Articles on this page are available in 1 other language: Spanish (16) (learn more)

Overview

Brief Summary

Biology

Like other fur seals, Guadalupe fur seals are territorial, with adult males fighting to form territories, and then endeavouring to accumulate females into their territories (5). Females start arriving at the breeding sites from mid-June to July or August, and give birth to a pup conceived the previous season within days of their arrival (5). About seven to ten days after giving birth the mother mates and then leaves to feed at sea (5). For the next eight to eleven months before the pup is weaned (5), the female will spend alternate periods of nine to thirteen days feeding at sea and nursing periods of five to six days back on land (7). Their search for prey may take them up to 500 kilometres away from their breeding sites and most of their dives are down to a depth of 50 metres (8). The Guadalupe fur seal diet is quite specialized on squid (95 percent) but also includes a few fishes (5) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Guadalupe fur seal was once considered extinct, after being decimated by poaching for its dense, luxurious underfur (2). Remarkably, the species was rediscovered in 1954 with just 14 individuals remaining and, despite a tremendous recovery, it still remains the rarest of all fur seal species (2) (4). In males, the thick, dense coat is dark, greyish-brown to greyish-black. Much of the head and back of the neck may appear yellowish, and a silvery to yellowish-grey mane of long, coarse hair exists on the nape of the thick, muscular neck (2) (5). Females are similarly coloured dark, greyish-brown to greyish-black, but often appear paler, creamy-grey on the underside of the neck and chest. Guadalupe fur seals have elongated, pointy snouts with whitish-cream whiskers, and the male has a large and bulbous nose (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The history of the Guadalupe fur seal during the past century is well documented. The seals were nearly extinguished by hunters seeking their dense, luxurious underfur in the 1800s. In the 1890s, the United States sent a scientist to Isla de Guadalupe, Mexico, to assess the situation. Only seven live seals were counted. About 60 were seen in 1926, most of which were soon killed by fisherman, and 14 animals were located in 1954. In 1975, the island off Baja California was declared a sanctuary by the Mexican government, giving the seals protection and producing a dramatic upswing in numbers— to 3,259 in 1987 and 7,348 in the early 1990s. As with all fur seals, males are larger than females, and the animals can move on land using all four flippers. They use their front flippers to swim, and feed mostly on fish and small marine invertebrates such as squid.

Links:
Mammal Species of the World
  • Original description: Merriam, C.H., 1897.  Proceedings of the Biological Society of Washington, 11:175.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The northernmost border of the range of A. townsendi is the Channel Islands, CA. The southern range border is Cedros Island, Baja California, Mexico. The only current breeding area is on Guadalupe Island, 290 km west of Baja California. The Guadalupe fur seal is the rarest of the fur seals, and it is also the only species of Arctocephalus found in the Northern Hemisphere. They have also been sighted as far south as Puerto Gurrero, near the Mexico/Guatemala border, as far north as the Point Reyes National Seashore in California, and possibly in the Gulf of California. It is possible that the true range of the species is underestimated due to the rarity of sightings.

Biogeographic Regions: nearctic (Native ); pacific ocean (Native )

  • Aurioles-Gamboa, D., C. Hernandez-Camacho. April 1999. Notes on the southernmost records of the Guadalupe fur seal, *Arctocephalus townsendi*, in Mexico. Marine Mammal Science, 15(2): 581-583.
  • Seal Conservation Society, 2001. "SCS: Guadalupe fur seal" (On-line). Accessed Tuesday, 20 November 2001 at http://www.pinnipeds.fsnet.co.uk/species/guadfur.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The distribution of the Guadalupe Fur Seal has been expanding in recent years. The majority of the population, with around 12-15 thousand individuals, is centred on Guadalupe Island, where nearly all pups are born. In 1997 a small colony was discovered at the San Benitos Islands, southwest of Guadalupe Island, near the Baja California coast; this site was a former rookery. A census in 2007 recorded a population of 1,566 animals and the first pups on San Benitos. A pup was also born on San Miguel Island in the Channel Islands in 1997. Guadalupe Fur Seals have been reported on other southern California islands, and the Farallon Islands off northern California with increasing regularity since the 1980s. They have been sighted in the Sea of Cortez, and as far south as 17°39'N at Zihuatanejo Guerrero, Mexico. The distribution at sea is poorly known, but records from a few satellite-tracked adult females suggest they travel several hundred kilometres during feeding trips.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (<100-250 square km (less than about 40-100 square miles)) Most commonly encountered on Guadalupe Island and vicinity, off the Pacific coast of Mexico. Sometimes appears along California coast (e.g., see Hanni et al. 1997). Breeds on eastern coast Guadalupe Island; an incipient breeding colony occurs on Isla Benito del Este off central Baja California (Maravilla-Chavez and Lowry 1999). Each year 2-6 adult males and juveniles are seen on San Nicolas Island and San Miguel Island, California (California Department of Fish and Game 1990). A female and pup recently were seen on San Miguel Island, California (Melin and DeLong 1999). Adult males and nonbreeders also have been observed at the Farallon Islands, California (Matthews and Moseley 1990), though this was not mentioned by Reeves et al. (1992). Historical range may have extended from the Revillagigedo Islands (Mexico) northward to coastal waters of west-central California (Belcher and Lee 2002). Aurioles-Gamboa et al. (1999) discussed the southernmost records of this species, which extend to Guerrero, Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (Farallon Islands of CA) south to Mexico (Islas Revillagigedo)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The Guadalupe fur seal used to have a much wider distribution, but for most of the 20th century breeding was restricted to only one island; Isla de Guadalupe, off the coast of Baja California, Mexico (4). In 1997 a group of Guadalupe fur seals was observed in Islas San Benito, 165 miles south west of Isla Guadalupe (6). In 2006 and 2007 the first pups were seen in San Benito, and the species has spread out all around the San Benito Archipelago. Non-breeding seals range as far north as the Farallon Islands and Sonoma County, California, and south into the Gulf of California (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The fur of Guadalupe fur seals is brownish gray dorsally, with a silvery and yellowish-gray "mane" on the nape of the neck. Their snouts are pointed, with a rust-orange color on the sides.

This species has great sexual dimorphism. Adult males usually weigh about 124 kg, and may get up to 160 kg, females weigh about 50 kg, rarely over 55. Males grow up to 1.9 m long, females to 1.4 m.

(Whitaker 1997; Wickens & York 1997)

Range mass: 50 to 160 kg.

Range length: 1.9 (high) m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 220 cm

Weight: 159000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are much larger than females.

Length:
Average: 2.2 m males; 1.5 m females
Range: 1.9-2.4 m males; 1.4-1.9 m females

Weight:
Average: 190 kg males; 50 kg females
Range: 150-22- kg males; 40-55 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Arctocephalus townsendi Merriam, 1897
Catalog Number: USNM 83617
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Partial Skull
Collector(s): C. Townsend
Year Collected: 1892
Locality: Guadelupe Island [= Isla Guadalupe], W side, on beach, Baja California, Mexico, North America, North Pacific Ocean
  • Type: Merriam, C. H. 1 Jul 1897 . Proceedings of the Biological Society of Washington. 11: 178.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Guadalupe fur seals only live on rocky coasts and in the caves found along these shores. They can dive to an average maximum depth of 17m for an average of 2.5 minutes.

Range elevation: 0 (high) m.

Range depth: onshore to 17 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: coastal

  • Whitaker, J. 1997. National Audubon Society Field Guide to North American Mammals. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Guadalupe Fur Seal are sexually dimorphic, with males 1.5-2 times longer and approximately 3–4 times heavier than adult females. Adult males may reach 2 m. Two adult males that were measured were approximately 1.8 and 1.9 m in length. The 1.9 m male was estimated to weigh 160-170 kg. Adult females average 1.2 m and reach approximately 1.4 m, and weigh 40-50 kg. Pups are estimated to be 50–60 cm long, weigh around 6 kg at birth and are weaned when 9-11 months.

Guadalupe Fur Seals are polygynous, with males establishing territories that are occupied by an average of six females. Pups are born from mid-June to August with a median birth date of 21 June. Male tenure on territories lasts at least as long as 31 days. Males defend territories with vocalizations, displays, and mutual displays with neighbouring bulls. Fighting between males is rare once territories are established. Females select only male territories that provide cover and shade from the sun and all territories occupied by females are fronted by water and include tidal pools. Adult females enter the water daily, presumably for cooling, while otherwise “ashore” attending their pups. Most animals breed in small caves, grottos, and cliff and boulder areas on the rugged east coast of volcanic Guadalupe Island. A small breeding colony was discovered on the east side of the easternmost parts of the San Benitos Islands in 1997, and it appears to be growing annually. During the breeding season of 2007, Guadalupe Fur Seals were seen on the three islands of San Benito.

Females returning to the rookery for the first time usually arrive at night or early in the morning. Estrous occurs 5-10 days after a female gives birth, and females can leave for their first foraging trip right after mating, or stay on the colony for another few days before departing. Foraging and attendance patterns are not well-known but the limited information indicates that females may travel from 700 to 4,000 km during feeding trips lasting from 4 to 24 days. Pups are weaned at 9–11 months, and females with pups can be seen on or around the island throughout the winter and into the spring.

Knowledge of activities and behaviour at sea, away from Guadalupe Island, are limited to a handful of records. At sea, they appear to be mostly solitary. In recent years they have been reported in small numbers throughout the summer in waters off Southern California and northern Baja California by long range sport fishing boats pursuing albacore. Observations of animals in captivity suggest that they spend a considerable amount of time grooming while floating at the surface. They often rest at the surface in the characteristic southern fur seal, head-down posture. They also float with one or more flippers extended out of the water. When travelling rapidly, they have been observed to “porpoise.”

Prey preference and foraging activity are poorly known. Feeding habits based on scat analysis at San Benito Islands indicated that 95% of the prey items were squid species dominated by the market squid (Loligo opalescens) which made up 65% of the identifiable prey. Stomach contents retrieved from stranded animals included a variety of squid, bony fishes, and crustaceans, including vertically-migrating species.

Killer whales and sharks, particularly Great White Sharks which are regularly seen at Guadalupe Island in the summer, are undoubtedly predators of Guadalupe Fur Seals, although there is no evidence in the literature to support this assumption. A wound on a male from a Cookie-cutter Shark bite has been reported.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Occurs on island shores with solid rock and large lava blocks, usually at the base of tall cliffs. Often occupies caves along east shore of Guadalupe Island.

Young are born on rocky shore or in coastal cave. Shelter from direct sunlight and access to water for cooling may be important factors in selection on breeding/birthing sites (Reeves et al. 1992). Reproductive males apparently are faithful to particular breeding sites over a number of years (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

When ashore, Guadalupe fur seals live and breed in rocky habitats, such as volcanic caves and grottos (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Remains in vicinty of breeding area throughout the year, though wandering individuals are sighted regularly off the California coast.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Guadalupe fur seals eat a variety of fish, including lantern fish, mackerel, and fish in the muctophid family. Squid also constitute a major part of their diet. In all cases, the seals swim out to sea and dive for their prey items. During the breeding season, females make 2 to 6 day forging trips to sea, coming onshore in between each trip in order to suckle their pups.

Anchovy otoliths (bony concretions formed in the ears of fish) have been found the the digestive tracts of Guadalupe fur seals, but they are believed to be remains left from feeding of the seals by fishermen.

(Hanni et al. 1997; Seal Conservation Society 2001; Whitaker, 1997)

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet apparently includes squid and lanternfish (Reeves et al. 1992). Population is not thought to be food limited nor to compete with other pinnipeds for food resources (Peterson et al. 1968).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

The Guadalupe fur seal plays the role of predator in the shoreline communities it inhabits.

(Whitaker 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Arctocephalus townsendi preys on:
Actinopterygii
Mollusca

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: Two breeding colony occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Historical population was at least 30,000. Reduced to near extinction by the fur seal trade. Population increased in the early 1900s to at least 1073 in 1978 and 1600 in 1984; total count in 1987 was 3259 at Guadalupe Island, including 468 adult males, 78 subadult males, 1134 females, 472 juveniles, and 998 pups (Reeves et al. 1992). Total population now about 7000 (Wicken and York 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Guadalupe fur seals have a polygynous breeding system, which involves a male seal with a territory (a bull) defending both his terriory and the females in his harem. The harem numbers between 4 to 12 females, each of which typically have one pup that they nurse.

Mating System: polygynous

Male Guadalupe fur seals are territorial, like other fur seals. They defend harems that number an average of 6.2 breeding females for each territorial bull. Males will defend their territory for 35 to 122 days. Unlike most other seal species, the males of A. townsendi occasionally observe their harems from the water. Female Guadalupe fur seals mate 7-10 days after giving birth to a pup conceived the previous year (post-partum estrus). Females lactate for an average of 9-11 months; how this related to the actual length of time before weaning is unclear.

(Whitaker, 1997; Wickens & York, 1997)

Breeding season: 15 June - 22 July

Average number of offspring: 1.

Average gestation period: approximately 12 months.

Average weaning age: most likely 11 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual

Parental Investment: female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Females give birth in May, June, and July (mainly mid-June), 3-6 days after arriving at rookery. Mating occurs 7-10 days after female gives birth. Females make periodic feeding trips to sea after mating, and they may continue to haul out and nurse their young through the following spring. Male territories include 2-8 females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctocephalus townsendi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCTACAAACCATAAAGATATTGGCACCCTATATCTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTCAGCCTATTGATCCGCGCGGAGTTAGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATCTATAACGTAATTGTCACCGCCCACGCATTCGTGATAATCTTTTTCATAGTAATACCTATTATAATCGGGGGCTTTGGAAATTGACTAGTACCCCTAATAATTGGAGCTCCCGACATGGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTTCTACTACTACTAGCCTCTTCCCTAGTTGAAGCTGGCGCAGGTACCGGATGAACAGTTTACCCTCCCCTAGCAGGAAACCTAGCCCATGCAGGGGCCTCCGTAGACTTGACTATCTTCTCCCTCCACCTAGCGGGAGTATCATCTATTCTGGGAGCCATTAACTTTATTACTACTATTATCAACATGAAACCCCCTGCTATATCCCAATACCAGACTCCTTTATTCGTGTGATCCGTACTAATCACAGCGGTACTACTTCTGCTATCCCTACCCGTCCTGGCAGCTGGTATCACTATATTACTTACGGACCGAAATCTAAATACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTCATCCTACCAGGATTTGGGATAATCTCACACATCGTCACCTACTACTCAGGAAAAAAGGAACCCTTTGGCTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTCACCGTAGGAATAGATGTTGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctocephalus townsendi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The Guadalupe fur seal was nearly hunted to extinction in the 1880's, with the known population numbering only 7 individuals in 1892. Other than two males sold to the San Diego Zoo in 1928, only one other GFS was sighted until 1954. Guadalupe Island was declared a seal sanctuary by the Mexican government in 1975. The Guadalupe fur seal was first placed on the "threatened" list in the US on March 11, 1967. By 1984 there were 1,600 seals in the Guadalupe Island population, including around 650 new pups. Current estimates place the population number at >7,000 individuals. Despite the bottlenecks of the late 1800's, there still remains a high level of genetic variability in the population. The population of Guadalupe fur seals is growing at the rate of 11.5% per annum.

(Bernardi et al. 1998; Seal Conservation Society, 2001; USFWS 2001; Whitaker 1997; Wickens & York 1997)

US Federal List: threatened

CITES: appendix i

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aurioles, D. & Trillmich, F. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
The reduction of this species took place more than three generations (30 years) ago, and its population is now increasing. It is restricted to a single location during the breeding season, but there are no immediately obvious threats that seem likely to drive it to Critically Endangered or even Extinct in a very short time period; it is, however, close to meeting criterion D2 for Vulnerable, and so it is listed as Near Threatened.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: Two breeding colonies (Guadalupe Island, Isla San Benito del Este, Mexico); formerly, breeding probably occurred also on islands along the California coast; restricted range is due to near extermination by excessive harvest; current population of 7,000+ is increasing.

Other Considerations: Presumed extinct after 19th century commercial harvesting. Rediscovered (1949) on San Nicolas Island, California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 03/11/1967
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: T

For most current information and documents related to the conservation status and management of Arctocephalus townsendi , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Since the 1950s, the species has recovered from an estimated population of 200-500 animals to an estimated level of 15-17 thousands at present, and is growing at about 13.7% per year.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Increasing in recent decades after near extinction.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Guadalupe Fur Seals have a long and mostly unfortunate history of association with humans. Hunted to the brink of extinction by the late 19th century, they were not reported again until 1926. Following this “rediscovery” all animals that could be found were taken and once again the species was thought to be extinct. Guadalupe Fur Seals were suspected to have survived, because of scattered unconfirmed reports in the 1930s, and were rediscovered once again with the sighting of a bull on San Nicholas Island in Southern California in 1949. An expedition to Guadalupe Island in 1954 confirmed the survival of the species.

Although the Guadalupe Fur Seal population is steadily growing, the species is still at risk because the total population remains low and nearly all pup production occurs at only one island. Also, since the species passed through a genetic bottleneck and probably recovered from a very small number of individuals, there may be a lack of genetic diversity within the surviving population (Weber et al. 2004).

The feeding ground of the species occupies the region around Guadalupe and San Benito Islands and the lower part of the California Current. This region is influenced by human population centres with contaminant runoff, extensive oil tanker traffic and offshore oil extraction activity from southern California. Like all fur seals, Guadalupe Fur Seals are vulnerable to oil spills because of their dependence on their thick pelage for thermoregulation. Guadalupe Fur Seals share most of their haulout and breeding sites with California Sea Lions, which have suffered from viral disease outbreaks in the past, and which could be a vector for transmission of diseases from terrestrial sources to Guadalupe Fur Seals, because of their extensive use of coastal areas.

No conflicts with commercial fisheries are known to exist at the present time, although gillnet and set-net fisheries probably take some animals, as is probably also the case for entanglement in marine debris. There is a possibility of negative interactions between Guadalupe Fur Seals and lobster fishermen when the seals occupy inshore areas to breed and out, particularly if the population continues to increase.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Formerly decimated by hunting. Currently, the species is vulnerable to mortality from oil spills, and offshore oil and gas exploration may affect potential habitat off California coast (Matthews and Moseley 1990). USAF space shuttle program's sonic booms could cause disturbance. Three of nine stranded individuals found recently in central and northern Clifornia had experienced entanglement in fishing gear or marine debris (Hanni et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Prized for their luxurious underfur, Guadalupe seals were hunted to near extinction in the 19th century (2) (10). Following its rediscovery in 1954, when just 14 individuals were found, the species has experienced a remarkable recovery, with population numbers having rebounded to a far healthier 7,348 by the early 1990s (10). Nevertheless, some Guadalupe seals may still be killed through entanglement in drift and set gillnets and individuals, particularly juvenile females, have been found stranded with injuries caused by entanglement in marine debris. In addition, El Niño and Hurricane Darby were responsible for 33 percent pup mortality in 1992, but it is not known how the population was affected by the 1997 to 1998 El Niño event (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I. The Guadalupe Fur Seal and its habitat are protected by the Mexican government and tourist visits to breeding islands are regulated and very limited. In the United States the species is protected by the Marine Mammal Protection Act and the Fish and Game Code of the State of California. The Guadalupe Fur Seal was listed as Threatened under the U.S. Endangered Species Act in 1985, which automatically brought the species the status of Depleted under the Marine Mammal Protection Act to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Research the possibility of translocating animals to historic breeding areas. Investigate effect of feral goats on Guadalupe Island.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Guadalupe Island was declared a wildlife sanctuary by Mexico in 1922; confirmed by new decree in 1972. Species is fully protected under various international conventions and national (U.S. and Mexican) and state laws.

Needs: Protect all existing and potential breeding sites from habitat degradation and disturbance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

In 1975, the Isla de Guadalupe was declared a sanctuary by the Mexican government and the Guadalupe fur seal is now fully protected under Mexican law (2). The species is also protected in the U.S. portion of its range by Californian law and is listed on Appendix I of CITES, prohibiting any international trade (3). Thankfully, these measures have produced a dramatic rise in numbers, and the future looks a little brighter for the world's rarest fur seal (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Prehistorically, A. townsendi may have been hunted by Chumash Indians at San Miguel Island and other Channel Islands in California. The seal produces a rich, dense fur that was highly prized up until recent times, with the species nearly driven to extinction by seal hunters in the 1880's. In 1892, only seven individuals were known to exist. The population has rebounded, and the trade in the fur of Guadalupe fur seals is prohibited.

(Melin & DeLong 1999; Whitaker 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Guadalupe fur seal

The Guadalupe fur seal (Arctocephalus townsendi) is one of six members of the fur seal genus Arctocephalus. Sealers reduced the population to just a few dozen by the late 19th century, but the species had recovered to 10,000 in number by the late 1990s. Many individuals can be found on Mexico's Guadalupe Island.

Biology[edit]

Guadalupe fur seals are sexually dimorphic in size, with the males being much larger than females, although few specimens have been measured. Individuals of both sexes are dark brown or dusky black, with the guard hairs on the back of the neck being yellowish or light tan. Pups are born with a black coat similar to that of adults. Observations suggest reproductive males are faithful to particular sites over a number of years. Tenure of territorial males lasts from 35–122 days. Births occur from mid-June through July, with most births taking place in June. The seals are one of the few with visible earflaps, confirming it is not a Phocidaen/true seal.

Distribution[edit]

Guadalupe fur seals breed along the eastern coast of Guadalupe Island, approximately 200 km west of Baja California. In addition, individuals have been sighted in the southern California Channel Islands, including two males who established territories on San Nicolas Island.

Impacts on Guadalupe fur seals[edit]

The major cause of the Guadalupe fur seal's decline was commercial hunting in the late 18th and early 19th centuries. The species was exterminated in southern California waters by 1825. Commercial sealing continued in Mexican waters through 1894.

Conservation and recovery efforts[edit]

The species is listed as endangered by the U.S. National Marine Fisheries Service under the Endangered Species Act. The principal cause of the decline in Guadalupe fur seals was commercial sealing. The species is now protected from such activity throughout its range, and the magnitude of the threat to the species is considered to be low. The portion of the Guadalupe fur seal's range which is under U.S. jurisdiction is at the limit of the species range. No activities in areas under U.S. jurisdiction are known to be adversely affecting recovery of this species now. Therefore, management activities in the U.S. portion of its range are not likely to contribute substantially to recovery. However, Guadalupe fur seals are protected from federal actions that are likely to jeopardize the species through interagency coordination under Section 7 of the Endangered Species Act. No other specific actions necessary for the recovery of the species have been identified, and no direct recovery actions are being implemented.

References[edit]

  1. ^ Aurioles, D. & Trillmich, F. (2008). Arctocephalus townsendi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 January 2009.
  • Belcher, Rebecca L.; and Thomas E. Lee, Jr. (2002). "Arctocephalus townsendi". Mammalian Species (700):1–5.
  • Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Has been regarded as conspecific with Arctocephalus phillipii by some authors (e.g., Hall 1981). Considered a distinct species by Jones et al. (1992), Wozencraft (in Wilson and Reeder 1993, 2005), and Reeves et al. (1992).

Gardner and Robbins (1998) pointed out that Otoes and Halarctus are the earliest available generic names for northern and southern fur seals, respectively; they have petitioned the ICZN to preserve the generic names Callorhinus and Arctocephalus for these seals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!