Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"Both male and female walruses have tusks, upper canine teeth that continue to grow throughout their lives. Males' tusks are larger and are used for display and as weapons, usually in competition with other males. Walruses occupy the continental shelf rather than deep water, feeding at depths no greater than 100 m. They eat a large variety of bottom-dwelling invertebrates, from tiny crustaceans to octopuses and large crabs. Walruses breed deep in the Arctic pack ice during the darkness of winter. Females begin breeding at 6-7 years of age, and have just one calf after a long, almost 15-month pregnancy. Males are sexually mature at about 9-10 years, but may not be successful in competing for mates until they are about 15 years old. Humans have exploited walruses for years for their ivory tusks, and also for meat, oil, and hides. Their only other predators are polar bears and killer whales, which mostly take the young."

Adaptation: Most parts of the skull of the Walrus, Odobenus rosmarus, have evolved to accommodate the enormous, heavy tusks. This includes not only the facial bones, which root them and basically make up the whole snout, but also the back of the skull, where the prominent flange of bone in the area of the ear is an attachment site for the major muscles that move this massive head around.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. p. 38. Tenth Edition, Vol. 1. Laurentii Salvii, Stockholm, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Description

 The warus Odobenus rosmarus is the only member of its family and is very easily identified. Like seals, walruses have both pectoral flippers and tail flippers as well as a muzzle with long whiskers. The walrus differs by having a broad muzzle with the whiskers on the front end, and by having two large tusks up to 1 m in length. The walrus is a large and bulky species reaching up to 3.6 m in length. Its skin is notably thick, rough and creased. It has small 'bloodshot' eyes. The tail end is enclosed in a web of skin. Most walruses are grey to cinnamon-brown in colour, becoming paler with age. The skin becomes flushed with blood when warm and they acquire a rosy red colouration.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

A massive circumpolar pinniped with large tusks
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gray-brown to cinnamon brown and sometimes pink; Robust, large body with Tusks
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Walruses have a discontinuous circumpolar Arctic and sub-Arctic distribution (Fay 1981, Rice 1998). The Pacific subspecies is normally found from the Bering and Chukchi Seas to the Laptev Sea in the west and the western Beaufort Sea in the east, with vagrants south into the North Pacific Ocean to Japan and to southcentral Alaska (Fay 1982). The Atlantic subspecies occurs in numerous subpopulations from the eastern Canadian Arctic and Greenland to the western Kara Sea, including the Barents, White and Pechora Seas, and Svalbard and Franz Josef Land (Committee on the Status of Endangered Wildlife in Canada 2006, North Atlantic Marine Mammal Commission, undated). Historically, Atlantic walruses occurred south to the Gulf of St Lawrence in the northwestern North Atlantic. Vagrants have been reported from New England, Iceland and in western Europe south to the Bay of Biscay. All subspecies of Walruses are found in relatively shallow continental shelf areas and seldom occur in deeper waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Walruses occupy a nearly circumpolar region of the Arctic. Three distinct subspecific populations are recognized: 1) Atlantic (Odobenus rosmarus rosmarus), which lives in the eastern Canadian Arctic and Greenland east to Novaya Zemlya; 2) Pacific (O. r. divergens), living in the Bering Sea and adjacent Arctic Ocean; 3) Laptev Sea (O. r. laptevi), occupying the Laptev Sea, north of Siberia. Some taxonomists do not recognize the Laptev Sea population as a separate subspecies. Unless otherwise specified, all walruses will be treated here as one population, Odobenus rosmarus (Jefferson et al. 1993; Nowak 1991; Parker 1990).

Biogeographic Regions: arctic ocean (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

circumpolar in the Arctic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Belgian Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Irish Exclusive economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Genus Odobenus has a discontinuous distribution throughout arctic waters of the Northern Hemisphere. Atlantic walruses range from Foxe Basin, Hudson Bay, James Bay, and Labrador in the eastern Canadian Arctic to Greenland and east to Kara Sea and Franz Josef Land. Pacific walruses are found in the Beaufort, Chukchi, and Bering Seas. A population found in the Laptev Sea in the central Russian Arctic, generally considered to be Pacific walrus, is thought by some Russian researchers to be a separate subspecies entirely: O. r. laptevi.

In winter, Pacific walruses occur in the Bering Sea, mainly between eastern Bristol Bay and an area southwest of St. Lawrence Island, and in the Gulf of Anadyr. In summer, most females and young occur in the Chukchi Sea (Point Barrow west to the mouth of the Kolyma River on the East Siberian Sea) and around the Diomede Islands, King Island, and Arakamchechen Island. When summer ice is light, large numbers haul out on shores of Wrangel and Herald islands and at traditional sites along the northern Chukchi Peninsula; in years of heavy summer ice, they generally remain associated with sea ice and do not come ashore in large numbers. During the southward fall migration, large groups haul out at Big Diomede Island and the Punuk Islands and at some coastal sites on the Siberian mainland. In summer, most males are found in the Bering Sea; many (at least 12,000) males summer on or near Round Island, in northern Bristol Bay, and another several thousand summer in the Gulf of Anadyr and in the Bering Strait (Reeves et al. 1992).

Historical Atlantic range included the Kara, Barents, and White seas and the shores of Novaya Zemlya, Franz Josef Land, Svalbard, and Bear Island; populations are still widespread but now are much smaller. Some still migrate through Karskye Vorota Strait between winter range in southeastern Barents Sea and summer range in the Kara Sea. Formerly occurred in large numbers south to Sable Island (off Nova Scotia) and the Magdalen Islands (Gulf of St. Lawrence) but extirpated south of Labrador by early 1900s. Centers of abundance are Hudson Strait, northern Hudson Bay, northern Foxe Basin, and along portions of the coasts of Greenland, Devon Island, Ellesmere Island, and Baffin Island; relatively large numbers occur in Smith Sound, Jones Sound, and their adjacent channels and embayments. From fall to late spring, a few hundred are present off central west Greenland in the Davis Strait pack ice; some winter in high arctic polynyas such as the North Water, Hell-Gate-Cardigan Strait, and Penny Strait-Queen's Channel, but there is also a northward migration in Davis Strait and Baffin Bay and a westward migration through Lancaster Sound during spring breakup (Reeves et al. 1992).

Laptev walruses occur mainly in the Laptev Sea, the eastern Kara Sea, and the western East Siberian Sea (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The most obvious physical characteristic of the walrus is the presence of large tusks in both the male and female. These tusks, which are canines, can reach lengths of 1 meter (the average size is 50 cm), and are usually longer and heavier in the males (bulls) than in the females (cows). Accompanying the tusks are stiff beard bristles, called vibrissae, and although individual variation in length is great, the bristles can grow up to 30 cm long. The bristles are replaced yearly. In natural environments these bristles are often quite worn. Bulls are physically larger than the cows, growing to lengths of 3 m compared to 2.6 m for cows. Aside from the conspicous beards, both males and females appear almost completely bald. In fact, they are covered with short coarse hair that becomes less dense as the animal ages. Their skin, which lies in many folds and wrinkles, can be 4 cm thick. This tough skin is the thickest on the neck and shoulders of adult males. As walruses age their skin becomes paler. When the animals enter the water they become even paler as blood flow to the skin is restricted. Conversely, when walruses are warm their skin is flushed with blood and they appear to be very red, almost "sunburned." Walruses have no external ears and their eyes are small and piglike (Lawlor 1979, Nowak 1991, Parker 1990).

Range mass: 400 to 1700 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 360 cm

Weight: 1265000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females and have more prominent tusks.

Length:
Range: 2.5-3.5 m males; 2.3-3.1 m females

Weight:
Range: 590-1,656 kg males; 400-1,250 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: long tusks, stout whiskers, large size, square face, colour of skin is brown with sparse red hair. May appear white or red at times.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Walruses are one of the largest pinnipeds. In the Pacific, males reach about 3.6 m in length and weigh 880-1,557 kg; adult females are about 3 m and 580-1,039 kg. In the Atlantic adults are slightly shorter and lighter. Newborns are 1-1.4 m and weigh 33-85 kg (Fay 1981). Walrus are characterized by their large tusks, which are well-developed in both males and females. Tusks are used for interspecific aggression, defense against predators (Polar Bears and Killer Whales) and as an aid for hauling-out on ice.

Courtship and mating occur in the winter. It is believed that Walruses are polygynous and that the males establish small aquatic territories where they vigorously vocalize and display adjacent to females hauled-out on ice floes (Fay 1981).

Walruses haul out on ice floes and beaches on islands or remote stretches of mainland coastlines. They are very gregarious animals and are frequently found in tight groups that number from the tens to the thousands. Pacific Walruses spend most of their lives associated with sea ice and migrate with the ice as it expands and moves south in the winter and breaks up and retreats in the spring and summer. Males often separate from the females in late spring and during the summer they use land haulouts some distance from sea ice, while the females, their calves, and most of the juveniles follow the retreating sea ice edge north (Fay 1982). The situation is somewhat different for Atlantic Walrus, with animals of all sex/age categories using terrestrial haulouts during summer months (Born 2005). At sea, Walruses can be found alone or in aggregations.

Walruses are primarily bottom feeders and shallow divers (Fay 1982, Born 2005). Most prey taken is found in the upper few centimeters of sediment, or lives on or just above the bottom. A wide variety of benthic invertebrates, with several species of clams, make up the majority of food for most animals. Their diet also includes other species of molluscs, and many species of worms, snails, soft shell crabs, amphipods, shrimp, sea cucumbers, tunicates, and slow-moving fish. Some individuals prey on seals, small whales and seabirds and may occasionally scavenge marine mammal carcasses.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Walruses prefer to inhabit areas with ice floes in the shallower regions near the coasts of Arctic waterways. Their seasonal migration patterns coincide with the changes in the ice. In the winter, walruses move south as the Arctic ice expands, and in the summer they retreat north as the ice recedes. This migration can cover distances of 3000 km. Individuals concentrate where the ice is relatively thin and dispersed in the winter. In the summer time, bulls may use isolated coastal beaches and rocky islets. Cows and young prefer to stay on ice floes in all seasons (Nowak 1991, Parker 1990).

Terrestrial Biomes: icecap

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 147 specimens in 1 taxon.
Water temperature and chemistry ranges based on 32 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 4.730
  Nitrate (umol/L): 0.796 - 7.918
  Salinity (PPS): 31.267 - 34.692
  Oxygen (ml/l): 7.354 - 8.676
  Phosphate (umol/l): 0.327 - 1.066
  Silicate (umol/l): 1.170 - 17.358

Graphical representation

Temperature range (°C): -1.109 - 4.730

Nitrate (umol/L): 0.796 - 7.918

Salinity (PPS): 31.267 - 34.692

Oxygen (ml/l): 7.354 - 8.676

Phosphate (umol/l): 0.327 - 1.066

Silicate (umol/l): 1.170 - 17.358
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Ice floes are used by all individuals in the winter, as well as by adult females and young in the summer. Require ice thicknesses of 60 cm or more to support their weight (Richard 1990). First-year ice with natural openings such as leads and polynyas is preferred; seldom found in areas of extensive, unbroken ice (Fay 1982). Males use beaches of remote islets and coastal headlands for summer resting and molting sites. Generally does not haul out on shores with permanent human occupation. Generally occurs in shallow waters (less than 100 m deep) (Richard and Campbell 1988). Young are born on ice floes. Sediment in feeding areas is typically composed of soft, fine sand (Richard 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The walrus is found in shallow water and coastal habitats, on sandy beaches and rocky shores.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic, Atlantic waters of Canada and Greenland; Offshore and in deep water within dense sea ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Beginning in April, females and young migrate northward from breeding areas in the Bering Sea into the Chukchi Sea following the retreating sea ice. Some individuals probably migrate more than 3000 km in a year, some or much of which may be done on floating cakes of ice (Reeves et al. 1992). Some sub-adult males make the northward migration along with the females. Along the Alaskan coast, small numbers of adult males apparently also make the migration following several weeks behind the majority of females. Mixed herds of males and females haul out at select locations along the Chukotka Peninsula and Wrangell Island, Russia in the summer months. Return migration commences in late September as sea ice advances southward. The majority of males stay in the Bering Sea throughout the summer making use of haulouts in Bristol Bay, Alaska, and along the Koryak coast in Russia (Fay 1985); similar seasonal movement may occur in North Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Walruses feed on animals that reside on the surface of the bottom of the ocean, or in the sediments that coat the bottom. Their main diet includes mussels, snails, echinoderms, and crabs. Walrus foraging dives usually last 2-10 minutes at depths of 10-50 m. They swim headfirst along the ocean bottom, rooting about with their stiff beard bristles in a piglike fashion. Softbodied organisms are swallowed whole. Two theories on how walruses eat bivalves have been proposed, and it appears that walruses employ both methods. Walruses crack mollusk shells between their flippers and then eat the soft part. More often, walruses hold the shelled organisms in their lips and ingest the fleshy parts by powerful suction, discarding the shells. Occasionally, walruses also prey on fish, seals, and young whales. Walruses are capable of holding down seals and small whales with their flippers and tearing them apart with their tusks. In the winter, when accompanying the females and young, the bulls apparently eat very little. It was once believed that walruses used their tusks to dig up food, but this notion is false (Nowak 1991, Parker 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on bivalve mollusks; principally clams. Also consumes many other benthic invertebrates. Generally eats fleshy portion of bivalve; rejects the shell. Some individuals may feed on fishes, birds, or other marine mammals. Feeds most commonly on bottom in shallow water (80 m or less) but apparently also can forage in deep water (200-500+ m) (Fay et al. 1984a, Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

arrow range of prey which include Greenland halibut, squid, and polar cod; Echolocate prey with sonar
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Odobenus rosmarus preys on:
benthonic invertebrates
Phoca largha

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious, with groups of up to several hundred animals hauling out among ice floes, and groups of up to several thousand males at terrestrial haulouts during the summer. Natural adult mortality rate is relatively low.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Most active when feeding during early morning; rests the remainder of the day (Banfield 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Size at birth 1.5m (15 feet); Sexual maturity at 5-7 years; Females have calves every 3 years; Longevity over 60 years, possibly more than 100; Behavior; Vocal and gregarious
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
40.0 years.

Average lifespan

Status: wild:
40.0 years.

Average lifespan

Status: wild:
16.8 years.

Average lifespan

Status: wild:
40.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, walrus have been estimated to live over 40 years (Bernhard Grzimek 1990). Their longevity in captivity has not been studied in detail and hence information on ageing is limited. One wild born specimen was about 30.6 years old when it died in captivity (Richard Weigl 2005). Atherosclerosis was described in a 25 year-old captive animal (Gruber et al. 2002).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Because walruses breed during the harsh Arctic winters, little is known about their mating systems. The walrus mating system is believed to be a female-defense polygyny. Large mature males have exclusive access to a herd of females for 1-5 days at a time. Courtship behavior is described in the next section. Mating takes place in January and February, most likely underwater. Walruses are interesting because implantation of the blastocyst is delayed for 4 or 5 months, until June or July. Birth occurs 10-11 months later, from mid-April to mid-June, meaning that the total gestation period is 15-16 months. Females give birth to a single, precocial offspring. The calf is about 113 cm long and weighs approximately 63 kg. It is grey in color and can swim at birth. The social bond between the mother and calf is very strong, and cows are extremely protective of their offspring. Lactation generally lasts for 2 years, but calves are often able to find food before they are finally weaned. Young bulls become sexually mature at 8-10 years, but are often unable to compete successfully for females until they are at least 15 years old. Females become sexually mature at 6-7 years, and are full grown at 10-12 years old. Female fecundity is greatest when cows are 9-11 years old, and at this age they can produce a calf every other year. The interval between births is longer in older females. In the wild, walruses have been known to live for over 40 years (Sjare and Stirling 1996, Nowak 1991).

Average birth mass: 60000 g.

Average gestation period: 331 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2635 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1745 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Females ovulate at 6-7 years. Between 1950-1975, females ovulated at 4-8 years, but by the late 1980s the age of first ovulation had increased by about 2 years, presumably due to changes in the food supply (Fay 1982). Pacific females first give birth generally at about 10 years; males are sexually mature at 8-10 years but generally do not successfully mate until about 15 years old. Gestation lasts 15-16 months, including 4-5 months before implantation of fertilized egg. One calf (rarely 2) is born April to mid-June (mainly May). Calf is weaned by 2-2.5 years. Females in their prime give birth in alternate years. "Mobile lek" polygynous breeding system (Fay 1982). May live up to at least 40 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Teeth crush shells: walrus
 

The cheek teeth of walruses are capable of crushing tough shells because they are strong and flat.

   
  "The walrus has only 18 teeth in its mouth, but the upper canines form great ivory tusks up to a metre long. It uses them for levering itself on to ice floes, as weapons in battles with other males over females, and as digging tools to extract clams and other invertebrates from the sea bed. A walrus may dive to depths of 200 metres and more in search of food, and is thought to use its tusks to plough up the sediments on the sea bottom to expose shells, which are recognized in these murky depths by the stiff sensory bristles on its snout. Behind the tusks are strong flat teeth capable of crushing the hardest shells." (Foy and Oxford Scientific Films 1982:147)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Tusks conserve materials: walrus
 

The tusks of a walrus conserve materials because they are multi-functional.

   
  "The walrus has only 18 teeth in its mouth, but the upper canines form great ivory tusks up to a metre long. It uses them for levering itself on to ice floes, as weapons in battles with other males over females, and as digging tools to extract clams and other invertebrates from the sea bed. A walrus may dive to depths of 200 metres and more in search of food, and is thought to use its tusks to plough up the sediments on the sea bottom to expose shells, which are recognized in these murky depths by the stiff sensory bristles on its snout. Behind the tusks are strong flat teeth capable of crushing the hardest shells." (Foy and Oxford Scientific Films 1982:147)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Odobenus rosmarus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0107-06|AJ428576|Odobenus rosmarus| AATCGATGACTATTCTCCACAAATCACAAGGACATCGGCACTCTCTATTTATTATTCGGCGCTTGGGCCGGAATGGCTGGTACTGCCCTC---AGCCTGTTGATCCGTGCAGAACTAGGTCAACCTGGCACTCTATTAGGGGAC---GACCAAATCTACAACGTAATTGTCACCGCCCATGCATTCGTAATAATCTTCTTCATAGTTATACCCATCATAACCGGAGGTTTTGGAAACTGATTAGTTCCCCTAATA---ATCGGAGCCCCCGACATAGCATTTCCTCGGATAAACAATATAAGCTTTTGACTATTGCCACCTTCTTTTCTACTACTATTGGCTTCATCCATGGTAGAGGCGGGAGCGGGAACCGGATGAACCGTCTACCCTCCTCTTGCAGGTAACCTAGCTCACGCAGGACCATCCGTGGACCTG---ACAATTTTCTCTCTTCACTTGGCAGGGGTATCATCCATTCTAGGGGCCATTAACTTTATCACAACCATTGTCAATATAAAACCTCCCGCAATATCCCAATACCAGACGCCCTTATTTGTATGGTCCGTATTAATTACAGCGGTACTACTGCTGCTATCACTACCAGTAGTGGCGGCT---GGCATTACTATGCTGCTCACAGACCGAAATCTGAATACAACTTTCTTTCATCCGTCCGGAGGAGGAGACCCCATCTTGTATCAACACCTATTCTGATTCTTTGGACATCCCGAAGTATATATCCTCATTCTACCAGGATTCGGAATAATTTCACACATCGTCACCTACTACTCAGGAAAGAAG---GAGCCTTTTGGCTATATAGGAATGGTCTGGGCGATAATATCTATTGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTCACTGTAGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Odobenus rosmarus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 31
Species: 33
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lowry, L., Kovacs, K. & Burkanov, V. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Although the global population is undoubtedly still quite large, there is evidence of declining populations in two of the subspecies. Climate change is expected to have negative consequences for Walruses, and particularly severe consequences for the Pacific subspecies. Additionally, little recent information is available regarding current population sizes and trends throughout much of the Walrus’s range. At this time, this species must be classified as Data Deficient.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although walrus populations had declined drastically by the early 20th century, management programs have resulted in the dramatic rebound of the Pacific population. Although the populations are not believed to be in danger of becoming extinct, the Atlantic and Laptev Sea populations still remain at low levels. Presently, estimates of the number of walruses in all populations is not known well enough to warrant an IUCN listing (Jefferson et al. 1993).

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Pacific Walrus population recovered from a depleted state in 1950 to historical high levels in the 1980s (Fay et al. 1997). The Bering-Chukchi segment of the population was estimated at approximately 230,000 in 1985 (Gilbert 1989) and 201,000 in 1990 (Gilbert et al. 1992). However, characteristics of Walrus behaviour and difficulties associated with conducting surveys resulted in estimates with low precision (Gilbert 1999). The current population size in the Bering-Chukchi region is unknown (U.S. Fish and Wildlife Service 2002). The number of Pacific Walrus in the Laptev Sea region was estimated at 4,000-5,000 animals according to a report cited in Fay (1982), but the current abundance in that region is also unknown.

Changes in the abundance of Atlantic Walrus in various regions during the past 45 years are unclear (Committee on the Status of Endangered Wildlife in Canada 2006, North Atlantic Marine Mammal Commission undated). Modelling indicates that the Walrus populations in West Greenland and the North Water have been in steady decline, while the population in East Greenland has been increasing (Witting and Born 2005). Walrus numbers at Svalbard have increased slowly during 1993-2006 (Lydersen et al. 2008). The current total abundance of Atlantic Walrus is very poorly known, but the most recent information suggests a population size of perhaps 18,000-20,000 (Committee on the Status of Endangered Wildlife in Canada 2006, North Atlantic Marine Mammal Commission undated). The current global population trend is unknown.

Although female Walrus can ovulate at four years of age, the majority do not give birth until they are 7-8 years old and usually only produce one calf every three years. Gestation lasts 15 months, including a delay of implantation time of 3-3.5 months. The period of calf dependency is long, regularly lasting two years and sometimes longer. Males become sexually mature between 7-10 years old, but are not physically and socially mature enough to successfully compete for breeding opportunities until they are approximately 15 years old. Longevity is approximately 40 years (Fay 1981).

The Committee on the Status of Endangered Wildlife in Canada (2006) gives the generation time for Atlantic Walrus, calculated as the average of ages of the youngest and oldest animal giving birth, as 21 years. However, because young animals are more common in the population and older females may exhibit reproductive senility this does not correspond to the IUCN definition. The average age of female Pacific walrus in the Alaska Native harvest is approximately 15 years (Garlich-Miller et al. 2006), which provides a more reasonable estimate of the generation time.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Native people of the Arctic have depended on Walruses for food, hides, ivory and bones since first contact, and subsistence harvests of both subspecies continue today in most parts of their ranges. All Walrus populations were severely depleted by episodic commercial hunting that was heaviest from the 18th through to the mid-20th centuries.

Direct conflicts with fisheries are uncommon (U.S. Fish and Wildlife Service 2002); however, trawl fisheries could disturb important benthic feeding areas (Committee on the Status of Endangered Wildlife in Canada 2006). Human disturbance at land-based haul-out sites, low-level aircraft over-flights and near-shore passage of vessels can have serious effects on Walruses out of the water, as they are highly susceptible to disturbance and easily panicked into stampedes (Fay and Kelly 1980).

Global warming and any associated reduction in the extent, timing, and characteristics of seasonal sea ice cover could negatively affect Walruses, especially the Pacific population. Declining sea ice reduces suitable strata for pupping and breeding aggregation and limits access to offshore feeding areas (Tynan and DeMaster 1997, Moore 2005, Laidre et al. in press). In the Atlantic where the use of coastal haulouts is more widespread, reduced sea ice cover could increase feeding opportunities for Walruses (Born 2005).

Reduction in sea ice could also lead to the addition of commercial sea lanes in currently rarely visited portions of the Walruses’ range, with increased risk of spills and discharge of pollutants, disturbance and coastal development (Reijnders et al. 1993, Tynan and Demaster 1997, Moore 2005). A history of poor international cooperation, crude population monitoring methods and delayed management responses has led to speculation that future management actions in response to population declines of Pacific Walruses may not be taken soon enough to be effective (Fay et al. 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: The currently declining levels of harvest by humans (USFWS 1995 stock assessment) do not appear to constitute a significant threat. Laptev population is threatened by pollution and industrial activity (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The population of Canada is listed on CITES Appendix III. Since 1972 coastal Alaska Natives have hunted Walruses in the United States for subsistence purposes under an exemption provided in the Marine Mammal Protection Act. No quotas or limits have been established, but all animals taken are required to be harvested in a non-wasteful manner. Alaska Natives work with the responsible management agency (U.S. Fish and Wildlife Service) to co-manage Walrus hunting. Regulations on harvest are in place in Canada, the Russian Federation, and Greenland. Norway prohibits all hunting at Svalbard (North Atlantic Marine Mammal Commission undated).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Aside from humans hunting them, walruses have little contact with people. Because of this, walruses have little negative impact on human economies (Jefferson et al. 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Walruses have been exploited by humans for many millenia. Native peoples have harvested them for their meat, skin (which they used for shelters and kayak coverings), and ivory for tools, weapons, and arts. In the early 10th century, Viking traders began taking large numbers, and this European decimation of walruses continued until the early 20th century. Walruses are now managed by governments but continue to be killed. Northern cultures are allowed to hunt walruses for subsistence living, but poachers continue to take walruses illegally, mostly for their ivory tusks (Jefferson et al. 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long exploited for ivory, leather, blubber oil, and food; some commercial and subsistence havest continues; see Reeves et al. (1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Walrus

The walrus (Odobenus rosmarus) is a large flippered marine mammal with a discontinuous circumpolar distribution in the Arctic Ocean and sub-Arctic seas of the Northern Hemisphere. The walrus is the only living species in the Odobenidae family and Odobenus genus. It is subdivided into three subspecies:[1] the Atlantic walrus (O. rosmarus rosmarus) which lives in the Atlantic Ocean, the Pacific walrus (O. rosmarus divergens) which lives in the Pacific Ocean, and O. rosmarus laptevi, which lives in the Laptev Sea.

The walrus is easily recognized by its prominent tusks, whiskers and great bulk. Adult Pacific males can weigh more than 1,700 kilograms (3,700 lb)[3] and, among pinnipeds, are exceeded in size only by the two species of elephant seals.[4] It resides primarily in shallow oceanic shelf habitat, spending a significant proportion of its life on sea ice in pursuit of its preferred diet of benthic bivalve mollusks. It is a relatively long-lived, social animal and is considered a keystone species in Arctic marine ecosystems.

The walrus has played a prominent role in the cultures of many indigenous Arctic peoples, who have hunted the walrus for its meat, fat, skin, tusks and bone. In the 19th and early 20th centuries, the walrus was the object of heavy commercial exploitation for blubber and ivory and its numbers declined rapidly. Its global population has since rebounded, though the Atlantic and Laptev populations remain fragmented and at historically depressed levels.

Contents

Etymology

A walrus, labeled "Ros marus piscis", depicted in а 16th century map of Scandinavia (the Carta Marina).

The origin of walrus is thought to derive from a Germanic language, such as English, and is variously attributed to Dutch or Old Norse. The first part is thought to derive from a word such as English "whale", Dutch "walvis" meaning whale. And the second part could come from a Norse word for "horse".[5] For example, the Old Norse word hrossvalr, means "horse-whale", and is thought to have been passed in an inverted form to Dutch and the North-German dialects as walros and Walross.[6] An alternative theory is from Dutch wal ("shore") and reus ("giant").[7]

The now archaic English word for walrus—morse—is widely supposed to have come from the Slavic.[8] Thus морж (morž) in Russian, mursu in Finnish, moršâ in Saami, and morse in French. Olaus Magnus, who depicted the walrus in the carta marina in 1539, first referred to it as the ros marus, likely a Latinization of morž, and this was adopted by Linnaeus in the binomial nomenclature.[9] The coincidental similarity between "morse" and the Latin word morsus meaning "a bite" supposedly contributed to the walrus's reputation as a "terrible monster".[9]

The compound Odobenus comes from odous (Greek for "tooth") and baino (Greek for "walk"), based on observations of walruses using their tusks to pull themselves out of the water. The term divergens in Latin means "turning apart", referring to the tusks.

Taxonomy and evolution

The walrus is a mammal in the order Carnivora. It is the sole surviving member of the family Odobenidae, one of three lineages in the suborder Pinnipedia along with true seals (Phocidae) and eared seals (Otariidae). While there has been some debate as to whether all three lineages are monophyletic, i.e. descended from a single ancestor, or diphyletic, recent genetic evidence suggests that all three descended from a caniform ancestor most closely related to modern bears.[10] Recent multigene analysis indicates that the odobenids and otariids diverged from the phocids approximately 20–26 million years ago, while the odobenids and the otariids separated 15–20 million years ago.[11][12] Odobenidae was once a highly diverse and widespread family, including at least twenty species in the Imagotariinae, Dusignathinae and Odobeninae subfamilies.[13] The key distinguishing feature was the development of a squirt/suction feeding mechanism; tusks are a later feature specific to Odobeninae, of which the modern walrus is the last remaining (relict) species.

Two subspecies are commonly recognized: the Atlantic Walrus, O. r. rosmarus (Linnaeus, 1758) and the Pacific Walrus, O. r. divergens (Illiger, 1815). Fixed genetic differences between the Atlantic and Pacific subspecies indicate very restricted gene flow, but relatively recent separation, estimated at 500,000 and 785,000 years ago.[14] These dates coincide with the fossil-derived hypothesis that the walrus evolved from a tropical or sub-tropical ancestor that became isolated in the Atlantic Ocean and gradually adapted to colder conditions in the Arctic.[14] From there, it presumably re-colonized the North Pacific during high glaciation periods in the Pleistocene via the Central American Seaway.[11] An isolated population in the Laptev Sea is considered by some, including Russian biologists and the canonical Mammal Species of the World,[1] to be a third subspecies, O. r. laptevi (Chapskii, 1940), and is managed as such in Russia.[15] Where the subspecies separation is not accepted, whether to consider it a subpopulation of the Atlantic or Pacific subspecies remains under debate.[4][16]

Photo of several walruses, with prominently displayed white pairs of tusks
Young male Pacific Walruses on Cape Pierce in Alaska. Note the variation in the curvature and orientation of the tusks and the bumpy skin (bosses), typical of males.

Anatomy

Photo of walrus in ice-covered sea
Walrus using its tusks to hang on breathing hole in the ice near St. Lawrence Island, Bering Sea
Drawing of walrus skeleton
Skeleton

While some outsized Pacific males can weigh as much as 2,000 kg (4,400 lb), most weigh between 800 and 1,680 kg (1,800 and 3,700 lb). The Atlantic subspecies weighs about 10–20% less than the Pacific subspecies.[4] The Atlantic Walrus also tends to have relatively shorter tusks and somewhat more flattened snout. Females weigh about two-thirds as much, with the Atlantic females averaging 560 kg (1,200 lb), sometimes weighing as little as 400 kg (880 lbs), and the Pacific female averaging 794 kg (1,750 lb).[17] Length ranges from 2.2 to 3.6 m (7.2–12 ft).[18][19] It is the second largest pinniped, after the elephant seals.

The walrus's body shape shares features with both sea lions (eared seals: Otariidae) and seals (true seals: Phocidae). As with otariids, it can turn its rear flippers forward and move on all fours; however, its swimming technique is more like that of true seals, relying less on flippers and more on sinuous whole body movements.[4] Also like phocids, it lacks external ears.

Tusks and dentition

The most prominent feature of the walrus is its long tusks. These are elongated canines, which are present in both sexes and can reach a length of 1 m (3 ft 3 in) and weigh up to 5.4 kg (12 lb).[20] Tusks are slightly longer and thicker among males, who use them for fighting, dominance and display; the strongest males with the largest tusks typically dominate social groups. Tusks are also used to form and maintain holes in the ice and aid the walrus in climbing out of water onto ice.[21] It was previously assumed that tusks were used to dig out prey from the seabed, but analyses of abrasion patterns on the tusks indicate that they are dragged through the sediment while the upper edge of the snout is used for digging.[22] While the dentition of walruses is highly variable, they generally have relatively few teeth other than the tusks. The maximal number of teeth is 38 with dentition formula: Upper: 3.1.4.2, lower: 3.1.3.2, but over half of the teeth are rudimentary and occur with less than 50% frequency, such that a typical dentition includes only 18 teeth Upper: 1.1.3.0, lower: 0.1.3.0 [4]

Vibrissae

Surrounding the tusks is a broad mat of stiff bristles ('mystacial vibrissae'), giving the walrus a characteristic whiskered appearance. There can be 400 to 700 vibrissae in 13 to 15 rows reaching 30 cm (12 in) in length, though in the wild they are often worn to a much shorter length due to constant use in foraging.[23] The vibrissae are attached to muscles and are supplied with blood and nerves making them a highly sensitive organ capable of differentiating shapes 3 mm (0.12 in) thick and 2 mm (0.079 in) wide.[23]

Skin

Aside from the vibrissae, the walrus is sparsely covered with fur and appears bald. Its skin is highly wrinkled and thick, up to 10 cm (3.9 in) around the neck and shoulders of males. The blubber layer beneath is up to 15 cm (5.9 in) thick. Young walruses are deep brown and grow paler and more cinnamon-colored as they age. Old males, in particular, become nearly pink. Because skin blood vessels constrict in cold water, the walrus can appear almost white when swimming. As a secondary sexual characteristic, males also acquire significant nodules, called bosses, particularly around the neck and shoulders.[21]

The walrus has an air sac under its throat which acts like a floatation bubble and allows it to bob vertically in the water and sleep. The males possess a large baculum (penis bone), up to 63 cm (25 in) in length, the largest of any land mammal, both in absolute size and relative to body size.[4]

Life history

Photo of 5 walruses on rocky shore
Walruses fighting

Reproduction

Walruses live to about 20–30 years old in the wild.[24] The males reach sexual maturity as early as 7 years, but do not typically mate until fully developed around 15 years of age.[4] They rut from January through April, decreasing their food intake dramatically. The females begin ovulating as soon as 4–6 years old.[4] The females are polyestrous, coming into heat in late summer and also around February, yet the males are fertile only around February; the potential fertility of this second period is unknown. Breeding occurs from January to March, peaking in February. Males aggregate in the water around ice-bound groups of estrous females and engage in competitive vocal displays.[25] The females join them and copulate in the water.[21]

Gestation lasts 15 to 16 months. The first 3 to 4 months are spent with the blastula in suspended development before it implants itself in the placenta. This strategy of delayed implantation, common among pinnipeds, presumably evolved to optimize both the mating season and the birthing season, determined by ecological conditions that promote newborn survival.[26] Calves are born during the spring migration, from April to June. They weigh 45–75 kg (99–170 lb) at birth and are able to swim. The mothers nurse for over a year before weaning, but the young can spend up to 3 to 5 years with the mothers.[21] Because ovulation is suppressed until the calf is weaned, females give birth at most every two years, leaving the walrus with the lowest reproductive rate of any pinniped.[27]

Migration

The rest of the year (late summer and fall) the walrus tends to form massive aggregations of tens of thousands of individuals on rocky beaches or outcrops. The migration between the ice and the beach can be long distance and dramatic. In late spring and summer, for example, several hundred thousand Pacific Walruses migrate from the Bering Sea into the Chukchi Sea through the relatively narrow Bering Strait.[21]

Ecology

Range and habitat

The majority of the Pacific Walrus population summers north of the Bering Strait in the Chukchi Sea along the north shore of eastern Siberia, around Wrangel Island, in the Beaufort Sea along the north shore of Alaska, and in the waters between those locations. Smaller numbers of males summer in the Gulf of Anadyr on the south shore of Siberia's Chukchi Peninsula and in Bristol Bay off the south shore of southern Alaska west of the Alaska Peninsula. In the spring and fall they congregate throughout the Bering Strait, reaching from the west shores of Alaska to the Gulf of Anadyr. They winter in the Bering Sea along the eastern shore of Siberia south to the northern part of the Kamchatka Peninsula, and along Alaska's southern shore.[4] A 28,000 year old fossil walrus specimen was dredged out of San Francisco Bay, indicating that the Pacific Walrus ranged far south during the last ice age.[28]

The much smaller Atlantic population ranges from the Canadian Arctic, Greenland, Svalbard and the western portion of the Russian Arctic. There are eight presumed sub-populations based largely on geographical distribution and movement data, five to the west of Greenland and three to the east.[29] The Atlantic Walrus once ranged south to Cape Cod and occurred in large numbers in the Gulf of St. Lawrence. In April 2006, the Canadian Species at Risk Act listed the Northwest Atlantic Walrus population (Québec, New Brunswick, Nova Scotia, Newfoundland and Labrador) as being extirpated in Canada.[30]

The isolated Laptev population is confined year-round to the central and western regions of the Laptev Sea, the easternmost regions of the Kara Sea, and the westernmost regions of the East Siberian Sea. Current populations are estimated to be between 5,000 and 10,000 individuals.[31]

Their limited diving ability brings them to depend on shallow waters (and appropriate nearby ice coverage) to enable them to reach their preferred benthic prey.

Population

There were roughly 200,000 Pacific Walruses according to the most recent (1990) census-based estimate.[32][33]

The Atlantic Walrus was nearly eradicated by commercial harvest and has a much smaller population. Good estimates are difficult to obtain, but the total population is probably below 20,000.[34][35]

Diet

Photo of walrus head in profile showing one eye, nose, tusks, and "mustache"
Vibrissae of captive walrus (Japan)
Photo of two walruses in shallow water facing shore
Walruses leaving the water

Walruses prefer shallow shelf regions and forage primarily on the sea floor, often from sea ice platforms.[4] They are not particularly deep divers compared to other pinnipeds: the deepest recorded dives are around 80 m (260 ft). They can remain submerged for as long as half an hour.[36]

The walrus has a diverse and opportunistic diet, feeding on more than 60 genera of marine organisms including shrimp, crabs, tube worms, soft corals, tunicates, sea cucumbers, various mollusks, and even parts of other pinnipeds.[37] However, it prefers benthic bivalve mollusks, especially clams, for which it forages by grazing along the sea bottom, searching and identifying prey with its sensitive vibrissae and clearing the murky bottoms with jets of water and active flipper movements.[38] The walrus sucks the meat out by sealing its powerful lips to the organism and withdrawing its tongue, piston-like, rapidly into its mouth, creating a vacuum. The walrus palate is uniquely vaulted, enabling effective suction.

Aside from the large numbers of organisms actually consumed by the walrus, its foraging has a large peripheral impact on benthic communities. It disturbs (bioturbates) the sea floor, releasing nutrients into the water column, encouraging mixing and movement of many organisms and increasing the patchiness of the benthos.[22]

Seal tissue has been observed in fairly significant proportion of walrus stomachs in the Pacific, but the importance of seals in the walrus diet is under debate.[39] There have been isolated observations of walruses preying on seals up to the size of a 200 kg (440 lb) Bearded seal.[40] There have been rare documented incidents of walruses preying on seabirds, particularly the Brünnich's Guillemot Uria lomvia.[41]

Predation

Due to its great size and tusks, the walrus has only two natural predators: the orca and the polar bear. The walrus does not, however, comprise a significant component of either predator's diet. Both the orca and the polar bear are also most likely to prey on walrus calves. The polar bear often hunts the walrus by rushing at beached aggregations and consuming individuals that are crushed or wounded in the sudden exodus, typically younger or infirm animals.[42] The bears also isolate walruses when the walrus overwinter and are unable to escape a charging bear due to inaccessible diving holes in the ice.[43] However, even an injured walrus is a formidable opponent for a polar bear, and direct attacks are rare. Polar bear–walrus battles are often extremely protracted and exhausting and bears have been known to forgo the attack after injuring a walrus. Orcas regularly attack walrus although it is believed that walruses have successfully defended themselves via counterattack against the larger cetacean.[44]

Relation to humans

Conservation

Siberian Yupik woman holding walrus tusks
Photo of section of tusk
Walrus tusk engraving made by Chukchi artisans depicting polar bears attacking walruses. On display in the Magadan Regional Museum, Magadan, Russia

In the 18th and 19th centuries, the walrus was heavily exploited by American and European sealers and whalers, leading to the near extirpation of the Atlantic population.[45] Commercial walrus harvesting is now outlawed throughout its range, although Chukchi, Yupik and Inuit peoples,[46] continue to kill small numbers towards the end of each summer.

Traditional hunters used all parts of the walrus.[47] The meat, often preserved, is an important winter nutrition source; the flippers are fermented and stored as a delicacy until spring; tusks and bone were historically used for tools as well as material for handicrafts; the oil was rendered for warmth and light; the tough hide made rope and house and boat coverings; the intestines and gut linings made waterproof parkas; etc. While some of these uses have faded with access to alternative technologies, walrus meat remains an important part of local diets,[48] and tusk carving and engraving remain a vital art form.

Walrus hunts are regulated by resource managers in Russia, the United States, Canada and Denmark and representatives of the respective hunting communities. An estimated 4–7,000 Pacific Walruses are harvested in Alaska and Russia, including a significant portion (approx. 42%) of struck and lost animals.[49] Several hundred are removed annually around Greenland.[50] The sustainability of these levels of harvest is difficult to determine given uncertain population estimates and parameters such as fecundity and mortality.

The effects of global climate change are another element of concern. The extent and thickness of the pack ice has reached unusually low levels in several recent years. The walrus relies on this ice while giving birth and aggregating in the reproductive period. Thinner pack ice over the Bering Sea has reduced the amount of resting habitat near optimal feeding grounds. This more widely separates lactating females from their calves, increasing nutritional stress for the young and lower reproductive rates.[51] Reduced coastal sea ice has also been implicated in the increase of stampeding deaths crowding the shorelines of the Chukchi Sea between eastern Russia and western Alaska.[52][53] However, there is insufficient climate data to make reliable predictions on population trends.[54]

Currently, two of the three walrus subspecies are listed as "least-concern" by the IUCN, while the third is "data deficient".[2] The Pacific Walrus is not listed as "depleted" according to the Marine Mammal Protection Act nor as "threatened" or "endangered" under the Endangered Species Act. The Russian Atlantic and Laptev Sea populations are classified as Category 2 (decreasing) and Category 3 (rare) in the Russian Red Book.[31] Global trade in walrus ivory is restricted according to a CITES Appendix 3 listing.

Culture

Photo of 2 masks. In the center is the image of a face, surrounded by a ring, in turn surrounded by 8 white rectangular pieces
Walrus Ivory masks made by Yupik in Alaska

The walrus plays an important role in the religion and folklore of many Arctic peoples. Skin and bone are used in some ceremonies and the animal appears frequently in legends. For example, in a Chukchi version of the widespread myth of the Raven, in which Raven recovers the sun and the moon from an evil spirit by seducing his daughter, the angry father throws the daughter from a high cliff and, as she drops into the water, she turns into a walrus — possibly the original walrus. According to various legends, the tusks are formed either by the trails of mucus from the weeping girl or her long braids.[55] This myth is possibly related to the Chukchi myth of the old walrus-headed woman who rules the bottom of the sea, who is in turn linked to the Inuit goddess Sedna. Both in Chukotka and Alaska, the aurora borealis is believed to be a special world inhabited by those who died by violence, the changing rays representing deceased souls playing ball with a walrus head.[55][56]

Because of its distinctive appearance, great bulk and immediately recognizable whiskers and tusks, the walrus also appears in the popular cultures of peoples with little direct experience with the animal, particularly in English children's literature. Perhaps its best-known appearance is in Lewis Carroll's whimsical poem The Walrus and the Carpenter that appears in his 1871 book Through the Looking-Glass. In the poem, the eponymous anti-heroes use trickery to consume a great number of oysters. Although Carroll accurately portrays the biological walrus's appetite for bivalve mollusks, oysters, primarily nearshore and intertidal inhabitants, in fact comprise an insignificant portion of its diet, even in captivity.[57]

Another appearance of the walrus in literature is in the story The White Seal in Rudyard Kipling's The Jungle Book, where it is the "old Sea Vitch—the big, ugly, bloated, pimpled, fat-necked, long-tusked walrus of the North Pacific, who has no manners except when he is asleep".[58]

The walrus is also mentioned in the songs "I Am the Walrus", "Glass Onion" and "Come Together" by The Beatles.

References

  1. ^ a b c Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001024. 
  2. ^ a b Lowry, L., Kovacs, K. & Burkanov, V. (IUCN SSC Pinniped Specialist Group) (2008). Odobenus rosmarus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 22 March 2009. Database entry includes a brief justification of why this species is of data deficient
  3. ^ Walrus: Physical Characteristics. seaworld.org
  4. ^ a b c d e f g h i j Fay, F.H. (1985). "Odobenus rosmarus". Mammalian Species 238 (238): 1–7. doi:10.2307/3503810. JSTOR 3503810. http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/default.html. 
  5. ^ Dictionary.com. Dictionary.reference.com. Retrieved on 2011-09-16.
  6. ^ Dansk Etymologisk Ordbog, Niels Age Nielsen, Gyldendal 1966
  7. ^ Etymology of mammal names. Iberianature.com (2010-12-29). Retrieved on 2011-09-16.
  8. ^ morse, n., etymology of The Oxford English Dictionary. 2nd ed. 1989. OED Online. Oxford University Press.
  9. ^ a b Allen, Joel Asaph (1880). History of North American pinnipeds, US Geological and Geographical Survey of the Territorie. Arno Press Inc. (1974 reprint). ISBN 978-0-405-05702-1. http://books.google.com/?id=jFspFxseyC8C&printsec=frontcover&q. 
  10. ^ Lento, G.M., Hickson, R.E., Chambers, G.K., Penny, D. (1995). Molecular Biology and Evolution. 12. pp. 28–52. 
  11. ^ a b Arnason U; Gullberg A; Janke A; Kullberg, Morgan; Lehman, Niles; Petrov, Evgeny A.; Väinölä, Risto (2006). "Pinniped phylogeny and a new hypothesis for their origin and dispersal". Molecular Phylogenetics and Evolution 41 (2): 345–354. doi:10.1016/j.ympev.2006.05.022. PMID 16815048. 
  12. ^ Higdon, Jeff W; Bininda-Emonds, Olaf; Beck, Robin and Ferguson, Steven H (2007). "Phylogeny and divergence of the pinnipeds (Carnivora: Mammalia) assessed using a multigene dataset". BMC Evol Biol. 2007 7: 216. doi:10.1186/1471-2148-7-216. PMC 2245807. PMID 17996107. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2245807. 
  13. ^ Kohno, N. (2006). "A new Miocene Odobenid (Mammalia: Carnivora) from Hokkaido, Japan, and its implications for odobenid phylogeny". Journal of Vertebrate Paleontology 26 (2): 411. doi:10.1671/0272-4634(2006)26[411:ANMOMC]2.0.CO;2. ISSN 0272-4634. 
  14. ^ a b Hoelzel, A. R. (Ed.), ed. (2002). Marine mammal biology: an evolutionary approach. Oxford: Blackwell Publishing. ISBN 0-632-05232-5. 
  15. ^ Chapskii, K.K. (1940). "Distribution of the walrus in the Laptev and East Siberian seas". Problemy Severa 6: 80–94. 
  16. ^ Born, E. W., Gjertz, I., and Reeves, R. R. (1995). Population assessment of Atlantic Walrus (Odobenus rosmarus rosmarus L.). Oslo, Norway: Meddelelser. Norsk Polarinstitut. p. 100. 
  17. ^ Odobenus rosmarus walrus. Animal Diversity Web
  18. ^ Walrus. Odobenus rosmarus . National Geographic
  19. ^ [1]
  20. ^ Berta, A. and Sumich, J. L. (1999). Marine mammals: evolutionary biology. San Diego, CA: Academic Press. pp. 494 pp.. 
  21. ^ a b c d e Fay, F. H. (1982). "Ecology and Biology of the Pacific Walrus, Odobenus rosmarus divergens Illiger". United States Department of the Interior, Fish and Wildlife Service. 
  22. ^ a b Ray, C., McCormick-Ray, J., Berg, P., Epstein, H.E., (2006). "Pacific Walrus: Benthic bioturbator of Beringia". Journal of Experimental Marine Biology and Ecology 330: 403–419. doi:10.1016/j.jembe.2005.12.043. 
  23. ^ a b Kastelein, R.A., Stevens, S., & Mosterd, P. (1990). "The sensitivity of the vibrissae of a Pacific Walrus (Odobenus rosmarus divergens). Part 2: Masking". Aquatic Mammals 16 (2): 78–87. 
  24. ^ Fay, F.H. (1960). "Carnivorous walrus and some arctic zoonoses". Arctic 13 (2): 111–122. http://pubs.aina.ucalgary.ca/arctic/Arctic13-2-111.pdf.  Comment
  25. ^ Nowicki, S. N.; Stirling, Ian and Sjare, Becky (1997). "Duration of stereotypes underwater vocal displays by make Atlantic walruses in relation to aerobic dive limit". Marine Mammal Science 13 (4): 566–575. doi:10.1111/j.1748-7692.1997.tb00084.x. 
  26. ^ Sandell, M. (1990). "The Evolution of Seasonal Delayed Implantation". The Quarterly Review of Biology 65 (1): 23–42. doi:10.1086/416583. PMID 2186428. 
  27. ^ Evans, P.G.H. & Raga, J.A. (eds), ed. (2001). Marine mammals: biology and conservation. London & New York: Springer. ISBN 0-306-46573-6. http://books.google.com/books?id=riDDOeRd9JAC&printsec=frontcover. 
  28. ^ Dyke, A.S. (1999). "The Late Wisconsinan and Holocene record of walrus (Odobenus rosmarus) from North America: A review with new data from Arctic and Atlantic Canada". Arctic 52 (2): 160–181. http://arctic.synergiesprairies.ca/arctic/index.php/arctic/article/view/920. 
  29. ^ Born, E. W., Andersen, L. W., Gjertz, I. and Wiig, Ø (2001). "A review of the genetic relationships of Atlantic walrus (Odobenus rosmarus rosmarus) east and west of Greenland". Polar Biology 24 (10): 713–718. doi:10.1007/s003000100277. 
  30. ^ Fisheries and Oceans Canada. "Atlantic Walrus: Northwest Atlantic Population". Archived from the original on 2007-08-18. http://web.archive.org/web/20070818123101/http://www.dfo-mpo.gc.ca/species-especes/species/species_atlanticwalrus_e.asp. Retrieved 9 October 2007. 
  31. ^ a b "Ministry of Natural Resources of the Russian Federation protected species list". http://zapoved.ru/?act=oopt_rb_more&id=262. Retrieved October 4, 2007. 
  32. ^ Gilbert, J.R. (1992). "Aerial census of Pacific walrus, 1990". USFWS R7/MMM Technical Report 92-1. 
  33. ^ US Fish and Wildlife Service (2002). "Stock Assessment Report: Pacific Walrus – Alaska Stock" (PDF). http://alaska.fws.gov/fisheries/mmm/walrus/pdf/Final_%20Pacific_Walrus_SAR.pdf. 
  34. ^ [NAMMCO] North Atlantic Marine Mammal Commission. 1995. Report of the third meeting of the Scientific Committee. In: NAMMCO Annual Report 1995, NAMMCO, Tromsø, pp. 71–127.
  35. ^ North Atlantic Marine Mammal Commission. "Status of Marine Mammals of the North Atlantic: The Atlantic Walrus" (PDF). http://www.nammco.no/webcronize/images/Nammco/654.pdf. 
  36. ^ Schreer, J. F.; Kovacs, Kit M. and O'Hara Hines, R. J. (2001). "Comparative diving patterns of pinnipeds and seabirds". Ecological Monographs 71: 137–162. doi:10.1890/0012-9615(2001)071[0137:CDPOPA]2.0.CO;2. ISSN 0012-9615. 
  37. ^ Sheffield G., Fay F. H., Feder H., Kelly B. P. (2001). "Laboratory digestion of prey and interpretation of walrus stomach contents". Marine Mammal Science 17 (2): 310–330. doi:10.1111/j.1748-7692.2001.tb01273.x. 
  38. ^ Levermann, N., Galatius, A., Ehlme, G., Rysgaard, S. and Born, E.W. (2003). "Feeding behaviour of free-ranging walruses with notes on apparent dextrality of flipper use". BMC Ecology 3 (9): 9. doi:10.1186/1472-6785-3-9. PMC 270045. PMID 14572316. http://www.biomedcentral.com/1472-6785/3/9/. 
  39. ^ Lowry, L.F. and Frost, K.J. (1981). "Feeding and Trophic Relationships of Phocid Seals and walruses in the Eastern Bering Sea". In National Oceanic and Atmospheric Administration (NOAA). The Eastern Bering Sea Shelf: Oceanography & Resources vol. 2.. University of Washington Press. pp. 813–824. 
  40. ^ Fay, F. H. (1985). "Odobenus rosmarus". Mammalian Species 238: 1–7. http://www.science.smith.edu/msi/pdf/i0076-3519-238-01-0001.pdf. 
  41. ^ Mallory, M. L., Woo, K., Gaston, A. J., Davies, W. E., and Mineau, P. (2004). "Walrus (Odobenus rosmarus) predation on adult thick-billed murres (Uria lomvia) at Coats Island, Nunavut, Canada". Polar Research 23 (1): 111–114. doi:10.1111/j.1751-8369.2004.tb00133.x. 
  42. ^ Ovsyanikov, N. (1992). "Ursus ubiquitous". BBC Wildlife 10 (12): 18–26. 
  43. ^ Calvert, Wendy and Stirling, Ian (1990). "Interactions between Polar Bears and Overwintering Walruses in the Central Canadian High Arctic". Bears: Their Biology and Management 8: 351–356. doi:10.2307/3872939. JSTOR 3872939. 
  44. ^ Jefferson, Thomas A.; Stacey, PAM J.; Baird, Robin W. (1991). "A review of Killer Whale interactions with other marine mammals: Predation to co-existence". Mammal Review 21 (4): 151. doi:10.1111/j.1365-2907.1991.tb00291.x. http://www.cascadiaresearch.org/robin/kwinteractionsrev.pdf. 
  45. ^ Bockstoce, J.R. and Botkin, D.B. (1982). "The Harvest of Pacific Walruses by the Pelagic Whaling Industry, 1848 to 1914". Arctic and Alpine Research 14 (3): 183–188. doi:10.2307/1551150. JSTOR 1551150. 
  46. ^ Chivers, C.J. (2002-08-25). "A Big Game". New York Times Online. http://query.nytimes.com/gst/fullpage.html?res=9B03EFD9103DF936A1575BC0A9649C8B63. 
  47. ^ US Fish and Wildlife Service (2007). "Hunting and Use of Walrus by Alaska Natives" (PDF). http://alaska.fws.gov/fisheries/mmm/mtrp/pdf/factsheet_walrus.pdf. 
  48. ^ Eleanor, E.W., Freeman, M.M.R. and Makus, J.C. (1996). "Use and preference for Traditional Foods among Belcher Island Inuit". Arctic 49 (3): 256–264. 
  49. ^ Garlich-Miller, J.G. and Burn, D.M. (1997). "Estimating the harvest of Pacific walrus, Odobenus rosmarus divergens, in Alaska". Fish. Bull. 97 (4): 1043–1046. 
  50. ^ Witting, L. and Born, E. W. (2005). "An assessment of Greenland walrus populations". ICES Journal of Marine Science 62 (2): 266–284. doi:10.1016/j.icesjms.2004.11.001. 
  51. ^ Kaufman, M (2006-04-15). "Warming Arctic Is Taking a Toll, Peril to Walrus Young Seen as Result of Melting Ice Shelf". Washington Post: p. A7. http://www.ngsednet.org/news/sample.cfm. 
  52. ^ Revkin, Andrew C.. (2009-10-02) NY Times, Global warming could reverse a walrus comeback. New York Times. 3 October 2009. Retrieved on 2011-09-16.
  53. ^ World Wildlife Fund, As Arctic Sea ice reaches annual minimum, large number of walrus corpses found, 18 September 2009. Wwfblogs.org. Retrieved on 2011-09-16.
  54. ^ Lemonick, Michael (2010-09-13). "As the Sea Ice Retreats, Walruses Come Ashore in Alaska". Climate Central. http://climatecentral.org/breaking/blog/as_the_sea_ice_retreats_walruses_come_ashore_in_alaska/. 
  55. ^ a b Bogoras, W. (1902). "The Folklore of Northeastern Asia, as Compared with That of Northwestern America" (free download). American Anthropologist 4 (4): 577–683. doi:10.1525/aa.1902.4.4.02a00020. 
  56. ^ Boas, Franz (1901). "The Eskimo of Baffin Land and Hudson Bay". Bull. Am. Mus. Nat. History xv (Pt. I): 146. http://books.google.com/books?id=FOkiAQAAMAAJ. 
  57. ^ Kastelein, R.A., Wiepkema, P.R. and Slegtenhorst, C. (1989). "The use of molluscs to occupy Pacific walrusses (Odobenus rosmarus divergens) in human care". Aquatic Mammals 15.1 15: 6–8. http://en.scientificcommons.org/1064548.  PDF copy
  58. ^ Kipling, Rudyard. (1894) The Jungle Book; (1994) Harmondsworth, England:Penguin Popular Classics, p. 84, ISBN 0-14-062104-0

Further reading

  • Heptner, V. G.; Nasimovich, A. A; Bannikov, Andrei Grigorevich; Hoffmann, Robert S, Mammals of the Soviet Union, Volume II, part 3. Washington, D.C. : Smithsonian Institution Libraries and National Science Foundation
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The two geographically isolated subspecies (O. r. divergens in Pacific, O. r. rosmarus in Atlantic) exhibit distinct differences in mtDNA haplotypes and have slight differences in cranial morphology and tusk characteristics; walruses from different sampling locations exhibit mtDNA differences that may be useful in stock identification (Cronin et al. 1994).

Walruses occurring along the north coast of Asia, particularly in the Laptev Sea, are thought to have little contact with the other forms, and some Russian investigators recognize them as a third subspecies, O. r. laptevi (Reeves et al. 1992).

The Odobenidae has been regarded as a subfamily of the Otariidae by some authors; other authors contend that this would make the Otariidae paraphyletic (see Wozencraft, in Wilson and Reeder 1993). Odobenidae also has been regarded as a subfamily of Phocidae. Jones et al. (1992), Rice (1998), and Wozencraft (in Wilson and Reeder 1993, 2005) recognized the Odobenidae as a distinct family.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!