Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Spotted Seals breed in isolated pairs rather than large groups. They congregate in breeding areas, but each pair keeps its distance. This type of breeding system, in which the male breeds with one female and stays with her and the pup until the pup is weaned, is rare among seals. Eight such breeding areas are known along the southern edge of the pack ice. Young seals suffer a high mortality rate. About 45 percent die in the first year of life, many due to predation by sharks, killer whales, walruses, polar bears, arctic foxes, eagles, ravens, and gulls.

Links:
Mammal Species of the World
  • Original description: Pallas, P.S., 1811.  Zoographia Rosso-Asiatica, 1:113.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

An Ice seal of the North Pacific to the Chukchi Sea
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Silver sides, darker back; Dark irregular spots on back and sides
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Spotted seals are found in the Sea of Okhotsk and the Sea of Japan and reach China in the northern Yellow and Bohai Seas. They are widespread in the Bering and Chukchi Seas and range north into the Arctic Ocean to about the edge of the continental shelf, west to about 170°E longitude and east to the Mackenzie River Delta in Canada (Shaughnessey and Fay 1977, Quakenbush 1988). They inhabit the southern edge of the pack ice from winter to early summer. In late summer and fall, spotted seals move into coastal areas, including river mouths. They breed mostly on sea ice and haul-out on sea ice when it is available, but they also haul out on beaches and sandbars (Burns 1970, Lowry et al. 1998, 2000). There are several sites along Asian coast where spotted seal breed on small remote islands (e.g., in Peter the Great Gulf, the Kuril Islands, and small islands along east coast of Kamchatka) (Burkanov 1988, 1990, Trukhin and Katin 2001, Kostenko et al. 2004, Vertyankin and Nikulin 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Spotted seals are commonly found along the continental shelves of the North Pacific Ocean and Bering Sea. They are also found on the ice flows of the Beaufort, Chukchi, and Okhotsk Seas, where breeding mainly occurs. They migrate as far south as the northern parts of the Huanghai, and the western Sea of Japan.

Biogeographic Regions: arctic ocean (Native ); pacific ocean (Native )

  • Lowry, L., K. Frost, R. Davis, R. Suydam, D. Demaster. 1994. Movements and behavior of satellite - tagged spotted seals in the Bering and Chukchi Seas. NOAA Technical Memo, U. S. Department of Commerce.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Bering Sea, Japan, Sea of Okhotsk, Yellow Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Po Hai Sea, coastal waters of Korea, Sea of Japan, coastal waters of Hokkaido and Honshu, Sea of Okhotsk, Kamchatka, Commander Islands, Bering Sea, Chukchi Sea, eastern Aleutian Islands. In Alaska, breeds in southeastern Bering Sea. In the Bering Sea, the greatest densities occur in winter in spring within approximatelly 25 km of the irregular and shifting southern margin (front) of the pack ice, where breeding and birthing occur (Reeves et al. 1992). Central Bering Sea stock occurs in winter and spring south of Cape Navarin to St. Matthew Island, dispersing into Anadyr Gulf. Eastern Bering Sea stock is centered in the southeastern Bering Sea from the Pribilofs to outer Bristol Bay and disperses northward through Bering Strait and along the shores of the Chukchi Sea. About 2000 occupy Kasegaluk Lagoon near Point Lay, Alaska, from July to freeze-up each year (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Spotted seals are intermediate sized phocid seals. Males measure from 1.5 to 2.1 meters in total length and females from 1.4 to 1.7 meters. Males weigh from 85 to 150 kg and females from 65 to 115 kg. Average sizes vary among populations. As their name suggests, spotted seals have characteristic markings of dark irregular spots on a lighter background. Like all pinnipeds, they have no external ears. Instead, only a small ear opening behind the eyes is visible. The furred hind flippers are short and extend behind their body to provide thrust when swimming. The smaller, front flippers act mainly as rudders and help with movement on land or ice. Each of the five digits on the front limbs has a claw, which also helps with short distance travel on land. The fur is dense, but spotted seals rely on a heavy layer of blubber to keep them warm.

Range mass: 65 to 150 kg.

Range length: 1.4 to 2.1 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Lowry, L. 1984. The spotted seal. Alaska Dep. Fish and Game marine mammal species accounts, Vol. 1. Juneau, Alaska.: Pp. 1 - 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 170 cm

Weight: 136 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 1.4-1.7 m

Weight:
Range: 81-109 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Phoca largha
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): L. Stejneger
Year Collected: 1896
Locality: Avatcha Bay, Kamchatka, Russia, Bering Sea, Asia, North Pacific Ocean
  • Type: Allen, J. A. 1902. Bulletin of the American Museum of Natural History. 16: 483.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Phoca largha
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull; Skeleton
Collector(s): C. Townsend
Locality: St. Paul Island, Pribilof Islands, Alaska, United States, Bering Sea, North America, North Pacific Ocean
  • Type: Allen, J. A. 1902. Bulletin of the American Museum of Natural History. 16: 495.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adult spotted seals are generally 1.5-1.7 m long and weigh 70-130 kg with little difference between the sexes (Bigg 1981).

In spring, spotted seals give birth to a single pup, mostly on the surface of sea ice but sometimes on land. Pups are born in a white lanugo coat that is shed at or before weaning which occurs about four weeks after birth. Mating occurs after pups are weaned. Spotted seals are annually monogamous and males defend lactating females on ice floes, and groups composed of a female with her pup and a male, called triads, are common during the breeding season (Quakenbush 1988).

In late-spring and summer many spotted seals leave the sea ice and haul-out on land to rest when they are not foraging. On some haulouts in Kamchatka the number of animals on shore may reach over 10,000 individuals (V. Burkanov pers. comm.). As sea ice reforms in October-November spotted seals again use the ice as their primary feeding and resting habitat (Burkanov 1990, Lowry et al. 1998, 2000). They are generalist feeders that take primarily a variety of fish species (walleye pollock, Arctic and saffron cod, rockfish, herring, sand lance, smelt, capelin, eelpout, salmonids and flounders), cephalopods (squid and octopus) and crustaceans (shrimp and crab) (Quakenbush 1988, Burkanov 1990).

Reported predators include Pacific sleeper sharks, killer whales, golden eagles, Steller’s sea eagles, ravens, gulls, polar and brown bears, wolves, Arctic foxes, walruses and Steller sea lions (Quakenbush 1988).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Spotted seals are strongly associated with sea ice from fall until late in the spring when they gather among the remaining ice packs. They gather on land when no ice is available.

Range depth: 100 (high) m.

Average depth: 30 m.

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Littoral distribution in summer when shorefast ice has melted. Occurs in estuaries and embayments in late summer and fall. Offshore along edge of ice pack in winter; rarely more than 100 km from pack ice edge. Rests ashore on tide exposed rocks and (in winter) on ice floes. During open-water season, often hauls out on sandbars and beaches. Young are born on ice, where they remain until they are weaned at three to four weeks of age (Perry, in Wilson and Ruff 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central and western North Atlantic-Arctic; Associated with edge of pack ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates between summer littoral habitat and offshore winter habitat along edge of ice pack; compass direction and timing of migration varies regionally (Bigg 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of spotted seals includes crustaceans, cephalopods, and fish (herring, capelin, cod, and especially pollock). Spotted seals can make vast feeding trips of hundreds of miles from the Chukchi Sea coast to the western Chukchi Sea, then returning.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Young eats mainly small crustaceans, including amphipods, shrimps, and euphausiids. Older seals feed opportunistically on various fishes (e.g., walleye pollock, capelin, arctic cod, saffron cod, sand lance, herring, and rainbow smelt), and some cephalopods and crustaceans. Feeds during day; occurrence of night feeding uncertain. (Bigg 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Schooling fish, epibenthic fish, crabs, cephalopods
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Smaller seals feed mostly on small pollock (Theragra chalcogramma) while older seals also feed on larger fishes. Seal predation may affect pollock stocks, as well as those of other prey animals, but their effect may be complex and is not well understood.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

When threatened by terrestrial predators, spotted seals take to the water in groups. They swim in flocks, like birds, turning, and twisting as a group in the water. Known predators of spotted seals include sharks, killer whales, walruses, Steller sea lions, polar bears, brown bears, wolves, foxes, and some large birds.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Phoca largha preys on:
non-insect arthropods
Actinopterygii
Mollusca
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Bering-Chukchi population probably is at least 200,000; Sea of Okhotsk population perhaps 130,000 (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Generally solitary in water but forms small groups when ashore (nonbreeding season). All ages congregate for molt after breeding.

Greatest densities occur along the southern edge of the pack ice in the pupping and mating season of late winter and spring. Family groups consisting of an adult female, adult male, and pup are spaced about 200 meters apart (Perry, in Wilson and Ruff 1999).

Taken by various predators, but none of these is known to be a significant influence on population size.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Size at birth 0.8-1m (2.5-3.3 ft), 8kg (20 lbs); Sexual maturity at 3-5 years; Females have pups every year; Longevity 30-35 years; Behavior; Seasonally ice associated; Gregarious outside breeding season; Poorly known compared to other seals
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Spotted seals can live to at least 35 years, most average 25 years in the wild. Approximately 45% of all pups die before their first year of age.

Range lifespan

Status: wild:
35 (high) years.

Average lifespan

Status: wild:
25 years.

Average lifespan

Status: wild:
32.0 years.

Average lifespan

Status: wild:
35.0 years.

Average lifespan

Sex: female

Status: wild:
32.0 years.

Average lifespan

Sex: male

Status: wild:
29.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, these animals are believed to live up to 35 years (Bernhard Grzimek 1990). Their longevity in captivity has not been studied in detail, but one specimen lived 33.6 years (Richard Weigl 2005). More detailed studies are necessary to determine the maximum longevity of this species. Previously classified as *Phoca vitulina largha*.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Breeding takes place in the spring. Breeding pairs meet about 10 days before the pregnancy of the last season reaches term, then mate underwater.

Implantation of the embryo is delayed until after the current year's pup is born. Spotted seal pups are born between early April and early May. The peak of the pupping season is in the first part of April. Newborns weigh between 7 to 12 kg, and measure from 75 to 90 cm in length. Pups are born with a dense coat of whitish hair that provides insulation until blubber is developed, this fur is shed by 4 to 5 weeks of age, the time at which pups are weaned. Pups can swim if forced to, but prefer not to until the time of weaning, at which time they can dive to depths of over 300 meters to feed. Sexual maturity is reached at 3 to 4 years of age in females, 4 to 5 years of age in males.

Breeding season: Most breeding occurs in early April.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 7 to 12 months.

Average gestation period: 12 months.

Range weaning age: 3 to 4 weeks.

Range time to independence: 3 to 4 weeks.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 7100 g.

Average number of offspring: 1.

Females nurse and care for their young until they are weaned at 4 to 5 weeks of age.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Lowry, L. 1984. The spotted seal. Alaska Dep. Fish and Game marine mammal species accounts, Vol. 1. Juneau, Alaska.: Pp. 1 - 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pairs form about 10 days before pupping, stay together (and away from other pairs) until mating about 1 month later. Gestation lasts 10.5 months, including a period of 1.5-4 months of delayed implantation. In Alaska, most births occur late March to mid-May. In Japan, births occur from late January to mid-April, with a peak in the second half of March. Lactation lasts 2-6 weeks (estimated at 2-3 weeks in Japan). Females sexually mature at 3-4 years, males at 4-5 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phoca largha

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0248-06|AY377147|Phoca largha| AATCGATGGTTATTTTCCACAAATCATAAGGATATTGGCACTCTTTATTTGCTGTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTC---AGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATTGTCACCGCCCATGCATTCGTAATAATTTTCTTCATGGTAATGCCCATCATAATTGGCGGCTTTGGGAACTGACTAGTGCCCCTAATA---ATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTCTGACTTTTACCACCGTCCTTCCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGGACCGGGTGAACCGTTTATCCTCCTCTAGCTGGGAACCTAGCTCATGCAGGAGCCTCTGTAGATCTA---ACAATTTTCTCCCTCCACTTGGCAGGTGTATCATCTATTCTTGGAGCTATCAACTTCATCACCACCATTATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTATGATCCGTACTAATCACGGCGGTGCTCCTACTATTATCGCTACCAGTCCTAGCAGCT---GGCATCACCATGCTACTCACAGACCGAAACCTGAATACAACATTCTTCGACCCTGCTGGAGGAGGTGATCCTATCCTGTATCAACATCTGTTCTGATTCTTCGGACATCCCGAGGTGTATATTCTAATCCTACCAGGATTCGGAATAATCTCACACATCGTTACCTACTATTCAGGAAAAAAA---GAACCTTTTGGTTATATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTCATTGTATGAGCCCACCATATATTCACTGTAGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phoca largha

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lowry, L. & Burkanov, V. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
The Spotted Seal is moderately abundant, but it faces numerous threats and several major subpopulations have declined in recent years. The global number of Spotted Seals is not known, nor is the extent of the current declines. Given the risk posed by climate change and the uncertainty regarding the status of this species – it should be classified as Data Deficient.

IUCN Evaluation of the Spotted Seal, Phoca largha
Prepared by the Pinniped Specialist Group

A. Population reduction
Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Age-structure data are not available for the Spotted Seal population so the generation time cannot be calculated precisely. With sexual maturity attained at 3-5 years of age and a maximum longevity of approximately 35 years, the average age of reproducing individuals should be at least 10 years. A population reduction of Sotted Seals has not been observed, estimated, inferred, or suspected in the past 30 years. However, population abundance is poorly known and has not been monitored.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of spotted seals has not been observed, estimated, inferred, or suspected in the past 30 years.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of Spotted Seals is suspected in the future because of predicted reduction in sea ice habitats due to continued climate warming. The likely amount of population reduction has not been projected, but could exceed 30% within the next 30 years. This meets the criterion for Vulnerable.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Spotted Seals has not been observed, estimated, inferred, or suspected in the past 30 years.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
The EOO of Spotted Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Spotted Seals is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The current abundance of Spotted Seals is poorly known, but the number of mature individuals is certainly > 10,000.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii)
% individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The current abundance of Spotted Seals is poorly known, but the number of mature individuals is certainly > 1,000. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction for Spotted Seals.

Listing recommendationPast, poorly documented, estimates of Spotted Seal abundance suggest a total population size of perhaps 400,000. Based on reports from coastal Alaskan hunters, Spotted Seals are still numerous and no major changes in abundance have been reported. However, climate warming and reduction in sea ice coverage are occurring, and because most Spotted Seals depend on sea ice for reproduction that will likely result in a population decline. Current abundance and population trend are unknown, and thus the Spotted Seal must be classified as Data Deficient at this time.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Spotted seals are not considered endangered. Populations of spotted seals have remained relatively stable in the territorial waters of the North American continent countries due to conservation efforts. Activities such as those related to oil, gas, coal, and mineral resource development need to be regulated to reduce potential impacts on important spotted seal habitats. In China, spotted seals are listed as a nationally endangered animal.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: data deficient

  • Quackenbush, L. 1988. Spotted seal. Pp. 107 -124 in J Lentfer (ed.), ed. Selected marine mammals of Alaska. Species accounts with research and management recommendations. Washington, D. C.: Marine Mammal Commission.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The abundance of spotted seals has never been well quantified. Poorly documented estimates suggest a total population size in the 1970s of perhaps 400,000, with 200-250,000 in the Bering-Chukchi Seas and perhaps 170,000 in the Okhotsk Sea (Bigg 1981, Quakenbush 1988). Mizuno et al. (2002) flew aerial line-transect surveys of a portion of the pack ice in the southern Okhotsk Sea in March 2000 and estimated there were 13,653 spotted seals in their 25,000 km² survey. There is no reliable estimate of the current total population size (Angliss and Outlaw 2007).

Female spotted seals become sexually mature at 3-4 years old and males at 4-5 years. Maximum longevity is at least 35 years (Quakenbush 1988).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: World population is regarded as essentially stable (Reeves et al. 1992). Total population probably near historical level (Bigg 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Subsistence hunting of spotted seals has no doubt occurred since humans first made contact with the species and they remain an important subsistence resource for coastal Natives in western Alaska (Quakenbush 1988). From the 1960s through the 1980s, the Soviet Union harvested several thousand spotted seals each year in both the Okhotsk and Bering seas, mostly from large commercial vessels (Heptner 1996). Commercial harvesting of this species no longer occurs in Russia.

Intensive harvesting of fish in the Okhotsk and Bering seas poses a risk to spotted seals as several of their main prey species are targets of commercial fisheries (Lowry and Frost 1985). Entanglement in commercial fisheries occurs occasionally in Japan and in the Sea of Okhotsk and Bering Sea and small organized control kills to limit damage to fisheries regularly occur in Japan (Mizuno et al. 2001, Angliss and Outlaw 2007). In Kamchatka, spotted seals sometimes eat fish out of fishing gear and fishermen shoot small numbers in local areas to defend their landings and protect their equipment (V. Burkanov pers. comm.).

Oil and gas development may cause disturbance to and adversely affect the habitat used by the spotted seals (Reijnders et al. 1993). Oil contamination poses poorly known risks to spotted seal populations. The greatest impacts would likely result if spills occurred during the pupping season, if food resources were negatively effected or if the spill was an event that affected a large area (St Aubin 1990). There is little information on contaminant burdens in this species, but concern would be greatest for animals living in the western part of the range where they occur near large population and industrial areas in China, Korea and Japan and in the Sea of Okhotsk.

Reduction in late winter and spring sea ice cover in the Sea of Okhotsk and the central and southern Bering Sea as a result of global climate change could be problematic for spotted seals as the majority of the population uses pack ice at the southern limit of the ice extent for pupping (Tynan and DeMaster 1997). Changes to ice characteristics that effect its location, timing, stability, etc. could result in lower survival of spotted seal pups. Disruption or alteration of the patterns of primary productivity and abundance of key prey species could also have detrimental effects on ice dependent seals like the spotted seal (Tynan and DeMaster 1997; Laidre et al., in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Intensive commercial fisheries for pandalid shrimps, pollock, and herring in the southern Bering Sea may threaten seals' food supply. Oil and gas exploration, extraction, and transport activities under way or scheduled in portions of winter range may impact seals or their food resources (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the United States the spotted seal is generally protected from all but subsistence hunting by Alaska Natives by the Marine Mammal Protection Act of 1972, which also generally prohibits import and export of parts or products from all marine mammals.

Commercial harvesting of spotted seals from vessels of the Russian Federation ended in 1994. Small scale commercial and subsistence harvest from small boats and land occurs along the Russian Far East coast, but the size of the harvest is relatively small (V. Burkanov pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Separate western, central, and eastern stocks have been proposed for management in the Bering Sea (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Spotted seals are known to raid fishing nets, if the opportunity arises.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Spotted seals are an important species for the native Eskimo subsistence hunter, who use every bit of the animal for food, clothes, fuel, and for other purposes. Spotted seal pups may be hunted for their fur.

Positive Impacts: food ; body parts are source of valuable material

  • Wolfe, R., C. Mishler. 1996. The subsistence harvest of harbor seal and sea lion by Alaska natives in 1995. Draft final report for year four, subsistence study and monitor system. Prepared for NMFS by Alaska Dept. Fish and Game, Juneau, Alaska.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: A few thousand to several thousand are harvested annually by "Soviet" hunters, to feed animals in fur farms; lately, nearly all of the harvest was made from ships in the Bering Sea. Japanese harvest formerly was more extensive, now occurs only when pack ice approaches coast of Hokkaido. A small subsistence harvest occurs in Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spotted seal

The spotted seal (Phoca largha), also known as the larga or largha seal, is a member of the family Phocidae, and is considered a "true seal". It inhabits ice floes and waters of the north Pacific Ocean and adjacent seas. It is primarily found along the continental shelf of the Beaufort, Chukchi, Bering and Okhotsk Seas[2] and south to the northern Yellow Sea and it migrates south as far as northern Huanghai and the western Sea of Japan. It is also found in Alaska from the southeastern Bristol Bay to Demarcation Point during the ice-free seasons of summer and autumn when spotted seals mate and have pups. Smaller numbers are found in the Beaufort Sea.[3] It is sometimes mistaken for the harbor seal to which it is closely related and spotted seals and harbor seals often mingle together in areas where their habitats overlap.[4]

The reduction in arctic ice floes due to global warming led to concerns that the spotted seal was threatened with extinction. Studies were conducted on its population numbers, with the conclusion, as of October 15, 2009, that the spotted seal population in Alaskan waters is not currently to be listed as endangered by NOAA.[5]

Contents

Etymology

The scientific name originated in the Greek word for seal, phoce, and larga, the term used by the Siberian Tungus people for this seal. The English common name is comes from this seal's characteristic dark, irregularly shaped spots. Alaskan Eskimo names include issuriq (Central Alaskan Yup'ik language), gazigyaq in St. Lawrence Island Yupik, and qasigiaq in Inupiaq.[3]

Habitat

Spotted seal distribution in Bering Sea and surrounding areas

Spotted seals are inhabitants arctic or sub-arctic waters, often in the outer areas of ice floes during the breeding season. They tend not to live within dense drift ice. In the summer months they locate in the open ocean or on nearby shores.[6]

Spotted seals are separated into three populations. The Bering Sea population includes approximately 100,000 in the western Bering Sea near Kamchatka, in the Gulf of Anadyr in Russia, and in the eastern Bering Sea in Alaskan waters (the only population in the US). A second population of about 100,000 seals breeds in the Sea of Japan and the Sea of Okhotsk. A third population of about 3,300 seals is to the south in Liaodong Bay, China and Peter the Great Bay, Russia.[6] There is also a smaller population of 300 grey spotted seals living in waters off Baekryeong Island located far north of the west coast of South Korea.

Physical description

Spotted seal showing narrow snout like that of a dog[3]

The spotted seal is of the family, Phocidae, or "true seals". Compared to other true seals, they are intermediate in size, with mature adults of both sexes generally weighing between 180 to 240 pounds (81 to 109 kg) and measuring 4.59 to 6.89 ft (1.5 to 2.1 meters), roughly the same size as a harbor seal or ribbon seal. The head of a spotted seal is round, with a narrow snout resembling that of a dog.[3]

The spotted seal has a relatively small body and short flippers extending behind the body that provide thrust, while the small flippers in front act as rudders. The dense fur varies in color from silver to gray and white and is characterized by dark, irregular spots against the lighter background and covering the entire body. Males and females differ little in size or shape. In places where their habitat overlaps with that of the harbor seal, they can be confused with them, as in Bristol Bay, Alaska. Like harbor seals, spotted seals have 34 teeth.[3][6]

Behavior and reproduction

Spotted seals are relatively shy and are difficult for humans to approach. They can be solitary in general but are gregarious and form large groups during pupping and molting seasons when they haul out on ice floes or, lacking ice, on land. The numerically largest groups in Alaska are at Kasegaluk Lagoon in the Chukchi Sea, near Cape Espenburg in Kotzebue Sound, and in Kuskokwim Bay on sandbars and shoals, where several thousand may collect.[3]

Sexual maturity is attained around the age of four. January to mid-April is the breeding season. Pup births peak in mid-March. Spotted seals are believed annually monogamous, and during breeding season, they form "families" made up of a male, female, and their pup, born after a 10 month gestation period. Average birth size is 3 ft (1 m) and 26 lbs.[7] Pups are weaned six weeks later. The maximum lifespan of the spotted seal is 35 years with few living beyond 25.[6][7]

Spotted seals dive to depths up to 1,000 ft (300 m) while feeding on a variety of ocean prey. Juveniles eat primarily krill and small crustaceans while adults eat a variety of fish including herring, arctic cod, pollock, and capelin.[3] They do not seem to vocalize a lot, although not much is known about their vocalizations. They appear to vocalize more while in molting groups. When approached in these groups, they make various sounds such as growls, barks, moans, and roars.[3]

Conservation status

On March 28, 2008, the U.S. National Oceanic and Atmospheric Administration (NOAA) initiated a status review[8] under the Endangered Species Act (ESA) to determine if listing this ice seal species under the ESA was warranted. After an 18-month review of the status of the spotted seal, NOAA announced on October 15, 2009 that two of the three spotted seal populations, together numbering 200,000 seals in or adjacent to Alaska, are not in danger of becoming extinct, nor are they likely to become so in the "foreseeable future",[5] even though global warming has caused a loss in arctic ice mass. The announcement stated: "We do not predict the expected fluctuations in sea ice will affect them enough to warrant listing at this time."[9]
In South Korea, spotted seals have been designated Natural Monument No. 331 and second-class endangered species. This is because the seals from South Korea travel to Dalian, China to breed every year where several thousands are harvested for their genitals and sealskin to be sold on the black market for Chinese medicine. An environmental activist group Green Korea United is currently working closely with local Chinese government to stop the seals from being poached by Chinese fishermen.[10]

The three seal siblings have been named mascots for the 2014 Incheon Asian Games.[11]

References

  1. ^ Lowry, L. & Burkanov, V. (2008). Phoca largha. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 January 2009.
  2. ^ Peter Saundry. 2010. Spotted seal. Encyclopedia of Earth. topic ed. C.Michael Hogan. ed in chief C. Cleveland, National Council for Science and the Environment, Washington DC
  3. ^ a b c d e f g h Burns, John J.. "Spotted Seal: Wildlife Notebook Series – Alaska Department of Fish and Game". www.adfg.state.ak.us. http://www.adfg.state.ak.us/pubs/notebook/marine/spt-seal.php. Retrieved 2009-10-15. 
  4. ^ "National Marine Mammal Laboratory". www.afsc.noaa.gov. http://www.afsc.noaa.gov/nmml/species/species_spotted.php. Retrieved 2009-10-16. 
  5. ^ a b "NOAA – National Oceanic and Atmospheric Administration – NOAA Will Not List Bering Spotted Seal as Endangered or Threatened". www.noaanews.noaa.gov. http://www.noaanews.noaa.gov/stories2009/20091015_spottedseal.html. Retrieved 2009-10-15. 
  6. ^ a b c d "Spotted Seal (Phoca largha) – Office of Protected Resources – NOAA Fisheries". www.nmfs.noaa.gov. http://www.nmfs.noaa.gov/pr/species/mammals/pinnipeds/spottedseal.htm. Retrieved 2009-10-15. 
  7. ^ a b Wynne, Kate. "Spotted (Largha) Seal". seagrant.uaf.edu. http://seagrant.uaf.edu/marine-ed/mm/fieldguide/spotted-seal.html. Retrieved 2009-10-16. 
  8. ^ "Marine Mammals; Advance Notice of Proposed Rulemaking". Federal Register /Vol. 73, No. 61 / Friday, March 28, 2008. http://www.nmfs.noaa.gov/pr/pdfs/fr/fr73-16617-ribbonseal.pdf. Retrieved 2009-10-16. 
  9. ^ Joling, Dan. "Feds deny protection for spotted seals near Alaska – Yahoo! News". The Seatle Times. http://seattletimes.nwsource.com/html/nationworld/2010072822_apusspottedseals.html. Retrieved 2009-10-16. 
  10. ^ Green Korea United :: Poaching for 1000 Spotted Seals, Wailing of Spotted Seals. Green-korea.tistory.com. Retrieved on 2011-09-15.
  11. ^ Kbs News. News.kbs.co.kr (2011-05-24). Retrieved on 2011-09-15.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Phoca largha has been treated as conspecific with P. vitulina by some authors; recent accounts generally have regarded vitulina and largha as separate species (e.g., Reeves et al. 1992; Wozencraft, in Wilson and Reeder 1993, 2005; Rice 1998, Baker et al. 2003). This is supported by limited mtDNA data (Mouchaty et al. 1995). See Bigg (1981) for a brief discussion of taxonomy.

A cladistic analysis of mtDNA data yielded three clades among northern seals: Phoca-Pusa-Halichoerus, Cystophora-Pagophilus, and Erignathus (Perry et al. 1995). Each clade may be regarded as a tribe of the subfamily Phocinae. The magnitude of the differences among Phoca, Pusa, and Halichoerus was on the same order as that between species and subspecies within the genus Odocoileus. Because Cystophora is the closest relative of Pagophilus, the latter cannot be regarded as congeneric with Phoca; the differences between the two are great enough to justify placing them in separate genera (Perry et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!