Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

South American Fur Seals are found on both the Atlantic and Pacific sides of South America, from Isla Marco (Uruguay) to Isla Mayorca (Peru). Most of the population is concentrated in the Atlantic side of the distribution, especially in the Uruguayan islands. Colonies are often difficult to access and are not regularly dispersed. Along the coast of continental Argentina, 12 rookeries have been described, all on islands. Some of these locales are only used as wintering places. Ten colonies are recorded where reproduction takes place within the Falkland-Malvinas. In the Pacific, animals concentrate in southern (Magellanic region) and northern Chile and in central Peru. The species has a discontinuous distribution and it is absent in the coast of Chile from 28-43°S.

Distribution at sea is poorly known. These seals are thought to forage primarily in continental shelf and slope waters. However, there are records of this species occurring more than 600 km offshore. Vagrants have been reported from the Pacific coast of Colombia and the Juan Fernandez Islands, and the species visits southern Brazil regularly.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Neotropical ocean coasts; ranges from southern Peru (Paracas Peninsula) south to Cape Horn on the Pacific side, and northward to southern Brazil on the Atlantic side. Also found in the Falkland Islands, Staten Island, and Escondida Island. There are two subspecies, based on size and range. Arctocephalus australis gracilis, the more widespread of the two, occurs throughout the entire range along the mainland. The smaller subspecies, Arctocephalus australis australis, inhabits the Falkland Islands. Recently, a population on South Georgia Island was determined to be A. australis australis (Reeves, et al. 1992, Daneri, et al. 1997, Nowak 1999).

Biogeographic Regions: neotropical (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

South America, from central Peru to southern Brazil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Falkland Islands
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult males reach an average length of 1.9 meters and mass of 150 – 200 kg. Their fur is blackish gray, with a mane of long guard hairs on the shoulder and neck area. The build of the male is proportionally broader in the shoulders than the female. Adult females average about 1.4 meters in length and a mass of 30 – 60 kg. Female and subadult fur is grayish black on the back and lighter on the ventral side. Newborn pups are all black. In general, these seals have a stocky build with a flat-topped, pointed muzzle and creamy white vibrissae. Ear pinnae are prominent. Dental formula 3/2, 1/1, 6/5. (Reeves, et al. 1992, Jefferson, et al. 1994, Nowak 1999)

Range mass: 30 to 200 kg.

Average mass: 110 kg.

Range length: 1.4 to 1.9 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
South American Fur Seals are sexually dimorphic. Adult males are approximately 1.3 times longer and 3.3 times heavier than adult females. Adult males reach 1.9 m and 120–160, and possibly 200 kg; females are about 1.4 m long and weigh 40-50 kg. Newborns are 60-65 cm and 3.5-5.5 kg. Most females give birth for the first time when they are 4 years old. Pups are born shortly after females return to the colonies. Oestrous occurs 7–10 days later, and following mating, a female begins to make foraging trips punctuated by time attending the pup ashore. Pups are weaned at 8 months to 2 years of age. Females will nurse a yearling and newborn pup at the same time.

Breeding takes place from mid-October through mid-January. The timing of breeding may differ in the Peruvian and Chilean-Atlantic colonies. Colonies are generally found along rocky coasts, on ledges above the shoreline or in boulder strewn areas. Most areas utilized have some source of shade such as at the base of cliffs or under boulders and easy access to the ocean or tidal pools. Males are polygymous and territorial, and fighting can result in dramatic wounds and scars. Individual bulls can occupy territories for up to 60 days and have up to 13 females on their territories at Uruguayan colonies. Male vocalizations include a bark or whimper, a guttural threat, and a submissive call. Females growl and have a pup-attraction call that is a high-pitched wail.

Time spent on trips and attending the pup likely varies with location and changes in marine productivity; El Niño years have a negative impact on animals in Peru and during them females must spend much more time attempting to forage. Female attendance in Uruguay is affected by weather with females spending less time ashore during the day when ground temperature exceeds 36ºC and more time ashore during storms. Survival rates of pups can be quite low when marine productivity is low and storm surges can sweep large numbers of pups off colonies. Locally, pup morality inflicted via predation by adult male South American sea lions can be significant at some colonies. Data collected on adult female South American fur seals during an El Niño event resulted in mean dives to 29 m, with a maximum of 170 m and mean duration of 2.5 minutes and maximum dive length of 7 minutes.

The population along the coast of Patagonia is linked to the Uruguayan colonies. Very few births occur in the Patagonian population, so the recent increases in numbers in this area are almost certainly due to a migration from the Uruguayan islands. It is possible that a similar movement occurs between the Staten Island colony and the Chilean colonies via the Beagle Channel.

At sea, these fur seals may be seen travelling or rafting at the surface in groups. South American Fur Seals will "porpoise,” or leap clear of the water when moving rapidly at sea, sometimes travelling like this in large groups. While resting at the surface they spend considerable time grooming and assume many poses typical of southern fur seals, including waving both hind flippers in the air while the head is submerged. Groups often form in the water at the base of a colony. They are frequently seen grooming while resting at the surface.

Demersal and pelagic fishes make up the majority of the diet in Uruguay and include: Anchoveta, weakfish, cutlassfish, and anchovy. Cephalopods, lamellibranchs and gastropods are also taken. Additional prey taken in other areas includes sardines, mackerel, hakes and crustaceans such as lobster krill in southern Chile and the Falkland Islands where squid is also a common prey item.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Arctocephalus australis apparently prefer rocky shores and islands, especially those with lots of vertical slope. This provides shady areas for them to escape the heat of the sun. During a given day there may be movement from drier rocks to areas close to the sea or in tide pools. They have been found in sea caves in Peru, where some climb up to 15 meters to find a spot to rest. Not much is known about their movements at sea, but a recent study with satellite telemetry has discovered that females will travel 15 to 200 km when foraging at sea. (Nowak 1999, Falklands Conservation 2000)

Average depth: 29 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet consists of anchovies, sardines, and mackerel, along with cephalopods, crustaceans, bivalve mollusks, and gastropods. Arctocephalus australis individuals usually forage at night and will dive for 3 minutes to an average depth of 29 meters, but will reach a maximum time of 7 minutes and 170 meters in pursuit of food. Numbers of anchovy can fluctuate abruptly in the Pacific Ocean, where El Nino events occur every 2 – 7 years. This will affect reproductive success of females. (Reeves, et al. 1992 & Majluf 1992)

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

South American fur seals are important members of the ecosystems in which they live. They are important predators on fish species and other marine organisms, and are preyed on by the largest predators in these oceans, great white sharks(Carcharodon carcharias) and orcas (Orcinus orca).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

No information was available on anti-predator adaptations. South American fur seals are preyed on by large sharks, such as great white sharks (Carcharodon carcharias), orcas (Orcinus orca), South American sea lions (Otaria byronia), and by humans. Their large size will protect them from many, smaller predators.

(Reeves, et al. 1992 & Couturier 1996)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Arctocephalus australis is prey of:
Chondrichthyes
Homo sapiens
Orcinus orca
Otaria byronia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Arctocephalus australis preys on:
non-insect arthropods
Actinopterygii
Mollusca
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

South American fur seals have an estimated lifespan of 25 to 30 years for females and 15 to 20 years for males. (Lima & Paez 1997)

Typical lifespan

Status: wild:
15 to 30 years.

Range lifespan

Status: captivity:
female: 30.6, male: 20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30.6 years (captivity) Observations: It has been estimated that females may live up to 30 years in the wild and males up to 20 years (Lima and Paez 1995). One wild born female was about 30.6 years old when she died in captivity (Richard Weigl 2005). Gestation time excludes delayed implantation period.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

In the austral spring (October – December) bulls establish breeding territories, approximately 50 square meters in area. Although they try to herd females and create harems, females typically move about freely. Dominant males are more successful at mating with more females. Non-breeding males are pushed to a separate part of the rookery, closer to the ocean. There, the younger males will engage in mock territory battles.

Mating System: polygynous

For South American fur seals, sexual maturity is reached at 3 years for females and 7 years for males. Females begin estrus usually 6 to 8 days after they give birth and, though all will mate, only about 15% will give birth the next year if they are nursing a pup. After mating, implantation is delayed for 4 months. Total gestation time averages 11.75 months. Litter size is limited to one pup. Reproduction is synchronous in rookeries, with a peak birthing period at a time of peak food availability. If rearing takes longer than a year, a second pup will be born, resulting in competition for the mother’s milk. After birth, the pup is nursed for 7 months to 3 years, depending on environmental conditions. Lactation period may vary and can overlap with pregnancy, resulting in energetic costs that are paid by smaller young being born. It can also result in successful births only occuring every few years, rather than yearly. This phenomenon is unique for Arctocephalus australis among otariids. In addition, an Uruguayan study showed a significant difference in pregnancy rates in Arctocephalus australis from year to year, indicating that both environmental and demographic stochasticity play a role in population dynamics. Pups are born throughout November and December along the Uruguayan coast, a bit earlier in Peru. Pups’ average weight is 3-5 kg. Studies have shown that females that lactate during pregnancy give birth to smaller young. Growth rates of young are slow, varying between 0.05 – 0.09 kg/per day. The average pup length at birth is 60-65 cm for males, 57-60 cm for females. Females reach full size in ten years. Both male and female pups are born with a dark coat of fur but, as they mature, females develop lighter coloration ventrally. Mortality of pups can be caused by maternal aggression during times of movement to or from the water and is considered to be higher than in other species of otariids (10 – 48%). Death can also be caused by aggressive males or by males of South American sea lions, Otaria byronia. However, a study in Uruguay showed South American fur seals to have an overall high survival rate for young adults. (Trillmich 1990, Harcourt 1992, Majluf 1992, Harcourt 1993, Nowak 1999)

Breeding season: Mating and birthing occurs from October through January.

Average number of offspring: 1.

Average gestation period: 11.75 months.

Range weaning age: 7 to 36 months.

Average weaning age: 12 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 4250 g.

Average gestation period: 236 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2556 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Pup rearing is done by the mother, with no help from the male. After birth, the mother will remain with the pup for 5 to 10 days before leaving to forage. Mothers will alternate between average foraging trips of 4.6 days and nursing their young for 1.3 days.  (Majluf 1992, Reeves, et al. 1992, Jefferson, et al. 1994, Lima and Paez 1995, Couturier 1996, Nowak 1999)

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctocephalus australis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0251-06|AY377150|Arctocephalus australis| AATCGATGATTATTCTCCACAAACCATAAAGATATTGGCACCCTTTATCTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTC---AGCCTATTGATCCGCGCGGAGTTGGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATCTACAACGTAATTGTCACCGCCCATGCATTCGTGATAATCTTTTTCATGGTAATACCTATTATAATTGGGGGCTTTGGAAATTGATTAGTACCCCTAATA---ATTGGAGCCCCCGATATGGCATTTCCTCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTCCTACTACTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCAGGTACCGGATGAACAGTTTACCCTCCCCTAGCAGGAAACCTAGCCCATGCAGGAGCTTCCGTAGACTTA---ACTATTTTCTCCCTTCACCTGGCAGGAGTATCATCTATTCTGGGAGCCATTAACTTTATTACTACTATTATCAACATGAAACCCCCTGCCATATCCCAATACCAAACCCCTTTATTCGTGTGATCCGTACTAATCACAGCGGTACTACTTCTGCTATCCCTGCCAGTCCTGGCAGCT---GGTATCACTATATTACTTACGGACCGAAATCTAAACACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTCATCCTACCAGGATTCGGGATAATCTCACACATCGTCACCTACTACTCAGGAAAAAAG---GAACCCTTTGGTTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTCACCGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arctocephalus australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Campagna, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its large and increasing population size, the South American Fur Seal should remain classified as Least Concern.

IUCN Evaluation of the South American Fur Seal, Arctocephalus australis
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

No integrated census data are available for the entire distribution range. Most of the population is concentrate on a few islands of Uruguay and the best available data suggest that numbers are expanding. A population decrease is possible for the Pacific side of the distribution and may be = 50% for colonies breeding in Chile. The Peruvian population is also under the strong impact of El Niño. In Argentina, the population is relatively small, but it is increasing. Due to a large proportion of the global population being stable or perhaps increasing, the criteria of population reduction do not apply at the species level.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Commercial harvesting has ceased and any local reductions are due to El Niño and to competition with fisheries, but these negative effects occur at a local level rather across the entire distribution range. Therefore, these criteria do not apply for the species.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A reduction in numbers at the species level may occur if climate change increases the impact of El Niño in the Pacific side of the distribution. However, thus far the numbers in the Uruguayan islands are stable or increasing.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A reduction in numbers at the species level may occur if climate change increases the impact of El Niño in the Pacific side of the distribution. However, thus far as the numbers in the Uruguayan islands are stable or increasing. Local colony reductions are not currently significant in terms of total global population size.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
The EOO is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
Number of mature individuals is likely > 10,000.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction.

Listing recommendationGlobally, the South American Fur Seal should be classified as Least Concern. However, particular attention should be paid to local populations in the Pacific. It is possible that the Peruvian and northern Chilean populations are a different stock that may qualify for a threatened status.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The population of South American fur seals in 1999 was estimated at 390,000, a drop from a 1987 estimation of 500,000. Although overall species numbers are healthy, the downward trend is causing some concern. Uruguay has the largest numbers of seals along its coast, numbering over 200,000. Peru’s number dropped to only 40 in the 1940’s, but subsequent protection has brought the numbers back up to about 20,000 by the 1980s. Because of the El Nino events and general overfishing along the Pacific coast of South America, the population in the Pacific is not recovering as quickly as it could. Presently, Peru has had a problem with fishermen illegally killing South American fur seals, claiming that the seals interfere with fishing operations and diminish the anchovy numbers. In the Falkland Islands, where commercial hunting greatly reduced their numbers, the population now contains about 15,000 seals. There are approximately 40,000 seals in Chile and 3,000 in Argentina. Arctocephalus australis is on appendix 2 of the CITIES. (Reeves, et al. 1992, Couturier 1996, Jefferson, et al. 1994)

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Most of the global population of South American Fur Seals is concentrated in Uruguay (200,000-250,000 animals). About 55% of the fur seals in Uruguayan waters are found at Isla de Lobos (ca. 180,000 animals; ca. 35,000 pups born per year). The remaining animals are distributed in the area of Cabo Polonio and Islas de la Coronilla. An additional 15-20 000 animals are found in the Malvinas-Falklands. The population along the Argentine Patagonian coast is about 20 000 animals (the largest colony is in Isla Rasa with 12 000 fur seals). The Chilean population is estimated to be 30 000 fur seals. The Peruvian population was estimated to be 11,400 during an El Niño year (Arias-Schreiber 1998). Therefore, the population global population is roughly 250-300 000 fur seals. The population of coastal Patagonia is increasing at about 8% per year. A decrease from 102,000 to 30.000 has been reported for the Chilean population (Sielfeld 1999, Venegas et al. 2002). El Niño years have dramatic effects on the Peruvian population.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Human subsistence hunting of South American Fur Seals undoubtedly began with first contact and continues today. Commercial exploitation began after the discovery of South American Fur Seals by Europeans in the 18th century. Harvest levels declined in the 20th century bringing about the cessation of hunting at many locations. A managed harvest of adult males continued in Uruguay until recent times (Vaz-Ferreira and Ponce de Leon 1987). Small numbers of fur seals are taken for subsistence and poached for human food in Chile in Peru. Animals are often shot in the coastal areas of Peru and an estimate yielded that up to 35% of the dead seals found on beaches have been shot.

Extensive development of large-scale commercial fisheries and ongoing, numerous small-scale coastal fisheries have had an unknown effect on the amount of food available to South American Fur Seals. These fisheries are also a source of entanglements and direct mortality.

In southern Chile, seals were illegally exploited some time ago as a source of free bait for the king crab fishery. Because this fishery is decreasing due to overexploitation, hunting pressure on the fur seal is being reduced, although incidental captures in shark nets have been reported for Uruguay (Scialabba 1989). Small numbers of fur seals are also caught in the Chilean trawl-fisheries.

Survival rates of pups can be quite low when marine productivity is low and storm surges can sweep large numbers of pups off colonies. During El Niño years, mortalities of 100% of pups born have been recorded. Also, high mortality rates of pups occur in dense colonies.

The limited number of large, dense breeding aggregations could make this species particularly sensitive to the effects of oil spills and disease epidemics. Like all fur seals, South American Fur Seals are vulnerable to oil spills because of their dependence on their thick pelage for thermoregulation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix II. South American Fur Seals are protected and managed by laws in most of the countries where they occur. In Chile, the status of total protection was given to all Arctocephalus species in 1978 (Torres 1987, Reijnders et al 1993). In Argentina, marine mammals are under the administration of the various provinces. At the Falkland Islands (Malvinas) fur seals are protected by British law. South American Fur Seals have also been afforded protection by the establishment of numerous reserves and protected areas, including privately owned sites.

Particular attention should be paid to local populations in the Pacific. It is possible that the Peruvian and northern Chilean populations are a different stock that may qualify for a threatened status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Fishermen may complain that these fur seals compete with them for valuable fish, such as mackerel and sardines, though their true impact on fisheries is likely to be negligible.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

South American fur seals have been hunted for centuries, both by indigenous peoples and by whalers. Early peoples in the area of Tierra del Fuego, as well as in Uruguay and Peru, used the seal for meat and clothing. Commercial hunting of these seals began in Uruguay as early as the 1500s, mainly for their skins and oil. The oil was used for lighting and later as a medicinal for tuberculosis. Hunting pressure was unregulated until the 1940s, when a population decline in Uruguay was evident. Since then, take has had an annual limit, which now is about 7,000 – 12,000 seals, limited to young males. In Peru, commercial hunting of these fur seals continued until 1959, when it was prohibited. In Chile and Argentina, the seals were hunted and used for bait to catch king crab. Today, commercial hunting is only done in Uruguay. (Reeves, et al. 1992, Jefferson, et al. 1994)

Positive Impacts: ecotourism ; source of medicine or drug ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

South American fur seal

The South American fur seal (Arctocephalus australis) breeds on the coasts of Chile, Peru and Argentina. The total population is around 250,000.

The population of South American fur seals in 1999 was estimated at 390,000, a drop from a 1987 estimate of 500,000. Although overall species numbers are healthy, the downward trend is causing some concern. Uruguay has the largest numbers of seals along its coast, numbering over 200,000.

Contents

Physical description

The South American fur seal has a dark grey coat of fur. The males of the species are almost entirely this color, though they may have grey or tan, grizzled markings. The females and subadult males have lighter grey or tan coloring on the chest and muzzle, and may have rust-brown or medium grey fur on their undersides. The muzzle is flat-topped and pointed, with a medium-sized nose. The nostrils are forward-facing and the nose extends past the mouth. The ear pinnae are long and prominent, and the vibrissae of adults are creamy white and of relatively short length. Adult males are larger than females, with thicker necks and larger shoulders. Males also develop manes of longer guard hairs on thetr heads and shoulders.[2] Size of the seals varies based on region, but on average, adult males measure up to 2 m long and weigh 150–200 kg and females measure up to 1.5 m long and weigh 30–60 kg.[3] Newborns are 60 to 65 cm and 3.5 to 5.5 kg.

Habitat

The South American fur seal is found on neotropical ocean coasts from the Paracas Peninsula of southern Peru south to Cape Horn on the Pacific coast, and northward to southern Brazil on the Atlantic coast. They are also found on the Falkland Islands, Staten Island, and Escondida Island.[4] Arctocephalus australis seals prefer rocky shores and islands, particularly those with steep slopes, which provide shady areas where they can escape the heat of the sun. They have been found in sea caves in Peru, where some climb up to 15 meters to find a spot to rest. There have been isolated records from continental Ecuador, the Galápagos Islands and the Gorgona island (Colombia). Anatomical information for the southern fur seals, Arctocephalus spp., is scant.[5]

References

  1. ^ Campagna, C. (IUCN SSC Pinniped Specialist Group) (2008). Arctocephalus australis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 14 January 2009.
  2. ^ Marine Mammals > Species: Arctocephalus australis (South American fur seal)
  3. ^ South American Fur Seal, Arctocephalus australis at MarineBio.org
  4. ^ ADW: Arctocephalus australis: Information
  5. ^ William Pérez, Helena Katz, Martin Lima. Gross heart anatomy of Arctocephalus australis (Zimmerman, 1783)Anatomical Science International (OnlineEarly Articles). doi:10.1111/j.1447-073X.2007.00189.x
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!