Overview

Distribution

New Zealand fur seals (Arctocephalus forsteri) are a non-migratory coastal species. Prior to being driven to near extinction, the population was historically found all around the North and South Islands including many offshore islands and sub-Antarctic islands. Today, they are found in New Zealand, around South Island, Big Green Island, Open Bay Islands, West Coast, Cape Foulwind, Cascade Point, Wekakura Point, Three Kings Islands, eastern Bass Strait, the Nelson-northern Marlborough region, Fjordland, New Zealand's sub-Antarctic islands Snares, Campbell, Chatham Islands, Antipodes, Bounty Islands, Stewart Island, the islands of the Foveaux Strait, a small colony at Cape Palliser near Wellington on the North Island and near the continental shelf edge of Otago Peninsula. There is also a population in southern and western Australia, Kangaroo Island, Tasmania and Victorian coastal waters, although the two New Zealand and Australian populations rarely overlap. On Australia’s sub-Antarctic Macquarie Island, a population of young non-breeding males was discovered. They are believed to have originated from New Zealand. The distribution of seals across this range is largely a result of the distribution of their food source. When New Zealand fur seals migrate it’s during the breeding season. However, during the summer, they stay closer to the rookery (70 to 80 km) then they do during the fall and winter seasons (162 to 178 km).

Biogeographic Regions: australian (Native ); oceanic islands (Native ); indian ocean (Native ); pacific ocean (Native )

Other Geographic Terms: island endemic

  • Boren, L. 2005. New Zealand fur seals in the Kaikoura region: colony dynamics, maternal investment and health. University of Canterbury: University of Canterbury. Biological Sciences. Accessed February 02, 2012 at http://hdl.handle.net/10092/1270.
  • Boren, L. 2010. Diet of New Zealand fur seals (Arctocephalus forsteri). DOC Research & Development Series 319, Series 319: 1-20.
  • Bradshaw, C., L. Davis, C. Lalas, R. Harcourt. 2000. Geographic and temporal variation in the condition of pups of the New Zealand fur seal (Arctocephalus forsteri): evidence for density dependence and differences in the marine environment. Journal of Zoology, 252/1: 41-51.
  • Crawley, M., G. Wilson. 1976. The natural history and behaviour of the New Zealand fur seal (Arctocephalus forsteri). Tuatara : Journal of the Biological Society, 22/1: 1-28.
  • Goldsworthy, S., N. Gales. 2011. "Arctocephalus forsteri" (On-line).
    IUCN Red List of Threatened Species
    . Accessed January 31, 2012 at http://www.iucnredlist.org/apps/redlist/details/41664/0.
  • Harcourt, R. 2001. Advances in New Zealand mammalogy 1990–2000:. Journal of the Royal Society of New Zealand, 31/1: 135-160.
  • MarineBio.org, 2011. "New Zealand fur seals, Arctocephalus forsteri at MarineBio.org" (On-line). MarineBio.org. Accessed January 31, 2012 at http://marinebio.org/species.asp?id=308.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

In New Zealand, this species occurs around both the North and South Islands, with small breeding colonies on the north and larger colonies on the west and southern coast and islands around the South Island, as well as on all of New Zealand's sub-Antarctic islands. They are less common off the North Island, with no colonies, but they do occur as far north as the Three Kings Islands. Their range extends to Macquarie Island, where males mate with Antarctic and Subantarctic fur seals and produced hybrid pups. Vagrants have been recorded in New Caledonia and from a bone in a 14th century archaeological site in the Cook Islands.

New Zealand Fur Seals also occur in the coastal waters and on the offshore islands of South and Western Australia, from just east of Kangaroo Island west to the southwest corner of the continent in Western Australia. Small populations are also establishing in Tasmania and Victorian coastal waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

New Zealand fur seals have a pointed nose, long whiskers and ear flaps. The adult coat consists of two layers, a topcoat that is a dark grey-brown on the dorsal side, which gradually lightens to a lighter gray-brown underside, provides a sense of camouflage, and a thick undercoat. Seals dark appearances comes from their deep chestnut undercoat and the dark gray coarse guard hairs of the topcoat. When the fur is wet, it appears darker, but when it is dry the white tipped guard hairs give off a silvery sheen.  At five months, the pups shed their black coats for their more adult silvery-grey coats. The bulls have long, thick guard hairs that make up their coarse mane. The females do not develop this mane. New Zealand fur seals are sexually dimorphic. The males are three times the females’ weight and 1.3 times longer. Bulls are massive throughout their neck and shoulders, while females possess an overall slender physique. Even male pups are significantly larger than female pups, which is due the high lipid reserves of female pups, while the male pups consist of more lean muscle tissue.  Adult males average 1.5 to 2.5 m long and weigh 120 to 180 kg. Adult females average 1 to 1.5 m long and 30 to 50 kg. The largest male on record weighed 250 kg and the largest female weighed 90 kg.  Physically there are no differences between the New Zealand fur seal and the Australian fur seal. Only genetic differences distinguish them.

Range mass: 30 to 250 kg.

Average mass: Males: 120 to 180, Females: 30 to 50 kg.

Range length: 1 to 2.5 m.

Average length: Males: 1.5 to 2.5, Females: 1 to 1.5 m.

Sexual Dimorphism: male larger; sexes shaped differently

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The New Zealand fur seals often inhabit rocky coastlines and offshore islands that provide protection from the strong ocean waves. They seem to prefer beaches with large rocks, reefs just off the coast and smooth rocky ledges to gain easy access to the sea. Warmer islands tend to have rock pools that the seals use for cooling.  Areas of vegetation that contain tussock and scrub are the usual sanctuaries of breeding seals and their young. Non-breeding colonies are more flexible in their choice of habitat Females are mid-water feeders with the distance and depth depending on the season and the age of their pups. During the breeding season, they will feed just beyond the continental shelf. During the fall and winter seasons, they will venture out for longer periods of time and dive further depths. Adult males feed over the continental slope and the juvenile seals forage in areas specifically containing the migrating lanternfish. Both the adult males and females will forage in shallow waters (0 to 20 m), but most often do benthic dives off the continental slope (females 60 to 80 m and males 100 to 200 m). The longest dive and deepest depth recorded for the females are 9.3 minutes and 312 m, whereas for males they are 14.8 minutes and 380 m.

Range elevation: Sea Level (low) m.

Range depth: 0 to 380 m.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
New Zealand Fur Seals are sexually dimorphic, with adult males reaching 1.3 times the length and more than 3 times the weight of adult females. There is some variation in the weights of adult males in the literature. Some ranges are up to a maximum of 250 kg, others to 200 kg. The largest male weighed at the Open Bay Islands of New Zealand was 154 kg. Adult males 8-12 years old had a maximum weight of 124 kg. Adult males are up to 2 m long. Adult females are 1.5 m and 30-50 kg. Pups average 3.3-3.9 kg and 40-55 cm at birth and male pups average 14.1 kg and females 12.6 kg around weaning when they are approximately 290 days old. Pups moult into adult pelage at 2-3 months. Females become mature at 4-6 years of age, males at 8-10 years (Dickie and Dawson 2003, McKenzie et al. 2005, 2007).

New Zealand Fur Seals are polygynous. Males arrive at colonies in late October before females and acquire and defend territories with vocalizations, ritualized displays and fighting. Male territories include an average of 5-8 females with the ratio of females to males varying between different colonies. The number of animals ashore at rookeries declines rapidly in January. Male vocalizations include a bark or whimper, a guttural threat, a low-intensity threat, a full threat, and a submissive call. Females growl and have a pup-attraction call that is a high-pitched wail.

Pups are born from mid-November to January, with most pups are born in December. Oestrous occurs 7-8 days after a female gives birth, and they usually spend another 1-2 days ashore with their pup before departing and beginning a cycle of foraging trips and periods of pup attendance ashore (Goldsworthy and Shaughnessy 1994, Goldsworthy 2006). Pups are weaned when they are about 10 months old. Adult female foraging trips are shorter when the pup is young and become longer as the pup gets older. In general, on-shore attendance bouts last under 2 days.

New Zealand Fur Seals are considered non-migratory. At sea they actively groom and raft in a variety of postures typical of southern fur seals including the “jug handle” position while sleeping at the surface. They often “porpoise” out of the water when travelling rapidly at sea. Rocky shoreline habitat with shelter, and locations more exposed to wind and weather are preferred for haul-outs and rookeries. When hauled out in New Zealand, New Zealand fur seals readily enter areas of coastal vegetation behind the shoreline.

New Zealand Fur Seals prey on a large variety of cephalopods, fish, and birds (Goldsworthy et al. 2003). In South Australia, key cephalopods prey include, Southern Ocean arrow squid and Gould’s squid; key fish species include redbait, ocean jackets, swallowtail and myctophids; and the most frequently taken bird species are little penguins and short-tailed shearwaters. Satellite tracking studies in South Australia indicate marked spatial separation in foraging regions used by juvenile, adult female and males seals. Lactating females forage predominantly in mid- to outer-continental shelf waters during summer months and then switch to deeper oceanic waters over winter months. In contrast, adult males focus their foraging over the continental slope. Juvenile seals forage in oceanic waters where they target nocturnal surface-migrating myctophid fish (Baylis et al. 2005). Adult female and male seals both forage in the water column in relative shallow depths (0-20 m) and near or on the bottom in deeper water. In females, benthic dives on the continental shelf in South Australia are typically at 60-80 m, while those of males on the continental slope are between 100-200 m. The maximum dive durations and depths recorded for adult females are 9.3 min and 312 m, and 14.8 min and 380 m for males.

Predators include Killer Whales, sharks, male New Zealand Sea Lions and possibly Leopard Seals at sub-Antarctic islands (Shaughnessy 2006).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The New Zealand fur seals are opportunistic foragers and will vary their diet according to what is available in the season and their location. They prey on several different cephalopods, fish, and birds throughout the year. The New Zealand fur seals can use their whiskers to feel underwater vibrations to help them to locate their food. Some of the animals they have been found to eat are: small penguins like the rockhopper penguins, short-tailed shearwaters, arrow squid, broad squid, warty squid, Antarctic flying squid, butterfish, New Zealand octopus, krill, lamprey, blind eel, ling, ahuru, crayfish, crab, lanternfish (Myctophidae, Symbolophonts, Lampanyctodes hectoris, Gymnoscopelus, Electrona), juvenile red cod, blue cod, flounder, whiptail, kahawai, horse mackerel, redbait, anchovy, ocean jackets, hagfish, spiny dogfish, school shark, sprat, silverside, lightfish, hoki, rattail, tarakihi, opalfish , Graham's gudgeon, barracouta, rostfish, warehou, lemon sole, sole, wary fish, dory, yelloweyed mullet, dwarf cod, Oliver's rattail, yellow weever, silver warehou, Southern blue whiting, javelin fish, deepsea smelt, common roughy, seaperch, and pilchard. Very few of these species are commercially important.

Animal Foods: birds; fish; mollusks; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Molluscivore , Eats other marine invertebrates)

  • Carey, P. 1992. Fish prey species of the New Zealand fur seal. New Zealand Journal of Ecology, 16/1: 41-46.
  • Nyree, F., R. Harcourt, C. Lalas. 1999. Seasonal variation in the diet of New Zealand fur seals (Arctocephalus forsteri) at Otago Peninsula, New Zealand. Wildlife Research, 26/2: 147-160.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

New Zealand fur seals host bacteria such as Mycobacteria tuberculosis and Campylobacter jejuni along with a few parasites. Lungworms such as Parafilaroides normani and Otostrongylus spp. also have been found along with respiratory mites (Orthohalaracne). New Zealand fur seals may also have blubber-cysts, which are the larvae of the cestode, Phyllobothrium enclosed in a cyst. Hookworms (Uncinaria spp.) and large roundworms such as Contracaecum, Psuedoterranova, Phocascaris and Anisakis are the most common parasites found in fur seals. Large amounts of these roundworms have been known to cause stomach ulcers.

Commensal/Parasitic Species:

  • Parafilsroides species
  • Otostrongylus species
  • Orthohalaracne
  • Phyllobothrium
  • Uncinaria species
  • Contracaecum
  • Psuedoterranova
  • Phocascaris
  • Anisakis

  • Bernardelli, A., R. Bastida, J. Loureiro, H. Michelis, M. Romano, A. Cataldi, E. Costa. 1996. Tuberculosis in sea lions and fur seals from the south-western Atlantic coast. Revue Scientifique et Technique de l'OIE, 15/3: 985-1005.
  • Dailey, M. 2009. A New Species of Parafilaroides (Nematoda: Filaroididae) in Three Species of Fur Seals (Carnivora: Otariidae) From the Southern Hemisphere. Journal of Parasitology, 95/1: 156-159.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators include sharks, orcas, leopard seals, New Zealand sea lions, and humans. The only primary anti-predator adaptation the New Zealand fur seal has acquired through evolution is its coat color that blends into its rocky land surroundings, its ability to swim swiftly through water, and its ability to climb onto shore.

Known Predators:

  • orcas (Orcinus orca)
  • leopard seals (Hydrurga leptonyx)
  • New Zealand sea lions (Phocarctos hookeri)
  • humans (Homo sapiens)
  • sharks (Chondrichthyes)

Anti-predator Adaptations: cryptic

  • Bradshaw, C., C. Lalas, S. Mcconkey. 1998. New Zealand. New Zealand Journal of Marine and Freshwater, 32/1: 101-104.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

New Zealand fur seals communicate through posture and physical movement. Territory boundaries and readiness to fight can be recognized through these actions.  Status of males can be assessed and established by the full neck display, where the smaller-necked males avoid the confrontation. The full neck posture is described as sitting in an upright, vertical position. The chest is protruding out, head is tilted back and nose is pointed up towards the sky. If the two males are the same size, the full neck display is done for much longer where the male’s chests keep in contact with the other. In order to prolong the display, while maneuvering for an attack position neck waving is conducted. When they carry their neck and head low dipped position, it’s to indicate submission; either after losing a full neck display or to avoid a fight in general. The male seal that has lost the full neck display faces away to appease the winner.  The alert posture shows general awareness, where an open-mouth display is used as an aggressive and a submissive display. Young pups have also been seen doing these displays during play-fighting with one another, however as the pups get older, they are more aggressive and skilled.

New Zealand fur seals also produce vocalizations, to give low intensity threatening calls. Territorial males will often bark to demonstrate their status or give a loud, deep, throaty, gruff call known as a choke call. The bark can also show sexual interest, where both males and females will whine or squeal to be more submissive. Male fur seals also whine or squeal to appease the winning male after a fight, while females threaten others by producing a high-pitched raspy growl.  When a female needs to locate her pup she uses both vocalization and vision. Once the female leaves the water she holds her body upright, extends and arches her head and neck forward searching, producing a high-pitched, rising screech. The returned call from the pup is also a high-pitched screech, but more monotone. To confirm recognition the female uses her olfactory senses to either accept or reject the pup as they sniff each other’s faces and noses.  The seal’s whiskers are useful in sensing, underwater vibrations and therefore locate food.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In the wild, the oldest observed New Zealand fur seals were a 25 year-old female and a 19-year-old male. The average lifespan in the wild is assumed to be 15 years for a male and 12 years for a female.  However, the first year is the hardest - during the first 300 days, pup mortality is approximately 40%. The only captive age recorded was 23.1 years.

Range lifespan

Status: wild:
Female-25, Male-19 (high) years.

Average lifespan

Status: wild:
Female-12, Male-15 years.

Range lifespan

Status: captivity:
23.1 (high) years.

  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits.. Journal of Evolutionary Biology, 22/8: 1770-1774.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but one specimen was about 23.1 years old when it died in captivity (Richard Weigl 2005). Males are socially mature about 10-12 years of age (Virginia Hayssen et al. 1993).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

New Zealand fur seals have a polygynous system, in which the male defends his territory with his harem of 5 to 8 females. As an island-hopper, a male fur seal will choose an island as his breeding site. When they arrive at an island, males will compete with each other to establish their territories a full two weeks before pregnant females come ashore.  Successful males with established territories are typically those between 7 and 15 years of age. Both male and female seals that aren’t breeding find other hauling grounds to rest upon during that season. The ideal territory has many shaded areas for the male and his group of females to cool themselves. These sheltered areas near the sea are frequently fought over throughout the breeding season and seldom left unoccupied by the territory holder. Seals appear on the hauling grounds, which allow easy access to and from the sea, around late October and stay until at least early February. As the breeding season progresses and the number of territorial males increases, the size of an individual’s territory decreases.  Most communication during the breeding season is aggressive. The males will herd the females to keep them on their territory and away from the other males. The longer the female is on a male’s territory, the higher the chances are that she will mate with him. Each male performs his herding techniques slightly different from the others. Females are allowed to move about the hauling grounds, but the herding territorial males make it difficult by blocking access for up to an hour at times.  Smelling is another key part of their mating behaviors. Males will smell the face and perineal regions of females to determine if the female is ready to mate. If the female is not ready to receive the male she displays aggressive behaviors such as growling, snapping and moving away. Females become more aggressive right before and after birth. Around eight days after giving birth, the female again goes into estrous. When the female is in estrous she will show interest in the male who occupies the territory she gave birth in by rubbing up against him and displaying very little aggression. The male detects the female’s sexual readiness by olfaction primarily. Copulation consists of mutual touching, and the male mounting and biting. When the female begins to the resist the male, he soon ejaculates and dismounts the female. The entire copulation can take from 5 to 30 minutes.

Mating System: polygynous

The breeding season for the New Zealand fur seal starts in late October and ends by early February. To increase breeding opportunities, males will remain ashore for as long as possible, surviving off energy reserves. The male will not eat for two to three months of breeding season. Cows typically mate once a year and have a gestation period of nine months. After fertilization the embryo goes through a 2 to 4 month delayed implantation. This allows females to birth and mate in the same breeding season. It also allows her body recovery time between birthing and the development of her next pup. The pups are born between late November and mid-January, with an average length of 40 to 55 cm. These pups are precocial, and can start suckling within 60 minutes. At 9 to 10 months of age the pups are weaned. There is significant weight variation in the pups at birth, which may be explained by the considerable sexual dimorphism between the two sexes. Male pups weigh on average 3.9 to 5.6 kg at birth and females at birth weigh 3.3 to 4.8 kg. At 290 days old the male pups weighed 14.1 kg and the females were 12.6 kg. From birth to 240 days of age the pups gained on average 24 g and 0.86 cm a day, but this rate slowed as they continued to age. Both male and female New Zealand fur seals reach sexual maturity around four to five years of age. Females will deliver their first pup at this time, but males don’t become territorial until 8 to 10 years because their body size does not compete with other males. Seven to eight days after giving birth, the cows will mate with the bull closest to her. Usually this will end up being the bull in whose territory they reside. Females breed anytime throughout the breeding season. However, only females breeding for the first time or females that didn't birth and rear a pup the year before are early season breeders.

Breeding interval: The New Zealand fur seal breeds once yearly.

Breeding season: The New Zealand fur seal breeding season is between late October and early February.

Range number of offspring: 0 to 1.

Average gestation period: 9 months.

Average weaning age: 9 to 10 months.

Average time to independence: 9 to 10 months.

Range age at sexual or reproductive maturity (female): 4 to 8 years.

Average age at sexual or reproductive maturity (female): 5 years.

Range age at sexual or reproductive maturity (male): 4 to 5 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous ; delayed implantation

Average birth mass: 3833.33 g.

Average gestation period: 236 days.

Average number of offspring: 1.

When New Zealand fur seal cows have have pups they protect and nurse it. Six to twelve days after giving birth, cows will leave their pup with other pups and start the feeding/weaning cycle. Mothers will go to sea and feed for three to eight days before returning to their pup and let it suckle for two to seven days. As the pup gets older, the foraging trips the cow takes gradually become longer and her time ashore becomes shorter. Harems occur when multiple females loyal to territorial bulls return to the bull’s territory. When several of the mothers simultaneously leave their pups for longer periods on feeding trips, the pups gather into small groups called pods until each hears the call of its mother and returns to her to suckle. The older the pups get, the more adventurous they become. They swim in water pools, play with the other pups, and mimic battles. The birth mass of the pup is related to the changes in yearly conditions such as place of birth, the mother’s age, her experience, prey abundance, and the mother’s foraging efficiency.

Parental Investment: precocial ; female parental care ; pre-independence (Provisioning: Female, Protecting: Female)

  • Bradshaw, C., L. Davis, C. Lalas, R. Harcourt. 2000. Geographic and temporal variation in the condition of pups of the New Zealand fur seal (Arctocephalus forsteri): evidence for density dependence and differences in the marine environment. Journal of Zoology, 252/1: 41-51.
  • Crawley, M., G. Wilson. 1976. The natural history and behaviour of the New Zealand fur seal (Arctocephalus forsteri). Tuatara : Journal of the Biological Society, 22/1: 1-28.
  • Gales, N., B. Haberley, P. Collins. 2000. Changes in the abundance of New Zealand fur seals, Arctocephalus forsteri, in Western Australia. Wildlife Research, 27/2: 165 - 168.
  • Goldsworthy, S., N. Gales. 2011. "Arctocephalus forsteri" (On-line).
    IUCN Red List of Threatened Species
    . Accessed January 31, 2012 at http://www.iucnredlist.org/apps/redlist/details/41664/0.
  • Harcourt, R. 2001. Advances in New Zealand mammalogy 1990–2000:. Journal of the Royal Society of New Zealand, 31/1: 135-160.
  • Lloyd, S. 2003. "Seals - New Zealand fur seal" (On-line). Te Ara - the Encyclopedia of New Zealand. Accessed March 16, 2012 at http://www.teara.govt.nz/en/seals/5.
  • MarineBio.org, 2011. "New Zealand fur seals, Arctocephalus forsteri at MarineBio.org" (On-line). MarineBio.org. Accessed January 31, 2012 at http://marinebio.org/species.asp?id=308.
  • McKenzie, J., B. Page, P. Shaughnessy, M. Hindell. 2007. Age and reproductive maturity of New Zealand fur seals (Arctocephalus forsteri). Journal of Mammalogy,, 88/3: 639-648.
  • Miller, E. 1974. Social behaviuor between adult male and female New Zealand fur seals, Arctocephalus forsteri (Lesson) during the breeding season. Australian Journal of Zoology, 22/2: 155 - 173.
  • Stirling, I. 1970. Observations on the behavior of the New Zealand fur seal (Arctocephalus forsteri). Journal of Mammalogy, 51/4: 766-778.
  • Stirling, I. 1971. Studies on the behaviour on the South Ausralian fur seal, Arctocephalus forsteri (Lesson) I. Annual cycle, postures and calls, and adult males during breeding season. Australian Journal of Zoology, 19/3: 243-266.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctocephalus forsteri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCGTAAATCGATGATTATTCTCCACAAACCATAAAGATATTGGCACCCTCTATTTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTTAGCCTATTGATCCGCGCGGAGTTAGGCCAACCAGGCACTCTACTAGGAGATGACCAAATCTACAACGTAATTGTCACCGCCCACGCATTCGTAATAATCTTTTTTATGGTAATACCTATTATAATTGGGGGCTTTGGAAATTGATTAGTACCCCTAATAATTGGAGCCCCCGACATGGCATTTCCTCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTTCTACTACTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCAGGTACCGGATGAACAGTTTACCCTCCTCTAGCAGGAAATCTAGCCCATGCAGGAGCTTCCGTAGACTTAACTATTTTCTCCCTTCACCTGGCAGGAGTATCATCCATTCTGGGAGCCATCAACTTTATTACTACTATTATCAACATGAAACCCCCTGCTATATCCCAATACCAAACCCCTTTATTCGTGTGATCCGTACTAATCACAGCGGTACTACTTCTGCTATCCCTACCAGTCCTGGCAGCTGGTATCACTATATTACTCACGGACCGAAATCTAAACACAACCTTCTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTGTATATTCTCATCCTACCAGGATTCGGGATAATCTCACACATCGTCACCTATTACTCAGGAAAAAAGGAACCCTTTGGTTATATGGGAATAGTCTGAGCAATAATATCAATCGGCTTCTTAGGCTTTATCGTATGAGCACACCATATATTCACCGTAGGAATAGATGTTGACACACGAGCATACTTCACCTCAGCCACTATAATTATCGCCATCCCTACTGGAGTAAAAGTATTTAGCTGACTAGCTACTCTGCATGGTGGTAACATCAAATGATCTCCTGCCATACTATGAGCCTTAGGATTTATCTTCCTATTCACAGTAGGAGGCCTCACAGGCATTGTGTTAGCAAACTCATCATTAGATATCGTCCTCCACGATACATACTACGTGGTGGCACACTTTCATTACGTATTATCAATAGGAGCAGTGTTTGCTATTATGGGCGGATTCGTTCATTGATTCCCCTTATTTTCAGGATTCATGCTCGATAGTACCTGGGCGAAAATCCACTTCACAATCATATTTGTTGGGGTCAATATGACATTCTTCCCACAACATTTTTTAGGCCTATCCGGAATACCACGACGATACTCTGACTACCCAGACGCCTACACAACATGAAATACAATCTCCTCTATAGGCTCGTTCATCTCACTTACGGCAGTGATACTTATGGTCTTCATAATCTGAGAAGCCTTTGCGTCCAAACGAGAGGTAGAGACGATTGAACTGACATCGACTAATATGGAGTGACTTCACGGATGTCCTCCTCCCTATCATACATTCGAAGAACCTACCTATATTGTATCGAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctocephalus forsteri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

New Zealand fur seals are listed as a low risk on the IUCN Red List, because they were once harvested by the native Polynesian culture and European sealers in the 1900s. In 1972, fur seals were given national protection. Trawling nets have been a source of drowning and entanglement to more than 10,000 New Zealand fur seals from 1989 to 1998. Hence, environmental groups are advocating for the creation of a trawl net that will not catch marine mammals. Environmentalists are also advising fish farms to build seal-proof barriers or away from fur seal habitats. Tourism also causes disturbances for the seals. They will often abandon those areas for quieter island shores. New Zealand fur seals are now protected by laws in Australia and New Zealand. All marine mammals of New Zealand are protected by the Marine Mammals Protection Act of 1978. In 2004, the Department of Conservation established a 5-year Conservation Plan. The Australian Commonwealth Government and the State Government each have their own jurisdiction over all marine animals that are within 4.8 km of the coast. New Zealand fur seals are protected by the Marine Mammal Sanctuary that was created in the Auckland Islands and by UNESCO in 1998 when they granted the New Zealand’s subantarctic islands “World Heritage” status. In 1999 a Conservation Action Plan was published for all Australian seals. On the eastern side of Macquarie Island in 2000, a 16 million hectare Marine Park was established. The Tasmanian government then encompassed all of Tasmania’s waters and 5.6 km adjoining Tasmania into the Macquarie Island Nature Reserve.  These parks, reserves, laws, conservation plans and environmentalist groups successfully protect New Zealand fur seals. Since conservation efforts went into effect, seal population numbers have been on the rise.

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Goldsworthy, S. & Gales, N. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its large and apparently increasing population size, the New Zealand Fur Seal should be classified as Least Concern.

IUCN Evaluation of the New Zealand Fur Seal, Arctocephalus forsteri
Prepared by the Pinniped Specialist Group

A. Population reduction
Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

New Zealand Fur Seal abundance in New Zealand and Australia combined is approximately 200,000 individuals. The population trend is increasing. Most of the population in Australia is in South Australia, where pup production has been increasing by >12% per year on Kangaroo Island over a 20 year period. Generation time has been estimated as 9.9 years. Because the population is large and increasing, these criteria do not apply for this species.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Commercial harvesting has ceased and populations have been increasing for at least the last 30 years. Therefore, these criteria do not apply for the species.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of New Zealand fur seals is not expected in the future. However, local impacts from fisheries by-catch in parts of the range, and/or global climate change may have detrimental impacts on the species.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

The New Zealand Fur Seal population is still recovering from 18th, 19th and early 20th century sealing. Populations have been recovering over at least the last 30 years and are expected to continue to recover into the near future. Therefore, these criteria do not apply for the species.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR < 100 km²; EN < 5,000 km²; VU < 20,000 km²

The EOO is > 20,000 km².

B2. Area of occupancy (AOO): CR < 10 km²; EN < 500 km²; VU < 2,000 km²

The AOO is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN < 5; VU < 10
(b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

None of the B criteria apply for this species.

C. Small population size and decline
Number of mature individuals: CR < 250; EN < 2,500; VU < 10,000

Number of mature individuals is >10,000. These criteria do not apply for the species.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR < 50; EN < 250; VU < 1,000
or
(a ii)
% individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

None of the C criteria apply for this species.

D. Very small or restricted population
Number of mature individuals: CR < 50; EN < 250; VU < 1,000 AND/OR restricted area of occupancy typically: AOO < 20 km² or number of locations < 5

Number of mature individuals is >10,000. The AOO is > 2,000 km². Therefore, these criteria do not apply for the species.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

A PVA has been undertaken on the South Australian subpopulation, which suggested very low extinction probabilities. Therefore, these criteria do not apply for the species.

Listing recommendationPopulations of the New Zealand Fur Seal are presently increasing, and there is no evidence for sustained declines in any parts of their range. The breeding range of the species is still expanding in both New Zealand and Australia. Although the species is subject to by-catch in commercial fisheries in both New Zealand and Australia, these levels, at present do not appear to be inhibiting broad scale population recovery. The species should be categorized as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The total population is estimated to be approximately 200,000 with about half of these in Australia. Populations are increasing in both Australia and New Zealand (e.g. Brothers and Pemberton 1990).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Humans have probably harvested New Zealand Fur Seals for subsistence since first contact in both Australia and New Zealand. There is evidence that Polynesian colonization of New Zealand and harvest of seals led to declines and loss of colonies on the coast of the North Island. European sealers nearly exterminated the species in the 19th century, but due to protection, the species has rebounded to occupy most of its former range.

Trawl and other fisheries are a source of entanglement and drowning (Page et al. 2004). Tourism and disturbance at colonies can lead to disruption of breeding behaviour and site abandonment, although most colonies are on offshore islands and are relatively inaccessible.

Like all fur seals, New Zealand Fur Seals are vulnerable to oil spills because of their dependence on their thick pelage for thermoregulation (Gales 1991). New Zealand fur seals share most of their range with several other regularly occurring pinnipeds that show up irregularly as vagrants. They also come in close contact with domestic and feral animals and in some areas wild carnivores. Thus, they are at risk of transmission of infectious diseases like morbilliviruses.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected throughout its range by the laws of Australia and New Zealand, respectively. In New Zealand all marine mammals are protected by the Marine Mammals Protection Act of 1978. Management is driven by Conservation Plans developed by the Department of Conservation. The current plan, written in 2004, is an action plan for conservation of all marine mammals from 2005-2010 (Suisted and Neale 2004). In Australia, State Governments have jurisdiction over marine mammals within three miles of the coast and each state has its own conservation legislation. The Australian Commonwealth Government has jurisdiction from three miles offshore throughout the rest of the countries’ 200 mile EEZ. An action plan for conservation of Australian seals was published in 1999 (Shaughnessy 1999).
It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

New Zealand fur seals cause negligible economic harm to humans. They often get caught in fishery nets and squid trawls, which could cause a negative economic impact. As seal populations grow, collisions with motor vehicles are on the rise.

  • Boren, L., M. Morrissey, N. Gemmell. 2008. Motor vehicle collisions and the New Zealand fur seal in the Kaikoura region. MARINE MAMMAL SCIENCE, 24/1: 235-238.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

New Zealand fur seals were a popular source of food and clothing to the Polynesian culture. When the European sealers arrived in the 19th century, they nearly caused the extinction of fur seals. Today, New Zealand fur seals also have become a popular modern day tourist attraction. To increase the profit of tourism, the tourist operations have created swim-with-seal programs.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arctocephalus forsteri

Arctocephalus forsteri, the New Zealand fur seal or southern fur seal, is a species of fur seal found around the south coast of Australia, the coast of the South Island of New Zealand, and some of the small islands to the south and east of there.[1] Male-only colonies are also located on the Cook Strait coast of the North Island near Wellington and vagrants are found as far north as New Caledonia.[citation needed] The English name New Zealand fur seal is used by English speakers in New Zealand (kekeno is used in the Māori language), and southern fur seal by English speakers in Australia.[citation needed] Although the two populations show some genetic differences, their morphologies are very similar, and thus they remain classed as a single species.[1]

Although the seals look docile, they can move surprisingly quickly and it is advisable never to approach a female with young or get between a seal and the water, cutting off its escape route to the sea.

Physical characteristics[edit]

Males have been reported as large as 250 kg; their average weight is about 126 kg.[1][2] Males can be 2 meters long. Females are between 30–50 kg on average, and can be as long as 1.5 meters. Pups are 3.3-3.9 kg on average, and between 40 and 55 cm long. At 290 days old males are about 14.1 kg, and females are about 12.6 kg.[1] They have external ears and hind flippers that rotate forward, which visibly distinguish them from other seals.[3] They have a pointy nose with long pale whiskers.[3] The fur seals are covered by two layers of fur. The coat is grey-brown on their back, and lighter on their belly.[3] Some have white tips on longer upper hairs, which can give them a silver-like appearance.[3]

Behavioral characteristics[edit]

Diving[edit]

New Zealand fur seals "porpoise" out of the water when traveling quickly at sea.[1] They can dive deeper and longer than any other fur seal.[3] Females can dive for about 9 minutes and to a depth of about 312 meters, and can dive deeper and longer in autumn and winter. Males can dive for about 15 minutes to a depth of about 380 meters.[1] On average New Zealand fur seals only dive for 1–2 minutes.[3] When they dive for food they dive deeper during the day but shallower at night, because during the day their prey typically migrates to deeper depths and migrates back up during the night.[3]

Communication[edit]

Males vocalize through a bark or whimper, either a gluttural threat, a low-intensity threat, a full threat, or a submissive call. Females growl and also have a high-pitched pup attraction wail call.[1]

Breeding[edit]

Female New Zealand fur seals mature between 4 and 6 years old, and males mature between 8 and 10 years old.[1] These seals are polygynous.[1][3] Males obtain and guard territory in late October before females arrive.[1] Often females only mate once a year, and this usually occurs eight days postpartum for about 13 minutes on average. Females have a delayed implantation of the fertilized egg, so that implantation on the uterine wall does not occur for 3 months.[3] Gestation occurs for 9 months[3] Females are more aggressive near the time of birth, and do not like to be approached right after birth.[2] Female New Zealand fur seals will continue to reproduce until their death which is on average between 14 and 17 years of age.[3]

Parenting[edit]

Pups are born between November and January.[1] Females stay close to the birth site for up to ten days. Pups are fairly mature at birth, and within 60 minutes they start suckling for about 7 minutes. Eventually the suckling can exceed 33 minutes.[2] Suckling can occur for about 300 days. Pups start to eat solid food just before weaning.[3] Pups are eventually weaned around September, and they disperse.[2][3]

Diet[edit]

Their diet includes cephalopods, fish, and birds.[1] Stomach contents have been analyzed and shown to include anchovy, barracuda, flounder, hagfish, lamprey, red cod, school shark, and many other species.[4] There are different factors that affect their diet, such as season, sex, breeding, surrounding colony, oceanography, and climatic patterns.[4]

Predators[edit]

New Zealand fur seals’ known predators are killer whales, sharks, male New Zealand sea lions, and possibly leopard seals.[1] New Zealand sea lions are also known to target pups as their prey.[5]

Human impact[edit]

These seals were widely hunted from shortly after the European discovery of New Zealand until the late 19th century. The population of the New Zealand seal fell to levels under 10% of the original numbers. Today trawls and fisheries are one of the main sources of death in New Zealand fur seals. They cause entanglement and drowning.[1] It has been estimated by the Royal Forest and Bird Protection Society that over 10000 seals could have drowned in nets between 1989 and 1998.[2] They are also known to be shot by commercial and recreational fishermen, because they sometimes interfere with fishing gear. How often these shootings occur is unknown, but the conflict between the seals and commercial fisheries is expected to increase.[6] On August 21 2014, two decomposing animals were found beheaded near Louth Bay in South Australia. The circumstances of their deaths were considered suspicious and an investigation followed their discovery.[7]

Legislative protection[edit]

New Zealand fur seals received protection by the creation of a 16 million hectare Marine Park located on the eastern side of Macquarie island in 2000. The Tasmanian government has also extended to Macquarie Island Nature Reserve by 3 nautical miles surrounding the island.[6] In New Zealand, the species is protected by the Marine Mammals Protection Act of 1978, which works to conserve marine animal species.[1] In Australian Commonwealth waters, Arctocephalus forsteri is protected under the Environment Protection Biodiversity Conservation (EPBC) Act 1999 under which it is listed as a protected marine species.[8]

RegionListed asLegislation
NSWVulnerableThreatened Species Conservation Act 1995 (New South Wales)[8]
SAMarine mammalNational Parks and Wildlife Act 1972 (South Australia)[9]
TASRareThreatened Species Protection Act 1995 (Tasmania)[8]
WAOther protected faunaWildlife Conservation Act 1950 (Western Australia)[8]

Gallery[edit]

References[edit]

  1. ^ a b c d e f g h i j k l m n o p Goldsworthy, S. & Gales, N. (IUCN SSC Pinniped Specialist Group) (2008). Arctocephalus forsteri. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 14 January 2009.
  2. ^ a b c d e Harcourt, R.G., (2001). "Advances in New Zealand mammalogy 1990-2000: Pinnipeds". Journal of The Royal Society of New Zealand, Downloaded October 6, 2011
  3. ^ a b c d e f g h i j k l m Department of Conservation. "New Zealand fur seal/kekeno" Found October 6, 2011
  4. ^ a b Boren, L. (2010) "Diet of New Zealand fur seals (Arctocephalus forsteri): a summary", Downloaded October 6, 2011
  5. ^ Bradshaw, C.J.A., Lalas, C., & McConkey, S. (1998). “New Zealand sea lion predation on New Zealand fur seals”. New Zealand Journal of Marine and Freshwater Research. Downloaded October 6, 2011
  6. ^ a b MarineBio.org (2011). "New Zealand Fur Seals, Arctocephalus forsteri at MarineBio.org" Found October 6, 2011
  7. ^ "Headless fur seals found on beach in SA treated as suspicious". ABC. 2014-08-25. Retrieved 2014-08-26. 
  8. ^ a b c d "Arctocephalus forsteri". Species profile and threats database. Australian Government - Department of the Environment. 2014. Retrieved 2014-08-26. 
  9. ^ National Parks & Wildlife Act 1972. Government of South Australia. 2014. 

Sources[edit]

  • Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!