Overview

Distribution

Range Description

Australian Sea Lions are found in southern and southwestern Australia from just east of Kangaroo Island west to Houtman Albrolhos in Western Australia. Vagrants have come ashore in Eastern Australia, as far north as the middle of New South Wales. Australian Sea Lions breed on at least 73 islands and at several mainland sites (McKenzie et al. 2005). Five sites account for approximately 60% of the annual pup production.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Australian sea lions are found on islands offshore of Australia. They range from western Australia to islands in southern Australia. The largest populations are found on Kangaroo Island and Dangerous Reef (near Port Lincoln) in southern Australia. The smallest numbers are found on the west coast of southern Australia and in Western Australia. Some live in Tasmania as well, but these are few in number. They once bred in the Bass Strait, but the entire population was wiped out by the sealing industry.

Biogeographic Regions: australian (Native ); indian ocean (Native ); pacific ocean (Native )

  • Tasmania Parks and Wildlife Service, 2000. "Wildlife of Tasmania: Australian Sea Lion, *Neophoca cinerea*" (On-line). Accessed October 29, 2001 at http://www.dpiwe.tas.gov.au/inter.nsf/WebPages/BHAN-53K49N?open.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

South Australia (state), South West Australia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

At birth, pups are roughly 60 to 70 cm and weigh approximately 6.5 to 8 kg. Their pelage is initially chocolate brown, but is replaced by adult-like fawn colred fur by the age of two months. Australian sea lions are sexually dimorphism, with a significant difference in the size of females and of males. As an adult, males grow to about 2.5 m and weigh 300 kg. Females grow to a length of about 1.8 m and weigh approximately 105 kg. Females reach sexual maturity at around 3 years of age, whereas males usually do not mature until they are 6 years of age or older. Males darken even further as they mature, and go through a transition phase where they have spots on their chests.

Australian sea lions have a large head with a long, narrow, and tapered muzzle. The skull has a sagittal crest approximately 30 mm in height. Males display a much larger head than females and juveniles, as well as significantly broader shoulders. Their pinnae, or ears, are incredibly small and lie close to the head. Juveniles are a dark brown with a pale crown and a dark facial mask. Subadult males and females display a coat that is fawn to silvery-gray on top and tan to pale yellow on the bottom. Mature males are dark brown with a cream-colored crown and nape, and a paler chest and throat area.

Range mass: 105 to 300 kg.

Range length: 1.8 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Ridgway, S. 1972. Mammals of the Sea: Biology and Medicine. IL: Charles C. Thomas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Australian Sea Lions are sexually dimorphic, with adult males reaching 1.25 times the length and 2.5-3.5 times the weight of adult females. Very little information on sizes of adult males is available, and some values in the literature may be overestimates. Adult males reach lengths of at least 2.5 m and weights of 200 to at least 300 kg. Females are 1.3 to just over 1.8 m and weigh from 61-105 kg. At birth, pups are approximately 60-70 cm long and weigh 6.4-7.9 kg. Pups are dark chocolate brown to charcoal in colour at birth and lighten to a smoky gray. The crown is paler than the rest of the body and there is a dark mask across the face. The postnatal moult starts when pups are 8-10 weeks old and is completed in several weeks; pups in their juvenile pelage resemble adult females.

Females become sexually mature at 4.5-6 years of age and males at 6 years or more. The mean age of breeding females is 11 years (McIntosh 2007). The oldest breeding female recorded was aged 24 years, while the maximum longevity recorded is 26 years for females and 21.5 years for males (McIntosh 2007). Age-specific survival probabilities are high (0.98) after six years of age and are similar for males and females (McIntosh 2007).

Australian Sea Lions are unusual among pinnipeds in having a supra-annual pupping interval (Gales et al. 1994, Gales and Costa 1997), with females producing pups every 17-18 months (mean breeding interval is 17.5 months, range 16.0-19.9). Females mated about 7-10 following the birth of a pups. Like most other pinnipeds, there is a 4-6 month period of delayed implantation of the blastocyst following conception. This leads to a prolonged (active) placental gestation of up to 14 months, the longest for any pinniped (Gales and Costa 1997). The annual pregnancy rate of mature females is ~71 % (Higgins and Gas 1993). Pups can be born at any time of the year, with females at a given site being loosely synchronous with each other and pupping generally occurring over a 5-7 month period at a given locale (Higgins 1993). Even neighbouring sites can be on entirely different breeding schedules. Males are sequentially polygynous, establishing territories around individual females, herding them in an effort to keep them from departing until the onset of estrous. This pattern is repeated until the male is compelled to go to sea and forage, after which he returns and repeats the strategy. Males defend their territories with guttural clicking, growling and barking vocalizations, posturing, and by fighting with rivals. Pups can be trampled when males are fighting or moving rapidly to confront rivals and control females, and killed outright in aggressive acts.

Pups are continuously attended for the first 9-10 days after birth. Over the next 5 months females make foraging trips that average 48.5 hours in length, followed by pup attendance periods that average 33 hours. Females suckle their pups for 15-18 months, usually weaning them a month before giving birth again. Some females care for their offspring for up to three years, and can be seen with a juvenile and a new pup. Adult female Australian Sea Lions behave aggressively toward pups that are not their own. Pups will play at the shoreline and in tide pools while their mothers are away, and following their postnatal moult, will actively swim on their own.

Adult female Australian Sea Lions are benthic, diurnal foragers (Costa and Gales 2003). They routinely transit to foraging locations by swimming along the bottom. Mean depth of dives from a series of lactating females tagged with time depth recorders ranged from 41.5-83.1 m; maximum depth of dives ranged from 60-105 m. Mean duration of dives ranged from 2.2-4.1 minutes, and the longest dive recorded lasted 8.3 minutes. Australian sea lions are fast, powerful swimmers and often ?porpoise? out of the water when moving rapidly at the surface.

These sea lions are considered non-migratory and probably spend most of their lives near their natal colony. The greatest distance travelled by a tagged animal is approximately 250 km. Genetic distinctiveness has been reported between nearby colonies, indicating a high degree of site fidelity and female philopatry (Campbell et al. 2008). At sea, Australian Sea Lions spend nearly all of their time in waters over the continental shelf.

Australian Sea Lions are thought to concentrate their efforts on shallow-water benthic prey, but also take a wide variety of fishes, such as rays, small sharks, Australian salmon, and whiting. Other prey includes squid, cuttlefish, small crabs, and occasionally (perhaps rarely) penguins, flying seabirds and small sea turtles. Fishermen complain of sea lions robbing lobster traps and fishing nets. Large prey items may be taken to the surface and shaken into portions that can be swallowed.

Predators include Great White Sharks (Shaughnessy et al. 2007) and presumably Killer Whales (Ling 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Australian sea lions are non-migratory , so they live and breed on sandy beaches near their birth site in relatively large colonies. The greatest distance recorded for a tagged animal has been 300km from its birth site (Jefferson, 1993). During times of tumultuous weather, they will often travel inland to seek shelter in dunes and coastal vegetation (Riedman 1990). Unlike many pinnipeds, Australian sea lions are very capable out of the water, and have been found as far as 9.4 km inland (Nowak, 1999). Many have been found at the tops of cliffs as high as 30 meters, as they are also excellent climbers.

In the water, Neophoca cinerea has been seen at depths up to 40 meters (Nowak, 1999).

Range elevation: 30 (high) m.

Range depth: 40 (high) m.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Terrestrial Biomes: desert or dune

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Australian sea lions feed on a small number of fishes (which include whiting, rays, and small sharks), squid, cuttlefish, and fairy penguins (Eudyptula minor). The main diet of N. cinerea consists of blue-throated wrasse (Notolabrus tetricus) and octopus (Achtel, P., personal communication). They concentrate on shallow-water benthic prey, and usually dive for food at depths no greater than 37 meters (Riedman, 1990).

Animal Foods: birds; fish; mollusks

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

This species is probably a component of control on fish and penguin populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

One of the predators of the Australian sea lion is the great white shark (Carcharodon carcharias), especially near the Dangerous Reef region of the Port Lincoln area (Riedman, 1990). Fishermen also occasionally kill them accidentally by entangling them in their nets (World Conservation Monitoring Centre, 2000). Historically, the population was greatly reduced due to sealing (Jefferson, 1993).

Known Predators:

  • World Conservation Monitoring Centre, 2000. "Species Under Threat: Australian Sea Lion" (On-line). Accessed October 29,2001 at http://www.wcmc.org.uk/species/data/species_sheets/austlio.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Neophoca cinerea is prey of:
Carcharodon carcharias
Homo sapiens

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Neophoca cinerea preys on:
Actinopterygii
Mollusca
Aves

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

See Reproduction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Information on longevity in this species is not available.

Range lifespan

Status: captivity:
24.1 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24.1 years (captivity) Observations: Could feature delayed implantantion, which then increases the gestation period. In the wild they live more than 12 years (Ling 1992). One wild born animal was about 24.1 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system of this sea lion is polygynous. A male secures a breeding territory on the beach and actively defends it against other males though ritualized posturing and aggressive confrontation. The male leaves his territory to feed in the ocean for a few hours at a time. Upon his return, he may have to battle to regain his territory.

Males keep several females on their territories. If the female strays, the male will aggressively herd her back, sometimes entering another male's territory to do so. (Nowak, 1999)

Males have been seen killing pups, although presumably not their own. Defense of territories may be an indirect mechanism of paternal care for young.

There is some evidence of cooperative breeding (See Behavior) in which females care for pups other than their own.

Mating System: polygynous ; cooperative breeder

Australian sea lions have a breeding cycle of approximately 17.6 months. These non-annual cycles are affected by some unknown factor, not by environmental influence as previously thought (Higgins, 1993). Some females do not produce young in consecutive breeding seasons (Nowak, 1999). Births can occur over a period of 4-6 months in any colony of N. cinerea, making births highly unsynchronized.

When the breeding cycle begins, males copulate with harems of four or five females at a time (Ridgway, 1972). Males also have the ability to herd the females into mating groups, a feature rare in other species of sea lion (Riedman, 1990).

Females enter estrous about 6 days after giving birth, and are mated by the male at this time. There is some debate in the literature about the ensuing gestation period. Pinnipeds typically experience a delay in implantation of about three months, followed by an eight or nine month placentation. Because N. cinerea experiences a much longer interbirth interval, it is clear that this species differs from the typical pinniped pattern. Some investigators think that Australian sea lions experience a longer than average dely in implantation of the blastocyst, amounting to 10-11 months, and a normal length pregnancy (8-9 months). Others think there is a more typical pinniped length delay in implantation (5-6 months) and a longer than average placentation (over 12 months). (Nowak, 1999)

Young are typically weaned just before the birth of subsequent offspring, at 15-18 months. However, females have been seen nursing pups of different ages at the same time.

Breeding season: Because the breeding interval is oddly spaced, the breeding season steadily shifts throughout the calendar year.

Average number of offspring: 1.

Range gestation period: 512 to 576 days.

Range weaning age: 15 to 18 months.

Range age at sexual or reproductive maturity (female): 3 to 6 years.

Range age at sexual or reproductive maturity (male): 3 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 7075 g.

Average number of offspring: 1.

Female N. cinerea come to shore about two days before they give birth in order to establish a natal site. After giving birth to a pup, the female will stay at the natal site for approximately 10 days before returning to the sea to forage. She will return to land every couple of days to nurse her young, staying with the pup for about 33 hours at a time. A mother uses both vocal and scent communication to locate and identify her pup.

As pups grow up, they often form small groups and swim in shallow rock pools before they venture into the ocean with their mothers.

Females care for their own young, nursing them until about 26 days before giving birth to their next pup. Some mothers have been seen nursing both a yearling and a newborn pup. There are reports of females being aggressive to pups other than their own, but there are also some reports of females taking care of groups of pups. This makes it difficult to determine how much cooperative care of young there might actually be, although it is clear that some cooperative care occurs. Altricial at birth, pups are able to follow their mothers both on land and into the sea at approximately 3 months of age.

No specific male parental care has been reported for N. cinerea, but by maintaining territories, fathers may protect their offspring from other males of the species.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Ridgway, S. 1972. Mammals of the Sea: Biology and Medicine. IL: Charles C. Thomas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neophoca cinerea

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0687-06|NC_008419|Neophoca cinerea| AATCGATGATTATTCTCTACAAACCATAAAGATATTGGCACCCTCTATCTACTATTCGGTGCATGAGCCGGAATAGCTGGCACCGCCCTC---AGCCTATTGATCCGCGCGGAGTTAGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATCTACAACGTAATTGTCACTGCCCACGCATTCGTAATAATCTTCTTCATGGTAATACCTATTATAATTGGAGGCTTCGGAAATTGATTGGTGCCCCTGATA---ATTGGAGCTCCCGACATGGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTCCTACTACTACTAGCCTCTTCCCTAGTTGAAGCCGGCGCAGGTACCGGATGAACGGTTTACCCTCCCCTAGCAGGGAACCTAGCCCACGCAGGGGCTTCCGTAGACTTG---ACTATTTTCTCCCTTCACCTGGCTGGAGTGTCATCTATTCTAGGAGCCATTAACTTTATTACCACTATTATCAACATGAAACCCCCTGCTATGTCCCAATACCAAACCCCCCTATTCGTGTGATCCGTACTAATCACAGCGGTACTACTTCTGCTGTCCCTACCAGTCCTAGCAGCT---GGTATCACTATATTACTTACGGACCGAAATCTAAATACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACATCCAGAAGTATATATTCTTATTTTGCCAGGATTCGGTATAATCTCACATATCGTCACCTATTACTCAGGAAAAAAA---GAACCCTTCGGCTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCCTAGGCTTTATCGTATGAGCACATCACATATTCACCGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Neophoca cinerea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd+3d

Version
3.1

Year Assessed
2008

Assessor/s
Goldsworthy, S. & Gales, N. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
The Australian Sea Lion has a small, genetically fragmented population. The global population is relatively small, population decline is documented at some colonies and most major colonies are at risk of extinction from fishery by-catch. This species should be classified as Endangered (EN).

IUCN Evaluation of the Australian Sea Lion, Neophoca cinerea
Prepared by the Pinniped Specialist Group

A. Population reduction
Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Australian Sea Lions have a non-annual and asynchronous breeding system. The mean interval between successive breeding seasons is 17.5 months (range16.0-19.9). Subpopulations across the range of the species breed at different times. Populations as near as 20 km can be up to 6 months out of phase in the timing of breeding. There are 73 known breeding sites. 61 of these produce >5 pups, with a total breeding cycle pup production estimated at 3,455 (mean pup production 57, median 27). 80% of the population is located in South Australia, 20% in Western Australia. Based on an age-structured model, the number of mature animals in the population is ~6,600 (Females >4.5 years; males >6 years). Genetic population substructure in the species is extreme, with most colonies (subpopulations) having unique mtDNA lineages, demonstrating extreme philopatry and meeting the IUCN definition of a severely fragmented population.

Some age-structure data are available for one Australian Sea Lion population (Seal Bay, Kangaroo Island). The generation time has been estimated to be 12.4-12.8 years. Hence 3 generations is equivalent to ~38 years.

Robust data on trends in abundance (based on pup abundance per breeding season) are available for only the three largest subpopulations:

- Seal Bay (Kangaroo Island)- pup abundance estimates have declined by 12.6% over 13 breeding season (17.7 years), a decline of -0.77%/year (-1.14%/breeding season), and population modeling projects the subpopulation to decline ?50% within 3 generations 38 years.
- The Pages Islands - trends in pup abundance for 13 breeding seasons show no significant change (i.e. stable).
- Dangerous Reef- trends in pup abundance over 8 breeding seasons from 1994/95 to 2006/07 indicate an increase of 6.9%/breeding season (4.6%/year). Most of this increase has taken place since 2000.

The main threat to the Australian Sea Lion is bycatch in demersal gillnet and trap fisheries. The recovery of the Dangerous Reef population coincides with closures in the gillnet fishery in Spencer Gulf in 2000. Fishery closures also provide protection for most of the foraging space of The Pages Islands subpopulation (stable). There are no substantive gillnet fishery closures that provide protection for the foraging space of the Seal Bay subpopulation which is declining.

No accurate trend data are available for the majority of subpopulations with low pup production (>70% of populations produce <50 pups).

Historical reductions in range and population size from sealing (1800-1830) and subsequent take are inferred. Recent reductions (last 30-40 years) have been inferred or suspected from the high proportion of small and potentially declining subpopulations based on actual and potential levels of bycatch in gillnet and trap fisheries. The causes of reduction and threat are reversible and understood (but have not ceased); thus, this criterion is not applicable.


A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on any of (a) to (e) under A1.

Declines have been detected at Seal Bay (12.6% decline over 13 breeding seasons, equivalent to a 25% decline over 3 generations). A population model suggests that this population will continue to decline at a level that will be ?50% within 3 generations.

The high proportion of small subpopulations in the species (50% produce ?27 pups per breeding season) is thought to be a consequence of systemic declines that have resulted from sustained fisheries by-catch over the last 40 years. However, trend data for these small populations are of poor quality or are totally lacking.

The major causes for reduction based on observed and potential levels of by-catch in gillnet and trap fisheries are known and have not ceased. As the rate of decline has only been estimated for one subpopulation and ranges from 25 to ?50% reduction over 3 generations, and declines are inferred in other (depleted) subpopulations, the Australian Sea Lion meets criterion A2b and A2d for Vulnerable (VU).


A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population model suggests that the Seal Bay subpopulation will decline ?50% within 3 generations 38 years (indicating E). A population viability analysis indicates that many South Australian subpopulations (~30%) are vulnerable to extinction in the absence of additional by-catch mortality. With low levels of fishery by-catch mortality (egg. 1-2 additional female mortalities/year/subpopulation), 80% of subpopulations are projected to be declining, and 42% may be quasi-extinct (?10 females) within 25 years (<3 generations). Current estimated by-catch levels are likely to be within these ranges.

At a subpopulation level, under criterion A3d, 38% of South Australian subpopulations are assessed as either VU or EN, and at least 42% are assessed as Critically Endangered (CR) based on criterion A3 (d) CR if current by-catch levels remain.


A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population decline has been detected in the recent past at Seal Bay (12.6% decline over 13 breeding seasons, equivalent to a 25% decline over 3 generations) and is projected to continue (?50% decline within 3 generations). The only subpopulation known to be increasing has only done so since gillnet fisheries were closed within its foraging grounds in 2000. The high proportion of small subpopulations in the species is suspected to result from systemic declines that have resulted from fisheries bycatch. Current rates of by-catch are high and have not ceased, and population modeling of South Australian populations suggests that even low levels of by-catch will lead to quasi-extinctions of some subpopulations (42% quasi-extinct within 3 generations) and continuing declines in others (38%). Hence, subpopulations range from VU to CR under A3 and A4d, though it is not possible to make an accurate global assessment for the species with available data.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
EOO for Australian Sea Lions is > 20,000 km²

B2. Area of occupancy (AOO): CR
AOO for Australian Sea Lions is > 2,000 km²

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

None of the criteria (a), (b) or (c) is satisfied.

C. Small population size and decline
Number of mature individuals: CR
Based on an age-structured model and estimates of pup production for the species, the number of mature individuals is estimated to be ~6,600 (Females >4.5 years; males >6 years). This meets criterion C for Vulnerable (VU).

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)

For the Seal Bay subpopulation a continuing decline is projected for the future (?50% decline within 3 generations) satisfying V. For subpopulations vulnerable to fisheries by-catch, with by-catch of ?1-2 females per year, declines are expected that would satisfy the EN or VU criteria for many subpopulations, and CR to quasi-extinct for some others.

C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR
For the 61 subpopulations that produce ?5 pups per breeding season, based on the number of mature individuals, most (48%) are categorized as CR , 39% as EN and 13% VU. The median number of mature individuals in each subpopulation is 52. If the breeding sites that producer <5 pups per breeding season are included, the median number of mature individuals per subpopulation would be <50, which satisfies a classification of CR.

or
(a ii)
% individuals in one subpopulation: CR = 90?100%; EN = 95?100%; VU = 100%

The largest subpopulation contains ~20% of individuals of the species.

(b) Extreme fluctuations in the number of mature individuals.

Based on C, C1 and C2(ai), the species is categorized as VU, although under some criteria, EN and CR could be justified.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The number of mature individuals in the Australian Sea Lion population is estimated to be ~6,600. This does not meet any of the above criteria.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

A population viability analysis has been undertaken for South Australian subpopulations (assuming a stable population structure, r = 0). PVAs were undertaken on individual subpopulation because of the extreme philopatry in the species. These determined that with no additional bycatch mortality, ~30% of subpopulations are presently categorized as EN or CR, based on criterion E. With low levels of fishery by-catch mortality (e.g., 1-2 additional female mortalities/year/subpopulation), 80% of subpopulations are categorized as either EN or CR, with 42% quasi-extinct (?10 females) within 25 years. Current estimated bycatch levels are likely to be within these ranges. Based on these quantitative analyses, at least 42% of South Australian populations would meet the criterion for Critically Endangered (CR), and 38% meet the criterion of either Endangered (EN) or Critically Endangered (CR).

Listing recommendation ? The Australian Sea Lion population is thought to be significantly reduced in size from historical levels. It is a non-annual, asynchronous breeder that exhibits extreme site fidelity to its multiple, small colonies within its fragmented population. Based on: levels of fishing effort over the last 40 years; current estimates of fishery by-catch rates of sea lions; the high proportion of small, depleted subpopulations; quantitative analyses, which suggest that until fishery by-catch is manage, subpopulations will continue to decline or disappear; and projected declines in abundance in excess of 50% for major colonies - the Australian Sea Lion should be classified as Endangered (EN).

History
  • 1996
    Lower Risk/least concern
  • 1994
    Rare
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Australian sea lions are fully protected within Australia. They were listed as “rare” in the 1994 IUCN Red List of Threatened Animals. They have been recently removed from this list, and the population has remained stable at around 10,000 animals (World Conservation Monitoring Centre, 2000). Harvesting of this species is not allowed, and a permit is required for research or capture for zoos (Toorn, 1999).

CITES: no special status

IUCN Red List of Threatened Species: endangered

  • Toorn, J. 1999. "Australian Sea Lion" (On-line). Accessed October 29, 2001 at http://ourworld.Compuserve.com/homepages/jaap/slions.htm#australian.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population of Australian Sea Lions is estimated to be 13,790 individuals based on an estimated total pup production of 3,380 (2,674 in South Australia and 706 in Western Australia) and a multiplication factor of 4.08 pups per breeding cycle (Goldsworthy et al. 2003, Goldsworthy and Page 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Australian aborigines have taken Australian Sea Lions for subsistence purposes for thousands of years. Early European colonists also took sea lions for food and other products, although numbers recorded in sealing logbooks were small (Ling 1999). Harvests by sealers in the 17th and 18th centuries reduced the population and extirpated them from areas around the Bass Strait and Tasmania.

Although now protected, the population has not rebounded fully in numbers or reoccupied all of its former range. Conflicts and interactions with fisheries exist. A high level of entanglement in abandoned and lost fishing gear and in marine debris has been reported, with a range of 0.2 to 1.3% of the population are entangled in these materials (Shaughnessy et al. 2003, Page et al. 2004). Other animals become entangled in fishing gear, particularly bottom-set gillnets of commercial shark fishers. A risk assessment of sea lion by-catch in shark gillnets indicated that there is a high risk of subpopulation extinction with even low levels of by-catch (Goldsworthy and Page 2007). A substantial sea lion tourist industry has developed; this activity is regulated at sea lion colonies in parks to minimize disturbance during the breeding season. Extensive disturbance can cause Australian Sea Lions to abandon colony sites.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected in Australia by State Conservation agencies under numerous independently enacted state laws, the earliest dating back to 1889. The Environment Protection and Biodiversity Conservation Act of 1999 provides protection for all pinnipeds in Australia. The Australian Sea Lion was listed as a Threatened species in the Vulnerable category in 2005. In South Australia, it was listed in February 2008 as Vulnerable under the National Parks and Wildlife Act of 1972. Fisheries are regularly monitored for evidence of marine mammal by-catch (Shaughnessy 1999). Australian fisheries have also attempted to reduce marine mammal by-catch through the development of several action plans and the development of a code of conduct for responsible fishing for at least one fishery. Several NGOs monitor by-catch issues and have prepared publications on ways to reduce marine mammal mortality in Australia?s fisheries (see Shaughnessy et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Fishermen often see them as a nuisance as they rob fishing nets and rock lobster traps.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The beauty and docility of Australian sea lions draws tens of thousands of tourists to Seal Bay on Kangaroo Island every year.

Positive Impacts: ecotourism

  • Goldie, N. 1998. "Concerns For Australian Sea Lion" (On-line). Accessed October 29, 2001 at http://www.csiro.au/index.asp?type=mediaRelease&id=ConcernsForAustralianSeaLion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Australian sea lion

The Australian sea lion (Neophoca cinerea) also known as the Australian sea-lion or Australian sealion, is a species of sea lion that breeds only on the south and west coasts of Australia. It is monotypic in the genus Neophoca.

Contents

Phylogeny

The Australian sea lion is a pinniped most closely related to other species of sea lion and fur seal in the family Otariidae.

Breeding behaviour

The breeding cycle of the Australian sea lion is unusual within the pinniped family. It is an 18 month cycle and is not synchronised between colonies. The duration of the breeding season can range from 5 to 7 months and has been recorded for up to 9 months at Seal Bay on Kangaroo Island.

Bulls do not have fixed territories during the breeding season. The males fight other males from a very young age to establish their individual positions in the male hierarchy and during the breeding season, dominant males will guard females for the right to breed with her when she comes into oestrus. A female comes into season for about 24 hours within 7 to 10 days after she has given birth to her new pup. She will only look after the new pup and generally fights off the previous season's pup if it attempts to continue to suckle from her.

Male Australian sea lions are also known to kill young as an act of defence of territory.

Sea lions on Kangaroo Island beach

Population status and protection measures

There are approximately 14,730 Australian sea lions[2] following the introduction of the Australian National Parks and Wildlife Act of 1972 which prohibited a harvest that began in earnest as soon as Europeans colonised the continent.

References

  1. ^ Goldsworthy, S. & Gales, N. (2008). Neophoca cinerea. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 30 January 2009. Listed as Endangered (EN A2bd+3d)
  2. ^ "Wildlife as Canon Sees It". National Geographic Magazine (National Geographic Society) 218 (6). December 2010. "Surviving number: Estimated at 14,730" 
  • Shannon Leone Fowler (2005). Ontogeny of diving in the Australian sea lion. Ph.D. thesis. University of California, Santa Cruz.
  • Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!