under the Bonn Convention (Appendix II).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: budiutamihanjaniputri

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur : 120-200 cm. Poids : 65-170 kg.
Nouveau-né : longueur : 70-90 cm. Poids : 7-12 kg.

Le Phoque veau-marin est un phoque relativement petit avec une silhouette trapue. Son cou est court et sa tête arrondie se finit par un museau large et obtus avec un nez légèrement retroussé dont les narines se rejoignent presque ventralement dessinant un V ouvert. Il a de grands yeux et de longues vibrisses pâles. Le pavillon auditif, en forme de fente, est moins visible que chez le Phoque gris. Ses membres sont en forme de nageoire. Les antérieurs sont courts et pointus, se finissant par de longues griffes tandis que les postérieurs, généralement petits, ont des extrémités carrés. Ces derniers se trouvent dans le prolongement du corps. La queue est courte. La couleur pelage du Phoque veau-marin varie du gris clair au brun foncé voire noir. La face dorsale est généralement plus foncée que la face ventrale. Son corps est parsemé d’une multitude de petites taches claires chez la forme sombre et foncées chez la forme pâle. Il compte 34 dents : I3/2, C1/1, M5/5.
Le Phoque veau-marin peut se confondre avec le Phoque gris (Halichoerus grypus). Ce dernier a un museau allongé, tandis que le Phoque veau-marin a une tête arrondie, avec un net décrochement entre le front et le museau, lui donnant un air de vieux chien.

Plutôt grégaires et sédentaires, les Phoques veaux-marins ne présentent pas d’organisation sociale précise. Vivant au rythme des marées, ils se dispersent dans l’eau quand la marée monte, seule leur tête est alors visible, et se regroupent (parfois par centaine) à marée basse sur les plages rocheuses et les bancs de sable, appelés « reposoirs ». Ils adoptent alors une position caractéristique « en banane », c’est-à-dire la tête et la queue levée, et deviennent méfiants et farouches, fuyant dans l’eau au moindre dérangement. Ils partent en mer pour se nourrir et reviennent sur terre pour se reposer, se reproduire et muer. La période de mue a lieu en été (juillet-septembre) et dure 3 ou 4 semaines.

La maturité sexuelle est atteinte entre 3 et 5 ans pour les femelles et 3 à 6 ans pour les mâles. L’accouplement peut avoir lieu entre la fin juillet et début septembre, immédiatement après le sevrage de son jeune. La gestation dure 10 mois environ avec une implantation différée et une croissance de l’embryon qui ne commence que deux à trois mois après l’accouplement, comme chez les autres pinnipèdes. La femelle met bas entre mi-juin et mi-juillet/août sur un banc de sable à marée descendante. Elle donne naissance à un ou deux jeunes qui seront sevrés au bout de 4 à 5 semaines. Ils peuvent vivre jusqu’à 35 ans.

Opportuniste, le Phoque veau-marin se nourrit de poissons pélagiques (flets, limandes, carrelets, mulets, merlans, saumons, loches, harengs,...) mais aussi de pieuvres et calamars.

Il fréquente les côtes sableuses et rocheuses et affectionne particulièrement les plages et les baies abritées offrant de nombreux bancs de sable qui se découvrent à marée basse. Il semble préférer les bancs de sable longeant des chenaux profonds qui lui offrent la tranquillité et lui permettent de se jeter à l’eau très rapidement en cas de danger.

Références : ROBINEAU D. 2004. Phoques de France. Fédération française des sociétés de sciences naturelles, Paris. 196p.
BENSETTITI, F. & GAUDILLAT, V. 2004. Cahiers d'habitats Natura 2000. Connaissance et gestion des habitats et des espèces d'intérêt communautaire. Tome 7. Espèces animales. La Documentation Française. 353p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Projects

With the vast coastline of the UK and Europe monitoring seal populations is challenging. Members of the public often participate surveys and along your local coastline you can play an important role in alerting authorities to the occurrence of sickened animals during episodes of viral distemper.Further information about seals and their biology can be found at the Sea Mammal Research Unit.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Harbour seals are usually sexually mature after the first five years of life and can live up to 35 years of age.In UK-waters, harbour seals can sometimes be found alongside the larger grey seal (Halichoerus grypus). Both species are vulnerable to viral distemper caused by PDV (Phocine Distemper Virus) but mortalities in the grey seal are not as pronounced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Common seals have a rounded head with eyes equidistant between the nose and the ears. The nostril slits form a characteristic 'v' shape when viewed from the front. Adult common seals grow up to 1.2 to 2 metres long, and weigh around 65-140 kg. Males are slightly bigger than females. The coat is grey to brownish-grey with a uniform pattern of small darker spots, although the pattern varies geographically. Individuals may live for 20-30 years (SMRU, 2004).May be confused with the grey seal (Halichoerus grypus) that has a much longer muzzle and their nostril slits are nearly parallel.  

Seals are highly adapted to live in water. Their limbs are modified into flippers and they have streamlined bodies. Phoca vitulina can dive to 450 m and remain submerged for up to 30 minutes. The common seal is a strong swimmer and can be seen leaping completely out of the water (porpoising) (Nowak, 2003). Only the head is usually seen when the seal is in water. As well as being fur-coated they have a thick layer of subcutaneous fat or blubber. This keeps them warm and enhances streamlining (SMRU, 2004). Seals are warm-blooded air-breathing mammals but spend a considerable amount of time below the water surface. Common seals give birth to pups in June and July and moult in August. The main threat to seals in the UK and Ireland is organochlorine compounds that may interfere with reproduction (SMRU, 2004).

 The Common or harbour seal has been reported as non-migratory and littoral in distribution and as exhibiting a diurnal haul-out pattern (Evans & Raga, 2001). Common seals in Europe belong to a distinct sub-species. Britain holds around 40% of the world population of the European sub-species (Duck & Thompson, 2003).

 The Conservation of Seals Act, 1970, provides a closed season for the Common seal during its pupping season. During this time, it is illegal to kill or take seals without a licence. There is also provision for giving complete protection to seals at al times, if neccesary. During the close season, a license is required to handle seals unless they are sick or injured (SMRU, 2004). The Baltic and Wadden Sea populations are listed under the Bonn Convention (Appendix II).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Harbor seals are the pinniped with the largest geographical range, encompassing coastal areas of the east and west Pacific and Atlantic Oceans in the Northern Hemisphere. Their range spans from the western Pacific Ocean coast north towards the Gulf of Alaska and to the southeastern Bering Sea. The western Atlantic Ocean harbor seals are distributed from the French coast to the North Sea and northward to the Barents Sea, as well as along the Atlantic coast of North America. Although they inhabit a large range of coastal and insular regions, the Pacific and Atlantic colonies are separated by large intervals with uncertain boundaries and five subspecies are recognized.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: holarctic

  • Boness, D. 2004. True Seals (Phocidae): Harbor Seal. Pp. 417-436 in M Hutchins, A Evans, J Jackson, D Kleiman, J Murphy, D Thoney, eds. Grzimek's Animal Life Encyclopedia, Vol. 14: Mammals III, 2nd Edition. Detroit: Gale.
  • Burns, J. 2008. Encyclopedia of Marine Mammals. Pp. 533-541 in W Perrin, B Wursig, J Thewissen, eds. Harbor Seal and Spotted Seal, Vol. 1, 2 Edition. New York, NY: Academic Press.
  • Riedman, M. 1990. The Pinnipeds: Seals, Sea Lions, and Walruses. Oxford, England: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Harbour seals are one of the most widespread of the pinnipeds. They are found throughout coastal waters of the Northern Hemisphere, from temperate to Polar Regions. Five subspecies are recognized: P. v. vitulina occurs in the eastern Atlantic from Brittany to the Barents Sea in north-western Russia and north to Svalbard, with occasional sightings as far south as northern Portugal; P. v. concolor occurs in the western Atlantic from the mid-Atlantic United States to the Canadian Arctic and east to Greenland and Iceland; P. v. mellonae only lives in a few lakes and rivers in northern Quebec, Canada, that drain into Hudson and James Bays (geological changes prohibit these seals from leaving this freshwater habitat); P. v. richardii is found in the eastern Pacific from central Baja California, Mexico to the end of the Alaskan Peninsula and possibly to the eastern Aleutian Islands, and; P. v. stejnegeri ranges from either the end of the Alaskan Peninsula or the eastern Aleutians to the Commander Islands, Kamchatka and through the Kuril Islands to Hokkaido in the western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Temperate and subarctic regions of the Northern Hemisphere. In the western North Atlantic, breeds at least from Cape Dorset on southwestern Baffin Island to Massachusetts; occurs along west coast of Greenland as far north as Disko Island and Avanersuaq, along the east coast to Ittoqqortormiit (Teilman and Dietz 1994); small numbers occur, mostly in river mouths, in parts of Hudson Strait, Ungava Bay, and Hudson Bay; small local populations inhabit some rivers and lakes of western Hudson Bay, moving as far as 240 km inland; small population occurs in the Lacs des Loups Marins (Seal Lakes) at the headwaters of the Nastapoka River in northern Quebec; large population breeds on Sable Island, 125 km off Nova Scotia; extirpated from Lake Champlain and Lake Ontario; sometimes ranges as far north as Ellesmere Island and as far south as Florida (Reeves et al. 1992, which see for distribution in eastern North Atlantic. In the eastern Pacific, breeds from Bahia San Quintin, Baja California, to Aleutian Islands, Pribilof Islands, and Nome, Alaska; in the western Pacific, Commander Islands south to Hokkaido, Japan (Reeves et al. 1992). In eastern North Atlantic, ranges from Murmansk to the outer Baltic and northern France, United Kingdom south to east Anglia, southern Ireland, Faroes, Spitsbergen, and Iceland (McLaren, in Macdonald 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Harbour seals are mainly founded focused along the north-western coastline of Scotland.Along the English coastline there are large colonies in the Wash and sub-colonies on northern parts of the Norfolk.Across the North Sea there are likely to be some 30,000 animals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The common seal is found from the subtropics to the Arctic around coasts of the North Atlantic and the North Pacific (6). In Europe they occur off Icelandic, Danish, German, Dutch and Icelandic coasts as well as around the UK. The UK supports 45 percent of the European population (five percent of the world population); main centres of population occur in the Moray Firth, The Wash and the Tay Estuary, and the species is fairly widespread around west Scotland, the Northern Isles and the Hebrides (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Harbor seals are physically adapted to maximize propulsion while diving. Their large round heads that lack external ears, although their middle ear bones are large. Rather than exhaling before diving, they essentially stop breathing underwater and their heart rate slows, resulting in conservation of oxygen in their bodies. They have narrow nostrils that easily close during swimming. Their flippers are long and flat, each made up of five webbed digits. Speed and agility in the water is enhanced by use of their hind limbs and flexible side-to-side movements of their trunks. Adult males are typically larger than females, measuring 160 to 190 cm in length, and weighing 80 to 170 kg. Females range from 160 to 170 cm long and weigh 60 to 145 kg.

Although various regions differ slightly, harbor seals are monomorphic. Individuals with a yellowish coat covered in small pale ringed black spots are characterized as being in the “light phase”. The “dark phase” seals have a black coat containing dark spots with light rings found primarily on their dorsum. Their varying color patterns are a result of differing concentrations of melanocytes in the epidermis. Their fur protects their skin from damage while on land, and is kept moist by secretions from sebaceous glands.

Thick layers of subcutaneous fat provide energy and insulation, giving them a higher resting metabolism rate that is 1.7 to 2.2 times higher than other terrestrial mammals their size. Another trait that separates harbor seals from other mammals is their vibrissae (whisker) structures, whose follicles are surrounded by 3 blood sinuses as opposed to 2.

Average mass: 80 to 170 kg.

Average length: 160 to 190 cm.

Sexual Dimorphism: male larger

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 115000 g.

Average basal metabolic rate: 73.29 W.

  • Berta, A., J. Sumich, K. Kovacs. 2006. Marine Mammals: Evolutionary Biology. Burlington, MA: American Press.
  • Nowak, R. 2003. Walker's Marine Mammals of the World. Baltimore, MD: The John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 170 cm

Weight: 136000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly larger than females.

Length:
Average: 1.8 m males; 1.5 m females

Weight:
Average: 130 kg males; 105 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Morphology

Harbour seals can reach up to 1.6 m in length and weigh about 120 kilos. Their colour varies from grey to brown with black marks. A characteristic feature is their V-shaped nostrils.
  • Stienen, E.W.M.; Van Waeyenberge, J.; Kuijken, E. (2003). Zeezoogdieren in Belgisch mariene wateren [Marine mammals in Belgian marine waters]. Rapport Instituut voor Natuurbehoud, A.2003.152. Instituut voor Natuurbehoud: Brussel, Belgium. 15 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morphology

Distinguishing Characteristics: small in size in relation to seals, dog-like face, v-shaped nostrils, colour varies from white to tan to dark brown to red (molttled):
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Harbor seals populate the shallow waters of coastal areas, bays, rocky islets, estuaries, and even freshwater lakes. They are typically seen near piers and beaches, as well as on intercoastal islands. They are more common in relatively cold marine waters that lack annual sea ice coverage. However, tidewater glaciers are utilized for shelter, breeding, and occasionally transportation. They forage at an average depth of 91 m, but can go as deep as 427 m.

Range depth: 427 (high) m.

Average depth: 91 m.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: coastal

Other Habitat Features: estuarine ; intertidal or littoral

  • Burde, J., G. Feldhamer. 2005. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
  • Spies, R. 2007. Long-Term Ecological Change in the Northern Gulf of Alaska. Kidlington, Ox, UK: Elsevier B.V..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Adult males are up to 1.9 m long and weigh 70-150 kg, females 1.7 m and 60-110 kg. At birth, pups are 65-100 cm and 8-12 kg (Burns 2002).

Harbour seals are mainly found in the coastal waters of the continental shelf and slope, and are also commonly found in bays, rivers, estuaries and intertidal areas. On land, harbor seals are usually extremely wary and shy unless habituated to human activities and noise sources in their vicinity. It is almost impossible to approach them when they are ashore without stampeding them into the water. Most harbour seal haul-out sites are used daily, based on tidal cycles and other environmental variables, although foraging trips can last for several days. Although generally considered a non-migratory species with a high degree of site fidelity to a haul out, juvenile dispersal, emigration and establishment of new haul out sites are all possible reasons for long range movements of harbour seals (Burns 2002).

Harbour seals are gregarious at haul-out sites. However, they usually do not lie in contact with each other. They will haul out on rocks, sand and shingle beaches, sand bars, mud flats, vegetation, a variety of man-made structures, glacial ice, and to a very limited extent sea ice in some areas. They usually lie close to the water to permit a rapid escape from threats. Sex and age segregation is common in most populations (Kovacs et al. 1990). At sea, they are most often seen alone, but occasionally occur in small groups. Localized aggregations can form in response to feeding opportunities and concentration of prey.

Male harbour seals become sexually mature when four to five years old. Female harbour seals usually become sexually mature when three to five years old. Gestation lasts 10.5-11 months, including a 2+-month delayed implantation. Throughout the range, the time of birthing varies widely and may follow a latitudinal cline (Temte 1994). Peak pupping date varies from mid March to early September. The mating system is promiscuous, or weakly polygynous, with males defending underwater calling sites (e.g. Van Parijs and Kovacs 2002). Mating usually takes place in the water, with females coming into oestrus around a month after giving birth. Moult follows the pupping and mating season. The timing of onset of moult depends on the age and sex of the animal with yearlings moulting first and adult males last (e.g. Reder et al. 2003). Most harbour seal monitoring programs are based on counts obtained during the moult and are therefore subject to possible biases due to changes in age and sex structure of the population.

Most pups shed their silvery gray lanugo coat in the uterus before birth. Exceptions to this include pups born prematurely, and some that are born early in the breeding season. Pups usually enter the water rapidly after birth, and because of tidal inundation at many sites used for birthing, this often occurs in hours (Burns 2002).

Harbour seals are generalist feeders that take a wide variety of fish, cephalopods, and crustaceans obtained from surface, mid-water, and benthic habitats (e.g. Olesiuk et al 1990, Payne and Selzer 1989). Their diet is highly varied, and animals from different populations and areas show differences and there is also variation associated with seasonal changes in the abundance of prey (e.g. Harkonen 1987, Andersen et al. 2004). Generally, a few species dominate the diet at any one location and time of year. Although primarily coastal, dives to over 500 m have been recorded (Burns 2002). Harbour seals also take many commercially important fish species such as Atlantic cod, many kinds of salmon, herring, and flatfishes to name a few, and this aspect of their foraging puts them into conflict with coastal fisheries.

Longevity is typically 35 years for females and 25 years for males, but is lower in P. v. stejnegeri and P. v. richardii which are reported to live to approximately 20 years for males and 30 years for females. Predators include killer whales, great white and Greenland sharks and possibly other shark species, Steller sea lions and walrus, gulls and ravens and in southerly locales feral dogs and eagles. There is no information on polar bear, brown bear, and wolf predation on harbor seals, but all are possible predators.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal waters to about 10 miles offshore, bays, harbors, coastal rivers, lakes. Most common in protected areas such as bays or inlets, much less numerous along simple open coastlines. Some frequently occur in freshwater bodies connected to the ocean. Resident year-round in freshwater in Lacs des Loups Marins (Quebec; Smith, 1996 COSEWIC report) and possibly in Lake Iliama (Alaska). Rests on isolated mudbanks, rocky or sandy shores, intertidal ledges, reefs, islands; sometimes piers and log rafts; also on ice in some areas (Scheffer 1958, Boulva and McLaren 1979, Johnson and Jeffries 1977, Burns and Gol'tsev 1984, Hoover 1988).

Pups are born on shore, often in an intertidal area; secluded sites and areas beyond strong wave action.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nearshore waters of the Atlantic Ocean and adjoining seas above about 30 degrees latitude
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

temperate to polar
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9881 specimens in 1 taxon.
Water temperature and chemistry ranges based on 896 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.297 - 21.498
  Nitrate (umol/L): 0.240 - 12.040
  Salinity (PPS): 30.381 - 35.656
  Oxygen (ml/l): 5.180 - 8.103
  Phosphate (umol/l): 0.205 - 1.202
  Silicate (umol/l): 0.987 - 22.664

Graphical representation

Temperature range (°C): 0.297 - 21.498

Nitrate (umol/L): 0.240 - 12.040

Salinity (PPS): 30.381 - 35.656

Oxygen (ml/l): 5.180 - 8.103

Phosphate (umol/l): 0.205 - 1.202

Silicate (umol/l): 0.987 - 22.664
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The common seal lives mainly along shorelines and in estuaries. It is commonly seen resting on sandbanks, easily accessible beaches, reefs and protected tidal rocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common seals seem to prefer sheltered waters. They haul out on a range of habitats such as rocky shores, sand and gravel beaches, mudflats and sand bars. Preferred haul out sites are protected against land predators and strong winds or waves, are close to food sources and enable direct access to deep water (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In some areas, makes seasonal migrations of up to at least several hundred kilometers. Many seals that summer in Bay of Fundy and Maine apparently migrate southward to winter in southern New England (Rosenfeld et al. 1988). In southern California, adults remain close to the Channel Islands year-round (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Harbor seals are carnivores that consume mostly fish. Despite regional variation in individual diets, the overarching goal of harbor seals is to keep foraging efforts low by eating what is abundant and easily caught. Adults eat mostly fish, consuming the fish whole or head first. Preferred medium-sized fish species include codfish (Gadus), hake (Merluccius merluccius), mackerel (Scombridae), and herring (Clupea pallasii pallasii). They also eat octopus (Octopoda) or squid (Teuthida), as well as crustaceans (Crustacea) such as crabs (Brachyura) and shrimp. Because newly weaned pups have poorly developed diving abilities, their primary diet consists of crustaceans that are easier to catch. Harbor seals weighing 100 kg eat about 5 to 7 kg of food per day. They will dive up to 427 m for a potential meal.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Newly weaned pups eat mainly bottom-dwelling crustaceans. Older individuals feed opportunistically on various fishes and some cephalopods and crustaceans. In southern California, most dives were 17-87 m (sometimes up to several hundred meters).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Harbor seals are hosts to many parasites. These include nematodes such as Pseudoterranova decipiens and Contracaecum osculatum and cestodes such as Anophryocephalus and Diplogonoporus. Although many parasites found living on the seals are normally harmless, seals that acquire pathogens when their immune systems are repressed could become deadly. The parasites could also pass bacteria and/or viruses that could make them very ill. For example, Leptospira interrogans is the bacterium responsible for the most recorded deaths in all pinnipeds.

Commensal/Parasitic Species:

  • Herreman, J., A. McIntosh, R. Dziuba, G. Blundell, M. Ben-David, E. Greiner. 2011. Parasites of harbor seals (Phoca vitulina) in Glacier Bay and Prince William Sound, Alaska. Marine Mammal Science, 27/1: 247-253.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators of harbor seals inlcude larger species like sharks (Selachimorpha), killer whales (Orcinus orca), and polar bears (Ursus maritimus). Haul out sites help reduce predation by shortening the time they spend in water, yet there is still danger on land. For example, coyotes (Canis latrans) may prey on pups when their mothers are foraging. Humans (Homo sapiens) also prey on harbor seals in some areas of the Arctic.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Hundreds of haulouts worldwide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population probably is at least 500,000. Population in eastern Canada south of Labrador was about 13,000 (and increasing) in the mid-1980s. In 1986, nearly 13,000 were counted at haul-out sites in Maine. Several thousand occur in winter in coastal southern New England. Total population in the North Pacific was estimated at more than 300,000 in 1979, with at least two-thirds of these in Alaska. Post-pupping population in British Columbia was 75,000-88,000 in the late 1980s. California population was estimated at 34,500 in the mid-1990s (NMFS, Federal Gister, 15 March 1996). See Reeves et al. (1992) for information on

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Mainly solitary in water, forms usually small groups when ashore or out of water on exposed rocks (sometimes up to several hundred). Mean maximum distance between haulout sites used by adults in Alaska was 14.7 kilometers; at-sea foraging area size averaged 267 square kilometers for adults and 385 square kilometers for subadults (Small and ver Hoef 2001).

Common causes of mortality include abandonment or orphaning of pups and predation by sharks, killer whales, and sometimes other mammals. Also, outbreaks of disease (influenza, distemper) sometimes kill hundreds or thousands of individuals in a local or regional population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

DMS in the odor landscape of the sea

Dimethyl Sulfide or DMS is present throughout the ocean(1). It’s an important odor component of many fish and shellfish, including clams, mussels, oysters, scallops, crabs and shrimp(2-9). Where does it come from? Usually from the marine plants they feed on.

Many species of plants and algae produce DMS, but not all species produce significant amounts of it. Nearly all of these are marine, and they tend to be in closely related groups with other DMS-producers, including Chlorophyte (green) seaweeds, the Dinophyceae in the dinoflagellates, and some members of the Chrysophyceae and the Bacillariophyceae (two classes of diatoms). Other large groups, like cyanobacteria and freshwater algae, tend not to produce DMS. (10,11)

Why do these groups produce DMS? In algae, most researchers believe a related chemical, DMSP, is used by the algae for osmoregulation- by ensuring the ion concentration inside their cells stays fairly close to the salinity in the seawater outside, they prevent osmotic shock. Otherwise, after a sudden exposure to fresh water (rain at the sea surface, for instance) cells could swell up and explode. In vascular plants, like marsh grasses and sugar cane, it’s not clear what DMS is used for. (12,13)

Freshly harvested shellfish can smell like DMS because DMSP has accumulated in their tissue from the algae in their diet. Some animals, including giant Tridacna clams and the intertidal flatworm Convoluta roscoffensis, harbor symbiotic algae in their tissues, which produce DMSP; this may not be important to their symbioses, but for Tridacna, the high DMS levels can be a problem for marketing the clams to human consumers. After death, DMSP begins to break down into DMS. A little DMS creates a pleasant flavor, but high concentrations offend the human palate.(2,14)

Not all grazers retain DMS in their tissues, though. At sea, DMS is released when zooplankton feed on algae. It’s been shown in the marine copepods Labidocera aestiva and Centropages hamatus feeding on the dinoflagellate Gymnodinium nelson that nearly all the DMS in the consumed algae is quickly released during feeding and digestion.(15) This has a disadvantage for the grazing zooplankton. Marine predators, like procellariiform seabirds, harbor seals, penguins, whale sharks, cod, and coral reef fishes like brown chromis, Creole wrasse and boga, can use the smell of DMS to locate zooplankton to feed on. (8,16,17)

It’s not easy to measure how much DMS is released from the Ocean into the air every year. Recent estimates suggest 13-37 Teragrams, or 1.3-3.7 billion kilograms. This accounts for about half the natural transport of Sulfur into the atmosphere, is the conveyor belt by which Sulfur cycles from the ocean back to land. In the atmosphere, DMS is oxidized into several compounds that serve as Cloud Condensation Nuclei (CCN). The presence of CCN in the air determines when and where clouds form, which affects not only the Water cycle, but the reflection of sunlight away from the Earth. This is why climate scientists believe DMS plays an important role in regulating the Earth’s climate. (12,18)

  • 1) BATES, T. S., J. D. Cline, R. H. Gammon, and S. R. Kelly-Hansen. 1987. Regional and seasonal variations in the flux of oceanic dimethylsulfide to the atmosphere. J. Geophys. Res.92: 2930- 2938
  • 2) Hill, RW, Dacey, JW and A Edward. 2000. Dimethylsulfoniopropionate in giant clams (Tridacnidae). The Biological Bulletin, 199(2):108-115
  • 3) Brooke, R.O., Mendelsohn, J.M., King, F.J. 1968. Significance of Dimethyl Sulfide to the Odor of Soft-Shell Clams. Journal of the Fisheries Research Board of Canada, 25:(11) 2453-2460
  • 4) Linder, M., Ackman, R.G. 2002. Volatile Compounds Recovered by Solid-Phase Microextraction from Fresh Adductor Muscle and Total Lipids of Sea Scallop (Placopecten magellanicus) from Georges Bank (Nova Scotia). Journal of Food Science, 67(6): 2032–2037
  • 5) Le Guen, S., Prost, C., Demaimay, M. 2000. Critical Comparison of Three Olfactometric Methods for the Identification of the Most Potent Odorants in Cooked Mussels (Mytilus edulis). J. Agric. Food Chem., 48(4): 1307–1314
  • 6) Piveteau, F., Le Guen, S., Gandemer, G., Baud, J.P., Prost, C., Demaimay, M. 2000. Aroma of Fresh Oysters Crassostrea gigas: Composition and Aroma Notes. J. Agric. Food Chem., 48(10): 4851–4857
  • 7) Tanchotikul, U., Hsieh, T.C.Y. 2006. Analysis of Volatile Flavor Components in Steamed Rangia Clam by Dynamic Headspace Sampling and Simultaneous Distillation and Extraction. Journal of Food Science, 56(2): 327–331
  • 8) Ellingsen, O.F., Doving, K.B. 1986. Chemical fractionation of shrimp extracts inducing bottom food search behavior in cod (Gadus morhua L.). J. Chem. Ecol., 12(1): 155-168
  • 9) Sarnoski, P.J., O’Keefe, S.F., Jahncke, M.L., Mallikarjunan, P., Flick, G. 2010. Analysis of crab meat volatiles as possible spoilage indicators for blue crab (Callinectes sapidus) meat by gas chromatography–mass spectrometry. Food Chemistry, 122(3):930–935
  • 10) Malin, G., Kirst, G.O. 1997. Algal Production of Dimethyl Sulfide and its Atmospheric Role. J. Phycol., 33:889-896
  • 11) Keller, M.D., Bellows, W.K., Guillard, R.L. 1989. Dimethyl Sulfide Production in Marine Phytoplankton. Biogenic Sulfur in the Environment. Chapter 11, pp 167–182. ACS Symposium Series, Vol. 393. ISBN13: 9780841216129eISBN: 9780841212442.
  • 12) Yoch, D.C. 2002. Dimethylsulfoniopropionate: Its Sources, Role in the Marine Food Web, and Biological Degradation to Dimethylsulfide. Appl Environ Microbiol., 68(12):5804–5815.
  • 13) Otte ML, Wilson G, Morris JT, Moran BM. 2004. Dimethylsulphoniopropionate (DMSP) and related compounds in higher plants. J Exp Bot., 55(404):1919-25
  • 14) Van Bergeijk, S.A., Stal, L.J. 2001. Dimethylsulfonopropionate and dimethylsulfide in the marine flatworm Convoluta roscoffensis and its algal symbiont. Marine Biology, 138:209-216
  • 15) Dacey , J.W.H. and Stuart G. Wakeham. 1986. Oceanic Dimethylsulfide: Production during Zooplankton Grazing on Phytoplankton. Science, 233( 4770):1314-1316
  • 16) Nevitt, G. A., Veit, R. R. & Kareiva, P. (1995) Dimethyl Sulphide as a Foraging Cue for Antarctic Procellariiform Seabirds. Nature 376, 680-682.
  • 17) Debose, J.L., Lema, S.C., & Nevitt, G.A. (2008). Dimethylsulfionoproprianate as a foraging cue for reef fishes. Science, 319, 1356.
  • 18) Charlson, R.J., Lovelock, J.E., Andraea, M.O., Warren, S.G. 1987. Oceanic phytoplankton, atmospheric sulphur, cloud albedo and climate. Nature, 326:655-661
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Harbor seals are extremely alert and appear to be continuously aware of their surroundings, even when in captivity. In comparison to related seals, they are known to be less vocal. Their detected sound frequencies range from 0.1 to 10 kHz. Their relative “quietness” may be an adaptation to avoid predication. The noises they produce have been associated with sounding more like burping, grunting, and yelping. Harbor seals are recognized to be a profoundly playful species in both pups and adults. They often play by themselves and with other objects such as kelp. They have large eyes with corneas that are flattened that allow them to take in more light and see brighter images in dark water. Their sensitive whiskers acoustically detect sound waves, which is useful for catching prey. Another behavior they are known for is slapping their flippers vigorously against the water’s surface; the motive behind such action is still unknown. With such a wide geographical range, behaviors may vary between regions.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Fish, crustaceans, squid
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Using special tagging devices it is possible to record the movements of animals.Adults are capable of dispersing widely throughout the North Sea but more usually stay 5-20km around their haul-out sites, diving and locally foraging for food.British and Danish populations often intermingle and in so doing sometimes spread viral distemper.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Activity pattern governed by tides and weather. Usually rests on shore or on rocks exposed during low tide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Harbor seals in the wild are estimated to reach an average lifespan of 40 years. In captivity, the longest recorded lifespan was 47.6 years.

Range lifespan

Status: captivity:
47.6 (high) years.

Average lifespan

Status: wild:
40 years.

Average lifespan

Status: wild:
34.0 years.

Average lifespan

Status: wild:
40.0 years.

Average lifespan

Sex: male

Status: wild:
26.0 years.

Average lifespan

Sex: female

Status: wild:
32.0 years.

  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits. Journal of Evolutionary Biology, 22/8: 1770-1774.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 47.6 years (captivity) Observations: In the wild, these animals are believed to live up to 40 years (Bernhard Grzimek 1990). One wild born specimen was about 47.6 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Harbor seals mate in aquatic habitats, and males attempt to attract potential mates in a variety of ways. These include showing off vocal or diving capabilities and direct competition between males. The latter involves intense fighting near haul out sites and areas of high female abundance. Males may also establish territories in areas of high female traffic to maximize contact with potential mates. Actual mating occurs in water, as is typical of seal species, which makes it difficult to observe and fully understand their mating systems. Harbor seals are considered mostly monogamous, but there have been reports in literature of slight polygamy with males mating with multiple females, but with a maximum of five successful fertilizations.

Mating System: polygynous

Female harbor seals typically give birth to a single pup every season with pregnancy rates that are about 85%. Twins have occasionally been reported. Once a female becomes fertilized, there is a delay in implantation that lasts about 2.5 months. Then implantation resumes and develops for 8 months before birth. The total gestation period lasts about ten and a half months. Birthing occurs close to the shore or on land, which appears to be an adaptation to isolate females and pups from aquatic predators.

Depending on regional and environmental factors, all sub-species of harbor seal pups are typically born in the same 10 week window lasting from late winter to summer. Newborns weigh 8 to 12 kg. While some seals retain a fine, downy coat of hair called lanugo after birth, harbor seal pups shed their lanugo well before they are born. At birth, the pups' fur is the same texture as that of the adults, which allows them to safely enter cooler waters. However, adult fur coats don't develop until the end of the first summer. Pups are weaned and independent after 4 to 6 weeks, and mating for the following year commences immediately afterward. Female harbor seals reach sexual maturity by age 3 to 4, and physical maturity by age 6 to 7. Male harbor seals don’t reach sexual maturity until age 4 to 5, and physical maturity until 7 to 9 years of age.

Breeding interval: Harbor seals usually breed once per year, normally in late winter to summer.

Breeding season: Breeding occurs during a 10 week period.

Range number of offspring: 0 to 2.

Average gestation period: 10.5 months.

Range weaning age: 4 to 6 weeks.

Range time to independence: 4 to 6 weeks.

Average age at sexual or reproductive maturity (female): 3-4 years.

Average age at sexual or reproductive maturity (male): 4-5 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous ; delayed implantation ; embryonic diapause

Average birth mass: 11000 g.

Average gestation period: 253 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1460 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Female harbor seals invest more effort in parental care than do males. Within the first hour of birth, mothers eagerly bond to establish recognition, which is critical to the success or raising a harbor seal. Pups are generally nursed for 4 weeks with milk containing around 50% fat from their mothers. This high fat content results in rapid growth. For 4 to 6 weeks until the pups are weaned, they cling to their mothers' backs in the water.

Parental Investment: female parental care ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Allen, S., C. Ribic, J. Kjelmyr. 1988. Herd segregation in harbor seals at Point Reyes, California. Calif. Fish and Game, 74/1: 55-59.
  • Boness, D. 2004. True Seals (Phocidae): Harbor Seal. Pp. 417-436 in M Hutchins, A Evans, J Jackson, D Kleiman, J Murphy, D Thoney, eds. Grzimek's Animal Life Encyclopedia, Vol. 14: Mammals III, 2nd Edition. Detroit: Gale.
  • Burde, J., G. Feldhamer. 2005. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
  • Burns, J. 2008. Encyclopedia of Marine Mammals. Pp. 533-541 in W Perrin, B Wursig, J Thewissen, eds. Harbor Seal and Spotted Seal, Vol. 1, 2 Edition. New York, NY: Academic Press.
  • Coltman, D., W. Bowen, J. Wright. 1998. Male mating success in an aquatically mating pinniped, the harbour seal (Phoca vitulina), assessed by microsatellite DNA marker. Behavioral Ecology and Sociobiology, 7/5: 627-638.
  • Geraci, J., V. Lounsbury. 2005. Marine Mammals Ashore: A Field Guide for Strandings. Baltimore, MD: National Aquarium in Baltimore.
  • Nowak, R. 2003. Walker's Marine Mammals of the World. Baltimore, MD: The John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Local birth season exhibits high degree of geographic variation, lasts 1-2 months within a particular area. Births occur mainly in May-June in Gulf of Alaska, Nova Scotia, and Newfoundland; June-July farther north in western Atlantic; February-March in Baja California. Lactation lasts 2-6 weeks (average about 3-4 weeks), followed within a few days by ovulation and mating, then blastocyst implantaion 1.5-3 months later. Females continue to forage during lactation period. Females sexually mature in 3-6 years, males in 3-7 years. Few live beyond 25 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Whiskers reduce drag: harbor seals
 

The highly sensitive whiskers of harbor seals reduce vortex-induced vibrations during swimming thanks to their undulated surface structure.

   
  "Harbor seals (Phoca vitulina) often live in dark and turbid waters,  where their mystacial vibrissae, or whiskers, play an important  role in orientation. Besides detecting and discriminating objects  by direct touch, harbor seals use their whiskers to analyze  water movements, for example those generated by prey fish or  by conspecifics. Even the weak water movements left behind by  objects that have passed by earlier can be sensed and  followed accurately (hydrodynamic trail following). While scanning  the water for these hydrodynamic signals at a swimming speed  in the order of meters per second, the seal keeps its long  and flexible whiskers in an abducted position, largely perpendicular  to the swimming direction. Remarkably, the whiskers of  harbor seals possess a specialized undulated surface structure, the  function of which was, up to now, unknown. Here, we show that  this structure effectively changes the vortex street behind the  whiskers and reduces the vibrations that would otherwise be  induced by the shedding of vortices from the whiskers (vortex-induced  vibrations). Using force measurements, flow measurements and  numerical simulations, we find that the dynamic forces on harbor  seal whiskers are, by at least an order of magnitude, lower than  those on sea lion (Zalophus californianus) whiskers, which do  not share the undulated structure. The results are discussed in  the light of pinniped sensory biology and potential biomimetic applications." (Hanke et al. 2010:2665)

  Learn more about this functional adaptation.
  • Hanke W; Witte M; Miersch L; Brede M; Oeffner J; Michael M; Hanke F; Leder A; Dehnhardt G. 2010. Harbor seal vibrissa morphology suppresses vortex-induced vibrations. Journal of Experimental Biology. 213: 2665-2672.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Whiskers sense prey movement: harbor seals
 

Whiskers of harbor seals detect prey with spectral sensitivity tuned to the frequency range of fish-generated water movement.

     
  "Harbour seals (Phoca vitulina) can use their whiskers to detect minute water movements. The high sensitivity of this sensory system should allow a seal to gain hydrodynamic information resulting from movements of other aquatic animals, such as prey, predators or conspecifics. Our results show that the whiskers of harbour seals form a hydrodynamic receptor system with a spectral sensitivity that is well tuned to the frequency range of fish-generated water movements." (Dehnhardt et al. 1998:235-236)

"Water movements in the wake of fishes persist for several minutes. Here we show that blindfolded seals can use their whiskers to detect and accurately follow hydrodynamic trails generated by a miniature submarine. This shows that hydrodynamic information can be used for long-distance prey location." (Dehnhardt et al. 2001:102)
  Learn more about this functional adaptation.
  • Dehnhardt, G; Mauck, B; Bleckmann, H. 1998. Seal whiskers detect water movements. Nature. 394(6690): 235-236.
  • Dehnhardt, G; Mauck, B; Hanke, W. 2001. Hydrodynamic trail-following in harbor seals (Phoca vitulina). Science. 293(5527): 102-104.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phoca vitulina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGGTTATTTTCCACAAATCATAAGGATATCGGCACTCTTTATTTGCTGTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTCAGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATTGTCACCGCCCATGCATTCGTAATAATTTTCTTCATGGTAATGCCCATCATAATTGGCGGCTTTGGGAACTGACTGGTGCCCCTAATAATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTCTGACTTTTACCACCGTCCTTCCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGAACCGGGTGAACCGTTTATCCTCCCCTAGCTGGGAACCTGGCTCATGCAGGAGCCTCTGTAGATCTAACAATTTTCTCGCTCCACTTGGCAGGTGTATCATCTATTCTTGGAGCTATCAACTTCATCACTACCATCATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTATGATCCGTATTAATCACAGCGGTGCTCCTACTATTGTCACTACCAGTCCTGGCAGCTGGCATCACCATGCTACTCACAGACCGAAACCTGAATACAACATTCTTCGACCCTGCCGGAGGAGGTGATCCTATCCTGTATCAACATCTGTTCTGATTCTTCGGACATCCTGAGGTGTATATTCTAATCCTACCAGGATTCGGAATAATCTCACACATCGTTACCTACTATTCAGGAAAAAAAGAACCTTTTGGTTATATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTCATTGTATGAGCCCACCATATATTTACTGTAGGGATGGACGTCGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phoca vitulina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The total population of harbor seals has been increasing since around the 1970s. However, major die-offs have occurred in recent years where thousands of seals have died from diseases not previously known to be a problem. Because they are a coastal species, they are particularly vulnerable to pollution. Their status on the IUCN Red List is "least concern." However, two subspecies are currently on the brink of extinction. First is the subspecies population Phoca vitulina stejnegeri in Japan that has been steadily declining due to excessive hunting since the 1980s. Secondly, the subspecies Phoca vitulina mellonae that lives in the Ungava Peninsula in Canada have very low population numbers of 120 to 600 seals. They are the subspecies most at risk due to low genetic variation and are also negatively impacted from hydroelectric developments. No reports of efforts to conserve these two subspecies have been found.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Thompson, D. & Härkönen, T. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its large and either stable or increasing population, on a global scale the Harbour Seal is considered to be Least Concern. However, for conservation concerns at a somewhat finer spatial scale, it is prudent to assess each of the subspecies separately as some populations are small and declining.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Worldwide distribution; high abundance; precipitous decline in some areas, increases in other areas; suspected threats include food shortages resulting from local fisheries management practices, incidental and intentional take, disease, and entanglement in marine debris.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Protected in Britain under the Conservation of Seals Act 1970 (closed season from 1 September until 31st December) (3) and schedule 3 of the Conservation Regulations (1994) (4). Listed as a protected species under Annex II and Annex V of the European Community's Habitats Directive. The eastern Atlantic population is listed under Appendix III of the Bern Convention. Subpopulations in the Baltic and Wadden Seas are listed under Appendix II of the Bonn Convention (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Combining recent estimates yields a world-wide population of 350,000 to 500,000 animals.

P. v. vitulina - Population dynamics of regional subpopulations vary dramatically, with recent large-scale declines in the northern UK populations (Thompson et al. 2001, Lonergan et al. 2007), rapid increases punctuated by major population crashes due to disease events in the Wadden Sea, southern England, Kattegat and Skagerrak populations and gradual increase after near extinction in the 1970s in the Baltic (e.g. Heide-Jorgensen and Harkonen 1988, Harkonen et al. 1999, 2002, 2005, 2006). Populations in Svalbard and the Baltic Sea, are low, both in the hundreds, although they are not considered to be separate subspecies. There are some morphological differences at least in the Svalbard population (Lydersen and Kovacs 2005). Overall the population of P. v. vitulina has increased since the 1970s.

P. v. concolor - Canadian populations declined during the 1970s from approximately 12,000 to 4,000. They have probably been increasing since the early 1980s with the exception of the Sable Island subpopulation that declined from a maximum pup production of 600 in 1989 to <10 p.a. by early 2000s. The Sable Island harbour seal declines are thought to be due to shark predation and competition with grey seals (Lucas and Stobo 2000, Bowen et al. 2003). Populations in West Greenland, Iceland and Norway are depleted as a result of hunting (Bjorge 1987, Hauksson 1992, Teilmann and Dietz 1994, Henriksen et al. 1997). Harbour seals in the eastern USA have increased at 6.6% p.a. since 1981, recovering from results of bounty hunting which ceased in the 1960s (Gilbert et al. 2005). Overall the population of P. v. concolor has been stable or increasing since 1980.

P. v. richardii - Population dynamics of regional subpopulations vary dramatically. Large-scale, long-term declines in Gulf of Alaska from the 1970s to the early 1990s with >60% declines, have apparently stabilized, with the population experiencing slight increases since the early 1990s (Pitcher 1990, Frost et al. 1999, Jemison and Kelly 2001, Boveng et al. 2003, Mathews and Pendleton 2006, Jemison et al. 2006). Long-term population increases from the 1970s up to early 1990s appear to have reached an asymptote in British Columbia, Washington, Oregon, and California. Overall the P. v. richardii populations has been stable or increasing since the early 1990s.

P. v. stejnegeri - Population dynamics of this subspecies are not well documented, but the population in the Kuril Islands appears to have increased slightly from 2,000-2,500 in the early 1960s (Belkin 1964), and again increased to around 3,000-3,500 individuals in 2000 (Trukhin 2002). Similarly, in the Commander Islands the subpopulation increased from around 2,000 in the early 1960s to around 3,000-3,500 in the early 1990s (Burdin et al. 1991) and is thought to be stable. The population in Japan is small, estimated at 350 individuals in late 1980s, having declined due to heavy hunting pressure (Hayama 1988). This population is still thought to be subject to high by-catch rates in trap net fisheries and is shot by fishermen coastally Wada et al. 1991).

P. v. mellonae – This subspecies lives in lakes and rivers of the Ungava Peninsula, Canada. It is thought to number some 120-600 individuals and may be the subspecies most at risk to extinction, due to low population numbers and potential effects of hydro-electric developments (Smith 1997).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Harbour seals live in coastal areas many of which are heavily fished. As a result there are entanglement and by-catch issues which may be significant in some populations e.g. in northern Japan (Burns 2002). Over fishing, oceanographic regime shifts and global climate change may impact food chains harbour seals depend upon for prey.

Historically, there have been organized population reduction programs and bounty schemes in several range states of countries, largely because of perceived. Hunting and/or licensed killing to protect fisheries still occurs in Norway, UK and Iceland and subsistence hunting is allowed in Greenland and the United States (Alaska). In Greenland and Iceland there are indications that hunting is responsible for continuing population declines.

Mass die-offs from viral outbreaks have claimed thousands of harbour seals on both sides of the Atlantic, but most notably in Europe. In 1988 more than 20,000 harbour seals are estimated to have died from a phocine distemper virus (morbillivirus) epidemic in European waters (Dietz et al. 1989, Reijnders 1989). A similar outbreak in 2002 killed approximately 30,000 (Harkonen et al. 2006). Other disease outbreaks occurred both before and after this large epidemic in both Europe and the western North Atlantic, but resulted in much smaller levels of mortality. Influenza from an avian source killed approximately 500 harbour seals in the North-eastern United States in 1979 and 1980 (Burns 2002). Potential for exposure to disease is probably increased by the natural behaviour of this species to haul out on near shore and at coastal mainland sites. As a result terrestrial carnivores, waste from human populations as well as contact with human pets and feral animals associated with human populations creates an increased risk of exposure to communicable diseases.

Because many harbour seals live and feed in close proximity to large populations of humans they are exposed to and can accumulate high levels of industrial and agricultural pollutants in some parts of their range (see Reijnders 1978, 1985, 1986, Aguilar et al. 2002, Wang et al. 2007); while some northern populations have very low contaminant levels (e.g. Wolkers et al. 2004). Immuno-suppression is one affect regularly attributed to exposure to high levels of certain organochlorines and these and other contaminants probably contribute to poor condition and overall fitness of a number of animals in some areas. Both chronic oil spills and discharges and episodic large scale spills cause direct mortality and have long term impacts on harbour seal health and their environment. Some additional examples of threats and impacts to harbour seal populations are given below.

P. v. stejnegeri, of the western Pacific, numbers approximately 7,000 animals. Fishery related mortality in the small Japanese population is a cause for concern (Wada et al. 1991). However, low levels of human activity in the Kurils and protected status within nature reserves in the Commander Islands means that there is no obvious anthropogenic threat to the bulk of the population.

P. v. mellonae numbers only some 120-600 animals which are restricted to the Seal Lakes (Lac des Loups Marin) of the Ungava Peninsula, Canada. This subspecies is at risk due to low population numbers and unknown effects of James Bay II hydroelectric development which may reduce the water level in the seal lakes by 20 cm. This might have impacts on mortality of seals in winter and altered hydrographic conditions could potentially affect the seals’ prey.

P. v. richardii has shown dramatic reductions in the recent past in one large part of its range, Gulf of Alaska and Prince William Sound. Although part of this decline may be related to the effects of the Exxon Valdez disaster, the overall decline in Gulf of Alaska is unexplained.

Subpopulations of P. v. vitulina in the Northern UK have recently declined by around 50% in less than 10years. The cause of this decline is unknown. The Icelandic population has declined by 5% p.a. since 1980, which is thought to be due to direct hunting. Populations in Svalbard and the Baltic Sea, which are both small are protected. Competition with increasing gray seal populations may have been responsible for declines in the mid-latitudes and further increases in grey seal populations seem likely in the North Sea. Rapidly increasing development of offshore wind generated power means that the levels of industrial activity and noise are increasing in the foraging areas of resident harbour seals. To date, there is little information available to assess the potential impacts of such disturbance.

Historical population reductions of P. v. concolor along the USA coast were probably due to hunting that has now ceased. The rapid decline in the Sable Island population may have been due to a combination of shark predation (Lucas and Stobo 2000) and competition with grey seals (Bowen et al. 2003); the continued increase of grey seal populations in Canadian and US waters could produce a more widely spread decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Pacific Ocean: Recent precipitous declines in the numbers of harbor seals observed at some traditional haulout areas indicate that a fairly high level of threat exists to the long-term viability of these populations. These declines have been most recently documented in the Bering Sea region, where comparable declines have also been documented for both fur seals and Steller's sea lions (Pitcher 1990, Fowler 1982, 1985, York and Kozloff 1987, Braham et al. 1980, Merrick et al. 1987, Calkins and Goodwin 1988). The causes for these declines are not fully known, but food shortages, disease, and entanglement in marine debris are primary factors currently being investigated (Pitcher 1990). Large numbers die from entanglement in gill nets in some areas (annually perhaps 5% of the population in California) (Reeves et al. 1992). In some areas, populations are reduced through government-sponsored culls (Norway) or commercial harvest (Iceland).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The population of common seals in the UK cannot be estimated very accurately but humans have historically hunted the common seal in great numbers. The Seal Conservation Act of 1970 gives a degree of protection as shooting is outlawed during the breeding season, however if a seal is deemed to be interfering with fishing nets, it can legally be shot at any time under the 'Fisheries Defence Clause' (5). In 1988 a disease caused by the newly emerged phocine distemper virus killed about 3,000 of the UK's common seals. Such drastic population crashes seem to be a natural occurrence, and little can be done to prevent them (3). Common seals are also susceptible to oil and chemical pollutants (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the United States the harbour seal is protected from all but subsistence hunting by the Marine Mammal Protection Act of 1972, which also prohibits importation of parts or products from all seals. Coastal reserves in Norway which exclude commercial fishing have been shown to reduce harbour seal mortality because of the generally restricted movements of this species along the Norwegian coast. Hunting is now prohibited in the Wadden Sea area (The Netherlands, Germany, Denmark, and Swedish waters) (Reijnders et al 1993), Swedish Baltic, Eire and UK (Harwood 1987). Licensed killing to protect fisheries is allowed in UK, Canada and USA. Illegal hunting probably occurs throughout the harbour seal's range. The harbour seal population in Svalbard is on the national Red List for Norway and is afforded complete protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: 1. Worldwide monitoring of population trends in harbor seals and other sympatric marine mammals. 2. Focused biological research on potential causes of population declines in specific regions. 3. Regional research on global changes and impacts that are in the marine ecosystem, particularly in the Bering Sea. 4. Long-term viability and recovery studies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Protected by the Marine Mammal Protection Act (1972) in the United States, but effective management plans have not been developed (Hoover 1988). Many haulout areas are protected by their designation as marine sanctuaries and wildlife refuges. Open water hatitat, however, is not protected. Protected in British Columbia by the Canadian Federal Fisheries Act (1970).

Needs: 1. Minimize all incidental take and disturbance. 2. Eliminate driftnet fisheries that occur in seal feeding and movement areas. 3. Regulate fisheries take of fish resources known to be important to the maintenance of healthy seal populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

A number of key UK pupping and haul-out sites have been suggested as candidate Special Areas of Conservation (9). It has been recommended that human access to breeding sites could be restricted to reduce disturbance. Guidance notes on monitoring techniques for this species have been produced by the Joint Nature Conservation Committee, the Government's wildlife advisor (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Harbor seals interfere with some commercial and local fisheries. They lower the available fish supply for consumption, and can also become entangled in nets. Entanglement usually leads to the nets breaking which releases fish that could have been caught and utilized by the fisheries.

  • Jefferson, T., M. Webber, R. Pitman. 2008. Marine mammals of the World. Canada: Elsevier.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Harbor seals are hunted for their blubber, meat, fur, and skin. They are also a potential source of ecotourism value.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Long subjected to subsistence and bounty hunting and commercial harvest for pelts (see Reeves et al. 1992 for details). Large numbers continue to be killed in some areas (e.g., Iceland, Norway).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Harbor seal

The harbor (or harbour) seal (Phoca vitulina), also known as the common seal, is a true seal found along temperate and Arctic marine coastlines of the Northern Hemisphere. The most widely distributed of pinniped (walruses, eared seals, and true seals), they are found in coastal waters of the northern Atlantic and Pacific oceans, the Baltic and North Seas.

Harbor seals are brown, tan, or gray, with distinctive V-shaped nostrils. An adult can attain a length of 1.85 meters (6.1 ft) and a mass of 132 kilograms (290 lb). Females outlive males (30–35 years versus 20–25 years). Harbor seals stick to familiar resting spots or haulout sites, generally rocky areas (although ice, sand and mud may also be used) where they are protected from adverse weather conditions and predation, near a foraging area. Males may fight over mates underwater and on land. Females bear a single pup, which they care for alone. Pups are able to swim and dive within hours of birth, developing quickly on their mothers' fat-rich milk. Blubber under their skins helps to maintain body temperature.

Their global population is 5–6 million, but subspecies in certain habitats are threatened. Once a common practice, sealing is now illegal in many nations within the animal's range.

Contents

Description

A young harbor seal on the coast of La Jolla, San Diego

Individual harbor seals possess a unique pattern of spots, either dark on a light background or light on a dark. They vary in color from brownish black to tan or grey; underparts are generally lighter. The body and flippers are short, heads are rounded. Nostrils appear distinctively V-shaped. As with other true seals, there is no pinna (ear flap). An ear canal may be visible behind the eye. Including the head and flippers, they may reach an adult length of 1.85 meters (6.1 ft) and a weight of 55 to 168 kg (120 to 370 lb).[3] Females are generally smaller than males.

Population

There are an estimated 5 million to 6 million harbor seals worldwide. While the population is not threatened as a whole, the Greenland, Hokkaidō and Baltic Sea populations are exceptions. Local populations have been reduced or eliminated through disease (especially the phocine distemper virus) and conflict with humans, both unintentionally and intentionally. It is legal to kill seals perceived to threaten fisheries in the United Kingdom, Norway and Canada, but commercial hunting is illegal. Seals are also taken in subsistence hunting and accidentally as bycatch (mainly in bottomset nets). Along the Norwegian coast bycatch accounted for 48% of pup mortality.[4]

Seals in the United Kingdom are protected by the 1970 Conservation of Seals Act, which prohibits most forms of killing. In the United States the Marine Mammal Protection Act of 1972 prohibits the killing of any marine mammals and most local ordinances as well as NOAA instruct citizens to leave them alone unless there is serious danger to the seal. On the East Coast of the US their numbers are increasing steadily as they are reclaiming parts of their range, which naturally extends to North Carolina but the subspecies particular to this area will stray as far south as Florida. Pupping is known to occur in Maine, Massachusetts, Rhode Island, Connecticut, and possibly New York (Long Island.)

Subspecies

There are five subspecies of Phoca vitulina:

  • Western Atlantic common seals, P. v. concolor (DeKay, 1842), inhabit eastern North America. The validity of this subspecies is questionable, and not supported by genetic evidence.[5]
  • Ungava seals, P. v. mellonae (Doutt, 1942), are found in eastern Canada in fresh water (included in P. v. concolor by many authors[who?]).
  • Pacific common seals, P. v. richardsi (Gray, 1864), are located in western North America.
  • Insular seals, Phoca vitulina stejnegeri (J. A. Allen, 1902), are in eastern Asia.
  • Eastern Atlantic common seals, P. v. vitulina (L., 1758), from Europe and western Asia, are one of the most[clarification needed] harbor seal species in the world.

Habitat and diet

Skeleton

Harbor seals prefer to frequent familiar resting sites. They may spend several days at sea and travel up to 50 kilometers in search of feeding grounds, and will also swim some distance upstream into freshwater in large rivers. Resting sites may be both rugged, rocky coasts, such as those of the Hebrides or the shorelines of New England, or sandy beaches.[1] Harbor seals frequently congregate in harbors, sandy intertidal zones,[1] and estuaries in pursuit of prey fish such as menhaden, anchovy, sea bass, herring, mackerel, cod, whiting and flatfish, and occasionally shrimp, crabs, mollusks and squid. Alantic subspecies of either Europe or North America will also exploit deeper dwelling fish of the genus Ammodytes as a food source and Pacific subspecies have been recorded occasionally consuming fish of the genus Oncorhynchus. Although primarily coastal, dives to over 500 m have been recorded.[6] Harbor seals have been recorded to attack, kill and eat several kinds of seabirds.[7]

Behavior and reproduction

A harbor seal colony in Helgoland, Germany

Harbor seals are gregarious animals, though they do not form groups as large as some other seals. When not actively feeding they will haul to rest. They tend to be coastal, not venturing more than 20 kilometers offshore. Both courtship and mating occur underwater. The mating system is not known, but thought to be polygamous. Females give birth once per year, with a gestation period of approximately nine months.

Birthing of pups occurs annually on shore. The timing of the pupping season varies with location,[8] occurring in February for populations in lower latitudes, and as late as July in the subarctic zone. The mothers are the sole providers of care, with lactation lasting four to six weeks. Researchers have found males gather underwater, turn on their backs, put their heads together and vocalize to attract females ready for breeding.[9] The single pups are born well developed, capable of swimming and diving within hours. Suckling for three to four weeks, pups feed on the mother's rich, fatty milk and grow rapidly; born weighing up to 16 kilograms, the pups may double their weight by the time of weaning.

Harbor seals must spend a great deal of time on shore when moulting, which occurs shortly after breeding. This onshore time is important to the life cycle, and can be disturbed when there is substantial human presence.[10] The timing of onset of moult depends on the age and sex of the animal, with yearlings moulting first and adult males last.[11] A female will mate again immediately following the weaning of her pup. Harbor seals are sometimes reluctant to haul out in the presence of humans, so shoreline development and access must be carefully studied in known locations of seal haul out.[citation needed]

Harbor seals in California

A pup nursing at Point Lobos

The California population of subspecies richardsi amounted to approximately 25,000 individuals as of 1984. Pacific harbor seals or Californian harbor seals are found along the entire Pacific coast shoreline of the state. They prefer to remain relatively close to shore in subtidal and intertidal zones, and have not been seen beyond the Channel Islands as a pelagic form; moreover, they will often venture into bays and estuaries and even swim up coastal rivers. They feed in shallow littoral waters on herring, flounder, hake, anchovy, codfish and sculpin.[12]

Breeding occurs in California from March to May, pupping between April and May, depending on local populations. As top level feeders in the kelp forest, harbor seals enhance species diversity and productivity. They are preyed upon by killer whales (orcas) and white sharks.

Considerable scientific inquiry has been carried out by The Marine Mammal Center and other research organizations beginning in the 1980s regarding the incidence and transmission of diseases in harbor seals in the wild, including analysis of phocine herpesvirus.[13] In the San Francisco Bay, some harbor seals are fully or partially reddish in color, possibly caused by an accumulation of trace elements such as iron or selenium in the ocean, or a change in the hair follicles.

See also

References

  1. ^ a b c Thompson, D. & Härkönen, T. (2008). Phoca vitulina. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 January 2009.
  2. ^ Linnæus, Carl (1758) (in Latin). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (10 ed.). Holmiæ (Stockholm): Laurentius Salvius. p. 38. http://www.biodiversitylibrary.org/item/80764#page/48/mode/1up. Retrieved 23 November 2012.
  3. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5.
  4. ^ Bjørge, A.; Øien, N., Hartvedt, S.,Bøthum, G. and Bekkby, T. (2002). "Dispersal and bycatch mortality in grey, Halichoerus grypys, and harbour, Phoca vitulina, seals tagged at the Norwegian coast.". Mar. Mamm. Sci. 18: 963–976. 
  5. ^ Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
  6. ^ Burns, J. J. 2002. Harbor seal and spotted seal Phoca vitulina and P. largha. In: W. F. Perrin, B. Wursig and J. G. M. Thewissen (eds), Encyclopedia of Marine Mammals, pp. 552–560. Academic Press.
  7. ^ "Harbour seal kills and eats duck", Tetrapod Zoology, 6 march 2008
  8. ^ Temte, J. L. 1994. "Photoperiod control of birth timing in harbour seal (Phoca vitulina)". Journal of Zoology (London) 233: 369–384.
  9. ^ Van Parijs, S. M. and Kovacs, K. M. 2002. "In-air and underwater vocalizations of eastern Canadian harbour seals, Phoca vitulina". Canadian Journal of Zoology 80: 1173–1179.
  10. ^ Patrick Sullivan, Gary Deghi and C.Michael Hogan, Harbor Seal Study for Strawberry Spit, Marin County, California, Earth Metrics file reference 10323, BCDC and County of Marin, January 23, 1989.
  11. ^ Reder, S., Lydersen, C., Arnold, W. and Kovacs, K. M. 2003. "Haulout behaviour of High Arctic harbour seals (Phoca vitulina vitulina) in Svalbard, Norway". Polar Biology 27: 6–16.
  12. ^ T.C. Newby, Pacific Harbor Seal, pp 184–191 in D. Haley, ed. Marine Mammals of Eastern North Pacific and Arctic Waters, Pacific Search Press, Seattle WA (1978)
  13. ^ Goldstein, T., Mazet, J.A.K., Gulland, F.M.D., Rowles, T., Harvey, J.T., Allen, S.G., King, D.P., Aldridge, B.M., Stott, J.L., "The transmission of phocine herpesvirus-1 in rehabilitating and free-ranging Pacific harbor seals (Phoca vitulina) in California", Veterinary Microbiology 103:131–141 (2004)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Phoca largha has been treated as conspecific with P. vitulina by some authors; recent accounts generally have regarded vitulina and largha as separate species (e.g., Reeves et al. 1992; Wozencraft, in Wilson and Reeder 1993, 2005; Rice 1998, Baker et al. 2003). This is supported by limited mtDNA data (Mouchaty et al. 1995).

Two subspecies have been recognized in the North Pacific (richardsi in east, stejnegeri in west [stejnegeri sometimes has been placed in Phoca largha]); populations on the Kuril Islands formerly were regarded as a subspecies, P. v. kurilensis. However, Reeves et al. (1992) stated that variation in North Pacific harbor seals may be regarded more realistically as a single trans-Pacific cline. Additionally, mtDNA and nuclear DNA data (Lamont et al. 1996, Burg et al. 1999) indicate the existence of at least three populations of harbor seals in the Pacific, as follows: (1) Japan, Russia, Alaska, and northern British Columbia, (2) southern British Columbia and Puget Sound, and (3) outer coasts of Washington, Oregon, and California. The data do not support the existence of the two nominal subspecies in the Pacific Ocean.

A phylogenetic analysis using mtDNA data revealed extensive macrogeographic subdivision among a subset of grouped localities that represent centers of harbor seal abundance along a distributional continuum from Japan to Alaska (Westlake and O'Corry-Crowe 2002). "Heterogeneity was influenced by population size and correlated with geographic distance, suggesting that dispersal occurs primarily among neighboring subpopulations. The two currently recognized subspecies of harbor seal in the Pacific, P. v. richardii of North America and P. v. stejnegeri of Asia, do not represent phylogenetically discrete mtDNA assemblages. The greatest differentiation detected was along the Commander-Aleutian Island chain, the region of the presumed subspecies boundary and a likely contact zone for expanding refugial populations of a number of marine mammal species after retreat of ice sheets. Differentiation between the Kodiak Archipelago and Prince William Sound, and between Bristol Bay and the Pribilof Islands, indicates that current management stocks are inappropriate and highlights the need for a detailed analysis of population and stock structure in Alaska."

North Atlantic populations are represented by subspecies concolor (west) and vitulina (east, including Iceland); nominal subspecies mellonae, from the Seal Lakes region of Quebec's Ungava Peninsula, was based on a small sample size and has not gained wide support (Reeves et al. 1992; but see Smith 1997).

Taxonomic separation of Atlantic and Pacific harbor seals is based on disjunct distributions rather than on morphological evidence (Reeves et al. 1992). In summary, current subspecies taxonomy should be regarded as of questionable significance, though regional studies of morphology and reproductive biology have suggested minimal genetic interchange among local populations (Bigg 1969, 1981, Shaughnessy and Fay 1977, Calambokidis et al. 1978, Pitcher and Calkins 1979, Kelly 1981, Burns and Gol'tsev 1984, Burns et al. 1984).

A cladistic analysis of mtDNA data yielded three clades among northern seals: Phoca-Pusa-Halichoerus, Cystophora-Pagophilus, and Erignathus (Perry et al. 1995). Each clade may be regarded as a tribe of the subfamily Phocinae. The magnitude of the differences among Phoca, Pusa, and Halichoerus was on the same order as that between species and subspecies within the genus Odocoileus. Because Cystophora is the closest relative of Pagophilus, the latter cannot be regarded as congeneric with Phoca; the differences between the two are great enough to justify placing them in separate genera (Perry et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!