Overview

Distribution

Range Description

Cape Fur Seals range along the southwestern and southern coasts of Africa, from Ilha dos Tigres in southern Angola, along the coast of Namibia to Algoa Bay in South Africa (Kirkman et al. 2013, Oosthuizen 1991). Sightings of vagrants are limited to one record from Gabon (Thibault 1999) and one from the Prince Edward Islands, South Africa (Kerley 1983). Australian Fur Seals are endemic to southeastern Australian waters and are found from the coasts of Tasmania, New South Wales, Victoria and across to South Australia with the centre of their distribution in Bass Strait (Kirkwood et al. 2010). The ranges of both subspecies are expanding, with the new colonies established in the last decade (Kirkman et al. 2007, Kirkwood et al. 2010, Shaughnessyet al. 2010, Kirkmanet al. 2013, McIntosh et al. 2014, Shaughnessy et al. 2014). While both subspecies seldom move beyond the continental shelves, Cape Fur Seals have been recorded up to 220 km offshore (Shaughnessy 1979).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctocephalus pusillus pusillus can be found along the southern and southwestern coast of Africa. They are commonly spotted throughout Namibia and as far east as Port Elizabeth (Schliemann 1990, King 1983).

Arctocephalus pusillus doriferus can be found along the southern and southeastern coasts of Australia. They are commonly spotted in places like Victoria, New South Wales, Tasmania and scattered islands (Schliemann 1990, King 1983).

Biogeographic Regions: ethiopian (Native ); australian (Native ); indian ocean (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Arctocephalus pusillus has two sub-species, A. p. pusillus and A. p. doriferus, which are separated by the ocean between Africa and Australia. Skull characteristics of the two subspecies are similar enough to place them in one species. A notable difference between the two is the crest between the mastoid process and the jugular process of the exoccipital, which is proportionately larger in A. p. pusillus (King, 1983).

Males of the South African or cape fur seal subspecies, A. p. pusillus, are an average of 2.3 meters in length and weigh from 200 to 350 kg (King 1983). Their coat is gray or black in color and is lighter on the underside (King 1983, Schliemann 1990). Female African fur seals are smaller, weighing an average of 120 kg (King 1983) and measuring an average of 1.8 meters long (Schliemann 1990). Their coats are brown with lighter shading on the underside.

Males of the subspecies A. p. doriferus, the Australian fur seal, weigh anywhere from 218-360 kg and are 2-2.2 meters in length (King 1983). Their coats are a gray-brown and they have a thick mane about their neck region which is slightly lighter (King, 1983). Female Australian fur seals vary greatly in size, weighing between 36 and 110 kg and measuring between 1.2 and 1.8m in length (King 1983, Schliemann 1990). Their coat is a silver-gray with a yellow colored throat and brown underside.

Range mass: 36 to 360 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • King, J. 1983. Seals of the World. Ithaca, New York: Comstock Publishing Associates.
  • Schliemann, H. 1990. Eared Seals and Walruses. Pp. 168-203 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Afro-Australian Fur Seals are the largest of all Fur Seals. Mean asymptotic mass and length of males is 229 kg (range 218-360 kg) and 221 cm (range 201-227 cm), and females are 85 kg (range 41-113 kg) and 163 cm (136-171 cm; Arnould and Warneke 2002, Kirkwood and Goldsworthy 2013). Pups at birth are 60-80 cm in length and weigh 5-12 kg. The Cape Fur Seal is slightly smaller (Warneke 1995).

Females become sexually mature at three to six years and males at nine to 12 years. Maximum longevity recorded is 16.9 years for males and 20.9 years for females (Arnould and Warneke 2002). The annual pregnancy rate of females has been estimated at 71% for Cape Fur Seals and 73% for Australian Fur Seals (Warneke and Shaughnessy 1985, Wickens and York 1997). Gestation lasts 51 weeks, including a three-month delay of implantation. Adult mortality rates are unknown (Butterworth et al. 1995, Reijnders et al. 1993).

Cape Fur Seals are highly polygynous. The breeding season is highly synchronous, taking place between late October and the beginning of January, with adult males arriving at the colonies first. Females give birth 1.5-2 days after arrival ashore. The peak of pupping is in the first week of December (
Warnecke and Shaughnessy 1985, David 1987a, De Villiers and Roux 1992). Adult females attend the pup for about six to nine days before coming into oestrous, mating, and departing on their first foraging trip (Rand 1955, Warnecke and Shaughnessy 1985). Foraging intervals are shorter for Cape Fur Seals (an average of 5.2 days) than Australian Fur Seals (six days), probably reflecting greater availability of food (Gamel et al. 2005, Kirkwood and Arnould 2011). While some pups may start foraging at seven months, they are usually weaned at 10-12 months, with suckling rarely continuing for two to three years (Warneke and Shaughnessy 1985, David and Rand 1986).

While Cape Fur Seals forage in both pelagic and benthic environments (Kooyman and Gentry 1986,David 1987b, Stewardson 2001), Australian Fur Seals are primarily benthic feeders (Arnould and Kirkwood 2008, Kirkwood and Arnould 2011, Kirkwood and Goldsworthy 2013). Characteristics of dives vary between sites (Kooyman and Gentry 1986, Stewardson 2001, Arnould and Kirkwood 2008, Kirkwood and Arnould 2011). The majority of recorded dives of Cape Fur Seals on the west coast of South Africa are to less than 50 m depth (Kooyman and Gentry 1986), while those on the southeast coast are to more than 60 m (Stewardson 2001). Mean dive duration of Cape Fur Seals varies between one minute (Stewardson 2001) and 2.1 minutes (Kooyman and Gentry 1986). Foraging dives by lactating Australian Fur Seal females are usually to 6585 m with a maximum depth of 164 m, and dives usually last from 2.0-3.7 minutes, with a maximum duration of 8.9 minutes (Arnould and Hindell 2001). The diurnal frequency of Cape Fur Seal dives shows a bimodal distribution with most dives taking place at dusk or during the first half of the night, with a smaller peak after dawn (Kooyman and Gentry 1986, Stewardson 2001). The maximum recorded diving depth is 204 m (Kooyman and Gentry 1986).

Cape Fur Seals are generalist foragers that take a wide variety of prey, including Cape Hake, Horse Mackerel, Pelagic Goby, Pilchards, Anchovy, squid of the genus Loligo, Rock Lobster, shrimp, prawns and amphipods (David 1987b, de Bruyn et al. 2003, Mecenero et al. 2006). They have also been reported to occasionally take African Penguins and several species of flying seabirds (Makhado et al. 2006). Australian Fur Seals eat a wide range of fish species including Redbait, Leatherjacket species, Jack Mackerel, Barracouta, Red Rock Cod and Flathead (Goldsworthy et al. 2003, Hume et al. 2004,Pageet al. 2005, Littnan et al. 2007,Kirkwoodet al. 2008,Deagleet al. 2009). Cephalopods are also important prey with key species being Goulds Squid, Octopus spp., and Cuttlefish (Hume et al. 2004, Page et al. 2005,Kirkwoodet al. 2008).

Great White Sharks (Pemberton and Kirkwood 1994,Martinet al. 2005) and Killer Whales (Rice and Saayman 1987) are predators of Afro-Australian Fur Seals at sea. On shore, Cape Fur Seal pups are preyed on by Black-backed Jackals and Brown Hyenas (Skinneret al. 1995, Oosthuizen et al. 1997,Kuhnet al. 2008).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Both subspecies of A. pusillus spend most of their year at sea but not too far from land. A maximum of 160 km from land is recorded but is not a common (King, 1983). Breeding occurs on the mainland or small islands in the sand or rocks (King, 1983). Both subspecies prefer small rocky islands for mating and pupping.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Stomach contents of South African fur seals indicate that fish make up about 70% of their diet, squid 20%, crab 2% (Schliemann, 1990). The remaining portion is composed of other crustaceans, cephalopods and sometimes birds (King 1983, Schliemann 1990). Australian fur seals commonly eat squid, octopus, fish and lobsters, along with other crustaceans and cephalopods (King 1983, Schliemann 1990). Like most air-breathing marine mammals A. pusillus finds its food in the ocean. In order to do so it must store oxygen and swim below the surface to the depth at which its particular prey is located. Both subspecies of A. pusillus dive for their food but they each occupy different depth niches in their respective locations. South African fur seals are surface divers with an average dive of about 45 meters and 2.1 minutes although they can dive as deep as 204 meters and for as long as 7.5 minutes when necessary (Riedman, 1990). While there is extensive overlap, Australian fur seals generally feed at a much lower depths. Their average dive is about 120 meters (Schliemann, 1990) and they commonly go as deep as 200 meters (Riedman, 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
18.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32.1 years (captivity) Observations: The gestation time includes an approximately 4-month period of delayed implantation. One wild born specimen was about 32.1 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The breeding season for both subspecies of A. pusillus begins in the middle of October. At this time males haul out on shore at the breeding grounds, or rookeries, to establish territories by displays, sparring, or actual battle. They do not eat again until they mate in November or December.

Females come ashore slightly later and also fight amongst each other for smaller territories in which to give birth. Female territories are always within male territories and females who are located on a certain male's territory become part of his harem. While harem sizes of both subspecies can reach as many as 50 females, or cows, the average size of the South African fur seal harem is 28 cows, the Australian fur seal harem averages 10 cows (Schliemann, 1990). Breeding occurs between the male and each of his harem members. While copulation occurs about 6 days after cows give birth to a single pup there is a delay in implantation of the blastocyst. In South African fur seals this delay is approximately 4 months while in Australian fur seals it is about 3 months (Riedman, 1990). Gestation in both subspecies averages 11.75 months (Riedman, 1990).

South African fur seal pups are anywhere from 4.5 to 7 kg and 60-70 cm at birth (King 1983), which occurs in late November or early December. The pups go through two different molts in their first year and a half. Their original coat is black and curly. This coat is replaced between 4 and 5 weeks with an olive-gray coat. The second molt takes place at about 13 months and replaces the olive-gray coat with a silver one which later fades in color (King 1983). Nursing in this subspecies begins immediately after birth and is continuous for the first six days. At this time the mother mates with her male harem leader and then begins going out to sea for food for a few days at a time. By the second month, however, she can be gone for up to two weeks before returning to feed the pup (King, 1983). At four to five months old pups begin supplementing their diet with crustaceans and fish. Lactation does continue, however, until the next pup is born. Pups begin swimming early and continually increase the amount of time that they can spend in the water. At seven months they can swim for two or three days at a time (King, 1983). Females become sexually mature at about 3 years and males may also follow this trend but are unable to establish territory at this time so do not usually mate until several years later (King, 1983).

Australian fur seal pups weigh 4.5 to 12.5 kg and measure 62-80 cm in length at birth. They are a silver-gray in color and their entire ventral side is yellow. Pups in this subspecies are usually born in early to middle December. As in South African fur seals, nursing begins right after birth and is continuous for the first week or so, until the mother mates again and goes out to sea for food. At this time, however, the Australian fur seal returns once every week to feed her pup (Riedman, 1990). By the eighth month of life Australian fur seals are eating some solid supplements although lactation continues until the next pup is born. The pups start swimming for prolonged periods also at the eighth month. Sexual maturity is widely varied within the subspecies. Females reach maturity any time between 3 and 6 years of age (King, 1983). Males probably reach maturity between four and five years of age but cannot hold a harem until they are closer to seven or eight years old (King, 1983).

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 6200 g.

Average gestation period: 368 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1643 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1276 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctocephalus pusillus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCTACAAACCATAAAGATATTGGCACTCTTTACCTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTCAGCTTATTGATCCGCGCAGAATTAGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATTTATAACGTAATTGTCACCGCCCACGCATTCGTAATAATCTTTTTCATGGTGATACCCATTATAATTGGAGGCTTTGGAAATTGATTAGTACCCCTAATAATTGGAGCTCCCGACATGGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTTCTACTATTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCGGGTACCGGATGAACGGTTTACCCTCCCCTAGCGGGAAACCTGGCCCATGCAGGAGCTTCCGTAGACTTGACTATTTTCTCCCTTCATCTAGCAGGGGTATCATCTATTCTAGGAGCCATTAACTTTATTACCACCATTATCAATATGAAGCCCCCTGCCATATCCCAATACCAAACTCCTTTATTCGTGTGATCCGTACTAATTACAGCGGTACTACTTCTACTATCCCTACCAGTCCTAGCAGCTGGTATCACTATATTACTTACGGACCGAAATCTAAATACAACCTTTTTTGACCCGGCTGGAGGAGGTGACCCCATCCTATACCAACATCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTAATTCTTCCAGGATTCGGGATAATCTCACACATCGTCACCTATTACTCGGGAAAAAAGGAACCCTTTGGCTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTTACCGTAGGAATAGATGTTGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctocephalus pusillus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Hofmeyr, G.J.G.

Reviewer/s
Goldsworthy, S.D.

Contributor/s
Kirkman, S., Meer, M. & Roux, J.-P

Justification

Abundance of Cape Fur Seals is estimated to be approximately 2,000,000 animals, while that of Australian Fur Seals is 120,000. No subpopulations exist for either subspecies and no localities are isolated from any others. Total abundance for each subspecies is estimated to have increased over the past three generations. Cape Fur Seal abundance has been stable over the past two generations while Australian Fur Seals increased up to 2007, but have since experienced a 6% mean annual decrease in pup production. It is unknown whether this apparent reduction is due to a poor pupping season in 2013/14, or if it represents a real decline in the population. Fluctuations in the abundance of Cape Fur Seals have been seen in the southern Namibian rookeries as a result of poor environmental conditions affecting prey populations. No major threats currently put any of the breeding sites at risk of extinction. Australian Fur Seals are subject to persistent bycatch mortality from trawl fisheries in part of their range, and both subspecies may be affected by global climate change should it have impacts upon their abiotic environment or prey species. Smaller island rookeries of both subspecies are possibly more vulnerable to such changes. The Afro-Australian Fur Seal does not meet the IUCN criteria for any threatened category and should be listed as Least Concern.


History
  • 2008
    Least Concern (LC)
  • 1996
    Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

South African fur seals are more abundant than are Australian fur seals. Both are at the mercy of poachers, even though there are legal hunting seasons for South African fur seals. Much of the poaching danger is in the form of fishermen and large fishing corporations who believe the seals to be jeopardizing their livelihood by stealing from their nets. While this does occur it is believed to be exaggerated by those in the fishing industry.

Humans are also inadvertently threatening these seals through pollution. Plastic, pieces of netting, and pieces of fishing line kill or injure thousands of these seals a year.

Non-human threats include killer whales and white sharks. Stingrays can cause some dangerous injuries. Pups left on the mainland are also sometimes taken by terrestrial predators, such as the black-backed jackal in South Africa.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

Estimates indicate that approximately two million Cape Fur Seals bred at some 40 colonies or colony groups in 2009. However, there have been substantial changes in distribution during this time period with an increase in the number of colonies, a northward shift in range and an increase in abundance in some areas (northern Namibia and northwestern South Africa; Kirkmanet al. 2013). In 2004 some 75% of Cape Fur Seals bred at three sites: the Atlas Bay-Wolf Bay-Long Islands Complex and Cape Cross in Namibia, and Kleinzee in South Africa (Kirkmanet al. 2007). All of these sites have experienced small declines in abundance since that time (Kirkmanet al. 2013). Most of the smaller rookeries are estimated to contain more than 1,000 adults. While the abundances of the larger rookeries are relatively stable, they do experience fluctuations. Fluctuations are greater in southern Namibian rookeries (Kirkmanet al. 2013) which have experienced major mortality events due to the impact of poor environmental conditions on prey populations (Gammelsrdet al. 1998, Gerber and Hilborn 2001). Smaller rookeries tend to experience greater fluctuations than larger rookeries (Kirkmanet al. 2007, 2013).

Australian Fur Seal pup production has been assessed during three national surveys at approximately five-year intervals since 2002/03. These have indicated a mean annual increase in pup production between 1986 and 2002/03 of 5%, slowing to 0.3% per year between 2002/03 and 2007/08 seasons. It is not clear if the apparent 6% per year decline between the 2007/08 and 2013/14 estimates is due to a poor pupping season in 2013/14, or represents a real decline in population over that period, as no colonies are monitored on an annual basis. The most recent estimate (2013/14) of pup production was 15,063 (McIntoshet al. 2014). Based on the 2007/08 surveys, two colonies adjacent to the Victorian coast, Seal Rocks (5,660 pups) and Lady Julia Percy Island (5,574 pups), account for 51% the total pup production. Based on these surveys the total Australian Fur Seal population is estimated to be 120,000 individuals (Kirkwoodet al. 2010).

In terms of national distributions, approximately 55% of pup production for this species takes place at 23 sites in Namibia, 38% at 16 sites in South Africa, less than 2% at a single site in Angola and 5% at 17 sites in Australia (Kirkmanet al. 2007, Kirkwoodet al. 2010,Shaughnessyet al. 2010,Kirkmanet al. 2013,McIntoshet al. 2014, Shaughnessyet al. 2014).

While rookeries of Cape Fur Seals are separated by between a few to several hundred kilometres, tag data (Oosthuizen 1991) and genetic evidence (Mattheeet al. 2006) indicate substantial movement between them and no distinct subpopulations.

Generation length has been calculated at 9.1 years (Pacificiet al. 2013). Population change for the species over three generations from 1982-2009 has been positive (Kirkmanet al. 2013, McIntoshet al. 2014).


Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Cape and Australian Fur Seals were hunted heavily during the 17th, 18th and 19th centuries and populations of bothwere reduced to low levels (Warnecke and Shaughnessy 1985,David 1987a). Under protection, both have recovered, although the Cape subspecies to a much greater extent than the Australian subspecies, which has not returned to estimated pre-exploitation levels (Kirkmanet al. 2013; Kirkwoodet al. 2005). Levels of exploitation of Cape Fur Seals were not as severe as those experienced by other species of Fur Seals and genetic variation remains high (Mattheeet al. 2006).

Harvests of Cape Fur Seals in South Africa were first controlled in 1893 and were suspended in 1990 (Wickenset al. 1991). Harvesting continues in Namibia at the mainland colonies of Cape Cross and the Wolf and Atlas Bays group (Jappet al. 2012). Harvest levels have remained high even in years with high levels of pup and adult natural mortality (Jappet al. 2012, Kirkmanet al. 2007). This mortality has been attributed to a scarcity of fish and poor marine productivity along the coast of Namibia, which occurs at intervals (Gammelsrdet al. 1998, Gerber and Hilborn 2001). Australian Fur Seals are not harvested.

The foraging distributions of both subspecies overlap extensively with commercial fishing activities, especially trawl fisheries operating in southeastern Australia (David 1987b, Wickenset al. 1992,Goldsworthyet al. 2003). Fisheries interactions therefore constitute one of the most important threats to the species, and especially for the less abundant Australian Fur Seal (v, National Seal Strategy Group and Stewardson 2007). This subspecies is subject to significant and ongoing bycatch mortality associated with demersal and mid-water trawling operations, and they constitute a significant bycatch in the mid-water trawl sector of the small pelagic fishery (Knuckeyet al. 2002,Hamer and Goldsworthy 2006, Tilzeyet al. 2006,Lyle and Willcox 2008, Tucket al. 2013). Ecological interactions with fisheries also pose a potential threat, given their reliance on small pelagics (Goldsworthyet al. 2003,Deagleet al. 2009). Australian Fur Seals also interact regularly with finfish (Salmon) aquaculture farms in Tasmania (Pemberton and Shaughnessy 1993, Humeet al. 2002, National Seal Strategy Group and Stewardson 2007, Robinsonet al. 2008). At aquaculture farms, Seals are at risk of becoming entangled in nets and having their behaviour changed by becoming habituated to a predictable food source (National Seal Strategy Group and Stewardson 2007).

Cape Fur Seals are reported to interact with commercial fisheries, both via direct competition and operationally. A number of commercially exploited species of fish are eaten by Seals (David 1987b, Wickenset al. 1992). While the effects of these interactions are difficult to assess due to the complexities of the marine food web and the range of species that Seals prey on (David 1987b, Punt and Butterworth 1995), it is possible that changes in fishing effort and changes in the abundance and distribution of commercially harvested fish species may result in reduced prey populations (Barangeet al. 1999,Royet al. 2007,Moloneyet al. 2013, Rouxet al. 2013). The impact of direct mortality of Cape Fur Seals due to fisheries is not well known and the effects of current interactions have not been studied. Seals have been taken incidentally in past fishing operations and levels of take have been estimated to be low (Wickenset al. 1992,David and Wickens 2003). A number are also shot illegally during fishing operations (Wickenset al. 1992).

While climate change does not pose the same level of threat to the Afro-Australian Fur Seals as it does for many other species of pinnipeds, it remains important (Kovacset al. 2012). Climate mediated changes in prey species (Barangeet al. 1999,Royet al. 2007,Moloneyet al. 2013, Rouxet al. 2013) may be responsible for changes in the distribution of rookeries of Cape Fur Seals (Kirkmanet al. 2013). It is also possible that climate change was responsible for recent periods of high mortality along the Namibian coast (Gammelsrdet al. 1998, Gerber and Hilborn 2001). Pups are vulnerable to high temperatures (De Villiers and Roux 1992), and changes leading to higher ambient temperatures and fewer windy days may increase mortality (Kovacset al. 2012). A number of pups are born on small and low lying islands (Kirkwoodet al. 2010,Kirkmanet al. 2013) and are susceptible to high mortality during summer storms (Hofmeyret al. 2011). Rising sea levels and possible changes in the frequency of such storms induced by climate change will threaten such colonies with extirpation.

Entanglement in marine debris poses a potential threat to the Afro-Australian Fur Seals (Shaughnessy 1999, Lynchet al. 2011ab,Kirkwood and Goldsworthy 2013). Rates of entanglement vary by colony, but have been estimated to be between 0.12%-0.66% for the Cape Fur Seal (Shaughnessy 1980).

Like all Fur Seals, Afro-Australian Fur Seals are vulnerable to oil spills because of their dependence on their thick pelage for thermoregulation (Bonner 1978). Cape Fur Seals come in regular contact with a number of species of terrestrial carnivores, and both subspecies are at risk of exposure to viruses and other disease types that could lead to epidemics (Lavigne and Schmitz 1990, Kirkman 2006).

Both subspecies are visited by tourists at a number of colonies. Disturbance is believed to be minimal (Kirkwoodet al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Australian Fur Seals are protected nationally by the Environment Protection and Biodiversity Conservation Act (1999). They are also protected in all Australian states in which they occur by state-specific legislation (National Seal Strategy Group and Stewardson 2007).

Although Cape Fur Seals have been protected in South Africa since 1893 by the Fish Protection Act, and in Namibia since 1922 by the Sealing and Fisheries Proclamation, they were still subject to government run or government authorized commercial harvests (Wickenset al.1991,Butterworth et al. 1995, David and Wickens 2003). Harvests ceased in South Africa in 1990 (Wickens et al. 1991) but continue in Namibia (Japp et al. 2012). In South Africa the Sea Birds and Seals Protection Act of 1973, provides broad protection for Seals. Furthermore, the commercial killing of Seals is now prohibited in South Africa under terms of the Policy on the Management of Seals, Seabirds and Shorebirds (MLRA 2007). While the conservation and harvesting of Seals in Namibia was previously controlled by the Sea Birds and Seals Protection Act, this has been replaced by the Marine Resources Act of 2000 which relaxed restrictions aimed at ensuring a humane harvest (Kirkman 2006,Algers et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Sealing has been common for centuries. Seals are taken for their pelts, their blubber, or their meat. Currently there are seasons for hunting different classes of the South African fur seal, but this is controversial. Seal pups are valued for their softer fur and male genitalia is taken and sold as an aphrodisiac. The Australian fur seal is protected and is not legally hunted by humans today, although it was hunted for meat in the past (King, 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brown fur seal

The brown fur seal (Arctocephalus pusillus), also known as the Cape fur seal, South African fur seal and the Australian fur seal is a species of fur seal.

Description[edit]

Fur seal grooming itself
Skull of male brown fur seal

The brown fur seal is the largest and most robust fur seal. It has a large and broad head with a pointed snout that may be flat or upturned slightly.[2] They have external ear flaps (pinnae) and their whiskers (vibrissae) are long, and may extend backward past the pinnae, especially in adult males. The foreflippers are covered with sparse hair over about three-quarters of their length. The hindflippers are short relative to the large body, with short, fleshy tips on the digits.[2] The size and weight of the brown fur seal depends on the subspecies. The Southern African subspecies is on average slightly larger than the Australian subspecies. Males of the African subspecies (A. p. pusillus) are 2.3 metres (7.5 ft) in length on average and weigh from 200–300 kilograms (440–660 lb).[3] Females are smaller, averaging 1.8 metres (5.9 ft) in length and weighing an average of 120 kilograms (260 lb).[4] Males of the Australian subspecies (A. p. doriferus) are 2–2.2 metres (6.6–7.2 ft) in length and weigh 190–280 kilograms (420–620 lb).[5] Females are 1.2–1.8 metres (3.9–5.9 ft) length and weigh 36–110 kilograms (79–243 lb).[4]

Adult male brown fur seals are dark gray to brown, with a darker mane of short, coarse hairs and a light belly, while adult females are light brown to gray, with a light throat and darker back and belly. The foreflippers of the fur seal are dark brown to black.[2] Pups are born black and molt to gray with a pale throat within three to five months.[2] The skull of the African subspecies has a larger crest between the mastoid process and the jugular process of the exoccipital.[4]

Ecology[edit]

A fur seal colony at Duiker Island, South Africa
Fur seal underwater

The African fur seal lives around the southern and southwestern coast of Africa from Cape Cross in Namibia and around the Cape of Good Hope to Black Rocks near Port Elizabeth in the Eastern Cape province.[2] The Australian fur seal lives in Bass Strait, at four islands off Victoria in southeastern Australia and five islands off Tasmania.[2] Brown fur seals prefer to haul out and breed on rocky islands, rock ledges and reefs, and pebble and boulder beaches. However, some large colonies can be found on sandy beaches.[2] Fur seals spend most of the year at sea, but are never too far from land. They have been recorded 160 km from land, but this is not common.[4]

The African fur seal’s diet is made of up to 70% fish, 20% squid and 2% crab.[6] Also eaten are other crustaceans, cephalopods and sometimes birds.[4][6] In rare instances they have even been documented attacking and eating sharks. A recent incident occurred off Cape Point, South Africa, where a large male was observed attacking and killing five blue sharks between 1 and 1.4 metres long. Observers concluded that the seal likely killed the sharks to eat the fish rich contents of their stomachs as well as their livers as a source of energy.[7] The Australian fur seal mostly eats squid, octopus, fish and lobsters.[4][6] The brown fur seal dives for its food. The African subspecies can dive as deep as 204m and for as long as 7.5 minutes.[8] The Australian subspecies generally feeds at lower depths, diving on average 120m[6] and can reach as deep as 200m.[8]

The brown fur seal's main predator is the great white shark, although they are also preyed upon by various other animals, as well, such as orcas. Land-based predators include black-backed jackals and brown hyenas on the Skeleton Coast in Namibia. In False Bay, the seals employ a number of antipredatory strategies while in shark-infested waters, such as:

  • Swimming in large groups
  • Low porpoising to increase subsurface vigilance
  • Darting in different directions to cause confusion when attacked
  • Riding near the dorsal fin to keep out of reach of the shark's jaws when attacked[9]

Behaviour[edit]

Brown fur seal colony at Friar Islands, Tasmania
Brown fur seals

Acoustic Behavior[edit]

Australian fur seals are social animals that use vocalizations in a broad range of contexts. These vocalizations have been shown to contain individually unique properties important for enabling individual recognition [10] This is particularly important for the reunion of mothers and pups that experience repeated separations whilst mothers are out at sea foraging, sometimes for days at a time. Upon their return mothers need to locate their pups [11][12]). This reunion process may also be facilitated through a combination of smell and spatial cues.

In males, increases in testosterone and calling rates are seen in conjunction with the onset of the breeding season ([13]). Males can also differentiate neighboring males from stranger males, responding more aggressively to the vocalizations of strangers ([14]). This difference in response is suspected because the threat posed by a stranger is unknown and potentially greater than their neighbor, who they would have previously encountered while establishing their territories (;[15][16]).

Breeding Behaviour[edit]

Brown fur seals often gather into colonies on rookeries in numbers ranging from 500–1500, at least for the Australian subspecies.[4] While fur seals spend most of the year at sea, they never fully evacuate the rookeries as mothers and pups return to them throughout the year. There is no established dispersal from a colony, although some fur seals from one colony have been found at another. True boundaries do not exist between the colonies. When at sea, fur seals travel in small feeding groups. Brown fur seals begin to breed in the middle of October, when males haul out on shore to establish territories though display, vocalisations, sparring and sometimes actual combat [1]. They will fast at this time and not eat until after mating in November or December. When the females arrive, they fight among themselves for territories in which to give birth. Female territories are smaller than those of males and are always located within them. Females within a male’s territory can be considered part of his harem. However, males do not herd the females, which are free to choose their mates and judge them based on the value of their territories. For the Australian fur seals, 82% of copulations are performed by males whose territories are located directly at the water's edge.[8] Copulation between the male and his females begins six days after they give birth to their pups conceived from the previous year. However, there is a delay in the implantation of the blastocyst, which lasts four months in the African subspecies and three months in the Australian subspecies.[8] Gestation for the brown fur seal lasts an average of 11.75 months.[8]

After mating, females begin alternating brief periods of foraging at sea with several days ashore nursing their pups.[2] Foraging trips last about seven days in winter and about four days in summer and autumn. When a mother returns from sea to feed her pup, she emits a loud call which attracts all the nearby pups, but she only responds to her pup. She possibly can recognize her pup by smell.[8] When left alone, pups gather in groups and play during the evening.[4] Pups are usually weaned at 4–6 months old.[2]

Human interactions[edit]

Brown fur seal Gaston in Prague Zoo

This species is an inquisitive and friendly animal when in the water, and will often accompany scuba divers. They will swim around divers for periods of several minutes at a time, even at a depth of 60m. On land, they are far less relaxed and tend to panic when people come near them.

Australian fur seals were hunted intensively between 1798 and 1825 for commercial reasons. Seal hunting stopped in Australia in 1923, and their population is still recovering. Breeding and haul-out sites are protected by law. South African fur seals have a very robust and healthy population. Harvesting of seals was outlawed in South Africa in 1990.

Brown fur seals are still harvested in Namibia. Permits are issued for the killing of pups for their luxurious fur and adult males for their genitalia which are considered an aphrodisiac in some countries. It is also considered necessary to limit seal numbers in Namibia because of the supposed effect seals have on the country's fish harvest. Research by environmental groups disputes this.[17]

References[edit]

  1. ^ Hofmeyr, G. & Gales, N. (2008). Arctocephalus pusillus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 30 January 2009.
  2. ^ a b c d e f g h i Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
  3. ^ "The S.A. Fur Seal". Botany.uwc.ac.za. 2001-02-01. Retrieved 2013-04-13. 
  4. ^ a b c d e f g h King, J. 1983. Seals of the World. Ithaca, New York: Comstock Publishing Associates.
  5. ^ "Dive behaviour, foraging location... preview & related info". Mendeley. doi:10.1139/cjz-79-1-35. Retrieved 2013-04-13. 
  6. ^ a b c d Schliemann, H. 1990. Eared Seals and Walruses. Pp. 168–203 in B. Grzimek, ed. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill.
  7. ^ "Seal attack! Hungry creature eats five blue sharks in rare images of sea mammal turning the tables on predator of the deep". Mail Online. January 29, 2013. Retrieved February 1, 2013. 
  8. ^ a b c d e f Riedman, M. 1990. The Pinnipeds: Seals, Sea Lions, and Walruses. Berkeley: University of California Press.
  9. ^ Anti-Predatory Strategies of Cape Fur Seals at Seal Island
  10. ^ Tripovich, J.S.; Canfield, R.; Rogers, T.L.; Arnould, J.P.Y. (2008). "Characterisation of Australian fur seal vocalizations during the breeding season.". Marine Mammal Science 24 (4): 913–928. doi:10.1111/j.1748-7692.2008.00229.x. 
  11. ^ Tripovich, J.S.; Rogers, T.L.; Canfield, R.; Arnould, J.P.Y (2006). "Individual variation in the pup attraction call produced by female Australian fur seals during early lactation.". Journal of the Acoustical Society of America 120 (1): 502–209. doi:10.1121/1.2202864. 
  12. ^ Tripovich, J.S.; Canfield, R.; Rogers, T.L.; Arnould, J.P.Y. "Individual variation of the Female Attraction Call produced by Australian fur seal pups throughout the maternal dependence period.". Bioacoustics-The International Journal of Animal Sound and its Recording 18: 259–276. doi:10.1080/09524622.2009.9753605. 
  13. ^ Tripovich, J.S.; Rogers, T.L.; Dutton, G. (2009). "Faecal testosterone concentrations and the acoustic behavior of two male captive Australian fur seals.". Australian Mammalogy 31 (2): 117–122. doi:10.1071/AM09009. 
  14. ^ Tripovich, J.S.; Rogers, T.L.; Arnould, J.P.Y. (2005). "Species-specific characteristics and individual variation of the Bark Call produced by male Australian fur seals (Arctocephalus pusillus doriferus).". Bioacoustics-The International Journal of Animal Sound and its Recording 15 (1): 502–509. doi:10.1080/09524622.2005.9753539. 
  15. ^ Tripovich, J.S.; Charrier, I.; Rogers, T.L.; Canfield, R.; Arnould, J.P.Y. (2008). "Acoustic features involved in the neighbour-stranger vocal recognition process in male Australian fur seals.". Behavioural Processes 79 (1): 74–80. doi:10.1016/j.beproc.2008.04.007. 
  16. ^ Tripovich, J.S.; Charrier, I.; Rogers, T.L.; Canfield, R.; Arnould, J.P.Y. (2008). "Who goes there? The dear-enemy effect in male Australian fur seals (Arctocephalus pusillus doriferus).". Marine Mammal Science 24 (4): 941–948. doi:10.1111/j.1748-7692.2008.00222.x. 
  17. ^ South African and Australian Fur Seals. Seal Conservation Society. Accessed 7 February 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!