Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Biology

Steller's sea lions breed in massive, noisy rookeries common to most members of this family (4). The males arrive at the haul-out sites in spring and establish their territory on the limited space of the beach; they usually do not feed throughout the breeding season, as they cannot afford to relinquish their hard-won position (7) (8). Females arrive in mid-May to late June and give birth to a single pup; only four days later the female is ready to mate again and the most successful males will aggressively guard, and mate with, up to 30 females (9). Despite mating straight after giving birth, the fertilised egg will not be implanted into the female's uterus until October (3). Both males and females reach sexual maturity at around three to six years of age, but males are unlikely to breed successfully until their eighth to tenth year due to the fierce competition at rookeries (3). Around nine days after giving birth the female will resume foraging trips to the sea. Most pups are weaned when about one year old, but a mother may continue to suckle her young for up to two or three years (6). The breeding season draws to an end in early July but these sea lions maintain their social lifestyle, being commonly seen on shore throughout the year in groups of tens to hundreds of animals (4) (7). Steller's sea lions are opportunistic hunters, feeding on a wide range of fish and cephalopods such as squid (6). In Alaska some of the more important prey species are walleye pollock (Theragra chalcogramma), Atka mackerel (Pleurogrammus monopterygius) and Pacific herring (Clupea harengus) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Steller sea lions are divided into two groups for conservation purposes. Those that live around Alaska and Russia are classified as endangered. The others, from southeastern Alaska south to California, are threatened. In Oregon and southeastern Alaska, the number of Steller sea lions has remained stable, but in the Gulf of Alaska, the Aleutian Islands, and southern California, numbers have declined dramatically in the last 20 years. The problem may be disease, reduced food availability, commercial fishing operations, some combination of these three factors, or there may be an as-yet unknown cause. Stellers feed on fish, squid, and octopus. They tend to avoid people, and use rocky islands to breed and rest. Individuals always return to the island where they were born to breed. Rookeries, where calves are born, and haulout sites for resting are usually packed with animals vocalizing noisily throughout the day. During the breeding season the competition among males for territorial space and females is loud, constant, and intense. Fighting is frequent and males may fast for 1-2 months while they try to stay in control of a group of females. The rigors of mating are costly; males tend to live half as long as females, only reaching their mid-teens.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the Steller sea lion  More images, video and sound
  • Original description: "Schreber, J.C.D., 1776.  in Schreber's Die Säugthiere in Abbildungen nach der Natur mit Beschreibungen, Wolfgang Walther, Erlangen, 7 volumes, 1774-1846; text, 3(17):300[1776]; 3(17):pl. 83.B[1776]."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Steller's sea lion is the largest of the eared seals (members of the family Otariidae), a group that includes fur seals and sea lions (3) (4). The impressive adult males are two and a half times the size of the females; they have large necks, and shoulders covered with a mane of long, coarse hair (2) (3). Both sexes are a light brown, whilst pups are originally black, moulting to the adult coat after three to four months (5). The common name of the species comes from the German naturalist who first described these seals in 1741, George Wilhelm Steller (4). Eared seals are able to control their hind flippers independently, allowing them to be particularly agile on land and, unlike the true seals (family Phocidae), they swim using their foreflippers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Steller Sea Lions are found from central California (formerly southern California), north along the west coast of North America to the Aleutian Islands, and west along the Aleutian chain to the Kamchatka Peninsula, and from there south along the Kuril Islands to northern Japan, the Sea of Japan, and possibly to both Koreas. Steller Sea Lions also occur in the Sea of Okhotsk, west of Kamchatka and the Kuril Islands. From the Aleutians they range north across the Bering Sea to the Bering Strait. Vagrants have been recorded in China, and at Herschel Island in the Beaufort Sea (Rice 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Steller's Sea Lion is found on the North Pacific coasts. The countries included are Russia, Japan, Canada, and part of the United States. More specifically it is found from the sea of Japan at 43 degrees N, north to the Pacific rim at 66 degrees N, and then south down to the North American Pacific coast to San Miguel Island at 34 degrees N.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range includes coastal waters of the North Pacific Ocean from California and northern Honshu, Japan, and Korea, north to the Bering Strait (Kenyon and Rice 1961, Calkins and Pitcher 1983, Loughlin et al. 1984, Bigg 1988, Perlov 1991, Sea Lion Recovery Plan Team 1991, NMFS 2008). Breeding rookeries extend from the central Kuril Islands and the Okhotsk Sea in the west to Año Nuevo Island and (formerly) San Miguel Island, California, in the east (Loughlin et al. 1987; NMFS 1993, 2008). Most of the largest rookeries formerly were in the Gulf of Alaska and the Aleutian Islands (Loughlin et al. 1984), but with the decline in the western distinct population segment the largest rookeries are now in Southeast Alaska and British Columbia (NMFS 2008). Breeding colonies occur in Oregon and British Columbia but not in Washington (nonbreeding occurrences only, mainly October to April).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Northern North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (AK, CA, OR, WA), Canada, Russia; North Pacific Ocean

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Steller's sea lions are found from the northern Californian coast, north to Alaska and across the Bering straits to the coasts of Russia and Japan (3). Recently, the species has undergone a worrying decline (especially in Alaska), and the United States population as a whole has declined by 75 percent since the mid to late 1970s (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This species is the largest of five species of seals belonging to the family Otariidae (eared seals). It is characterized by a yellowish buff color, and a coat of short coarse hair that lacks a distinct undercoat. Sea lions have longer flippers than the true or earless seals. They are capable of rotating their hind flippers forward in order to have full use of all four limbs on land.

Steller's Sea Lions show remarkable sexual dimorphism. Males are much larger than females. The length of the average male is 282 centimeters, while the length of the average female is only 228 centimeters. The weight of the average male is 566 kilograms, while the weight of the average female is only 263 kilograms. Males also have extremely thick muscular necks and a mane of coarse long hair.

Newborn pups are about 100 centimeters long, weigh 16-23 kilograms, and have a thick, dark brown pelage that molts to lighter after six months. After 2-3 years their color changes again, this time to the adult color.

Range mass: 263 to 566 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Males are much larger than females.

Length:
Average: 2.8 m males; 2.3 m females
Range: "up to 3.3 m males; up to 2.9 m females "

Weight:
Average: 566 kg males; 263 kg females
Range: up to 1,120 kg males; up to 350 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 300 cm

Weight: 1000000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This species differs from the California sea lion in larger adult size (California sea lion is about 250 cm and 400 kg at most), paler pelage, absence of a protruding crest on the forehead of adult males, and presence of a large diastema between the fourth and fifth upper postcanine teeth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Steller Sea Lions are the largest otariids and the fourth largest pinniped. Both sexes are robust and powerfully built at all ages. They are sexually dimorphic, with adult males weighing three times as much, and growing 20-25% longer than adult females. Pups are born with a thick blackish-brown lanugo that is moulted by about 6 months of age. The maximum length of adult males is about 3.3 m and average weight is 1000 kg. The maximum length for adult females is about 2.5 m and average weight is 273 kg. Pups are born at an average of about 1 m and 18-22 kg.

The age of maturity is 3-6 years for females, and 3-7 years for males (Calkins and Pitcher 1982). Males are not able to defend territories before they are 9 years old (L. Lowry pers. comm.). The annual pregnancy rate of mature females declined during the 1970’s and 1980’s and was estimated to be 55% in the 1980’s based on collections at sea (Pitcher et al. 1998). Recent age-structured modelling based on population counts from the central Gulf of Alaska indicates that the birth rate in 2004 was 36% lower than in the 1970’s (Holmes et al. 2007). Gestation lasts one year, including a delay of implantation of about 3 months. Females may live up to 30 years old and males to about 20 years (Reijnders et al 1993).

Steller Sea Lions are highly polygynous and breed in the late spring and summer. Adult males arrive before females and those that are nine years or older establish themselves on territories, which they aggressively and vociferously defend. Steller sea lions have deep voices and produce powerful low-frequency rolling roars and can be heard for long distances over the noise of wind and waves.

Pups are born from May through July, and females stay continuously ashore with their newborns for the first week to ten days after giving birth. Following this period of attendance, females make foraging excursions, primarily at night for periods of 18-25 hours, followed by time ashore to nurse their pup. Females come into estrous and mate about two weeks after giving birth. Weaning can occur before the next breeding season, but it is not unusual to see females nursing yearlings or older juveniles.

Throughout their range, Steller Sea Lions are primarily found from the coast to the outer continental shelf and slope. However, they frequent and cross deep oceanic waters in some parts of their range. Steller Sea Lions occasionally leave haulouts in very large groups; however, sightings at sea are most often of groups of 1-12 animals. They aggregate in areas of prey abundance, including near fishing vessels, where they will feed on netted fish and by-catch. Steller sea lions are known to haulout on sea ice.

They are not considered migratory; juveniles and subadults make the longest distance trips. Adults usually forage and live near their natal colonies and return to these sites to breed. The area used by adult females for foraging in winter increases dramatically over the area used in the summer and females tend to dive deeper in winter than summer. Diving is generally to depths of 200 m or less and dive duration is usually two minutes or less, with both parameters varying by season and age of the animal Diving ability of pups and juveniles increases with age, and they routinely dive to depths of around 140 m for periods of two minutes as yearlings. The diving of adult males has not been studied.

Steller Sea Lions feed on many varieties of fish and invertebrates. Much of the information on diet comes from animals living in Alaska, where Steller Sea Lions feed on walleye pollock, Pacific Cod, Atka Mackerel, herring, sand lance, several varieties of flatfish, salmon and rockfish, and invertebrates such as squid, octopus, bivalves and gastropods (Sinclair and Zeppelin 2002, Trites et al. 2007). Adult females with young pups feed extensively at night, switching to foraging at any time after the breeding season. Steller sea lions are known to kill and consume young and small northern fur seals at the Pribilof Islands, and also have been reported to kill and consume Harbour and Ringed seals, and possibly Sea Otters.

The primary predators of Steller Sea Lions are Killer Whales. Sleeper Sharks in Alaska have been found with Steller Sea Lion remains in their stomachs, but it is unknown whether the prey was scavenged and in any case they are not believed to be primary predators. Great White Sharks presumably take Steller pups within the areas where their range overlaps.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Colder waters are more preferable than warm waters.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Marine habitats include coastal waters near shore and over the continental slope; sometimes rivers are ascended in pursuit of prey. When not on land, the sea lions may congregate at nearshore traditional rafting sites, or move out to the edge of the continental shelf (Kajimura and Loughlin 1988, Sea Lion Recovery Plan Team 1991). While offshore, the sea lions are most often found within 35 km of shore (Kenyon and Rice 1961, Fiscus and Baines 1966, Fiscus et al. 1976, Bonnell et al. 1983) but may range out to several hundred kilometers offshore. The distance sea lions move offshore varies seasonally, with fewer animals being sighted at sea during the summer (Fiscus et al. 1976, Bonnell et al. 1983). Waters extending 0.9 km from rookeries (and major haulouts) were determined to be essential habitat by the Recovery Team (see NMFS 1993); these waters, plus an air zone extending 0.9 km above a rookery/major haulout and (in Alaska) a land zone extending 0.9 km landward from a rookery/major haulout are included in critical habitat designations.

The most commonly used terrestrial habitat types are rookeries and haulouts. Rookeries are areas where adults congregate for breeding and pupping. These habitats generally occur on beaches of remote islands with difficult access for humans and other mammalian predators (Sea Lion Recovery Plan Team 1991). The beaches can be sand, gravel, cobble, boulder, or bedrock. Female sea lions tend to select locations for pupping that are gently sloping and protected from waves (Sandegren 1970). Females often use the same pupping site in successive years and tend to breed in or near their natal colony (Calkins and Pitcher 1982). Rookery sites may be used as haulout sites during the nonbreeding season. Independent juveniles usually avoid rookeries (Gentry 1970, Sandegren 1970, Calkins and Pitcher 1983, Hoover 1988). From about two weeks after birth, the pups begin to spend increasing amounts of time in the intertidal areas and swimming near shore. Haulouts are areas used by adult sea lions during the nonbreeding season and by nonbreeding adults and subadults throughout the year (Sea Lion Recovery Plan Team 1991). Haulout locations include exposed rocks, reefs, beaches, jetties, breakwaters, navigational aids, floating docks, and sea ice. Selection of both rookery and haulout sites appears to depend on a number of factors including substrate type, degree of exposure to wind and waves, proximity to food resources, tradition of use, season, and the degree of human disturbance (Gentry 1970, Sandegren 1970, Calkins and Pitcher 1983, Hoover 1988, Johnson et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 271 specimens in 1 taxon.
Water temperature and chemistry ranges based on 75 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 5.206 - 16.416
  Nitrate (umol/L): 0.224 - 8.579
  Salinity (PPS): 30.381 - 33.496
  Oxygen (ml/l): 5.650 - 7.417
  Phosphate (umol/l): 0.330 - 1.215
  Silicate (umol/l): 1.436 - 20.291

Graphical representation

Temperature range (°C): 5.206 - 16.416

Nitrate (umol/L): 0.224 - 8.579

Salinity (PPS): 30.381 - 33.496

Oxygen (ml/l): 5.650 - 7.417

Phosphate (umol/l): 0.330 - 1.215

Silicate (umol/l): 1.436 - 20.291
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in the cool waters of the northern Pacific Ocean, hauling out on beaches and rocky coastline (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Steller sea lions are not known to make regular migrations, but they do move considerable distances (reviewd by NMFS 2008). For example, Raum-Suryan et al. (2002) analyzed resightings of 8,596 pups that were branded from 1975-1995 on rookeries in Alaska. Almost all resightings of young-of-the-year were within 500 km of the rookery where the pup was born, although subsequent observations documented movements of 11 month-old pups with their mothers of over 800 km. Juvenile animals were seen at much greater distances from their rookery of birth (up to 1,785 km). Sightings of adults were generally less than 500 km away from the natal rookery although adult males have since been seen over 1,000 km from the rookery where they held a territory (also their natal rookery). [Source: NMFS 2008]

Some individuals may move northward in the Bering Sea in fall and winter (Loughlin et al. 1987). In late summer and fall, individuals from northern breeding colonies migrate southward, while those (especially adult males) from southern breeding areas migrate northward.

Juveniles in the Gulf of Alaska tend to move away from their rookeries in the summer and cross the northern sections of the Gulf. In southeastern Alaska, the movement tends to occur as a shift from inside waters in winter to the outer coastal waters in the summer (Calkins and Pitcher 1982).

Females with dependent young feed relatively close to rookeries and haulouts because they must return at regular intervals to feed their offspring (NMFS 2008). In Alaska, females foraged within 50 km of rookeries in summer but ranged up to several hundred kilometers offshore in winter (Merrick and Loughlin 1997).

Dispersal of individuals from their natal rookeries may play a significant role in the metapopulation dynamics and recovery of this species. For example, new rookeries established recently in Southeast Alaska resulted at least in part from dispersal of individuals from the large Forrester Island rookery and from rookeries in the western distinct population segment (Calkins et al. 1999, Raum-Suryan et al. 2002, Pitcher et al. 2007; unpublished data from Alaska Department of Fish and Game and NMFS, cited by NMFS 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Steller's Sea Lions are known to be true carnivores. They feed on both commercial and non-commercial fish, and also on cephalopods (octopus and squid). Commercially exploited walleye pollack is an important part of their diet. This selective diet is a major cause of the Sea Lions' diminishing population, due to competition with humans for this favorite.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Steller sea lions feed opportunistically on fishes (mainly demersal and off-bottom schooling species) and cephalopods; sometimes also on various other invertebrates (cnidarians, sand dollars, worms, shelled mollusks, crustaceans, etc.) and rarely on birds or small pinnipeds (though males at St. George Island kill and eat large numbers of northern fur seal pups in late summer and fall).

Bulls fast for 1-2 months during during breeding season.

Throughout the year, feeding may occur in the vicinity of rookeries or far (hundreds of kilometers) away, and in shallow or deep water, depending on the sex and age of the individual and the season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Eumetopias jubatus preys on:
Callorhinus ursinus
Phoca largha

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: NMFS (2008) mapped approximately 65 breeding rookeries (sites where greater than 50 pups were born); 13 of these are in the eastern distinct population segment. There are several hundred haul-out sites (NMFS 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: In the late 1970s, total population estimates had remained stable at about 250,000-300,000 since the late 1950s, with breeders distributed among 51 rookeries, 60 percent of which included over 1,000 adults; 38 percent of the recorded population was at nonbreeding haul-out sites during the breeding season (Loughlin et al. 1984). Surveys at rookeries and haulout sites throughout Alaska and Russia in 1989, and estimates from counts conducted at other locations in recent years, provided the following minimum numbers of sea lions: Alaska (53,000); Washington, Oregon, California (4,000); British Columbia (6,000); Russia (3,000) (National Marine Fisheries Service 1990).

Based on 2004-2005 data (NMFS 2008), the total population size of the western distinct population segment (DPS) of Steller sea lions in Alaska was estimated to be approximately 45,000 animals. The 2005 population of Steller sea lions in Russia (part of the western DPS) is estimated to be about 16,000. The eastern DPS was estimated to number between 46,000 and 58,000 animals in 2002 (Pitcher et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Predators include orcas (killer whales) and sharks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Activity occurs throughout the year. Most feeding apparently occurs mainly at night, though diurnal feeding also is likely. Females with small young apparently feed mainly at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: wild:
30.0 years.

Average lifespan

Status: wild:
23.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32.8 years (captivity) Observations: The total gestation time of approximately 1 year includes a 3-4 months period of delayed implantation (Ronald Nowak 2003). In the wild, females have been estimated to live up to 30 years (http://www.demogr.mpg.de/longevityrecords). Males live less due to fights with other males. Record longevity in captivity, however, belongs to one wild born male who was about 32.8 years of age when he died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating generally occurs in May. Males establish a harem of 3-20 females and a territory surrounding them. The pups from the preceding season are born from late May to early June. Shortly after giving birth, the female is impregnated again. Sixty to sixty seven percent of all females are impregnated every year. Implantation of the fertilized egg is delayed for three months giving Steller's Sea Lion a twelve month gestation period. The new pups are fed by their mother for a minimum of three months and sometimes up until the next pup is born. The pups are able to swim after one month, and can catch food after approximately three months. The age of maturity is 3-6 years for females, and 3-7 years for males. On average, females live 30 years. Males, subject to injury in violent encounters with other males, typically live only 18 years.

Average birth mass: 19000 g.

Average gestation period: 274 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2420 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1780 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The life cycle includes several basic stages, minimally including recently born pups, dependent juveniles, independent juveniles and subadults, and adults.

Females give birth to single pups a few days after arriving at the rookery, late May to early July (mainly late June). Females mate with territorial males within 2 weeks of parturition; mating occurs June to mid-July. Implantation is delayed 3-4 months; total gestation period is about 1 year. Female stays with her pup for 3-13 days, then begins a series of 1-2-day feeding trips that extend over a period of several weeks, during which time the pup is left ashore. Young are weaned usually within 1 year in California; lactation usually lasts more than 1 year in Alaska. Females are sexually mature in 3-4 years (or up to 8 years); may breed into their early 20s (Mathisen et al. 1962, Pitcher and Calkins 1981); most adult females breed annually, though a high rate of reproductive failure results in a lower than 100 percent birth rate among adult females (estimated at 55-63 percent by Pitcher and Calkins 1981 and Calkins and Goodwin 1988). Males attain sexual maturity at 3-7 years old (Pitcher and Calkins 1981), but breeding (territorial) males typically are at least 7-8 years old (most often 9-13 years old in Alaska) (Thorsteinson and Lensink 1962, Loughlin et al. 1987, Raum-Suryan et al. 2002). Males may live up to around 20 years and females to around 30 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eumetopias jubatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0578-06|NC_004030|Eumetopias jubatus| AATCGATGATTATTCTCTACAAATCATAAGGATATTGGCACCCTCTATCTACTATTCGGTGCATGAGCCGGAATGGCTGGCACCGCCCTC---AGCCTATTGATCCGCGCAGAATTAGGCCAACCAGGCACTCTACTGGGGGAC---GACCAAATCTACAATGTAATTGTCACCGCCCACGCATTCGTAATAATCTTTTTCATAGTAATGCCTATTATAATTGGAGGCTTTGGAAATTGATTAGTACCCCTAATA---ATTGGAGCTCCCGACATGGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTTCTACTACTACTAGCTTCTTCTCTAGTTGAAGCCGGCGCGGGTACCGGATGAACGGTTTACCCTCCCTTAGCAGGAAATCTAGCCCATGCAGGAGCTTCCGTAGATTTA---ACTATTTTCTCCCTTCACCTGGCAGGAGTATCATCTATTCTAGGAGCCATCAACTTTATTACTACCATTATCAACATGAAACCCCCTGCTATATCTCAATACCAAACTCCCTTATTCGTGTGATCTGTACTAATCACGGCAGTACTGCTTCTACTATCCCTACCAGTACTAGCAGCT---GGCATCACCATACTACTTACGGACCGAAATCTAAATACAACCTTTTTCGATCCGACCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTTTTCGGACACCCAGAAGTATATATTCTCATTCTTCCAGGGTTCGGAATAATCTCACACATCGTCACCTATTACTCAGGAAAAAAG---GAACCCTTTGGCTATATGGGGATAGTCTGAGCAATAATATCTATTGGCTTCTTAGGTTTTATCGTATGAGCACATCATATATTCACCGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eumetopias jubatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Species: 11
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2a

Version
3.1

Year Assessed
2008

Assessor/s
Gelatt, T. & Lowry, L. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
The eastern and western stocks of Steller Sea Lions are showing opposite trends, with slight increases in the east and renewed declines in the west. The causes of the severe decline of the western stock of Steller Sea Lions during the 1970s and 1980s remain unknown, although some causes have been eliminated as likely threats to recovery. The global population of Steller Sea Lions qualifies for Endangered (EN) status because of the overall global decline of 54% in the last three generations. It is particularly concerning that the cause of the declines has not yet been identified.

IUCN Evaluation of the Steller Sea Lions, Eumetopias jubatus
Prepared by the Pinniped Specialist Group

A. Population reduction
Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Generation time in Steller Sea Lions is approximately 10 years. Steller Sea Lions have experienced a dramatic decline over the last three generations (30 years) but the causes are not clearly reversible, nor understood (global decline is, however, not > 50%). The decline has slowed and even stopped in some areas but still persists in others such as the western Aleutians.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Steller Sea Lions experienced a dramatic overall decline between about 1970 and 2000 (three generations). The population has been split into two stocks with the eastern stock showing a 3% increase while the western stock declined at a rate as high as 15% annually in the 1980s and overall declined about 70% between the late 1970s and 1990. The overall reduction in abundance of the species between the mid 1970s and 2007 is estimated to be 54%. The reasons for the precipitous declines of the past two decades and the continued, slowed decline is unknown and may not be reversible. The Steller sea lion therefore meets the criterion for Endangered.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

The overall population of Steller Sea Lions has increased slightly since 2000 due to a continued 3% per year increase in the eastern stock and a slowing of the decline in the western stock. However, if the trend analysis includes data from prior to 2000 the predicted future trend would be negative.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Steller sea lions have experienced a population reduction and this reduction could continue into the future for unknown causes

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
The EOO of Steller Sea Lions is >20,000 km²

B2. Area of occupancy (AOO): CR
The AOO of Steller Sea Lions is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN
(b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.

(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
Both segments of the Steller Sea Lion population exceed 10,000 mature individuals.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)

C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR
or
(a ii)
% individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%

(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
Both segments of the Steller Sea Lion population exceed 1,000 mature individuals.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There have been many population viability analyses conducted on Steller Sea Lions. Results have been consistent and indicate that if only the western segment of the population is considered it has a high probability of declining to a low level. Even the most conservative analyses found that the probability of quasi-extinction of the western segment within 100 years was approximately 10%. However, since the eastern segment is showing an increase, it is likely that for the entire population of Steller Sea Lions, the probability of extinction is

Listing recommendationThe eastern and western stocks of Steller Sea Lions are showing opposite trends, with slight increases in the east and renewed declines in the west. The causes of the severe decline of the western stock of Steller Sea Lions during the 1970s and 1980s remain unknown, although some causes have been eliminated as likely threats to recovery. The global population of Steller Sea Lions qualifies for Endangered (EN) status because of the general, overall level of decline from 1957-2007 of 54% (criterion A2a), and the continued decline, for unknown reasons in the western stock.

History
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

These animals are a threatened species. The Steller sea lion was placed on the Endangered Species list in 1990. The Western Alaskan population was reclassified as Endangered in April 1997. This is due to a number of causes. Thousands were once killed each year in the nets of fishermen in Alaska. Changes in fishing techniques and gear in 1984 reduced the number killed. An unknown number are shot each year during commercial fishing because this species is seen as a pest to the industry. The Steller Sea Lion eats a variety of commercial fish. The intense commercial fishing of pollock, a major food source, has decreased the Alaskan population from 175,000 animals in 1962 to 40,000 in 1992. They are also caught in plastic trash, which usually leads to death. This species is also hunted on a small scale for subsistence and for trade.

The Steller Sea Lion is protected in the United States and the Commonwealth of Independent States (CIS) is proposing to add the species to the "red" species list.

US Federal List: endangered

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Fairly large breeding range around the edge of the North Pacific; abundance declined greatly in the 1970s and 1980s, then declined at a lower rate in the 1990s, especially in the western segment of the range; subsequently the decline greatly decreased or ceased; population fluctuations may be related to competition with fisheries, environmental variability, toxic substances, predation by orcas (killer whales), or other factors, but further study is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2B,N3N : N2B: Imperiled - Breeding, N3N: Vulnerable - Nonbreeding

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 04/10/1990
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: western pop.

Status: Threatened
Date Listed: 04/05/1990
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: eastern pop.


Population detail:

Population location: Entire, except the population segment west of 1440 W. Long
Listing status: T

Population location: Population segment west of 1440 W. Long
Listing status: E

For most current information and documents related to the conservation status and management of Eumetopias jubatus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The worldwide population of Steller Sea Lions declined by 64% during the period from 1960 to 1989, and is currently estimated to be between approximately 105,800-117,800 animals. The decline has been most dramatic in the large populations from the Gulf of Alaska (-54%), west throughout the Aleutian Island chain (-81%), to the moderately-sized Russian population (-74%). The most recent estimates, derived from the last complete surveys of pups (2005) and non pups (2004) in western Alaska (Fritz et al. 2005), Russia (Burkanov and Loughlin 2005), and the population known as the “Eastern Stock” which includes all Steller Sea Lions east of 144° (Pitcher et al. 2007) suggest an overall decline from the mid 1970s in excess of 50%.

Several population viability analyses conducted on Steller Sea Lions (e.g. York et al. 1996, Gerber and Van Blaricom 2001, Winship and Trites 2006, NMFS Steller Sea Lion Final Draft Recovery Plan 2008). Results have been consistent and indicate that the western segment of the population has a high probability of declining to a low level. Even the most conservative of the analyses found that the probability of quasi-extinction of the western segment within 100 years was approximately 10%.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Through the 1990s, the western distinct population segment (DPS) continued to decline. The western population showed an increase of approximately 3% per year between 2000 and 2004. This was the first recorded increase in the population since the 1970s. However, the most recent available data from incomplete non-pup surveys in 2006 and 2007 suggest that the overall trend for the western DPS, through 2007, is either stable or slightly declining. It is not known whether the changing trends in the western DPS are the result of management actions, natural changes in the ecosystem, or other factors. [Source: NMFS 2008]

The eastern DPS remains on an increasing trend (NMFS 2008). At least part of the increase reflects movement of individuals from the western DPS into the eastern DPS. For example, of the two most recently established rookeries in the eastern DPS, about 70 percent of the pups born on Graves Rock were from western DPS females, and about 45 percent of the pups born at White Sisters were from western DPS females (Gelatt et al. 2006, NMFS unpublished data, cited by NMFS 2008). Movement inferred from the genetics data has been confirmed by the sighting of western branded females with pups at Graves Rock and White Sisters (NMFS unpublished data, cited by NMFS 2008).

Global Long Term Trend: Decline of 30-70%

Comments: The western distinct population segment (DPS) of Steller sea lions decreased from an estimated 220,000-265,000 animals in the late 1970s to fewer than 50,000 in 2000. The decline began in the 1970s in the eastern Aleutian Islands (Braham et al. 1980), western Bering Sea/Kamchatka and the Kuril Islands. In Alaska, the decline spread and intensified east and west of the eastern Aleutians in the 1980s and persisted at a slower rate through 2000 (Sease et al. 2001). The 12 percent increase in numbers of nonpups counted in the Alaskan range of the western DPS between 2000 and 2004 was the first region-wide increase observed during more than two decades of systematic surveys. The observed increase, however, has not been spread evenly among all regions of Alaska. Increases were noted in the eastern and western Gulf of Alaska and in the eastern and central Aleutian Islands, while the decline persisted through 2004 in the central Gulf of Alaska and the western Aleutian Islands. [Source: NMFS 2008]

The eastern DPS has increased at approximately 3 percent per year since the late 1970s (Pitcher et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Steller Sea Lions have been important to the subsistence cultures of people living near them for long periods. Native Alaskans currently take about 300 a year for food and other products. The reasons for the large declines in the population, which were especially acute in some portions of the range during the period 1960 to 1989 are unclear, but are the subject of intensive ongoing investigations. Factors hypothesized include: the direct and indirect effects of large-scale commercial fisheries on key Steller sea lion prey species, long-term ecosystem shifts, and changes in behaviour by a primary predator, the killer whale.

Steller Sea Lions are killed in nets in fisheries off Alaska. An unknown number may be shot during commercial fishing operations. Tissue contaminant levels are generally low in most parts of their range. Deliberate killing by fishermen, disease, incidental take by fisheries, and reduced food supply have been suggested as factors which may have contributed to the current decline (Lowry et al. 1989, Reijnders et al. 1993, Loughlin and York 2000). The Steller Sea Lion Recovery Team identified and ranked threats to recovery of the western stock and used a weight of evidence approach to assess the relative impact. The team recognized three threats as “potentially high”: environmental variability, competition with commercial fisheries and killer whale predation. Similarly, Atkinson et al. (2008) recently reviewed the suspected anthropogenic sources of mortality for the same stock of Steller Sea Lions and concluded that competition with fisheries and the potential impacts of contaminants could not be excluded as continuing threats to recovery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Western distinct population segment (DPS): A threats assessment concluded that the following threats are relatively minor: (1) Alaska Native subsistence harvest, (2) illegal shooting, (3) entanglement in marine debris, (4) disease, and (5) disturbance from vessel traffic and scientific research. Considerable uncertainty remains about the following potential threats to the recovery of the western DPS (relative impacts in parenthesis): competition with fisheries (potentially high), environmental variability (potentially high), incidental take by fisheries (low), toxic substances (medium) and predation by killer whales (potentially high). Considerable uncertainty, controversy, and disagreement exist within the scientific and stakeholder communities with regard to the potential threat posed by killer whale predation. [Source: NMFS 2008]

Eastern DPS: No threats to continued recovery were identified by NMFS (2008) for the eastern DPS. Although several factors affecting the western DPS also affect the eastern DPS (e.g., environmental variability, killer whale predation, toxic substances, disturbance, shooting), these threats do not appear to be at a level sufficient to keep this population from continuing to recover, given the long term sustained growth of the population as a whole. However, concerns exist regarding global climate change and the potential for the southern part of the range (i.e., California) to be adversely affected. [Source: NMFS 2008]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The world population of Steller's sea lions has been undergoing a mysterious decline; since 1980, numbers have dropped from over 300,000 individuals to fewer than 100,000 (10). Despite this well-documented and worrying decline, the causes are still being debated; various hypotheses cite pollution, bycatch, parasites and disease, rookery disturbance and predation by killer whales (10). Research into dietary factors have revealed that Steller's sea lions in the northeast Pacific have suffered a decrease in the diversity and energy content of their diet since the mid 1970s, corresponding to changes in fish species available due to natural climatic changes (11). A diet dominated by low energy fish (such as pollock) can cause sea lions to lose condition, and can result in reduced pregnancy rates and increased susceptibility to disease or predation. This may be one of the major causes of the population decline (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Steller Sea Lion is protected in the United States and Canada, and the Commonwealth of Independent States (Russia) is proposing to add it to their “red” species list. In the United States the Steller Sea Lion is listed as Depleted under the U.S. Marine Mammal Protection Act. The species was listed as Threatened in 1990 with the Western Population moved to Endangered in 1997 under the U.S. Endangered Species Act. A draft recovery plan for Steller Sea Lions was prepared in 1992, and a new assessment team was initiated in 2001. A draft and publication are planned for spring 2008. Critical habitat was designated in 1993, including no entry zones near rookeries and management of fisheries activity in the vicinity of rookeries. A groundfish management that strategically disperses fisheries over areas and time was put in force in 2003. Extensive funding has been applied to Steller Sea Lion research to develop information on ecology, behaviour, genetics, population dynamics, and movements to assist in the development of management activities, to attempt to understand the reasons for the decline and to promote recovery of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: NMFS (2008) listed the following recent conservation actions that likely have benefited Steller sea lions: substantial reduction in disturbance of important rookeries and haulouts; substantial reduction in the incidental catch of Steller sea lions in commercial fishing operations, particularly the groundfish trawl fishery; significant efforts to reduce intentional take by prohibiting shooting at or near Steller sea lions; intensive research to better describe the threats to Steller sea lions and provide management with options for recovery actions; potential reduction in the competitive interactions between Steller sea lions and commercial fisheries for pollock, Atka mackerel, and Pacific cod in Alaska; acquired additional information on the status, foraging ecology, and survivorship of Steller sea lions.

Management Research Needs: Research is needed on key threats potentially impeding sea lion recovery (NMFS 2008).

An adaptive management program to evaluate fishery conservation measures should be designed and implemented (NMFS 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: The Steller sea lion is protected in U.S. waters under the Marine Mammal Protection Act of 1972 and the Endangered Species Act of 1973. Specific protection measures include prohibition of shooting near sea lions, establishment of buffer zones to exclude marine vessels near rookeries and haulouts, and set quotas on allowable incidental kills (National Marine Fisheries Service 1990a, 1990b). Traditional subsistence take of Steller sea lions by Alaska natives is not prohibited by either of these Acts. In Canada, the Steller sea lion is protected under the Canadian Federal Fisheries Act of 1970 (Bigg 1988). This protection includes prohibition of disturbance, molestation, or killing of sea lions. Approximately 40 permits have been allotted to aquaculture facilities in southcoastal British Columbia to take sea lions habitually destroying their crops. In Russia, Steller sea lions are proposed for listing in the Red Book of threatened and endangered species (Laughlin, pers. comm., 1992). Also, no-entry buffer protection zones have been placed around the Commander and Kuril islands. There is no official protection for sea lions in Japan and males are harvested on the island of Haikado (Laughlin, pers. comm., 1992). See NMFS (1993) for listings and maps of areas included in designated critical habitat in Alaska, Oregon, and California. NMFS has implemented protective measures to reduce the effects of certain commercial groundfish fisheries near important sea lion rookeries and haulouts (Federal Register, 22 January 1999). NMFS and other agencies are implementing the recovery plan.

Needs: Current fishery conservation measures (or equivalent) should be maintained until substantive evidence demonstrates that these measures can be reduced without limiting recovery. (NMFS 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Steller's sea lion was listed as Threatened on the United States Endangered Species Act in 1990 throughout its range; the western stock in Alaska was listed as Endangered in 1997 (6). The United States National Marine Fisheries Service (NOAA) has established a number of protection measures relating to fishing bans around major rookeries and feeding areas, in an attempt to slow the decline in population numbers (6). A consortium of North Pacific Universities is carrying out ongoing research into the causes of the perplexing population decline (10). The battle to understand the factors involved in the decline in Steller's sea lion numbers may also provide better understanding of the complex marine ecosystem and the effects of fish stock changes (by both natural and man-made causes) on other marine mammals and sea birds (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Eats many commercial fish that humans exploit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Profit from meat, hides, and blubber. Ecotourism benefits greatly from sea lions because humans think that they are "cute".

They are a primary source of food for inhabitants of the Aleutian Islands. Their skins can be used for boat coverings, clothing, and their whiskers for cleaning of Chinese opium pipes. Since the passage of the Marine Mammal Protection Act (1972), the use of these sea lions has declined.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Steller sea lion sometimes is viewed as a nuisance due to presumed economic impact on fisheries.

Historically this species was used for food, clothing, boat coverings, meat for fox farms, and craftwork. Current subsistence take (a couple hundred per year in Alaska in the early 2000s) for food, clothing, and craftwork is subject to federal management (in the United States) and is not regarded as contributing to population declines.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: The recovery plan (NMFS 2008) identified 78 substantive actions needed to achieve recovery of the western DPS by addressing the broad range of threats. These actions address three main objectives: (1) the collection of information on status and vital rates, (2) research programs to collect information on the remaining threats to recovery, including natural and anthropogenic factors, and (3) the implementation of conservation measures to remove impacts of anthropogenic threats to recovery. The recovery plan highlighted four actions believed to be especially important to the recovery program for the western DPS: (1) continue population monitoring and research on the key threats potentially impeding sea lion recovery; (2) maintain current or equivalent level of fishery conservation measures; (3) design and implement an adaptive management program to evaluate fishery conservation; and (4) develop an implementation plan. See NMFS (2008) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Steller sea lion

The Steller sea lion (Eumetopias jubatus) also known as the northern sea lion, is a threatened species of sea lion in the northern Pacific. It is the sole member of the genus Eumetopias and the largest of the eared seals (Otariidae). Among pinnipeds, it is inferior in size only to the walrus and the two elephant seals. The species is named for the naturalist Georg Wilhelm Steller, who first described them in 1741. The Steller sea lion has attracted considerable attention in recent decades due to significant, unexplained declines in their numbers over a large portion of their range in Alaska.

Contents

Physical description

Steller sea lion skull

Adult animals are lighter in color than most sea lions, ranging from pale yellow to tawny and occasionally reddish. Steller sea lion pups are born almost black, weighing around 23 kg (51 lb), and remain dark for several months. Females and males both grow rapidly until the fifth year, after which female growth slows considerably. Adult females measure 2.3–2.9 m (7.5–9.5 ft) in length, with an average of 2.5 m (8.2 ft), and weigh 240–350 kg (530–770 lb), with an average of 263 kg (580 lb).[2][3] Males continue to grow until their secondary sexual traits appear in their fifth to eighth year. Males are slightly longer than the females; they grow to about 2.82–3.25 m (9.3–10.7 ft) long, with an average of 3 m (9.8 ft).[4] Males have much wider chests, necks and general forebody structure and weigh 450–1,120 kg (990–2,500 lb), with an average of 544 kg (1,200 lb).[5][6][7] Males are further distinguished from females by broader, higher foreheads, flatter snouts, and darker, slightly tuftier hair around their large necks, giving them a maned appearance. Indeed, their Latin name translates roughly as: "maned one with the broad forehead".

Ecology

Relative sizes of sleeping Steller sea lion pup, adult female and male on Yamsky Islands in the northeast Sea of Okhotsk

The range of the Steller sea lion extends from the Kuril Islands and the Sea of Okhotsk in Russia to the Gulf of Alaska in the north, and south to Año Nuevo Island off central California. They formerly bred as far south as the Channel Islands, but have not been observed there since the 1980s. Based on genetic anаlyses and local migration patterns, the global Steller sea lion population has traditionally been divided into an eastern and western stock at 144° W longitude, roughly through the middle of the Gulf of Alaska.[8][9] Recent evidence suggests the sea lions in Russia in the Sea of Okhotsk and the Kuril Islands comprise a third Asian stock, while the sea lions on the eastern seaboard of Kamchatka and the Commander Islands belong to the western stock.

Steller sea lions congregate on rocks in the Gulf Islands of British Columbia.

In the summer, Steller sea lions tend to shift their range somewhat southward. Thus, though there are no reproductive rookeries in Japan, there are several consistent haulouts around Hokkaidō in the winter and spring.

Steller sea lions are skilled and opportunistic marine predators feeding on a wide range of fish and cephalopod species. Important diet components include walleye pollock,[10][11] Atka mackerel,[10] halibut,[11] herring, capelin,[12] flatfish[12][13] Pacific cod,[10][11] rockfish,[12][13] sculpins,[12] and cephalopods.[10] They seem to prefer schooling fish and remain primarily in between intertidal zones and continental shelves. They are also known to enter estuarine environments and feed on some semifreshwater fish such as sturgeon. Very occasionally, they have been known to prey on northern fur seals, harbor seals and sea otter pups. They are near the top of the marine food chain, but are susceptible to predation by killer whales and white sharks.

Reproductive behavior and life history

Steller sea lion pup (Kuril Islands, Russia)

Reproductively mature male sea lions aggregate in May on traditional, well-defined reproductive rookeries,[14][15] usually on beaches on isolated islands. The larger, older males establish and defend distinct territories on the rookery.[14][15] A week or so later, adult females arrive, accompanied occasionally by sexually immature offspring, and form fluid aggregations throughout the rookery. Like all other otariids, Steller sea lions are polygynous. However, unlike some other species, they do not coerce individual females into harems but control spatial territories among which females freely move about.[14] Steller sea lions have used three types of territories; aquatic, semiaquatic and terrestrial. Males with semiaquatic territories have the most success in defending them.[15] The boundaries of territories are defined by natural features, such as rocks, faults or ridges in rocks. Territories can remain stable for 60 days.[14]

Pregnant females give birth soon after arriving on a rookery, and copulation generally occurs one to two weeks after giving birth,[14][15] but the fertilized egg does not become implanted in the uterus until the fall. Twins are rare.[16] After a week or so of nursing without leaving the rookery, females begin to take progressively longer and more frequent foraging trips, leaving their pups behind, until at some point in late summer the mother and pup both leave the rookery. Reproductive males fast throughout the reproductive season,[17] often without entering the water once from mid-May until August, at which point the structure of the reproductive rookeries begins to fall apart and most animals leave for the open seas and disperse throughout their range.

Age at weaning is highly variable, pups may remain with their mothers for as long as four years. Incidents of mothers feeding daughters who are simultaneously feeding their own newborn pups have been documented, an extremely rare occurrence among mammals.

Interactions with humans

Steller sea lions haul out on Amak Island

Steller sea lion were hunted for meat and other commodities by prehistoric communities everywhere their range intersected with human communities.[1] Aside from food and clothing, their skin was notably used to cover baidarkas and kayaks. A subsistence harvest on the order of 300 animals or less continues to this day in some native communities in Alaska.[1]

Historically, the sea lion has had only very slight commercial value. For example, in the 19th century, their whiskers sold for a penny apiece for use as tobacco-pipe cleaners.[18] Their penises are considered to be aphrodisiacs in some forms of traditional Chinese medicine.

Steller sea lions are sometimes killed intentionally by fishermen,[1] as they are seen as competitors and a threat to fish stocks.[1] Killing sea lions is strictly prohibited in the U.S, Canada and Russia, but in Japan, a fixed number are still removed annually ostensibly to protect their fisheries.

In recent years, Steller sea lions have been known to enter the Columbia River estuary and feed on white sturgeon, several salmon species and rainbow trout, some of which are also listed under the U.S. Endangered Species Act. They enter the Columbia River primarily in the late winter and spring, occasionally going as far upstream as Bonneville Dam.[19] Though not as abundant as the California sea lion, they are still a concern for those agencies charged with managing the fish populations. Since the Steller sea lions are themselves protected under the Marine Mammal Protection Act,[1] managers are compelled to use nonlethal deterrence methods, such as rubber bullets and noisemakers. Deterrence by the public is strictly forbidden.

Steller sea lion releasing air underwater

Recent decline

While the populations of the eastern and Asian stocks appear stable, the population in the western stock, particularly along the Aleutian Islands, was estimated to have fallen by 70–80% since the 1970s. As a consequence, in 1997 the western stock of Steller sea lions was listed as endangered and the eastern stock was listed as threatened under the Endangered Species Act.[20][21] They have since been the object of intense study and the focus of much political and scientific debate in Alaska.

One suspected cause of their precipitous decline is overfishing of Alaska pollock, herring, and other fish stocks in the Gulf of Alaska. Other hypotheses include increased predation by orcas,[22] indirect effects of prey species composition shifts due to changes in climate, effects of disease or contaminants, shooting by fishermen, and others. The decline is certainly due to a complex of interrelated factors which have yet to be defined by the research effort.[23][24]

References

  1. ^ a b c d e f Gelatt, T. & Lowry, L. (2008). Eumetopias jubatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 30 January 2009. Listed as Endangered (EN A2a)
  2. ^ Steller Sea Lions, Eumetopias jubatus. marinebio.org
  3. ^ Steller Sea Lions. Northwest Regional Office. noaa.gov
  4. ^ Loughlin, Thomas. "Eumetopias jubatus". Mammalian Species 283: 1–7. 
  5. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 
  6. ^ Eumetopias jubatus. Steller sea lion. Animal Diversity
  7. ^ Peter F Olesiuk and Michael A. Bigg Marine mammals in British Columbia. (~1984)
  8. ^ Alaska Marine Mammal Stock Assessments, 2009. (PDF) . Retrieved on 2011-09-16.
  9. ^ Allen, B. M., and R. P. Angliss NOAA-TM-AFSC-206. STELLER SEA LION (Eumetopias jubatus): Eastern U. S. Stock. (PDF) . Revised 11/25/2008. Retrieved on 2011-09-16.
  10. ^ a b c d E. H. Sinclair and T. K. Zeppelin (2002). "Seasonal and Spatial Differences in Diet in the Western Stock of Steller Sea Lions (Eumetopias jubatus)". Journal of Mammalogy 83 (4): 973–990. doi:10.1644/1545-1542(2002)083<0973:SASDID>2.0.CO;2. JSTOR 1383503. 
  11. ^ a b c Keyes, M. C. 1968. The nutrition of pinnipeds. Pages 359–395 in R. J. Harrison, R. C. Hubbard, R. S. Peterson, C. E. Rice, and R. J. Schusterman (eds) The behavior and physiology of pinnipeds. Appleton, Century-Crofts, New York.
  12. ^ a b c d Ole A. Mathisen, Robert T. Baade and Ronald J. Lopp (1962). "Breeding Habits, Growth and Stomach Contents of the Steller Sea Lion in Alaska". Journal of Mammalogy 43 (4): 469–477. doi:10.2307/1376909. JSTOR 1376909. 
  13. ^ a b Clifford H. Fiscus and Gary A. Baines (1966). "Food and Feeding Behavior of Steller and California Sea Lions". Journal of Mammalogy 47 (2): 195–200. doi:10.2307/1378115. JSTOR 1378115. 
  14. ^ a b c d e Gentry, R. L. (1970). "Social Behavior of the Steller’s Sea Lion". Ph. D. Thesis, University of California, Santa Cruz, CA.
  15. ^ a b c d Sandergen, F. E. (1970). 'Breeding and Maternal Behavior of the Steller’s Sea Lion (Eumetopias jubatus) in Alaska', M. S. Thesis, University of Alaska, College.
  16. ^ Alaska Department of Fish and Game, "Life History". Adfg.alaska.gov. Retrieved on 2011-12-17.
  17. ^ Riedman, M. (1990). The Pinnipeds: Seals, Sea lions, and Walruses. Los Angeles, University of California Press. p. 200 ISBN 0-520-06497-6.
  18. ^ Terry L. Haynes and Craig Mishler The subsistence harvest and use of Steller sea lions in Alaska. Technical paper no. 198. Alaska Dept. of Fish and Game, Division of Subsistence. Juneau, Alaska 1991
  19. ^ Seal & Sea Lion Facts of the Columbia River & Adjacent Nearshore Marine Areas, NOAA, March 2008, http://www.nwr.noaa.gov/marine-mammals/seals-and-sea-lions/upload/cr-pinniped-fs.pdf 
  20. ^ US National Marine Fisheries Service Steller Sea Lion web page. Nmfs.noaa.gov. Retrieved on 2011-09-16.
  21. ^ Species Profile. Ecos.fws.gov. Retrieved on 2011-09-16.
  22. ^ Markus Horning and Jo-Ann Mellish (2012). "Predation on an Upper Trophic Marine Predator, the Steller Sea Lion: Evaluating High Juvenile Mortality in a Density Dependent Conceptual Framework". PLoS ONE 7 (1). doi:10.1371/journal.pone.0030173. PMID 22272296. 
  23. ^ Clover, Charles. 2004. The End of the Line: How overfishing is changing the world and what we eat. Ebury Press, London. ISBN 0-09-189780-7
  24. ^ Dalton, Rex (2005). "Is this any way to save a species?". Nature 436 (7047): 14–6. doi:10.1038/436014a. PMID 16001032. 

Further reading

  • Heptner, V. G.; Nasimovich, A. A; Bannikov, Andrei Grigorevich; Hoffmann, Robert S, Mammals of the Soviet Union, Volume II, part 3. Washington, D.C. : Smithsonian Institution Libraries and National Science Foundation
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: No controversy exists regarding the taxonomic status of this species. Research has focused on identifying patterns of genetic variation within the species. Some of this research is summarized here.

MtDNA data of Bickham et al. (1996) indicated the existence of two genetically differentiated populations of E. jubatus, one in the Commander Islands in Russia and the Aleutian Islands and Gulf of Alaska in Alaska, the other including samples from southeastern Alaska and Oregon; the populations do not trace their ancestries back to a single maternal ancestor in either case; they likely diverged as a result of separation in different glacial refugia. The authors stated that the two populations "likely should be managed separately."

Trujillo et al. (2004) studied genetic variation at 6 nuclear microsatellite loci with biparental inheritance and the maternally inherited mitochondrial DNA (mtDNA) at 3 geographic scales (rookeries, regions, and stocks). Population structure was not well defined, and there was no obvious phylogeographic pattern to the distribution of microsatellite alleles. This contrasts with the clear phylogeographic pattern revealed by control-region sequences of mtDNA in which 2 well-differentiated stocks, eastern and western, were defined as well as 2 distinct groups, Asian and central, in the western stock. Trujillo et al. (2004) stated that the difference in patterns between the biparentally and maternally inherited genetic markers can be explained by relatively high male dispersal rates and female philopatry, or else there has been insufficient time since populations have been isolated for the nuclear loci to have diverged. Trujillo et al. (2004) recommended that the presently accepted stock structure be retained for management purposes and that further studies be carried out to test the male dispersal hypothesis.

Harlin-Cognato et al. (2006) examined Steller sea lion phylogeography using range-wide mtDNA data and found that the pattern of diversification of female lineages appears to correlate with the glacial advances and retreats during the Pleistocene, from approximately 60,000 to 180,000 years ago. Four populations, ostensibly derived from distinct glacial refugia, were recognized, including continental North America, Gulf of Alaska and mainland Alaska, Aleutian Islands, and Eurasia.

Recent research indicates that the geographic boundary between the western and eastern populations may be changing or possibly disappearing (Pitcher et al. 2007; NMFS unpublished data, cited by NMFS 2008).

The English name for sea lions has been inconsistently rendered as sea lion, sealion, and sea-lion (Rice 1998; Wozencraft, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!