Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Biology

At the start of the breeding season, males begin arriving at their traditional sites about a month ahead of the females and start competing for breeding territories (4). These fights can be extremely violent, with each mature bull aiming to slash an opponent's neck with his sharp canine teeth. Only the largest and heaviest bulls can hope to claim the title of 'beachmaster'; the smaller younger males, who have no chance of competing with the fully-grown animals, occupy the fringes of the breeding territories (3). The females arrive in mid-June and give birth to the pups, conceived the year before, some two days after their arrival. Within a week of the birth, the females will mate again (4). Males compete to secure as many females as he can within his harem, although it is thought that females are influenced by the presence of other females and the characteristics of the territory rather than the mere size and power of the male (2). The beachmasters will continue to squabble and fight over females right through the breeding season, usually because these colonies are crowded, and wandering females sometimes stray into another male's territory (3). Occasionally, younger males will attempt to steal a mating with a female and, if spotted by one of the beachmasters, he will be chased off (2). In order to ensure that his females are not claimed by another male, bull northern fur seals do not feed throughout the breeding period and may eventually loose 20% of their body weight (4). Mothers suckle their pups for up to 10 days before returning to feed at sea, usually during the night. She will stay at sea from between four and ten days feeding, returning to feed her pup for one or two days. She will do this for four months before leaving her youngster and migrating south, usually in late October (4). Fur seals feed on a variety of prey, including squid and pollack (4) and have also been recorded taking seabirds (2). The fertilised egg within the female fur seal undergoes a four month period of delayed implantation. This ensures that that the developing pup will be born at the right time the following year when the animals return to their breeding grounds. The pups will spend as long as 22 months at sea before returning to the beach where they were born (4). Fur seals mature between the ages of three and six, but males will probably not begin to breed for an additional three years (2). The principal natural predators of fur seals are orca (killer whales), great white sharks and the much larger Steller sea lion Eumetopias jubatus. On land, pups can fall prey to foxes (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

"Northern fur seals breed on islands near Russia, Alaska, and California, but not necessarily on the island where they were born—females tagged as pups have been found breeding on other islands. The seals range widely in the North Pacific, some swimming as far south as the US-Mexican border, and in the western Pacific, as far south as southern Japan. Females and their offspring tend to travel farther than males, who usually stay in Alaskan waters in the non-breeding season. Population numbers in some areas plummeted in the late 20th century, for a variety of reasons. From 1956-1968, 300,000 females were killed annually for their fur. Fisheries take millions of tons of fish—the seals' food—every year, and many seals died when they were trapped in tough, plastic, 30-mile-long fishing nets."

Links:
Mammal Species of the World
Visit ARKive for more images of the northern fur seal  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. p. 37. Tenth Edition, Vol. 1. Laurentii Salvii, Stockholm, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Northern fur seals belong to the family known as eared seals, more commonly called sea lions. They differ from the true seals in having small external earflaps and hind flippers that can be turned to face forwards. Together with strong front flippers, this gives them extra mobility on land and an adult fur seal can move extremely fast across the beach if it has to. They also use their front flippers for swimming, whereas true seals use their hind flippers (3). Sea lions show a considerable size difference between the sexes. A bull northern fur seal is a big heavy animal, over two metres in length and weighing as much as 270 kg. Their fur varies in colour, ranging from reddish to black, and they have thick necks and a mane (2). The females (cows) are much smaller, less than a metre and a half in length and weighing a fifth as much as the bulls (2). Their colouring differs, too, having a silvery-grey back, with reddish-brown at the front and a whitish-grey patch on the chest (4). Young seal pups are black with paler markings around the nose and mouth (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Northern Fur Seals are a widely-distributed pelagic species in the waters of the North Pacific Ocean and the adjacent Bering Sea, Sea of Okhotsk and Sea of Japan. They range from Northern Baja California, Mexico north and offshore across the North Pacific to Northern Honshu, Japan. The southern limit of their distribution at sea is approximately 35° N. Vagrants reach the Yellow Sea in the west and eastern Beaufort Sea in the Arctic. The vast majority of the population breeds on the Pribilof Islands, with substantial numbers on the Commander Islands as well. Still other sites are used, including San Miguel Island in California, Bogoslof Island in the Bering Sea, and Robben Island off Sakhalin Island in Russia. Many animals, especially juveniles, migrate from the Bering Sea south to southern California or the waters off Japan, to spend the winter feeding.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northern fur seals migrate from the North Pacific Ocean in the winter to the Bering Sea in the summer. Northern fur seal populations occur along the coast of California (down to San Diego), Alaska, Russia, and Japan.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native ); pacific ocean (Native )

  • Mori, J., N. Baba, T. Kubodera. 2001. Squid in the diet of northern fur seals, *Callorhinus ursinus*, caught in the western and central North Pacific Ocean. Fisheries Research, 52: 91-97.
  • Nowak, R. 1999. Walker's Mammals of The World, 6th ed.. Baltimore: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Bering Sea, North Pacific, Sea of Okhotsk
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Breeding range is mostly the eastern and western Bering Sea and Sea of Okhotsk; also the vicinity of San Miguel Island, California. Primary breeding sites are the Pribilof Islands (St. Paul and St. George) in the eastern Bering Sea and the Commander Islands in the western Bering Sea; smaller breeding rookeries are on Robben Island in the Sea of Okhotsk, on the Kuril Islands north of Japan, on Bogoslof Island in the eastern Aleutians, and on San Miguel Island (Adams Cove, Castle Rock) in southern California (Reeves et al. 1992). A few haul out seasonally on Southeast Farallon Island and (rarely) on San Nicolas Island, California (Reeves et al. 1992). In winter, the species ranges south to the Honshu coast, Japan, to California, and occasionally the Mexican coast in the eastern Pacific. Adult females range farther south in winter than do males, about which little is known regarding nonbreeding distribution (perhaps remain near the Aleutians).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Northern fur seals range over most of the northern Pacific Ocean, as far south as southern California in the east and to central Japan in the west. Northwards, their range extends to the Bering Sea, north of the Aleutian Islands, and the Sea of Okhotsk, west of the Kamchatka peninsular (4). Their main breeding grounds are on the Pribilof Islands of St. George and St. Paul in the southern Bering Sea. They also breed on a number of other islands scattered throughout their range, principally the central Kuril Islands and Tyuleniy Island in the Sea of Okhotsk, the Commander Islands off the coast of Alaska, Bogoslof Island in the Aleutians and San Miguel Island off the coast of California (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Northern fur seals are extremely sexually dimorphic. Male and female northern fur seals vary both in size and color. Adult females are smaller than males, measuring about 142 cm and weighing 43-50 kg, and are usually gray or brown. Adult males tend to be reddish in coloration or black, measure 213 cm, and weigh between 181 and 272 kg. Northern fur seal pups have black pelage. Additional characteristics include vibrissae, which are white on the adult and black on the pup. Pups usually have lighter markings on the nose and underside. Adults, especially males, have a mane, which is similar to the mantle of some squirrels. The adults have small noses, thick underfur,and long pinnae. The fur on the front flippers stops at the wrist.

Range mass: 43 to 272 kg.

Average mass: 147.50 kg.

Average length: 142-213 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Weight: 270000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are much larger than females.

Length:
Average: up to 2.1 m males; 1.2-1.5 m females

Weight:
Range: 136-279 kg males; 30-50 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Northern Fur Seals exhibit extreme sexual dimorphism, with males being 30-40% longer and more than 4.5 times heavier than adult females. Males can be as large as 2.1 m and 270 kg. Females can be up to 1.5 m and 50 kg or more. Newborns weigh 5.4-6 kg, and are 60-65 cm long. Pups are blackish at birth, with variable oval areas of buff on the sides, in the axillary area and on the chin and sides of the muzzle. After 3-4 months, pups moult to the colour of adult females and subadults. Northern Fur Seals become sexually mature at 3-5 years old, at which time females usually produce one pup a year for most of the rest of their lives. Gestation lasts 51 weeks, which includes a delay of implantation of 3.5 to 4 months. Longevity of this species is 25 years (Reijnders et al 1993). Males do not become physically mature, and large enough to compete for a territory that will be used by females, until they are 8-9 years old. The generation time for females is approximately 12-15 years depending on the determination methods used.

Breeding on the Pribilof Islands occurs from mid-June through August, with a peak in early July (the median date in southern California is approximately 2 weeks earlier than at the Pribilofs). This is a highly polygynous species. Males arrive at the rookeries up to one month before females and vocalize, display and fight to establish and maintain territories.

Northern Fur Seals usually give birth a day after arrival at the rookery. Mean time from birth to oestrous is 5.3 days, followed by a departure for a mean of 8.3 days for the first feeding trip. Females breeding at the Pribilof Islands are located relatively far from the foraging areas, which are concentrated at the edge of the continental shelf and hence females in this population consistently make longer foraging trips than most other female otariids, with a mean trip length of 6.9 days. Once foraging begins the mean depth of dives is 68 m and average duration is 2.2 minutes with maximum depth recorded of 207 m and maximum duration of 7.6 minutes. Pups are visited 8-12 times over the lactation period and attended for a mean of 2.1 days during each visit, before being abruptly weaned at 4 months old.

Northern Fur Seals are one of the most pelagic pinnipeds. They spend most of the year at sea, rarely (if ever) returning to land between one breeding season and the next. Thus, males spend an average of only 45 days ashore a year and females only 35 days a year. Once weaned, juveniles go to sea and do not haul-out until they return, usually to the island of their birth, 2-3 years later. At sea, Northern Fur Seals are most likely to be encountered alone or in pairs, with groups of 3 or more being uncommon. They forage relatively far from shore, over the edge of the continental shelf and slope. Diving is concentrated around dawn and dusk. Northern fur seals spend quite a bit of time rafting at the surface, either asleep or grooming. They employ a wide variety of resting postures, including raising one or more flippers into the air, and draping one of their fore flippers over both of the rear flippers to form a posture known as the "jug handle" position.

Many animals, especially juveniles, migrate from the Bering Sea south to California or the waters off Japan, to spend the winter feeding.

The diet varies by location and season and includes many varieties of epipelagic and vertically-migrating mesopelagic schooling and non-schooling fish and squid. Prey species of importance in the waters off California and Washington include anchovy, hake, saury, several species of squid and rockfish, and salmon. In Alaskan waters, Walleye Pollock, Capelin, Sand Lance, Herring, Atka Mackerel, and several species of squid are important prey.

Predators include Killer Whales, sharks, and Steller Sea Lions.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Northern fur seals spend the majority of their lives in the cool water of the North Pacific Ocean. During the reproductive season northern fur seals arrive at island breeding grounds. Male northern fur seals remain on land. Females will remain on land during mating but will re-enter the ocean to hunt while nursing a pup.

Range depth: 207 (low) m.

Average depth: 175 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2073 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1685 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 3.487 - 16.999
  Nitrate (umol/L): 0.116 - 11.410
  Salinity (PPS): 30.381 - 33.496
  Oxygen (ml/l): 5.554 - 7.600
  Phosphate (umol/l): 0.330 - 1.408
  Silicate (umol/l): 1.436 - 30.351

Graphical representation

Temperature range (°C): 3.487 - 16.999

Nitrate (umol/L): 0.116 - 11.410

Salinity (PPS): 30.381 - 33.496

Oxygen (ml/l): 5.554 - 7.600

Phosphate (umol/l): 0.330 - 1.408

Silicate (umol/l): 1.436 - 30.351
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Open ocean and coastal waters. Rocky shores during breeding season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Although northern fur seals spend most of the year at sea in the cold northern waters of the Pacific Ocean (2), their breeding grounds are on rocky coastlines close to the edge of the continental slope (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Males arrive in breeding areas in late May and early June, migrate south to winter range from early August to early October. Females and young migrate south beginning in October (e.g., see Ragen et al. 1995 for information on migration from St. Paul Island south through the Aleutian Islands), gone from Bering Sea by late November; begin returning north to rookeries in March (Reeves et al. 1992). San Miguel Island population probably stays in California waters all year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Northern fur seals are described as opportunistic feeders. The main components of the diet are fish and squid. Occasionally northern fur seals will feed on birds. The diet is mainly dependent on the availability of prey due to season and location.

Foods eaten include: pollack, herring, lantern fish, cod, rockfish, squid, loons and petrels.

Animal Foods: birds; fish; mollusks

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds mostly on small schooling fishes and squids, including a wide variety of species in both groups. Occasionally eats birds. Feeds mostly at night. Adult males fast 1-2 months during breeding season. In the Pribilof Islands, lactating females forage usually within 160 km of rookery, occasionally up to 430 km away; feeding dives average about 68 m, sometimes exceed 200 m (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Because of their feeding habits, these seals play an important role in food webs, affecting the population of prey fishes. They also may have an effect on predator populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Since the main predators of northern fur seals are marine mammals, the main strategy of escape is to emerge onto land.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Callorhinus ursinus is prey of:
Carcharodon carcharias
Orcinus orca
Eumetopias jubatus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Callorhinus ursinus preys on:
Actinopterygii
Mollusca
Aves

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population was estimated at 1.75 million in 1976, with nearly 900,000 in the Pribilofs and 256,000 in the Commander Islands. The Pribilof herd totaled about 2.5 million in the late 1950s; total population in 1983 was estimated at about 1.2 million (NMFS, Federal Register, 15 March 1996); in 2002, population estimate was 888,120 (NMFS 2003). San Miguel Island, California, population was about 10,500 in the mid-1990s (Barlow et al., cited by NMFS, Federal Register, 15 March 1996). Nearly 1,400 pups were born at the two San Miguel Island rookeries in 1988 (Reeves et al. 1992) and 2,634 in 1994 (Barlow et al.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Solitary or slightly gregarious at sea.

Large sharks, killer whales, and northern sea lions are the primary predators. Mortality rate is nearly 50% in first year; natural mortality averages 10-20% per year for 2-3-year-olds, 10-11% for mature females, and 32-38% for adult males (Reeves et al. 1992).

Some movement occurs among rookeries; immigrants from the Pribilof, Commander, and Robben islands contributed to growth of the San Miguel Island colony, and recent repopulation of the Kuril Islands evidently resulted from immigration of seals from western and eastern Bering Sea rookeries (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Vocal communication is important twice during the lifetime of a northern fur seal. Vocalizations are crucial to the mother and pup relationship. While the mother and pup are on the mating island the mother frequently returns to the ocean to hunt. When the mother returns vocalizations are used to find the young. If the young becomes lost the mother is able to locate her young by distinctive individual vocalizations. This type of vocalization is described as being loud, repetitive, and low or deep. Once the mother and pup have located each other the mother uses scent to verify the pup is her young.

Verbal communication also becomes important when males are competing for territory. Males will bark at each other during competition.

These animals are also reported to use scent marks.

Communication Channels: acoustic

Other Communication Modes: scent marks

Perception Channels: acoustic

  • Insley, S. 2001. Mother-offspring vocal recognition in northern fur seals is mutual but asymmetrical. Animal Behavior, 61: 129-137.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Feeds mostly at night. Active day and night in breeding aggregations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Gestation is approximately one year. After the pup is born nursing will last for 4 months. Both males and females of the species reach sexual maturity between the ages of 3-6 years.

(Insley 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Actual lifespans of up to 26 years have been measured, although it is thought that the actual maximum may be around 30 years of age.

Range lifespan

Status: wild:
26 (high) years.

Typical lifespan

Status: wild:
30 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: After fertilization, implantation is delayed for 3.5 to 4 months, making the total gestation period to be approximately 11.75 months (Ronald Nowak 2003). In the wild, females have been estimated to live more than 30 years (http://www.demogr.mpg.de/longevityrecords), which is possible but unverified. Their longevity in captivity has not been studied in detail but one wild born specimen was about 25.1 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Northern fur seals are polygynous. Males compete for territories and successful males can mate with many females.

Males arrive at the mating island prior to the females, at which time they begin to claim a mating territory. The mating islands in the Pribilofs, St. George and St. Paul,the southern California island San Miguel, and additional islands in the Bering Sea are the most common mating grounds.

Non-mating males will also travel to the island and usually end up on a territory on the outer edge. Non-mating males learn from their experiences until they reach mating age and are able to successfully compete with other males.

When females arrive it is believed that they choose a mate not based on the male's appearance, but the specific characteristics of the mating territory and possibly the presence of other females.

Males will participate in aggressive, but usually not lethal, behavior with other males. Females are more likely than males to be injured during the mating selection process. Occasionally, two males with fight over a female if she attempts to leave a mating territory, which could result in a tug of war. While males are sparing they will make attempts not to injure any pups in the area.

Mating System: polygynous

Northern fur seals are extremely polygamous. In some cases a single male may mate with up to 50 females during one breeding season. However, more typical is 15 to 20 females. The number of females a male mates with is dependent on the number of available females and the male’s ability to control a mating territory.

The female arrives at the mating island, gives birth to a pup which is a result of the prior year's mating, then mates. Mating occurs during summer. The fertilized egg undergoes delayed implantation. After the blastocyst stage occurs, development halts for approximately four months. Implantantion of the embryo occurs four months after fertilization.

Gestation lasts for approximately one year. Pups are born between June and July, and remain on land for 60-70 days. Peak pupping season is mid-June to mid-July, and peak mating occurs just after this, from late-June to late July.

Females typically become sexually mature between 3 and 6 years of age. Males reach sexually maturity between the same ages, but typically will not participate in mating until three years later.

The same group of males and females tends to return to the same mating island every year. However, male pups born on a particular island will go to a different island when they reach reproductive age. This can be considered dispersal of males.

Breeding interval: Northern fur seals breed annually.

Breeding season: Mating occur in summer, with the peak of mating falling in late June through mid-July.

Average number of offspring: 1.

Range gestation period: 11 to 12 months.

Average weaning age: 4 months.

Range age at sexual or reproductive maturity (female): 3 to 6 years.

Range age at sexual or reproductive maturity (male): 3 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 5281 g.

Average number of offspring: 1.3.

Pups are born unable to swim or to move around much. Females care for their pups. They nurse the pups, providing milk to sustain them. During the nursing period, the mother makes feeding trips to the ocean. She may leave her pup for four to nine days! The mother returns to land to nurse the pup for about two days between feeding trips. Weaning occurs between three and four months of age, and is apparently begun by the pup. After the pup is weaned, there are no long-term social bonds in this species.

Parental Investment: altricial ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Nowak, R. 1999. Walker's Mammals of The World, 6th ed.. Baltimore: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Females arrive at rookery mainly in June, with some arriving as late as early August. Pups are born 2-3 days after pregnant females arrive. Pupping peaks about July 15, usually ends about August 1. Mating occurs 4-7 days after single pup is born. In the Pribilofs, pups are weaned in October and November, about 125 days after birth; young go to sea soon afterward. Females sexually mature usually at 4-5 years, few males breed before they are 8-9 years old. In a given year, about 57% of adult females give birth. Few males breed in more than 2 seasons. Maximum longevity about 26 years. Male territory may contain from less than 10 to about 100 females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Callorhinus ursinus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0683-06|NC_008415|Callorhinus ursinus| AATCGATGATTATTCTCTACAAACCACAAAGATATCGGTACCCTCTACCTATTATTTGGTGCATGAGCTGGAATGGCTGGCACTGCCCTC---AGCCTACTGATCCGCGCGGAATTAGGCCAACCAGGCACCCTACTAGGAGAC---GACCAAATCTATAACGTAATTGTCACCGCCCATGCATTCGTAATAATCTTTTTCATAGTAATACCTATCATAATTGGAGGCTTTGGAAACTGATTAGTACCCCTAATA---ATTGGAGCTCCCGACATGGCATTCCCCCGAATAAACAATATGAGTTTCTGACTTCTACCACCTTCTTTTCTACTACTACTAGCCTCTTCTCTAGTTGAAGCAGGCGCAGGTACCGGATGAACGGTCTACCCTCCCCTAGCAGGTAACCTAGCCCACGCAGGAGCTTCCGTGGACTTG---ACCATTTTCTCTCTTCACCTGGCGGGAGTATCATCTATCCTAGGAGCTATTAACTTTATTACTACCATTATCAACATAAAACCCCCCGCCATATCCCAATATCAAACTCCCCTGTTCGTATGATCTGTACTAATCACAGCAGTACTACTTCTGCTATCCCTACCAGTCCTAGCAGCT---GGCATTACTATATTGCTTACAGACCGGAATCTAAACACAACCTTTTTCGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACATCTATTCTGATTCTTCGGACACCCAGAAGTATATATCCTCATTCTACCAGGATTCGGAATGATCTCACACATCGTCACTTACTATTCAGGAAAAAAA---GAACCTTTTGGCTATATAGGGATGGTTTGAGCAATAATATCCATTGGCTTCCTGGGCTTTATCGTATGAGCACATCACATATTCACCGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Callorhinus ursinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2b

Version
3.1

Year Assessed
2008

Assessor/s
Gelatt, T. & Lowry, L. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
The Eastern stock of Northern Fur Seals is predominantly in the Pribilof Islands. This stock has experienced a significant, steep decline in recent years and has failed to recover despite the cessation of commercial harvesting. Although the global population is still over a million animals, the current downward trend in abundance remains a mystery. The most troubling aspect of the situation is that the Pribilof population’s pup production currently matches that during a time of very strong growth in the early 1900s (1918) yet the numbers continue to drop. Because this portion of the population represents approximately one half of the world-wide population, it seems that the species should be considered in the threatened category of Vulnerable under IUCN Red List Criterion A2 (due to the fact that the causes of the reduction do not appear to have ceased, are not understood, and may not be reversible based on the unknown cause). Thus, the Northern Fur Seal should remain classified as Vulnerable.

IUCN Evaluation of the Northern Fur Seal, Callorhinus ursinus
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Male Northern Fur Seals begin competing for a territory at approximately 7-9 years of age and females begin breeding after the age of four. Generation time is unknown but since females can breed successfully into their early twenties, it is likely in excess of 12-15 years. Northern Fur Seals have shown a significant decline in recent years but the reasons for the reductions are not fully understood, have not ceased despite a ban in commercial hunting and therefore are not clearly reversible.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Although other areas within the range of the species have shown slight increases and the proportion of the population on the Pribilofs has decreased, St. Paul Island remains the largest Northern Fur Seal rookery in the world with over 122,000 pups born in 2004. Accordingly, some rookeries are decreasing in size. The Eastern Pacific stock of Northern Fur Seals (Pribilof Islands and Bogoslof Island) experienced a decline of >50% between the early 1950’s and 2005. However, this decline was at least in part due to a steady harvest of fur seals that ended on St. Paul Island in 1984. However, despite the cessation of the commercial harvest, the population in the Pribilofs has continued to decline and pup production on the largest rookery at St. Paul Island declined by over 22% between 2000 and 2004 and experienced an average annual rate of decline of 6% (SE = 0.7%) between 1998-2004. Although the overall world population has not declined as dramatically as that of the Pribilofs, because the Pribilofs represent almost half of the species population, the species should still be considered to be Vulnerable.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of northern fur seals is suspected in the future based on current trends at the largest rookeries. The likely amount of population reduction has not been projected, but if the current trend continues on the Pribilof Islands for the next 30 years, the population will move from being Vulnerable to being Endangered.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Northern Fur Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Northern Fur Seals is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The current global abundance of Northern Fur Seals (all age classes) is approximately one million.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The current abundance of Northern Fur Seals is approximately one million. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction for Northern Fur Seals.

Listing recommendationThe Eastern stock of Northern Fur Seals is predominantly located in the Pribilof Island; this stock has experienced a significant, steep decline since the 1950’s that stabilized and then began dropping again recently. The reasons for the current downward trend remain a mystery. The most troubling aspect of this decline is that the Pribilof population currently has a pup production level similar to that in 1918, a time of strong growth, yet the numbers continue to drop. Because the Pribilof population represents approximately one half of the world-wide population the species should be considered in the threatened category of Vulnerable, based on A2b due to the fact that the causes of the reduction do not appear to have ceased, are not understood, and may not be reversible.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Harvesting of the seal for its coat almost led to the species extinction in the mid 1700s. At the time of the Alaskan Treaty provisions where put into place in order to maintain population sizes. The treaty stated that only juvenile male seals, found on land, could be killed.

Current threats include loss of breeding habitat on islands.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

  • Hilton-Taylor, C. 2001. "2000 IUCN Redlist of Engangered Species - *Callorhinus ursinus*" (On-line). Accessed December 13, 2001 at http://www.redlist.org/search/details.php?species=3590.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2M - Imperiled

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Occurs in the North Pacific Ocean; declines have occurred in recent decades in the north, but California breeding population has increased; population decline in the Pribilof Islands in the 1980s apparently was due to harvests of females during the 1960s, increased mortality at sea (e.g., due to entanglement in debris such as discarded fishing nets), and perhaps reduced prey availability caused by increased commercial fishing; substantial numbers are killed in the high-seas squid driftnet fishery.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU A1b) on the IUCN Red List 2003 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The current global population was estimated to be approximately 1.1 million in 2004-2005. Abundance is declining. The overall decline is not proportional with the regions where the greatest decreases are occurring - in the Pribilof Islands – in fact, the small populations in the Kuril Islands and on Bogoslof Island in the Aleutians have increased. Approximate individual site population sizes are estimated as follows: Pribilof Islands: 688,028: Commander Islands: 225,000-230,000; Robben Island: 88,000; Kuril Islands: 45,000-50,000; San Miguel Island: 7,784 (Reijnders et al 1993). The Pribilof Islands population declined at 6.2% annually on St. Paul Island and 4.5% annually on St. George Island between 1998 – 2004 (Towell et al. 2006). Pup production on St. Paul again dropped, by 10.5% between 2004 and 2006. Once containing approximately 75% of the world population of northern fur seals, the Pribilofs currently have approximately 50%. Estimated pup production on St. Paul Island in 2004 was at a level equal to that observed in 1918, which was a time when the population was growing at a rate of 8% annually following cessation of the pelagic harvests (Towell et al. 2006), so the current declines are quite perplexing.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Northern Fur Seals have one of the longest and most complex histories of commercial harvesting, which began when the main breeding colonies were discovered in the late 18th century; exploitation continued through until 1984. Numerous international treaties and agreements were put in force over time in efforts to manage this species. There were many periods of decline and recovery over this long period. It is estimated that the population numbered up to 2.5 million animals in the 1950s. They may have been considerably more numerous than this level back when there were many more active rookeries, before the onset of exploitation by Europeans and Americans.

Northern Fur Seals compete for Walleye Pollock with one of the largest commercial fisheries world. Measurable annual mortality, especially for juveniles and subadults, is caused by entanglements in derelict and discarded fishing gear, marine debris and direct interactions with commercial fisheries. This mortality was highest during the period of active high seas drift net fishing in the North Pacific in the 1980s. But, entanglement in debris is an ongoing problem. Long-term ecosystem regime change in the North Pacific and possible changes in the foraging patterns of a key predator (the Killer Whale), may be working synergistically with the fisheries related issues to cause the current population decline.

Like all fur seals, Northern Fur Seals are vulnerable to oil spills because of their dependence on their thick pelage for thermoregulation. The small colonies at San Miguel Island in the California Channel Islands and on the Farallon Island may be at greatest risk due to proximity to major harbours, shipping lanes and offshore oil extraction facilities.

The effect of global climate change on this species is uncertain. However, any further negative disruption of the ecosystem of the northern fur seal should be considered a threat.

Small numbers of Northern Fur Seals are taken annually by Alaska Natives in a subsistence harvest on the Pribilof Islands. For the period 1999-2003, the average annual harvest was 869 animals; all animals taken were juvenile and sub-adult males. Subsistence harvest has declined in recent years to the level of 478 taken in 2007 on both Pribilof Islands (Lestenkoff and Zavadil 2007, Malavansky 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Population decline in the Pribilof Islands in the 1980s apparently was due to harvests of females during the 1960s, increased mortality at sea (e.g., due to entanglement in debris such as discarded fishing nets), and perhaps reduced prey availability caused by increased commercial fishing in the North Pacific and Bering Sea. Substantial numbers are killed in the high-seas squid driftnet fishery between 40 and 50 degrees N latitude (Reeves et al. 1992). Until a new international fur seal treaty is established, this species remains vulnerable to renewed killing at sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The fur that protects the northern fur seal from the cold has led to the animals being hunted for centuries. Although early native peoples made little impact on their numbers, the 'discovery' of the species in the 18th century was followed by commercial hunting that nearly led to the seals' extinction by the end of the 19th century. In 1911 a treaty, the North Pacific Fur Seal Convention was signed by the USA, Japan, Russia and the UK (acting for the Dominion of Canada), limiting hunting to immature males on land and banning all sea hunts (4). Although serious commercial hunting of the northern fur seal has ended, the animals no longer enjoy the protection of the international treaty which lapsed in 1984. Neither is the animal currently protected under CITES (Convention on International Trade in Endangered Species) (5). There is still some hunting permitted under licence in Canadian waters by native peoples only (5), and a similar agreement exists for natives of the Aleutian Islands (4). But the main threats globally are now believed to be caused by entanglement in the nets of the Japanese squid fishing fleets and in the Bering Sea. Seals are also threatened by marine pollution such as plastic twine and waste packaging, as well as discarded trawl nets. The animals are very vulnerable to oil pollution and, with an increase in oil and gas exploration around several of their breeding grounds, there are fears that accidental oil spills and the inevitable industrial disturbance will affect seal populations (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Following the termination of the Interim Convention on the Conservation of the North Pacific Fur Seal in 1984, the Northern Fur Seal is now managed on land independently by the Commonwealth of Independent States and the United States. The eastern north Pacific stock of the Northern Fur Seal was listed as depleted under the U.S. Marine Mammal Protection Act in 1988, and a final conservation plan was completed in December 2007.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The North Pacific Fur Seal Convention lapsed in 1984 after an extension was vetoed by the USA (5), but all commercial hunting has ceased at sea and only limited numbers are now taken under licence. It is believed the world population currently stands at about 1,350,000 animals, but with no current international agreement, some experts fear that commercial hunting could start again at some time in the future. There is also evidence that the El Niño event of 1997-8 affected the pup survival rate of the San Miguel Island breeding colony. A drop in the availability of fish led to 87% of young fur seals dying before they were weaned (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species has often been accused of having a negative impact on fisheries. However, analysis of stomach contents indicate that northern fur seals do not feed on the same species that humans take. Most of the diet of these seals appears to be lanternfish, which are not harvested by people.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern fur seals have been harvested mostly for their fur, but are also used as a food source.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long history of commercial exploitation for pelts, both at sea and at breeding rookeries (see Reeves et al. 1992 for details). Commercial harvest on Pribilof Islands ended in the mid-1980s, but a relatively small subsistence harvest by Aleuts is allowed. Subsistence harvest by Aleut residents on Pribilof Islands in 1993 was 1518 seals on St. Paul Island and 319 seals on St. George Island (Federal Register, 1 November 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern Fur Seal

The Northern fur seal (Callorhinus ursinus) is an eared seal found along the north Pacific Ocean, the Bering Sea and the Sea of Okhotsk. It is the largest member of the fur seal subfamily (Arctocephalinae) and the only species in the genus Callorhinus.

Contents

Physical description

Male and harem

Northern fur seals have extreme sexual dimorphism, with males being 30–40% longer and more than 4.5 times heavier than adult females. The head is foreshortened in both sexes because of the very short down-curved muzzle, and small nose, which extends slightly beyond the mouth in females and moderately in males. The pelage is thick and luxuriant, with a dense underfur that is a creamy color. The underfur is obscured by the longer guard hairs, although it is partially-visible when the animals are wet. Features of both fore and hind flippers are unique and diagnostic of the species. Fur is absent on the top of the fored flippers and there is an abrupt "clean shaven line" across the wrist where the fur ends. The hind flippers are proportionately the longest in any otariid because of extremely long, cartilaginous extensions on all of the toes. There are small claws on digits 2–4, well back from the flap-like end of each digit. The ear pinnae are long and conspicuous, and naked of dark fur at the tips in older animals. The mystacial vibrissae can be very long, and regularly extend beyond the ears. Adults have all white vibrissae, juveniles and subadults have a mixture of white and black vibrissae, including some that have dark bases and white ends, and pups and yearlings have all-black vibrissae. The eyes are proportionately large and conspicuous, especially on females, subadults, and juveniles.

Adult males are stocky in build, and have an enlarged neck that is thick and wide. A mane of coarse longer guard hairs extends from the top of the head to the shoulders and covers the nape, neck, chest, and upper back. While the skull of adult males is large and robust for their overall size, the head appears short because of the combination of a short muzzle, and the back of the head behind the ear pinnae being obscured by the enlarged neck. Adult males have an abrupt forehead formed by the elevation of the crown from development of the sagittal crest, and thicker fur of the mane on the top of the head.

Canine teeth are much longer and have a greater diameter in adult males than those found on adult females, and this relationship holds to a lesser extent at all ages.

A juvenile.

Adult females, subadults and juveniles, are moderate in build. It is difficult to distinguish the sexes until about age 5. The body is modest in size and the neck, chest, and shoulders are sized in proportion with the torso. Adult females and subadults have more complex and variable coloration than adult males. They are dark-silver-gray to charcoal above. The flanks, chest, sides, and underside of the neck, often forming a chevron pattern in this area, are cream to tan with rusty tones. There are variable cream to rust-colored areas on the sides and top of the muzzle, chin, and as a "brush stroke" running backwards under the eye. In contrast, adult males are medium gray to black, or reddish to dark brown all over. The mane can have variable amounts of silver-gray or yellowish tinting on the guard hairs. Pups are blackish at birth, with variable oval areas of buff on the sides, in the axillary area, and on the chin and sides of the muzzle. After 3–4 months, pups molt to the color of adult females and subadults.

Males can be as large as 2.1 m and 270 kg. Females can be up to 1.5 m and 50 kg or more. Newborns weigh 5.4–6 kg, and are 60–65 cm long.

The teeth are haplodont, i.e. sharp, conical and mostly single-rooted, as is common with carnivorous marine mammals adapted to tearing fish flesh. As with most Caniforms, the upper canines are prominent. The dental formula of the adult is:[2]

Dentition
3.1.4.2
2.1.4.1

Range

Overview of rookery

The northern fur seal is found in the north Pacific – its southernmost reach is a line that runs roughly from the southern tip of Japan to the southern tip of the Baja California peninsula, the Sea of Okhotsk and the Bering Sea. There are estimated to be around 1.1 million Northern Fur Seals across the range, of which roughly one half breeds on the Pribilof Islands in the east Bering Sea. Another 200–250,000 breed on the Commander Islands in the west Bering Sea and some 100,000 breed on Tyuleni Island off the coast of Sakhalin in the southwest Sea of Okhotsk and another 60–70,000 in the central Kuril Islands in Russia. Smaller rookeries (around 5,000 animals) are found on Bogoslof Island in the Aleutian Chain and San Miguel Island in the Channel Island group off the coast of California.[3] Recent evidence from stable isotope analysis of Holocene fur seal bone collagen (δ13C and δ15N) indicate that prior to the maritime fur trade, it was more common for these animals to breed at local rookeries in British Columbia, California and likely along much of the northwest coast of North America.[4]

During the winter months, northern fur seals display a net movement southward, with animals from Russian rookeries regularly entering Japanese and Korean waters in the Sea of Japan and Alaskan animals moving along the central and eastern Pacific as far as Baja California.

The northern fur seal's range overlaps almost exactly with that of Steller sea lions, with which they occasionally cohabit reproductive rookeries, notably in the Kurils, the Commander Islands and Tyuleni Island. The only other fur seal found in the northern hemisphere is the Guadalupe Fur Seal which overlaps slightly with the northern fur seal's range in California.

Ecology

Fur seals are opportunistic feeders, primarily feeding on pelagic fish and squid depending on local availability. Identified fish prey include hake, anchovy, herring, sand lance, capelin, pollock, mackerel and smelt. Their feeding behavior is primarily solitary.

Northern fur seals are preyed upon primarily by sharks and orcas. Occasionally, very young animals will be eaten by Steller sea lions. Occasional predation on live pups by arctic foxes has also been observed.

Due to very high densities of pups on reproductive rookeries and the early age at which mothers begin their foraging trips, mortality can be relatively high. Consequently, pup carcasses are important in enriching the diet of many scavengers, in particular gulls and arctic foxes.

Reproductive behavior

Seals aggregate on traditional breeding grounds (rookeries) in May. Generally older males (10 years and older) return first and compete for prime breeding spots on the rookeries. They will remain on the rookery fasting throughout the duration of the breeding season. The females come somewhat later and give birth shortly thereafter. Like all other otariids, northern fur seals are polygynous, with some males breeding with up to 50 females in a single breeding season. Unlike Steller sea lions, with whom they share habitat and some breeding sites, Northern fur seals are possessive of individual females in their harem, often aggressively competing with neighboring males for females. Deaths of females as a consequence of 'tug-of-war's have been recorded, though the males themselves are rarely seriously injured. Young males unable to acquire and maintain a territory of a harem typically aggregate in neighboring "haulouts" occasionally making incursions into the reproductive sections of the rookery in an attempt to displace an older male.

Northern Fur Seal pups

After remaining with their pups for the first eight to ten days of their life, females begin foraging trips lasting up to a week. These trips last for about four months before weaning, which happens abruptly, typically in October. Most of the animals on a rookery enter the water and disperse towards the end of November, typically migrating southward. Breeding site fidelity is generally high for fur seals females, though young males might disperse to other existing rookeries, or occasionally found new haulouts.

Peak mating occurs somewhat later than peak birthing from late June to late July. As with many other otariids, the fertilized egg undergoes delayed implantation: after the blastocyst stage occurs, development halts and implantantion occurs four months after fertilization. In total, gestation lasts for approximately one year, such that the pups born in a given summer are the product of the previous year's breeding cycle.

Status

Recently there has been increased concern about the status of fur seal populations, particularly in the Pribilof Islands, where there has been a roughly 50% decrease in pup-production since the 1970s and a continuing drop in pup production of about 6–7% per year. This has caused them to be listed as "vulnerable" under the U.S. Endangered Species Act and has led to an intensified research program into their behavioral and foraging ecology. Possible causes are increased predation by orcas, competition with fisheries and climate change effects, but there is, to date, no scientific consensus. The IUCN (2008) lists the species as globally threatened under the category "vulnerable".

Fur trade

Northern fur seals have been a staple food of native northeast Asian and Alaskan Inuit peoples for thousands of years. The arrival of Europeans to Kamchatka and Alaska in the 17th and 18th centuries, first from Russia and later from North America, was followed by a highly extractive commercial fur trade. The commercial fur trade was accelerated in 1786, when Gavriil Pribylov discovered St. George Island, a key rookery of the seals. An estimated 2.5 million seals were killed from 1786 to 1867. This trade led to a decline in fur seal numbers. Restrictions were first placed on fur seal harvest on the Pribilof Islands by the Russians in 1834. Shortly after the United States purchased Alaska from Russia in 1867, the U.S. Treasury was authorized to lease sealing privileges on the Pribilofs, which were granted somewhat liberally to the Alaska Commercial Company. From 1870 to 1909, pelagic sealing proceeded to take a significant toll on the fur seal population, such that the Pribilof population, historically numbering on the order of millions of individuals, reached a low of 216,000 animals in 1912.

Significant harvest was more or less arrested with the signing of the North Pacific Fur Seal Convention of 1911 by Great Britain (on behalf of Canada), Japan, Russia and the United States. The Convention of 1911 remained in force until the onset of hostilities among the signatories during World War II, and is also notable as the first international treaty to address the conservation of wildlife.[5] A successive convention was signed in 1957 and amended by a protocol in 1963. "The international convention was put into effect domestically by The Fur Seal Act of 1966 (Public Law 89-702)," said an Interior Department review of the history.[6] Currently, there is a subsistence hunt by the residents of St. Paul Island and an insignificant harvest in Russia.

See also

References

  1. ^ Gelatt, T. & Lowry, L. (2008). Callorhinus ursinus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 30 January 2009. Listed as Vulnerable (VU A2b)
  2. ^ Chiasson, B. (August 1957). "The Dentition of the Alaskan Fur Seal". Journal of Mammalogy (Journal of Mammalogy, Vol. 38, No. 3) 38 (3): pp. 310–319. doi:10.2307/1376230. http://jstor.org/stable/1376230 
  3. ^ Ream, R.; Burkanov, V. (2005). "PICES XIV Annual Meeting" (PDF). http://www.pices.int/publications/presentations/PICES_14/S3/Ream.pdf 
  4. ^ Szpak, Paul; "Orchard, Trevor J., Grocke, Darren R." (2009). "A Late Holocene vertebrate food web from southern Haida Gwaii (Queen Charlotte Islands, British Columbia)". Journal of Archaeological Science 36 (12): 2734–2741. doi:10.1016/j.jas.2009.08.013. http://uwo.academia.edu/PaulSzpak/Papers/156301/A-Late-Holocene-vertebrate-food-web-from-southern-Haida-Gwaii--Queen-Charlotte-Islands--British-Columbia-. 
  5. ^ "North Pacific Fur Seal Treaty of 1911". National Oceanic and Atmospheric Administration. http://celebrating200years.noaa.gov/events/fursealtreaty/welcome.html#treaty. 
  6. ^ Baker, R.C., F. Wilke, C.H. Baltzo, 1970. The northern fur seal, U.S. Dep. Int., Fish Wildlf Serv., Circ. 336, overall quote pp. 2-4, 14-17. Quoted on 4th p. of PDF, in "Fisheries Management: An Historical Overview" by Clinton E. Atkinson; p. 114 of Marine Fisheries Review 50(4) 1988.
  • R. Gentry: Behavior and Ecology of the Northern Fur Seal. Princeton University Press, 1998 ISBN 0-691-03345-5
  • R. Nowak: Walker's Marine Mammals of The World. Johns Hopkins University Press, 1999 ISBN 0-8018-7343-6
  • J. E. King: Seals of the world. Cornell University Press, 1983 ISBN 0-8014-1568-3
  • Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Gardner and Robbins (1998) pointed out that Otoes and Halarctus are the earliest available generic names for northern and southern fur seals, respectively; they have petitioned the ICZN to preserve the generic names Callorhinus and Arctocephalus for these seals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!