Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

South American fur seals (Arctocephalus australis) inhabit South America. They reside on rocky shores along the coasts of Uruguay, Argentina, Chile and Peru. They are heavily distributed along the Atlantic side of South America. They are also commonly found on the Uruguay islands and the Falkland Islands. These areas are more secluded with less human disturbances and are safer for breeding periods. They are found as far north as central Peru. There have been sightings of these seals as far off as 600 km. However, knowledge of South American fur seals lives at sea is limited.

Biogeographic Regions: neotropical (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

South American Fur Seals are found on both the Atlantic and Pacific sides of South America, from Isla Marco (Uruguay) to Isla Mayorca (Peru). Most of the population is concentrated in the Atlantic side of the distribution, especially in the Uruguayan islands. Colonies are often difficult to access and are not regularly dispersed. Along the coast of continental Argentina, 12 rookeries have been described, all on islands. Some of these locales are only used as wintering places. Ten colonies are recorded where reproduction takes place within the Falkland-Malvinas. In the Pacific, animals concentrate in southern (Magellanic region) and northern Chile and in central Peru. The species has a discontinuous distribution and it is absent in the coast of Chile from 28-43°S.

Distribution at sea is poorly known. These seals are thought to forage primarily in continental shelf and slope waters. However, there are records of this species occurring more than 600 km offshore. Vagrants have been reported from the Pacific coast of Colombia and the Juan Fernandez Islands, and the species visits southern Brazil regularly.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

South America, from central Peru to southern Brazil
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Female and male South American fur seals differ greatly in size. Males can get up to three times larger than females. Females can reach up to 1.4 m in length, whereas males can reach up to 1.9 m. Females weighing 50 kg are considered large, but males can get up to 200 kg. Female seals are either dark brown or a dark gray dorsally, and ventrally are lighter in color. Male colors are similar but can get even darker. Juvenile males begin to produce guard hairs around their face, from the top of their heads to about the shoulder area. When seals become an adult, the mane of guard hair is frosted with a lighter gray coloring. Adult seals have a stocky body and compared to other fur seals, have a longer snout. The fins are also longer and narrower than other fur seals. South American fur seals have 20 upper teeth and 16 lower teeth, which is beneficial when they have to climb on rocky shores. Other fur seal fins may be more paddle like and wider. South American fur seals when born weigh between 3.5 and 5.5 kg and measure 60 to 65 cm in length. When they are first born, the pup is black, and as it grows and molts, it becomes lighter. They molt 3 to 4 months after birth.

Range mass: 60 to 200 kg.

Range length: 1.4 to 1.9 m.

Sexual Dimorphism: male larger; sexes colored or patterned differently

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

South American fur seals spend their time both on shore and in the ocean. Breeding periods are spent on the shores of Peru, Argentina, Uruguay and the Falkland islands. When they are not in breeding season, they are usually in the ocean. When on land, they prefer rocky areas to shield them from the sun. They are able to move quite easily on land and are able to climb steep slopes.

Range depth: 39.6 to 170.6 m.

Habitat Regions: tropical ; terrestrial ; saltwater or marine

Aquatic Biomes: coastal

  • Eales, P., S. Scott, M. Scott, K. Bryan, D. Burnie, et al.. 2006. Ocean: The World's Last Wilderness Revealed. 375 Hudson Street, New York, NY10014: DK Publishing.
  • Reeves, R., B. Stewart, P. Clapham, J. Powell. 2002. Guide to Marine Mammals of the World. New York: Alfred A. Knopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
South American Fur Seals are sexually dimorphic. Adult males are approximately 1.3 times longer and 3.3 times heavier than adult females. Adult males reach 1.9 m and 120–160, and possibly 200 kg; females are about 1.4 m long and weigh 40-50 kg. Newborns are 60-65 cm and 3.5-5.5 kg. Most females give birth for the first time when they are 4 years old. Pups are born shortly after females return to the colonies. Oestrous occurs 7–10 days later, and following mating, a female begins to make foraging trips punctuated by time attending the pup ashore. Pups are weaned at 8 months to 2 years of age. Females will nurse a yearling and newborn pup at the same time.

Breeding takes place from mid-October through mid-January. The timing of breeding may differ in the Peruvian and Chilean-Atlantic colonies. Colonies are generally found along rocky coasts, on ledges above the shoreline or in boulder strewn areas. Most areas utilized have some source of shade such as at the base of cliffs or under boulders and easy access to the ocean or tidal pools. Males are polygymous and territorial, and fighting can result in dramatic wounds and scars. Individual bulls can occupy territories for up to 60 days and have up to 13 females on their territories at Uruguayan colonies. Male vocalizations include a bark or whimper, a guttural threat, and a submissive call. Females growl and have a pup-attraction call that is a high-pitched wail.

Time spent on trips and attending the pup likely varies with location and changes in marine productivity; El Niño years have a negative impact on animals in Peru and during them females must spend much more time attempting to forage. Female attendance in Uruguay is affected by weather with females spending less time ashore during the day when ground temperature exceeds 36ºC and more time ashore during storms. Survival rates of pups can be quite low when marine productivity is low and storm surges can sweep large numbers of pups off colonies. Locally, pup morality inflicted via predation by adult male South American sea lions can be significant at some colonies. Data collected on adult female South American fur seals during an El Niño event resulted in mean dives to 29 m, with a maximum of 170 m and mean duration of 2.5 minutes and maximum dive length of 7 minutes.

The population along the coast of Patagonia is linked to the Uruguayan colonies. Very few births occur in the Patagonian population, so the recent increases in numbers in this area are almost certainly due to a migration from the Uruguayan islands. It is possible that a similar movement occurs between the Staten Island colony and the Chilean colonies via the Beagle Channel.

At sea, these fur seals may be seen travelling or rafting at the surface in groups. South American Fur Seals will "porpoise,” or leap clear of the water when moving rapidly at sea, sometimes travelling like this in large groups. While resting at the surface they spend considerable time grooming and assume many poses typical of southern fur seals, including waving both hind flippers in the air while the head is submerged. Groups often form in the water at the base of a colony. They are frequently seen grooming while resting at the surface.

Demersal and pelagic fishes make up the majority of the diet in Uruguay and include: Anchoveta, weakfish, cutlassfish, and anchovy. Cephalopods, lamellibranchs and gastropods are also taken. Additional prey taken in other areas includes sardines, mackerel, hakes and crustaceans such as lobster krill in southern Chile and the Falkland Islands where squid is also a common prey item.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

South American fur seals are nocturnal hunters. They are known to feed on anchovies, shrimp, lobster, squid and krill. Location plays a role in the primary diet of these seals. In Peru and Uruguay the seals feed on anchovies. The seals living closer to Brazil shores hunt for shrimp. South American fur seals in Chile tend to hunt for krill, specifically lobster krill. Fur seals can dive up to 170 m and can stay underwater for 7 minutes per dive. If the females are caring for young on shore, they will spend a couple days at sea, then come back for a few days to care for their pup. It is not known how much food is consumed by the seals daily in the wild.

Animal Foods: fish; mollusks; aquatic crustaceans

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

South American fur seals are an integral part of their food web and, thus, play a role in ecosystem trophic dynamics.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

South American fur seals are hunted by the South American sea lions, orcas, sharks, and humans. Other dangers posed to them include climate change and over-fishing.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Arctocephalus australis is prey of:
Chondrichthyes
Homo sapiens
Orcinus orca
Otaria byronia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Arctocephalus australis preys on:
non-insect arthropods
Actinopterygii
Mollusca
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

South American fur seals communicate vocally and with touch. Males will compete for territories and females physically. When the seals communicate with each other over distances they use vocalizations. An important aspect of vocal communication between mothers and pups is vital to the pups survival. If at any time the mother and pup are separated they have an individualized call that only the mother and pup recognize. When the mother goes to forage in the ocean for a couple days while lactating, she needs to be able to find her pup again when she returns to shore. If they do not reunite, the young seal risks starving to death and being trampled by other mother seals.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In the wild, fur seals can live between 12 and 30 years. Little else is known about the lifespan of South American fur seals.

Typical lifespan

Status: wild:
12 to 30 years.

Range lifespan

Status: captivity:
female: 30.6, male: 20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30.6 years (captivity) Observations: It has been estimated that females may live up to 30 years in the wild and males up to 20 years (Lima and Paez 1995). One wild born female was about 30.6 years old when she died in captivity (Richard Weigl 2005). Gestation time excludes delayed implantation period.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

South American fur seals are polygynous; males mate with more than one female each breeding period. Males will compete for certain areas along the shore between October and December to establish territories for them and their females. The dominant males will gain the most females and the largest territory. The ratio of male to female South American fur seals is greater than that of any other mammal, implying that each male has more females on average than any other polygynous mammal.

Mating System: polygynous

Each year between October and December South American fur seals begin their breeding period. Males and females come to shore and males fight for territories. Females give birth anytime throughout these three months. Female seals give birth to just one pup per breeding season. When the pups are born they can weigh between 3.5 and 5.5 kilograms and measure between 60 and 65 centimeters long. The pups are first black when they are born and eventually molt to a dark brown or grey. Female South American fur seals wean their pups between 6 and 12 months, but sometimes they can wean up to 3 years. In this extreme case, the mother seal will potentially be nursing two pups at the same time. Seven to ten days after giving birth, the female will mate with a male. Embryonic diapause lasts between 3 and 4 months. The gestation period ranges from 8 to 12 months. Male seals reach sexual maturity around the age of 7, but many of them don’t actually mate until they are 8 years of age. This may be the result of competition required to earn territory and females. Females, on the other hand, reach sexual maturity around the age of 3.

Breeding interval: South American fur seals breed once a year shortly after the females give birth.

Breeding season: South American fur seals breed between October and December.

Range number of offspring: 1 (high) .

Range gestation period: 8 to 12 months.

Range weaning age: 6 to 36 months.

Average weaning age: 12 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; delayed implantation ; embryonic diapause

Average birth mass: 4250 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2556 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Female seals give birth and feed pups until they are able to feed on their own. Mothers wean pups anywhere between 6 to 36 months. After the pup is born the mother alternates between days in the water foraging for food and days on land caring for her young. Often times, the survival of the pup relies on how crowded the shoreline is with seals. When the mother is gone foraging, if the shore is too crowded, the young pup can get trampled by other female seals or get lost and starve.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • 2012. "Marine Bio" (On-line). South American Fur Seals, Arctocephalus australis. Accessed August 20, 2012 at http://marinebio.org/species.asp?id=312.
  • Arnould, J. 2002. Southern Fur Seals. Pp. 1146-1151 in W Perrin, B Wursig, J Thewissen, eds. Encyclopedia of Marine Mammals, Vol. 1, 1 Edition. San Diego, California: Academic Press.
  • Campanga, C. 2008. "Arctocephalus australis" (On-line). IUCN Red List. Accessed August 20, 2012 at http://www.iucnredlist.org/details/2055/0.
  • Charrier, I., N. Mathevon, P. Jouventin. 2003. Individuality in the voice of fur seal females: an analysis study of the pup attraction call in Arctocephalus tropicalis. Marine Mammal Science, 19/1: 161-172.
  • Eales, P., S. Scott, M. Scott, K. Bryan, D. Burnie, et al.. 2006. Ocean: The World's Last Wilderness Revealed. 375 Hudson Street, New York, NY10014: DK Publishing.
  • Phillips, A., I. Stirling. 2000. Vocal individuality in mother and pup South American fur seals, Arctocephalus australis. Marine Mammal Science, 16/3: 592-616. Accessed August 08, 2012 at http://onlinelibrary.wiley.com.ezproxy.uwsp.edu/doi/10.1111/j.1748-7692.2000.tb00954.x/pdf.
  • Reeves, R., B. Stewart, P. Clapham, J. Powell. 2002. Guide to Marine Mammals of the World. New York: Alfred A. Knopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctocephalus australis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AATCGATGATTATTCTCCACAAACCATAAAGATATTGGCACCCTTTATCTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTCAGCCTATTGATCCGCGCGGAGTTGGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATCTACAACGTAATTGTCACCGCCCATGCATTCGTGATAATCTTTTTCATGGTAATACCTATTATAATTGGGGGCTTTGGAAATTGATTAGTACCCCTAATAATTGGAGCCCCCGATATGGCATTTCCTCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTCCTACTACTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCAGGTACCGGATGAACAGTTTACCCTCCCCTAGCAGGAAACCTAGCCCATGCAGGAGCTTCCGTAGACTTAACTATTTTCTCCCTTCACCTGGCAGGAGTATCATCTATTCTGGGAGCCATTAACTTTATTACTACTATTATCAACATGAAACCCCCTGCCATATCCCAATACCAAACCCCTTTATTCGTGTGATCCGTACTAATCACAGCGGTACTACTTCTGCTATCCCTGCCAGTCCTGGCAGCTGGTATCACTATATTACTTACGGACCGAAATCTAAACACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTCATCCTACCAGGATTCGGGATAATCTCACACATCGTCACCTACTACTCAGGAAAAAAGGAACCCTTTGGTTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTCACCGTAGGAATAGATGTTGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctocephalus australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

South American fur seals used to be commercially hunted, but now that is no longer an issue. In 1997 the seals were harmed by an oil spill that covered about 5,000 sq m. An estimated 6,000 seals were killed. During El Nino years, food becomes scarce for the seals on the Pacific side of South America. In Peru 2012, the population was recovering from an El Nino year that wiped out 80% of the females and pups. In Uruguay, the population is healthy and growing.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Campagna, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its large and increasing population size, the South American Fur Seal should remain classified as Least Concern.

IUCN Evaluation of the South American Fur Seal, Arctocephalus australis
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

No integrated census data are available for the entire distribution range. Most of the population is concentrate on a few islands of Uruguay and the best available data suggest that numbers are expanding. A population decrease is possible for the Pacific side of the distribution and may be = 50% for colonies breeding in Chile. The Peruvian population is also under the strong impact of El Niño. In Argentina, the population is relatively small, but it is increasing. Due to a large proportion of the global population being stable or perhaps increasing, the criteria of population reduction do not apply at the species level.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Commercial harvesting has ceased and any local reductions are due to El Niño and to competition with fisheries, but these negative effects occur at a local level rather across the entire distribution range. Therefore, these criteria do not apply for the species.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A reduction in numbers at the species level may occur if climate change increases the impact of El Niño in the Pacific side of the distribution. However, thus far the numbers in the Uruguayan islands are stable or increasing.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A reduction in numbers at the species level may occur if climate change increases the impact of El Niño in the Pacific side of the distribution. However, thus far as the numbers in the Uruguayan islands are stable or increasing. Local colony reductions are not currently significant in terms of total global population size.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR < 100 km²; EN < 5,000 km²; VU < 20,000 km²

The EOO is > 20,000 km².

B2. Area of occupancy (AOO): CR < 10 km²; EN < 500 km²; VU < 2,000 km²

The AOO is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN < 5; VU < 10
(b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR < 250; EN < 2,500; VU < 10,000

Number of mature individuals is likely > 10,000.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR < 50; EN < 250; VU < 1,000
or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR < 50; EN < 250; VU < 1,000 AND/OR restricted area of occupancy typically: AOO < 20 km² or number of locations < 5


E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction.

Listing recommendationGlobally, the South American Fur Seal should be classified as Least Concern. However, particular attention should be paid to local populations in the Pacific. It is possible that the Peruvian and northern Chilean populations are a different stock that may qualify for a threatened status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Most of the global population of South American Fur Seals is concentrated in Uruguay (200,000-250,000 animals). About 55% of the fur seals in Uruguayan waters are found at Isla de Lobos (ca. 180,000 animals; ca. 35,000 pups born per year). The remaining animals are distributed in the area of Cabo Polonio and Islas de la Coronilla. An additional 15-20 000 animals are found in the Malvinas-Falklands. The population along the Argentine Patagonian coast is about 20 000 animals (the largest colony is in Isla Rasa with 12 000 fur seals). The Chilean population is estimated to be 30 000 fur seals. The Peruvian population was estimated to be 11,400 during an El Niño year (Arias-Schreiber 1998). Therefore, the population global population is roughly 250-300 000 fur seals. The population of coastal Patagonia is increasing at about 8% per year. A decrease from 102,000 to 30.000 has been reported for the Chilean population (Sielfeld 1999, Venegas et al. 2002). El Niño years have dramatic effects on the Peruvian population.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Human subsistence hunting of South American Fur Seals undoubtedly began with first contact and continues today. Commercial exploitation began after the discovery of South American Fur Seals by Europeans in the 18th century. Harvest levels declined in the 20th century bringing about the cessation of hunting at many locations. A managed harvest of adult males continued in Uruguay until recent times (Vaz-Ferreira and Ponce de Leon 1987). Small numbers of fur seals are taken for subsistence and poached for human food in Chile in Peru. Animals are often shot in the coastal areas of Peru and an estimate yielded that up to 35% of the dead seals found on beaches have been shot.

Extensive development of large-scale commercial fisheries and ongoing, numerous small-scale coastal fisheries have had an unknown effect on the amount of food available to South American Fur Seals. These fisheries are also a source of entanglements and direct mortality.

In southern Chile, seals were illegally exploited some time ago as a source of free bait for the king crab fishery. Because this fishery is decreasing due to overexploitation, hunting pressure on the fur seal is being reduced, although incidental captures in shark nets have been reported for Uruguay (Scialabba 1989). Small numbers of fur seals are also caught in the Chilean trawl-fisheries.

Survival rates of pups can be quite low when marine productivity is low and storm surges can sweep large numbers of pups off colonies. During El Niño years, mortalities of 100% of pups born have been recorded. Also, high mortality rates of pups occur in dense colonies.

The limited number of large, dense breeding aggregations could make this species particularly sensitive to the effects of oil spills and disease epidemics. Like all fur seals, South American Fur Seals are vulnerable to oil spills because of their dependence on their thick pelage for thermoregulation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix II. South American Fur Seals are protected and managed by laws in most of the countries where they occur. In Chile, the status of total protection was given to all Arctocephalus species in 1978 (Torres 1987, Reijnders et al 1993). In Argentina, marine mammals are under the administration of the various provinces. At the Falkland Islands (Malvinas) fur seals are protected by British law. South American Fur Seals have also been afforded protection by the establishment of numerous reserves and protected areas, including privately owned sites.

Particular attention should be paid to local populations in the Pacific. It is possible that the Peruvian and northern Chilean populations are a different stock that may qualify for a threatened status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative economic effects of South American fur seals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These seals were hunted from 1515 to 1979 in Uruguay and Chile. Seals are no longer hunted commercially, but are still often poached. South American fur seals were hunted for their fur, skin, and oil to make clothes, leather, and light lanterns respectively. When they are poached, often time their meat is used for king crab bait.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

South American fur seal

The South American fur seal (Arctocephalus australis) breeds on the coasts of Chile, Peru, and Argentina. The total population is around 250,000.

The population of South American fur seals in 1999 was estimated at 390,000, a drop from a 1987 estimate of 500,000. Although overall species numbers are healthy, the downward trend is causing some concern. Uruguay has the largest numbers of seals along its coast, numbering over 200,000.

Physical description[edit]

The South American fur seal has a dark grey coat of fur. The males of the species are almost entirely this color, though they may have grey or tan, grizzled markings. The females and subadult males have lighter grey or tan coloring on the chest and muzzle, and may have rust-brown or medium grey fur on their undersides. The muzzle is flat-topped and pointed, with a medium-sized nose. The nostrils are forward-facing and the nose extends past the mouth. The ear pinnae are long and prominent, and the vibrissae of adults are creamy white and of relatively short length. Adult males are larger than females, with thicker necks and larger shoulders. Males also develop manes of longer guard hairs on their heads and shoulders.[2] Size of the seals varies based on region, but on average, adult males measure up to 2 m long and weigh 150–200 kg and females measure up to 1.5 m long and weigh 30–60 kg.[3] Newborns are 60 to 65 cm and 3.5 to 5.5 kg.

Habitat[edit]

The South American fur seal is found on neotropical ocean coasts from the Paracas Peninsula of southern Peru south to Cape Horn on the Pacific coast, and northward to southern Brazil on the Atlantic coast. They are also found on the Falkland Islands, Staten Island, and Escondida Island.[4] A. australis seals prefer rocky shores and islands, particularly those with steep slopes, which provide shady areas where they can escape the heat of the sun. They have been found in sea caves in Peru, where some climb up to 15 m to find a spot to rest. There have been isolated records from continental Ecuador, the Galápagos Islands, and the Gorgona Island (Colombia). Anatomical information for the southern fur seals, Arctocephalus spp., is scant.[5]

Subspecies[edit]

Two subspecies are currently recognised:[6]

  • A. a. australis - Falkland Islands
  • A. a. gracilis - South America

The New Zealand fur seal is sometimes considered a subspecies of A. australis.[6]

References[edit]

  1. ^ Campagna, C. (IUCN SSC Pinniped Specialist Group) (2008). Arctocephalus australis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 14 January 2009.
  2. ^ Marine Mammals > Species: Arctocephalus australis (South American fur seal)
  3. ^ South American Fur Seal, Arctocephalus australis at MarineBio.org
  4. ^ ADW: Arctocephalus australis: Information
  5. ^ William Pérez, Helena Katz, Martin Lima. Gross heart anatomy of Arctocephalus australis (Zimmerman, 1783)Anatomical Science International (OnlineEarly Articles). doi:10.1111/j.1447-073X.2007.00189.x
  6. ^ a b Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!