Overview

Distribution

Range Description

Cape Fur Seals haul out along the mainland and coastal islands of southwestern and southern Africa, from Ilha dos Tigres in Angola to Algoa Bay in South Africa (Kirkman et al. 2007). Vagrants have been sighted on the coasts of Gabon (Thibault 1999) and the Prince Edward Islands (Kerley 1983). Australian Fur Seals breed on islands of the Bass Strait (Warnecke 1995) but range the waters off the coasts of South Australia, Tasmania, Victoria and New South Wales (Pemberton and Gales 2004). While both subspecies do not travel far from their continental shelves, Cape Fur Seals have been recorded up to 220 km offshore (Shaughnessy 1979).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Arctocephalus pusillus pusillus can be found along the southern and southwestern coast of Africa. They are commonly spotted throughout Namibia and as far east as Port Elizabeth (Schliemann 1990, King 1983).

Arctocephalus pusillus doriferus can be found along the southern and southeastern coasts of Australia. They are commonly spotted in places like Victoria, New South Wales, Tasmania and scattered islands (Schliemann 1990, King 1983).

Biogeographic Regions: ethiopian (Native ); australian (Native ); indian ocean (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Australia, New Zealand Exclusive Economic Zone, South Africa
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Arctocephalus pusillus has two sub-species, A. p. pusillus and A. p. doriferus, which are separated by the ocean between Africa and Australia. Skull characteristics of the two subspecies are similar enough to place them in one species. A notable difference between the two is the crest between the mastoid process and the jugular process of the exoccipital, which is proportionately larger in A. p. pusillus (King, 1983).

Males of the South African or cape fur seal subspecies, A. p. pusillus, are an average of 2.3 meters in length and weigh from 200 to 350 kg (King 1983). Their coat is gray or black in color and is lighter on the underside (King 1983, Schliemann 1990). Female African fur seals are smaller, weighing an average of 120 kg (King 1983) and measuring an average of 1.8 meters long (Schliemann 1990). Their coats are brown with lighter shading on the underside.

Males of the subspecies A. p. doriferus, the Australian fur seal, weigh anywhere from 218-360 kg and are 2-2.2 meters in length (King 1983). Their coats are a gray-brown and they have a thick mane about their neck region which is slightly lighter (King, 1983). Female Australian fur seals vary greatly in size, weighing between 36 and 110 kg and measuring between 1.2 and 1.8m in length (King 1983, Schliemann 1990). Their coat is a silver-gray with a yellow colored throat and brown underside.

Range mass: 36 to 360 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • King, J. 1983. Seals of the World. Ithaca, New York: Comstock Publishing Associates.
  • Schliemann, H. 1990. Eared Seals and Walruses. Pp. 168-203 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
These two subspecies are the largest of all fur seals. They are also highly sexually dimorphic. Adult male Australian Fur Seals average 2.16 m in length and 279 kg in mass, while adult females are 1.36 –1.71 m in length and attain an average weight of 78 kg. Newborns are 60-80 cm in length and weigh between 5 and 12 kg (Warnecke 1995). Adult male Cape Fur Seals are 2–2.3 m long and average 247 kg in weight. Adult females are 1.2–1.6 cm long and weigh an average of 57 kg. At birth they weigh around 6 kg (Shaughnessy 1979).

Females of this species become sexually mature at 3-6 years and males at 9- 12 years. The annual pregnancy rate of mature females is 71 % for Cape Fur Seals (Wickens and York 1997) and 73 % in Australian Fur Seals (Warnecke and Shaughnessy 1985). Gestation lasts 51 weeks, including a three-month delay of implantation. Longevity and adult mortality are unknown (Arnould et al. 2003, Butterworth et al. 1995, Reijnders et al. 1993).

Both subspecies are highly polygynous. Adult males arrive at the colonies first. Breeding is from late October to the beginning of January. Females give birth 1.5–2 days after arrival ashore. The peak of pupping for both subspecies is in the first week of December, although there is some variation between colonies (De Villiers and Roux 1992, Warnecke and Shaughnessy 1985). Females attend the pup for 8-9 days before coming into oestrous, mating, and departing on their first foraging trip (Warnecke and Shaughnessy 1985). Foraging trips get longer as the season progresses from summer to winter, changing from a mean of 3.71 to 6.77 days for Australian Fur Seals. Periods of attendance stay the same from birth to weaning and have a mean length of 1.7 days (Arnould and Hindell 2001). Foraging intervals are shorter for Cape Fur Seals, probably reflecting greater availability of food (Gamel et al. 2005). Pups are usually weaned at 10–12 months even though some pups begin to forage at 7 months, and others are nursed for 2–3 years (Warnecke and Shaughnessy 1985).

Foraging dives by lactating Australian Fur Seal females are usually to 65–85 m with a maximum depth of 164 m, and dives usually last from 2–3.7 minutes, with a maximum duration of 8.9 minutes (Arnould and Hindell 2001). At sea, these seals are found alone or in small groups of up to 15 animals, but they often gather in huge rafts adjacent to rookeries. Neither of the populations is migratory; they tend to move locally within their restricted ranges (Arnould 2002, Oosthuisen 1991, Warnecke and Shaughnessy 1985).

Both subspecies are opportunistic feeders that take a wide variety of prey, including pelagic, mid-water and benthic animals. Australian fur seals feed benthically and take a variety of species of fish, squid, octopus and rock lobsters (Warnecke and Shaughnessy 1985). Cape Fur Seals are principally pelagic foragers. They take cape hake, horse mackerel, pelagic goby, pilchards, anchovy, squid of the genus Loligo, rock lobster, shrimp, prawns, and amphipods (David 1987a, De Bruyn et al. 2003, Mecenero 2006). Cape Fur Seals have also been reported to occasionally take African Penguins and several species of flying seabirds (Crawford et al. 1989).

Predators of the Cape and Australian Fur Seals include Killer Whales and Great White Sharks at sea (Compagno 1989, Pemberton and Kirkwood 1994). The Cape Fur Seal is also preyed upon on shore by Black-backed Jackals and Brown Hyenas in southern Africa (Skinner et al. 1995).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Both subspecies of A. pusillus spend most of their year at sea but not too far from land. A maximum of 160 km from land is recorded but is not a common (King, 1983). Breeding occurs on the mainland or small islands in the sand or rocks (King, 1983). Both subspecies prefer small rocky islands for mating and pupping.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Stomach contents of South African fur seals indicate that fish make up about 70% of their diet, squid 20%, crab 2% (Schliemann, 1990). The remaining portion is composed of other crustaceans, cephalopods and sometimes birds (King 1983, Schliemann 1990). Australian fur seals commonly eat squid, octopus, fish and lobsters, along with other crustaceans and cephalopods (King 1983, Schliemann 1990). Like most air-breathing marine mammals A. pusillus finds its food in the ocean. In order to do so it must store oxygen and swim below the surface to the depth at which its particular prey is located. Both subspecies of A. pusillus dive for their food but they each occupy different depth niches in their respective locations. South African fur seals are surface divers with an average dive of about 45 meters and 2.1 minutes although they can dive as deep as 204 meters and for as long as 7.5 minutes when necessary (Riedman, 1990). While there is extensive overlap, Australian fur seals generally feed at a much lower depths. Their average dive is about 120 meters (Schliemann, 1990) and they commonly go as deep as 200 meters (Riedman, 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
18.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32.1 years (captivity) Observations: The gestation time includes an approximately 4-month period of delayed implantation. One wild born specimen was about 32.1 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The breeding season for both subspecies of A. pusillus begins in the middle of October. At this time males haul out on shore at the breeding grounds, or rookeries, to establish territories by displays, sparring, or actual battle. They do not eat again until they mate in November or December.

Females come ashore slightly later and also fight amongst each other for smaller territories in which to give birth. Female territories are always within male territories and females who are located on a certain male's territory become part of his harem. While harem sizes of both subspecies can reach as many as 50 females, or cows, the average size of the South African fur seal harem is 28 cows, the Australian fur seal harem averages 10 cows (Schliemann, 1990). Breeding occurs between the male and each of his harem members. While copulation occurs about 6 days after cows give birth to a single pup there is a delay in implantation of the blastocyst. In South African fur seals this delay is approximately 4 months while in Australian fur seals it is about 3 months (Riedman, 1990). Gestation in both subspecies averages 11.75 months (Riedman, 1990).

South African fur seal pups are anywhere from 4.5 to 7 kg and 60-70 cm at birth (King 1983), which occurs in late November or early December. The pups go through two different molts in their first year and a half. Their original coat is black and curly. This coat is replaced between 4 and 5 weeks with an olive-gray coat. The second molt takes place at about 13 months and replaces the olive-gray coat with a silver one which later fades in color (King 1983). Nursing in this subspecies begins immediately after birth and is continuous for the first six days. At this time the mother mates with her male harem leader and then begins going out to sea for food for a few days at a time. By the second month, however, she can be gone for up to two weeks before returning to feed the pup (King, 1983). At four to five months old pups begin supplementing their diet with crustaceans and fish. Lactation does continue, however, until the next pup is born. Pups begin swimming early and continually increase the amount of time that they can spend in the water. At seven months they can swim for two or three days at a time (King, 1983). Females become sexually mature at about 3 years and males may also follow this trend but are unable to establish territory at this time so do not usually mate until several years later (King, 1983).

Australian fur seal pups weigh 4.5 to 12.5 kg and measure 62-80 cm in length at birth. They are a silver-gray in color and their entire ventral side is yellow. Pups in this subspecies are usually born in early to middle December. As in South African fur seals, nursing begins right after birth and is continuous for the first week or so, until the mother mates again and goes out to sea for food. At this time, however, the Australian fur seal returns once every week to feed her pup (Riedman, 1990). By the eighth month of life Australian fur seals are eating some solid supplements although lactation continues until the next pup is born. The pups start swimming for prolonged periods also at the eighth month. Sexual maturity is widely varied within the subspecies. Females reach maturity any time between 3 and 6 years of age (King, 1983). Males probably reach maturity between four and five years of age but cannot hold a harem until they are closer to seven or eight years old (King, 1983).

Average birth mass: 6200 g.

Average gestation period: 368 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1643 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1276 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctocephalus pusillus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0685-06|NC_008417|Arctocephalus pusillus| AATCGATGACTATTCTCTACAAACCATAAAGATATTGGCACTCTTTACCTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTC---AGCTTATTGATCCGCGCAGAATTAGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATTTATAACGTAATTGTCACCGCCCACGCATTCGTAATAATCTTTTTCATGGTGATACCCATTATAATTGGAGGCTTTGGAAATTGATTAGTACCCCTAATA---ATTGGAGCTCCCGACATGGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTTCTACTATTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCGGGTACCGGATGAACGGTTTACCCTCCCCTAGCGGGAAACCTGGCCCATGCAGGAGCTTCCGTAGACTTG---ACTATTTTCTCCCTTCATCTAGCAGGGGTATCATCTATTCTAGGAGCCATTAACTTTATTACCACCATTATCAATATGAAGCCCCCTGCCATATCCCAATACCAAACTCCTTTATTCGTGTGATCCGTACTAATTACAGCGGTACTACTTCTACTATCCCTACCAGTCCTAGCAGCT---GGTATCACTATATTACTTACGGACCGAAATCTAAATACAACCTTTTTTGACCCGGCTGGAGGAGGTGACCCCATCCTATACCAACATCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTAATTCTTCCAGGATTCGGGATAATCTCACACATCGTCACCTATTACTCGGGAAAAAAG---GAACCCTTTGGCTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTTACCGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arctocephalus pusillus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hofmeyr, G. & Gales, N. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to their large population sizes, the global Cape Fur Seal (Afro-Australian Fur Seal) population appears to be healthy, and the subspecies should both therefore be classified as Least Concern (LC). However, current hunting levels might not be sustainable in Namibia, given low pup production levels during several recent years and hence this species should be reviewed again within a decade.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

South African fur seals are more abundant than are Australian fur seals. Both are at the mercy of poachers, even though there are legal hunting seasons for South African fur seals. Much of the poaching danger is in the form of fishermen and large fishing corporations who believe the seals to be jeopardizing their livelihood by stealing from their nets. While this does occur it is believed to be exaggerated by those in the fishing industry.

Humans are also inadvertently threatening these seals through pollution. Plastic, pieces of netting, and pieces of fishing line kill or injure thousands of these seals a year.

Non-human threats include killer whales and white sharks. Stingrays can cause some dangerous injuries. Pups left on the mainland are also sometimes taken by terrestrial predators, such as the black-backed jackal in South Africa.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Estimates indicate that of some 2 million Cape Fur Seals presently breed at some 23 rookeries or rookery groups in 2004 (Kirkman et al. 2007). The population size of this subspecies is believed to have been relatively stable since 1993 (Butterworth et al. 1995, Kirkman et al. 2007). Some 75% of Cape Fur Seals breed at three of these sites: the Atlas Bay-Wolf Bay-Long Islands Group, Kleinzee and Cape Cross. Most other rookeries are estimated to contain more than a 1,000 adults (Kirkman et al. 2007). While the abundances of the larger rookeries are relatively stable, they do experience fluctuations. These fluctuations are greater in Namibian rookeries which have experienced major mortality events due to the impact of poor environmental conditions on prey populations (Roux 1998). Smaller rookeries tend to experience greater fluctuations than larger rookeries (Kirkman et al. 2007).

Some 92,000 Australian Fur Seals were estimated to breed at nine rookeries in 2003 and the population is believed to be increasing. More than half of the population (55%) breed at two of these sites: Lady Julia Percy Island and Seal Rocks. Five other rookeries are estimated to contain more than a 1000 adults. Inter-annual fluctuations are experienced at some rookeries (Kirkwood et al. 2005).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Cape and Australian Fur Seals were hunted heavily during the 17th, 18th and 19th centuries and both populations were reduced to low levels (David 1987b, Warnecke and Shaughnessy 1985). Under protection, both have recovered, although the Cape subspecies to a much greater extent than the Australian subspecies, which has not rebounded to estimated pre-exploitation levels (Kirkwood et al. 2005, Kirkman et al. 2007). Levels of exploitation of Cape Fur Seals were not as severe as that experienced by other species of fur seals and genetic variation remains high (Matthee et al. 2006).

Seal harvests in South Africa were first controlled in 1893 and were suspended in 1990. They continue in Namibia at the mainland colonies of Cape Cross and Wolf and Atlas Bays. The 2006 annual harvest in Namibia was set at 85 000 animals which is made up primarily of pups, but also includes a small percentage of bulls. This high harvest level has been retained despite several years with very high mortality levels for pups along with many thousands of adult deaths in Namibia (Kirkman 2006). This mortality has been attributed to a scarcity of fish and poor marine productivity along the coast of Namibia, which occurs at intervals (Roux 1998).

Cape Fur Seals are sometimes reported to be detrimental to commercial fisheries, both via direct competition and operational interactions. Some seals are taken incidentally in fishing operations every year. A number are also shot illegally during fishing operations (Wickens et al. 1992). More significantly, Cape Fur Seals are known to become entangled in marine debris such as packing bands, discarded lines and nets and other material that can become a collar around an animal’s neck. Rates of entanglement vary by colony, but have been estimated to be between 0.12–0.66 % (Shaughnessy 1980). Conflicts between Australian Fur Seals and local fisheries include seals damaging gear and stealing catch, and becoming entangled in nets and traps (Goldsworthy et al. 2003, Pemberton et al. 1992, Stewardson 2007). While the shooting of seals during fishing operations does occur, it is illegal (Stewardson 2007).

Like all fur seals, Cape and Australian Fur Seals are vulnerable to oil spills because of their dependence on their thick pelage for thermoregulation (Bonner 1978). Cape Fur Seals come in regular contact with a number of species of terrestrial carnivores, and both subspecies are at risk of exposure to viruses and other disease types that could lead to epidemics (Kirkman 2006, Lavigne and Schmitz 1990).

Both subspecies are visited by tourists at a number of colonies. Disturbance is believed to be minimal (Kirkwood et al. 2003)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Australian Fur Seals are protected nationally by the Environment Protection and Biodiversity Conservation Act (1999). They are also protected in all states in which they occur by state-specific legislation (Stewardson 2007). Australian Fur Seals are included in national strategies on seals published in 1999 (Shaughnessy 1999) and 2007 (DAFF 2007).

Although Cape Fur Seals have been protected in South Africa since 1893, they were still subject to government run or government authorized commercial harvests to 1990 (Butterworth et al. 1995, Wickens et al. 1991). The Sea Birds and Seals Protection Act of 1973 (SBSPA), provides broad protection for seals in South Africa, but also provides for a harvest if it is deemed desirable. While the conservation and harvesting of seals in Namibia was previously controlled by the SBSPA this has been replaced by the Marine Resources Act (2000) which relaxed restrictions aimed at ensuring a humane harvest (Kirkman 2006).

Listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Sealing has been common for centuries. Seals are taken for their pelts, their blubber, or their meat. Currently there are seasons for hunting different classes of the South African fur seal, but this is controversial. Seal pups are valued for their softer fur and male genitalia is taken and sold as an aphrodisiac. The Australian fur seal is protected and is not legally hunted by humans today, although it was hunted for meat in the past (King, 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brown fur seal

The brown fur seal (Arctocephalus pusillus), also known as the Cape fur seal, South African fur seal and the Australian fur seal is a species of fur seal.

Contents

Description

Fur seal grooming itself
Skull of male brown fur seal

The brown fur seal is the largest and most robust fur seal. It has a large and broad head with a pointed snout that may be flat or upturned slightly.[2] The pinnae and vibrissae are long, and the vibrissae may extend backward past the pinnae, especially in adult males. The foreflippers are covered with sparse hair over about three-quarters of their length. The hindflippers are short relative to the large body, with short, fleshy tips on the digits.[2] The size and weight of the brown fur seal depends on the subspecies. Males of the African subspecies (A. p. pusillus) are 2.3 metres (7.5 ft) in length on average and weigh from 200–350 kilograms (440–770 lb).[3] Females are smaller, averaging 1.8 metres (5.9 ft) in length and weighing an average of 120 kilograms (260 lb).[3] Males of the Australian subspecies (A. p. doriferus) are 2–2.2 metres (6.6–7.2 ft) in length and weigh 218–360 kilograms (480–790 lb).[3] Females are 1.2–1.8 metres (3.9–5.9 ft) length and weigh 36–110 kilograms (79–240 lb).[3]

Adult male brown fur seals are dark gray to brown, with a darker mane of short, coarse hairs and a light belly, while adult females are light brown to gray, with a light throat and darker back and belly. The foreflippers of the fur seal are dark brown to black.[2] Pups are born black and molt to gray pelage with a pale throat within three to five months.[2] The skull of the African subspecies has a larger crest between the mastoid process and the jugular process of the exoccipital.[3]

Ecology

A fur seal colony at Duiker Island, South Africa
Fur seal underwater

The African fur seal lives around the southern and southwestern coast of Africa from Cape Cross in Nambia and around the Cape of Good Hope to Black Rocks of Cape province.[2] The Australian fur seal lives in Bass Strait, at four islands off Victoria in southeastern Australia and five islands off Tasmania.[2] Brown fur seals prefer to haul out and breed on rocky islands, rock ledges and reefs, and pebble and boulder beaches. However, some large colonies can be found on sandy beaches.[2] Fur seals spend most of the year at sea, but are not too far from land. They have been recorded 160 km from land, but this is not common.[3]

The African fur seal’s diet apparently is made of up to 70% fish, 20% squid and 2% crab.[4] Also eaten are other crustaceans, cephalopods and sometimes birds.[3][4] The Australian fur seal mostly eats squid, octopus, fish and lobsters.[3][4] The brown fur seal dives for its food. The African subspecies can dive as deep as 204m and for as long as 7.5 minutes.[5] The Australian subspecies generally feeds at lower depths, diving on average 120m[4] and can reach as deep as 200m.[5]

The brown fur seal's main predator is the great white shark, although they are also preyed upon by various other animals, as well, such as orcas. Land-based predators include black-backed jackals and brown hyenas on the Skeleton Coast in Namibia. In False Bay, the seals employ a number of antipredatory strategies while in shark-infested waters, such as:

  • Swimming in large groups
  • Low porpoising to increase subsurface vigilance
  • Darting in different directions to cause confusion when attacked
  • Riding near the dorsal fin to keep out of reach of the shark's jaws when attacked[6]

Life history

Brown fur seal colony at Friar Island, Tasmania
Brown fur seals

Brown fur seals often gather into colonies on rookeries in numbers ranging from 500–1500, at least for the Australian subspecies.[3] While fur seals spend most of the year at sea, they never fully evacuate the rookeries as mothers and pups return to them throughout the year. There is no established dispersal from a colony, although some fur seals from one colony have been found at another. True boundaries do not exist between the colonies. When at sea, fur seals travel in small feeding groups. Brown fur seals begin to breed in the middle of October, when males haul out on shore to establish territories though display, sparring and sometimes actual combat. They will fast at this time and not eat until after mating in November or December. When the females arrive, they fight among themselves for territories in which to give birth. Female territories are smaller than those of males and are always located within them. Females within a male’s territory can be considered part of his harem. However, males do not herd the females, which are free to choose their mates and judge them based on the value of their territories. For the Australian fur seals, 82% of copulations are done by males whose territories are located directly on the water.[5] Copulation between the male and his females begins six days after they give birth to their pups conceived from the previous year. However, there is a delay in the implantation of the blastocyst, which lasts four months in the African subspecies and three months in the Australian subspecies.[5] Gestation for the brown fur seal lasts an average of 11.75 months.[5]

After mating, females begin alternating brief periods of foraging at sea with several days ashore nursing their pups.[2] Foraging trips last about seven days in winter and about four days in summer and autumn. When a mother returns from sea to feed her pup, she emits a loud call which attracts all the nearby pups, but she only responds to her pup. She possibly can recognize her pup by smell.[5] When left alone, pups gather in groups and play during the evening.[3] Pups are usually weaned at 4–6 months old.[2]

Human interactions

Brown fur seal in Prague Zoo

This species is an inquisitive and friendly animal when in the water, and will often accompany SCUBA divers. They will swim around divers for periods of several minutes at a time, even at a depth of 60m. On land, they are far less relaxed and tend to panic when people come near them.

Australian fur seals were hunted intensively between 1798 and 1825 for commercial reasons. Seal hunting stopped in Australia in 1923, and their population is still recovering. Breeding and haul-out sites are protected by law. South African fur seals have a very robust and healthy population. Harvesting of seals was outlawed in South Africa in 1990.

Brown fur seals are still harvested in Namibia. Around 85,000 pups a year are clubbed to death; their fur is bought by Turkish businessman Hatem Yavuz[citation needed], and sold to the fashion industry. Many animal activist groups strongly condemn this culling. The seal is a protected species in South Africa; there are now only a million seals in the wild. The quota set by the Namibian government for culling the pups, until 2019, will be a million pups.

References

  1. ^ Hofmeyr, G. & Gales, N. (2008). Arctocephalus pusillus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 30 January 2009.
  2. ^ a b c d e f g h i Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
  3. ^ a b c d e f g h i j King, J. 1983. Seals of the World. Ithaca, New York: Comstock Publishing Associates.
  4. ^ a b c d Schliemann, H. 1990. Eared Seals and Walruses. Pp. 168–203 in B. Grzimek, ed. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill.
  5. ^ a b c d e f Riedman, M. 1990. The Pinnipeds: Seals, Sea Lions, and Walruses. Berkeley: University of California Press.
  6. ^ Anti-Predatory Strategies of Cape Fur Seals at Seal Island
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!