Overview

Distribution

Range Description

In New Zealand, this species occurs around both the North and South Islands, with small breeding colonies on the north and larger colonies on the west and southern coast and islands around the South Island, as well as on all of New Zealand's sub-Antarctic islands. They are less common off the North Island, with no colonies, but they do occur as far north as the Three Kings Islands. Their range extends to Macquarie Island, where males mate with Antarctic and Subantarctic fur seals and produced hybrid pups. Vagrants have been recorded in New Caledonia and from a bone in a 14th century archaeological site in the Cook Islands.

New Zealand Fur Seals also occur in the coastal waters and on the offshore islands of South and Western Australia, from just east of Kangaroo Island west to the southwest corner of the continent in Western Australia. Small populations are also establishing in Tasmania and Victorian coastal waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Arctocephalus forsteri is found throughout New Zealand and in western and southern Australia (Department of Conservation).

Biogeographic Regions: australian (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Extreme sexual dimorphism characterizes this species: while the average female weighs approximately 40kg and is 1.2m in length, the average male weighs close to 160kg. and is 1.6m in length. New Zealand fur seals have sharp, elongate snouts and external, visible ears. They are covered by two layers of fur which is actually dark brown, but when wet Arctocephalus forsteri may appear black (Department of Conservation).

Range mass: 30 to 180 kg.

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
New Zealand Fur Seals are sexually dimorphic, with adult males reaching 1.3 times the length and more than 3 times the weight of adult females. There is some variation in the weights of adult males in the literature. Some ranges are up to a maximum of 250 kg, others to 200 kg. The largest male weighed at the Open Bay Islands of New Zealand was 154 kg. Adult males 8-12 years old had a maximum weight of 124 kg. Adult males are up to 2 m long. Adult females are 1.5 m and 30-50 kg. Pups average 3.3-3.9 kg and 40-55 cm at birth and male pups average 14.1 kg and females 12.6 kg around weaning when they are approximately 290 days old. Pups moult into adult pelage at 2-3 months. Females become mature at 4-6 years of age, males at 8-10 years (Dickie and Dawson 2003, McKenzie et al. 2005, 2007).

New Zealand Fur Seals are polygynous. Males arrive at colonies in late October before females and acquire and defend territories with vocalizations, ritualized displays and fighting. Male territories include an average of 5-8 females with the ratio of females to males varying between different colonies. The number of animals ashore at rookeries declines rapidly in January. Male vocalizations include a bark or whimper, a guttural threat, a low-intensity threat, a full threat, and a submissive call. Females growl and have a pup-attraction call that is a high-pitched wail.

Pups are born from mid-November to January, with most pups are born in December. Oestrous occurs 7-8 days after a female gives birth, and they usually spend another 1-2 days ashore with their pup before departing and beginning a cycle of foraging trips and periods of pup attendance ashore (Goldsworthy and Shaughnessy 1994, Goldsworthy 2006). Pups are weaned when they are about 10 months old. Adult female foraging trips are shorter when the pup is young and become longer as the pup gets older. In general, on-shore attendance bouts last under 2 days.

New Zealand Fur Seals are considered non-migratory. At sea they actively groom and raft in a variety of postures typical of southern fur seals including the “jug handle” position while sleeping at the surface. They often “porpoise” out of the water when travelling rapidly at sea. Rocky shoreline habitat with shelter, and locations more exposed to wind and weather are preferred for haul-outs and rookeries. When hauled out in New Zealand, New Zealand fur seals readily enter areas of coastal vegetation behind the shoreline.

New Zealand Fur Seals prey on a large variety of cephalopods, fish, and birds (Goldsworthy et al. 2003). In South Australia, key cephalopods prey include, Southern Ocean arrow squid and Gould’s squid; key fish species include redbait, ocean jackets, swallowtail and myctophids; and the most frequently taken bird species are little penguins and short-tailed shearwaters. Satellite tracking studies in South Australia indicate marked spatial separation in foraging regions used by juvenile, adult female and males seals. Lactating females forage predominantly in mid- to outer-continental shelf waters during summer months and then switch to deeper oceanic waters over winter months. In contrast, adult males focus their foraging over the continental slope. Juvenile seals forage in oceanic waters where they target nocturnal surface-migrating myctophid fish (Baylis et al. 2005). Adult female and male seals both forage in the water column in relative shallow depths (0-20 m) and near or on the bottom in deeper water. In females, benthic dives on the continental shelf in South Australia are typically at 60-80 m, while those of males on the continental slope are between 100-200 m. The maximum dive durations and depths recorded for adult females are 9.3 min and 312 m, and 14.8 min and 380 m for males.

Predators include Killer Whales, sharks, male New Zealand Sea Lions and possibly Leopard Seals at sub-Antarctic islands (Shaughnessy 2006).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

New Zealand fur seals oscillate between aquatic and terrestrial habitats. When in the ocean, they are observed both far and near from shore. During the breeding season, however, fur seals spend most of their time along a rocky coastline, especially preferring those areas with an abundance of large boulders, crevices and caves so as to shelter and provide protection for pups. Further, Arctocephalus forsteri prefers areas which are near sheltered water or intertidal pools (Seal Conservation Society).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Arctocephalus forsteri primarily feeds on aquatic species such as arrow squid, octopus, barracuda and jade mackerel. The seals are found to feed beyond the continental shelf in depths greater than 22m. Because its prey includes many vertical migrators (those organisms that rise to the surface during the night to feed and sink during the day), fur seals are found to feed almost exclusively during the night. These seals have been observed feeding continuously from sundown to dawn (Department of Conservation).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but one specimen was about 23.1 years old when it died in captivity (Richard Weigl 2005). Males are socially mature about 10-12 years of age (Virginia Hayssen et al. 1993).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Arctocephalus forsteri females reach sexual maturity between 4 and 6 years of age, and males become sexually mature near 5-6 years old. The breeding season within this species begins in mid-November and lasts through mid-January. New Zealand fur seals are polygamous, with 1 male mating with several females. Females give birth to 1 pup nearly every year until their death around 14-17 years. Females mate 68 days after the birth of a pup, but due to delayed implantation of the blastocyst (which does not implant for 3 months), gestation periods last 9 months. Young are suckled for approximately 300 days before they are weaned (Seal Conservation Society).

Average birth mass: 3833.33 g.

Average gestation period: 236 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1825 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1825 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctocephalus forsteri

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0572-06|NC_004023|Arctocephalus forsteri| AATCGATGATTATTCTCCACAAACCATAAAGATATTGGCACCCTCTATTTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTT---AGCCTATTGATCCGCGCGGAGTTAGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATCTACAACGTAATTGTCACCGCCCACGCATTCGTAATAATCTTTTTTATGGTAATACCTATTATAATTGGGGGCTTTGGAAATTGATTAGTACCCCTAATA---ATTGGAGCCCCCGACATGGCATTTCCTCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTTCTACTACTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCAGGTACCGGATGAACAGTTTACCCTCCTCTAGCAGGAAATCTAGCCCATGCAGGAGCTTCCGTAGACTTA---ACTATTTTCTCCCTTCACCTGGCAGGAGTATCATCCATTCTGGGAGCCATCAACTTTATTACTACTATTATCAACATGAAACCCCCTGCTATATCCCAATACCAAACCCCTTTATTCGTGTGATCCGTACTAATCACAGCGGTACTACTTCTGCTATCCCTACCAGTCCTGGCAGCT---GGTATCACTATATTACTCACGGACCGAAATCTAAACACAACCTTCTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTGTATATTCTCATCCTACCAGGATTCGGGATAATCTCACACATCGTCACCTATTACTCAGGAAAAAAG---GAACCCTTTGGTTATATGGGAATAGTCTGAGCAATAATATCAATCGGCTTCTTAGGCTTTATCGTATGAGCACACCATATATTCACCGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arctocephalus forsteri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Goldsworthy, S. & Gales, N. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Due to its large and apparently increasing population size, the New Zealand Fur Seal should be classified as Least Concern.

IUCN Evaluation of the New Zealand Fur Seal, Arctocephalus forsteri
Prepared by the Pinniped Specialist Group

A. Population reduction
Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

New Zealand Fur Seal abundance in New Zealand and Australia combined is approximately 200,000 individuals. The population trend is increasing. Most of the population in Australia is in South Australia, where pup production has been increasing by >12% per year on Kangaroo Island over a 20 year period. Generation time has been estimated as 9.9 years. Because the population is large and increasing, these criteria do not apply for this species.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Commercial harvesting has ceased and populations have been increasing for at least the last 30 years. Therefore, these criteria do not apply for the species.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of New Zealand fur seals is not expected in the future. However, local impacts from fisheries by-catch in parts of the range, and/or global climate change may have detrimental impacts on the species.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

The New Zealand Fur Seal population is still recovering from 18th, 19th and early 20th century sealing. Populations have been recovering over at least the last 30 years and are expected to continue to recover into the near future. Therefore, these criteria do not apply for the species.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
The EOO is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

None of the B criteria apply for this species.

C. Small population size and decline
Number of mature individuals: CR
Number of mature individuals is >10,000. These criteria do not apply for the species.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii)
% individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

None of the C criteria apply for this species.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
Number of mature individuals is >10,000. The AOO is > 2,000 km². Therefore, these criteria do not apply for the species.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

A PVA has been undertaken on the South Australian subpopulation, which suggested very low extinction probabilities. Therefore, these criteria do not apply for the species.

Listing recommendationPopulations of the New Zealand Fur Seal are presently increasing, and there is no evidence for sustained declines in any parts of their range. The breeding range of the species is still expanding in both New Zealand and Australia. Although the species is subject to by-catch in commercial fisheries in both New Zealand and Australia, these levels, at present do not appear to be inhibiting broad scale population recovery. The species should be categorized as Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although presently it is not legal to hunt Arctocephalus forsteri for fur or meat, they are still extremely threatened by human populations. They are subject to pollution, which affects their health in addition to actually physically trapping and drowning them. New Zealand fur seals are also inadvertantly caught in hoki nets that are set for other aquatic species. There have been observed increases in their population, however, in recently years at rates near 16-19%, and their numbers are quoted at being near 60,000. Fortunately, the future of Arctocephalus forsteri looks promising despite pollution and accidental catching (Forest and Bird Society).

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population is estimated to be approximately 200,000 with about half of these in Australia. Populations are increasing in both Australia and New Zealand (e.g. Brothers and Pemberton 1990).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Humans have probably harvested New Zealand Fur Seals for subsistence since first contact in both Australia and New Zealand. There is evidence that Polynesian colonization of New Zealand and harvest of seals led to declines and loss of colonies on the coast of the North Island. European sealers nearly exterminated the species in the 19th century, but due to protection, the species has rebounded to occupy most of its former range.

Trawl and other fisheries are a source of entanglement and drowning (Page et al. 2004). Tourism and disturbance at colonies can lead to disruption of breeding behaviour and site abandonment, although most colonies are on offshore islands and are relatively inaccessible.

Like all fur seals, New Zealand Fur Seals are vulnerable to oil spills because of their dependence on their thick pelage for thermoregulation (Gales 1991). New Zealand fur seals share most of their range with several other regularly occurring pinnipeds that show up irregularly as vagrants. They also come in close contact with domestic and feral animals and in some areas wild carnivores. Thus, they are at risk of transmission of infectious diseases like morbilliviruses.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected throughout its range by the laws of Australia and New Zealand, respectively. In New Zealand all marine mammals are protected by the Marine Mammals Protection Act of 1978. Management is driven by Conservation Plans developed by the Department of Conservation. The current plan, written in 2004, is an action plan for conservation of all marine mammals from 2005-2010 (Suisted and Neale 2004). In Australia, State Governments have jurisdiction over marine mammals within three miles of the coast and each state has its own conservation legislation. The Australian Commonwealth Government has jurisdiction from three miles offshore throughout the rest of the countries’ 200 mile EEZ. An action plan for conservation of Australian seals was published in 1999 (Shaughnessy 1999).
It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Often fur seals interfere with commercial fishing equipment by becoming tangled in nets. In these instances they are usually killed. Further, many fishermen intentionally try to capture and kill them due to the belief that the seals deplete commercial fish stocks. It has been shown that fur seals eat minuscule amounts of commercially important fish and instead the bulk of their diet consists of organisms not used by humans. Unfortunatley, however, the practice of killing them continues (Forest and Bird Society).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the 18th and 19th centuries, Arctocephalus was widely hunted for food by the Maori people. With the onset of European sealing industry, fur seals were hunted for their fur in addition to their meat. Starting in 1894, however, both of these activities were deemed illegal and the New Zealand fur seal was granted full protection (Department of Conservation).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Arctocephalus forsteri

Arctocephalus forsteri, also known as the Australian fur seal, New Zealand fur seal or southern fur seal, is a species of fur seal found around the south coast of Australia, the coast of the South Island of New Zealand, and some of the small islands to the south and east of there.[1] Male-only colonies are also located on the Cook Strait coast of the North Island near Wellington and vagrants are found as far north as New Caledonia.[citation needed] The English common name New Zealand fur seal is used by English speakers in New Zealand (kekeno is used in the Māori language), and southern fur seal by English speakers in Australia.[citation needed] Although the two populations show some genetic differences, their morphologies are very similar, and thus they remain classed as a single species.[1]

Although the seals look docile, they can move surprisingly quickly and it is advisable never to approach a female with young or get between a seal and the water, cutting off its escape route to the sea. Their teeth are very sharp and many New Zealanders have been bitten.[citation needed]

Contents

Physical Characteristics

The New Zealand fur seal is a fairly large mammal. Males have been reported to be as large as 250 kg in the literature, but the average weight is about 126 kg.[1][2] Males can also grow to be 2 meters long. Females are between 30–50 kg on average, and can grow to be as long as 1.5 meters. Pups are 3.3-3.9 kg on average, and between 40 and 55 cm long. At 290 days old males are about 14.1 kg, and females are about 12.6 kg.[1] They have external ears and hind flippers that rotate forward, which visibly distinguish them from other seals.[3] They have a pointy nose with long pale whiskers.[3] The fur seals are covered by two layers of fur, and their coat is grey-brown on their back, but it is lighter on their belly.[3] Some fur seals have white tips on longer upper hairs, which can give the fur seal a silver like appearance.[3]

Behavioral Characteristics

Diving

New Zealand fur seals "porpoise" out of the water when traveling quickly at sea.[1] New Zealand fur seals are the best at diving out of any other fur seal because they can dive deeper and longer.[3] Females can dive for about 9 minutes and to a depth of about 312 meters. But females can dive deeper and longer in autumn and winter. Males can dive for about 15 minutes to a depth of about 380 meters.[1] On average New Zealand fur seals only dive for 1–2 minutes.[3] When they dive for food they dive deeper during the day but shallower at night, because during the day their prey typically migrates to deeper depths and migrates back up during the night.[3]

Communication

Males vocalize through a bark or whimper, either a gluttural threat, a low-intensity threat, a full threat, or a submissive call. Females growl and also have a high-pitched pup attraction wail call.[1]

Breeding

Female New Zealand fur seals mature between 4 and 6 years old, and males mature between 8 and 10 years old.[1] These seals are polygynous.[1][3] Males obtain and guard territory in late October before females arrive.[1] Often females only mate once a year, and this usually occurs eight days postpartum for about 13 minutes on average. Females have a delayed implantation of the fertilized egg, so that implantation on the uterine wall does not occur for 3 months.[3] Gestation occurs for 9 months[3] Females are more aggressive near the time of birth, and do not like to be approached right after birth.[2] Female New Zealand fur seals will continue to reproduce until their death which is on average between 14 and 17 years of age.[3]

Parenting

Pups are born between November and January.[1] Females stay close to the birth site for up to ten days. Pups are fairly mature at birth, and within 60 minutes they start suckling for about 7 minutes. Eventually the suckling can exceed 33 minutes.[2] Suckling can occur for about 300 days. Pups start to eat solid food just before weaning.[3] Pups are eventually weaned around September, and they disperse.[2][3]

Diet

Their diet includes cephalopods, fish, and birds.[1] Stomach contents have been analyzed and shown to include anchovy, barracuda, flounder, hagfish, lamprey, red cod, school shark, and many other species.[4] There are different factors that affect their diet, such as season, sex, breeding, surrounding colony, oceanography, and climatic patterns.[4]

Predators

New Zealand fur seals’ known predators are killer whales, sharks, male New Zealand sea lions, and possibly leopard seals.[1] New Zealand sea lions are also known to target pups as their prey.[5]

Human Impact

These seals were widely hunted from shortly after the European discovery of New Zealand until the late 19th century. The population of the New Zealand seal fell to levels under 10% of the original numbers. Today trawls and fisheries are one of the main sources of death in New Zealand fur seals. They cause entanglement and drowning.[1] It has been estimated by the Royal Forest and Bird Protection Society that over 10000 seals could have drowned in nets between 1989 and 1998.[2] They are also known to be shot by commercial and recreational fishermen, because they sometimes interfere with fishing gear. How often these shootings occur is unknown, but the conflict between the seals and commercial fisheries is expected to increase.[6] New Zealand fur seals have recently received protection by the creation of a 16 million hectare Marine Park that is located on the eastern side of Macquarie island in 2000. The Tasmanian government has also extended to Macquarie Island Nature Reserve by 3 nautical miles surrounding the island.[6] New Zealand fur seals are protected by the Marine mammals protection act of 1978, which works to conserve marine animal species.[1]

Gallery

References

  1. ^ a b c d e f g h i j k l m n o p Goldsworthy, S. & Gales, N. (IUCN SSC Pinniped Specialist Group) (2008). Arctocephalus forsteri. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 14 January 2009.
  2. ^ a b c d e Harcourt, R.G., (2001). "Advances in New Zealand mammalogy 1990-2000: Pinnipeds" "Journal of The Royal Society of New Zealand", Downloaded October 6, 2011
  3. ^ a b c d e f g h i j k l m Department of Conservation. "New Zealand fur seal/kekeno" Found October 6, 2011
  4. ^ a b Boren, L. (2010) "Diet of New Zealand fur seals (Arctocephalus forsteri): a summary", Downloaded October 6, 2011
  5. ^ Bradshaw, C.J.A., Lalas, C., & McConkey, S. (1998). “New Zealand sea lion predation on New Zealand fur seals” “New Zealand Journal of Marine and Freshwater Research”, Downloaded October 6, 2011
  6. ^ a b MarineBio.org (2011). "New Zealand Fur Seals, Arctocephalus forsteri at MarineBio.org" Found October 6, 2011

Sources

  • Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!