You are viewing this Taxon as classified by:

Articles on this page are available in 1 other language: Spanish (22) (learn more)

Overview

Brief Summary

Description

California sea lions are the best-known eared seals. All seals can hear, but earless seals (in the family Phocidae) have internal ears. The eared seals (sea lions and fur seals, in the family Otariidae) have small external ears. They also can pull their rear flippers up under their bodies and use to them move around on land, which phocids cannot do. California sea lions spend most of their time in coastal waters, and eat fish. Adult males migrate northward for the winter and return to island beaches off the California and Mexican coastlines for the May—July breeding season. They loudly defend patches of territory, on land or in the shallows, fasting for 4—6 weeks while they are on patrol. About a month after pupping (giving birth), females are ready to mate with the males who have been waiting impatiently. Ninety percent of the young are born in June. They are born on land and nurse for a year or more.

Links:
Mammal Species of the World
  • Original description: "In Bory de Saint-Vincet (ed.), Dictionnaire Classique d'Histoire Naturelle.  Paris, 13:420."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

The California sea lion is a highly gregarious species, hauling out in large groups, although tending to feed individually or in small groups, unless large quantities of food are present. They feed on a large number of different fish species (including some commercial species), such as northern anchovies, pacific whiting, mackerel and are known to also take some cephalopod species. Dives usually last about two minutes, but can last up to ten minutes, and average depths of 26 to 98 metres, although California sea lions have been known to dive to well below 200 metres (2). The breeding season starts in May, at which time adult males begin to fight for a territory. Most males are unsuccessful and retreat to the sea, or to bachelor beaches nearby. Successful males guard their territory and maintain boundaries with routine displays and frequent barking. A male may maintain his territory for up to 45 days depending on other competitive males and on fat reserves. Females give birth to a single pup throughout May and June and are ready to mate again about 28 days after giving birth, although this interval is more variable among the population in Mexico. The mothers spend the first week after birth with their pup and then begin alternating feeding trips at sea (two to three days) with suckling bouts on land (one to two days), until the pup is weaned, at about ten to twelve months. The mothers and pups recognise each other after separation by sound and smell (2). The breeding season ends in August after which time most males migrate north and the females and juveniles disperse, but stay close to the breeding islands. Average lifespan is 15 to 24 years with the young reaching sexual maturity at about four to five years. However, males will generally fail to hold a territory until they are older (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

This highly social and intelligent species is well adapted to a semi-aquatic life-style. California sea lions swim using their fore-flippers and are particularly agile on land as they are able to control their hind flippers independently (3). Male and female California sea lions differ significantly in appearance. Males are substantially bigger than females and have an enlarged sagittal crest, which is usually topped with white fur. The adult males are generally dark brown with a lighter belly and side colouring, whereas the females can appear more tan coloured. The pups are born with a blackish-brown coat which moults after a month and is replaced with a light brown coat. This coat is shed after four or five months and replaced with the adult coat. The California sea lions found in Mexico appear smaller than those found in California (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The California Sea Lion occurs in the eastern North Pacific from Islas Tres Marias north of Puerto Vallarta, north throughout the Gulf of California and around the end of the Baja California Peninsula north to the Gulf of Alaska. Sightings of vagrants have been reported from the southern Bering Sea in the north (Maniscalco et al., 2004) to Chiapas Mexico in the south. Females, which were only very rarely found north of Point Conception in the early 1980s, are now routinely found in northern California, where former breeding sites have been reoccupied.

Large numbers of adult and subadult males and juveniles undertake a post-breeding season migration north from the major rookeries in southern California and Baja California and winter from central California to Washington State. Smaller numbers of animals migrate to British Columbia and southeast Alaska, making it to the northern Gulf of Alaska, Alaska Peninsula, and eastern Aleutian Islands. Other animals appear to remain in the Gulf of California year round and do not undertake long migrations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Zalophus californianus are found along the shore from California to Mexico including Baja and Tres Marias Islands, in the Galapagos Islands and in the southern Sea of Japan (Scheffer, 1958). The populations in each area do not interact with other populations (Scheffer, 1958) and therefore are considered subspecies. California sea lions tend to seasonally migrate long distances (Riedman, 1990). Males usually migrate north to British Columbia after the breeding season (Mate, 1978).

Biogeographic Regions: nearctic (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East North Pacific, Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Coastal North Pacific, Mazatlan and Baja California to Vancouver Island (males in fall and winter); breeds on San Miguel, San Nicolas, Santa Barbara, and San Clemente islands in southern California; largest breeding colony is on San Miguel Island; a few pups are born occasionally at South Farallon and Ano Nuevo islands off central California; in Mexico, breeds on the Coronados, Guadalupe, San Martin, Cedros, and San Benito islands off the Pacific coast of Baja California, and there are many smaller colonies on islands in the Gulf of California (Keith et al. 1984, Reeves et al. 1992). Galapagos and eastern Asian populations, sometimes included in this species, are now regarded as distinct species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found from British Columbia in Canada south to Baja in Mexico, including the Gulf of California. California sea lions breed mainly on offshore islands from southern California's Channel Islands south to Mexico (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Newborn pups average 75 cm in length and weigh between 5 to 6 kg. Adult males average 2.2 meters in length and 275 kg in weight but can reach length of 2.4 meters and weights of 390kg. Females are smaller, averaging 1.8 meters in length and 91 kg in weight but can reach lengths of 2 meters and weights of 110kg . Pups have a blackish brown coat, which is molted by the first month and replaced with a light brown coat. The light brown coat is shed after 4 or 5 months and replaced with the adult pelage. Adult males are mostly dark brown with lighter belly and side coloring. Adult females are dark brown but can also appear tan. Zalophus californianus exhibit pronounced sexual dimorphism . Adult males have an enlarged saggital crest and a lighter pelage. In addition to the head features males are more robust and larger than females. All California sea lions have black flippers which are coated with short black stubble. The typical dental formula is 3/2, 1/1, and 5/5.

(Mate, 1979,)(Jefferson et al., 1993), and (Riedman, 1990)

Range mass: 390 (high) kg.

Range length: 2.4 (high) m.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 250 cm

Weight: 300000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are about four times larger than females.

Length:
Average: 2.1 m males; 1.6 m females
Range: 2-2.5 m males; 1.6-1.8 m females

Weight:
Average: 375 kg males; 94 kg females
Range: 350-400 kg males; 90-120 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The California Sea Lion is the well-known “performing seal” of zoos, circuses and marine theme parks. It is a sexually dimorphic species, with males reaching three to four times the weight of adult females and 1.2 times their length. Pups are born with a thick brownish-black lanugo that is generally moulted by the end of the first month. The succeeding light brown juvenile coat is shed 4-5 months later and is replaced by adult coloration. Male California Sea Lions reach lengths of 2.4 m, and weights of more than 390 kg. Females only reach 2 m, and weigh an average of 110 kg. Newborn pups are about 80 cm long and weigh 6-9 kg (Peterson and Bartholomew 1967).

Age of maturity for both sexes is about 4-5 years. Females produce one pup each year after a gestation of about 11 months. A long term mark-resighting study (1980-2006) recorded a maximum observed longevity of 19 years for males and 25 years for females (Hernandez-Camacho et al. in press). Age-specific birth rates vary among age classes; 5 yr-old females show 0.59, females between 6 and 15 year-old exhibit 0.79 (Melin 2002; Hernandez-Camacho et al. in press), and between 16-25 year-old show decreased birth rate between 0.35 and 0.11 (Hernandez-Camacho et al. in press).

Pupping and breeding take place from May through July. Pupping starts earlier in the Gulf of California (May 8) than in California (May 20) and the duration of the breeding season is longer in the Gulf (13 weeks) than in California (9.5 weeks) (Garcia-Aguilar and Aurioles-Gamboa 2003). Males are highly polygynous and hold territories both on land and in shallow water near shore for periods up to 45 days. Females stay ashore with their newborn pups for about seven days before they depart for the first of many foraging trips that usually last 2-3 days and are followed by attendance with the pup at the rookery for 1-2 days. Most pups are weaned at 12 months of age. However, some pups continue to receive maternal care as yearlings and 2-3year olds (Newsome et al. 2006).

The diving pattern of lactating adult females is consistent with that of a number of other otariid species. The deepest dive recorded was to approximately 274 m and the longest dive lasted just under ten minutes. Typical feeding dives are shallower than 80 m, and last less than three minutes (Feldkamp et al. 1989; Antonelis et al. 1990). Lactating adult females are active for most of the time they are at sea and feeding bouts occur during the day and at night, with peaks of activity at dawn and dusk. The fact that feeding dives occur in bouts suggests that California sea lions are frequently exploiting patches of prey (Weise and Costa 2007).

California Sea Lions are generally found in waters over continental shelf and slope zones; however, they occupy several islands far offshore in deep oceanic areas, such as Guadalupe Island. They frequent coastal areas including bays, harbours, and river mouths.

California Sea Lions feed on a wide variety of prey, but usually maintain a preference for 4-5 species at each location, often taking what is abundant locally or seasonally in the areas they occupy (Lowry et al. 1990; Garcia-Rodriguez and Aurioles-Gamboa 2004). A lower diversity of prey is taken outside the breeding season, when many animals disperse over large areas, as opposed to during the breeding season, when preferred prey can be reduced by intense foraging activity in small areas within travelling range of the rookeries (Lowry 1991). Principle prey taken by California Sea Lions in the Pacific includes: Pacific whiting, market squid, red octopus, jack and Pacific mackerel, blacksmith, juveniles of various species of rockfish, herring, northern anchovy, and salmon (Antonelis et al. 1984; Lowry et al. 1990; Lowry 1991). Sea lions in the Gulf of California have northern anchovy, Pacific whiting, and rockfish as prey in common with animals in the Pacific and also take various species of midshipmen, myctophids and bass, as well as sardines, largehead hairtail and Eastern Pacific flagfin (Aurioles-Gamboa et al. 1984; Garcia-Rodriguez and Aurioles-Gamboa 2004). Because of their boldness and taste for commercially-important fish species, such as salmon and rockfish that are easily taken from fishing lines (DeMaster et al., 1985) California sea lions are considered a nuisance by many sport and commercial fishermen. They will also ascend rivers following spawning runs of anadromous fish and take advantage of man-made structures such as canal locks and fish ladders that concentrate prey.

Predators of California Sea Lions include Killer Whales, sharks, Coyotes and feral dogs, and until they were recently extirpated from the California Channel Islands, bald eagles were known to take young pups.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zalophus californianus generally live along coastlines but have been found in rivers in along the northern Pacific coast. California sea lions often congregate on man-made structures such as jetties, piers, offshore buoys and oil platforms. Zalophus californianus tend to inhabit places which have undergone human intervention (Riedman, 1990).

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6192 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2769 samples.

Environmental ranges
  Depth range (m): 0 - 139.2
  Temperature range (°C): 8.622 - 26.131
  Nitrate (umol/L): 0.038 - 26.169
  Salinity (PPS): 30.381 - 35.304
  Oxygen (ml/l): 2.414 - 6.583
  Phosphate (umol/l): 0.330 - 2.161
  Silicate (umol/l): 1.436 - 34.422

Graphical representation

Depth range (m): 0 - 139.2

Temperature range (°C): 8.622 - 26.131

Nitrate (umol/L): 0.038 - 26.169

Salinity (PPS): 30.381 - 35.304

Oxygen (ml/l): 2.414 - 6.583

Phosphate (umol/l): 0.330 - 2.161

Silicate (umol/l): 1.436 - 34.422
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal waters. Hauls out on rocky and sandy beaches, primarily on islands. Young are born in rookeries on rocky and sandy beaches, primarily on islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding occurs on sandy beaches and rocky areas of remote islands where there is easy access to shade, water for cooling down and plenty of food (2). California sea lions generally fish in open waters along the Pacific coast, but are increasingly being found up rivers and often congregate on man-made structures such as jetties and piers (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

After the breeding season (August-September) some adult and subadult males move northward and overwinter as far north as British Columbia; return south March-May. Males from Baja California rookeries arrive in southern California in December-January (Reeves et al. 1992). Migratory status of females and young unclear.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Male California sea lions have been known to assemble at the mouths of fresh water rivers where there is a steady supply of fish. California sea lions tend to feed alone or in small groups unless there is an large quantity of food. Under conditions of increased food supply, Z. californianus hunt in larger groups. Zalophus californianus have been known to feed cooperatively with cetaceans, seabirds and harbor porpoises. Often one species locates a school of fish and signals the presence of food to the other species. While rare, it has been recorded that California sea lions drink seawater while not breeding (Riedman, 1990).

Foods eaten include: cephalopods, anchovies, herring, Pacific whiting, rockfish, hake, salmon, squid and octopuses (Riedman, 1990).

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic feeder. Feeds on squid, octopus, and a various fishes, including herring, anchovy, whiting, mackerel, sardines, hake, rock-fish, etc. Males do not feed during breeding season. Lactating females at San Miguel Island forage with 100 km of rookery, in highly productive upwelling areas; most feeding dives are relatively shallow (26-74 m) (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

See Riedman, 1990.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Zalophus californianus is prey of:
Carcharodon carcharias
Carcharhinus leucas
Orcinus orca

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Zalophus californianus preys on:
Cephalopoda
Genyonemus lineatus
Trachurus symmetricus
Engraulis mordax
Actinopterygii
Mollusca
Enhydra lutris

Based on studies in:
USA: California, Southern California (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: U.S. population was estimated at more than 160,000 in the mid-1990s (NMFS, Federal Register, 15 March 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious at all seasons. Predators include killer whales and sharks, though these have little impact on populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Feeds mostly at night, spends the morning and mid-day sleeping on beaches.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest recorded wild Z. californianus lived 17 years (Mate, 1979).

In captivity, the oldest recorded Z. californianus lived to be 31 years old. The age of Z. californianus can be determined by counting the number of rings on cross sections of its teeth (Mate, 1978).

Range lifespan

Status: wild:
17 (high) years.

Range lifespan

Status: captivity:
31 (high) years.

Average lifespan

Status: wild:
17.0 years.

Average lifespan

Status: captivity:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 35.7 years (captivity) Observations: The total gestation time, of approximately 11.5 months, probably includes a 3 month period of delayed implantation (Ronald Nowak 2003). In the wild, these animals appear to live up to 17 years (Bernhard Grzimek 1990). One wild born male was still alive in captivity at about 35.7 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During breeding season males claim territories. A male consistently occupies a territory until factors change and cause him to be displaced. Typical occupation time is approximately two weeks; few Z. californianus males remain at their site for longer. While guarding their territory, males remain present and do not leave even in pursuit of food. As external factors change, males replace other males on the territory. Replacement occurs throughout the entire breeding season. Males are known to attack if others invade their territory. California sea lions tend to breed on islands or remote beaches. Zalophus californianus exhibit moderate to extreme polygyny and tend to live in colonies of a few males and many females. Female Z. californianus exhibit mate choice, by "respond[ing] differently to the attempts of various males"(Riedman, 1990).

Mating System: polygynous

The peak breeding season occurs in early July. The total gestation period is about 11 months (Riedman, 1990). Most births occur from mid-May to mid-June (Scheffer, 1958) with the majority of pups born in mid-June. The time between birth and estrus is about 28 days. California sea lions reach sexual maturity between four and five years (Riedman, 1990).

Breeding season: mating in July, births in mid-May to mid-June

Average number of offspring: 1.

Average gestation period: 11 months.

Range weaning age: 6 to 12 months.

Average age at sexual or reproductive maturity (female): 4-5 years.

Average age at sexual or reproductive maturity (male): 4-5 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal )

Average birth mass: 7000 g.

Average gestation period: 259 days.

Average number of offspring: 1.2.

Average age at sexual or reproductive maturity (male)

Sex: male:
1826 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

The lactation period in Z. californianus ranges from six months to a year. There are many possible reasons for the variation in lactation periods including availability of food resources, the mother's age and health, the sex of the pup and the birth of a new pup. Zalophus californianus provide more lengthy maternal care for female offspring then for male offspring, yet during lactation both males and females have equal access and receive equal resources.

Parental Investment: female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males establish breeding territories after arrival of females. Single pups are born mainly in late June in California, late May-January in Galapagos. Females mate 3-4 weeks after giving birth, then make periodic trips to sea to feed. Young are weaned generally in 4-8 months in California but frequently after more than a year and sometimes three years in the Galapagos. Females sexually mature at about 4 years, may live up to 25 years; most adult females breed annually. Males first breed probably at 9-10 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Zalophus californianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCTACAAACCATAAAGATATTGGCACCCTCTATTTACTATTTGGTGCATGAGCTGGAATGGCTGGCACCGCTCTCAGCCTATTAATCCGCGCGGAATTAGGCCAACCAGGCACCCTACTAGGGGAC---GACCAAATCTACAATGTAATTGTCACCGCCCATGCATTCGTAATAATCTTTTTCATAGTAATGCCTATTATGATTGGAGGCTTTGGAAATTGATTAGTACCCCTAATAATTGGTGCTCCCGACATGGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTTCTACTACTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCGGGTACCGGATGAACGGTTTATCCTCCCCTAGCAGGGAATCTAGCCCATGCGGGAGCTTCCGTAGACTTGACTATTTTCTCCCTTCACCTGGCAGGAGTATCATCTATTCTGGGAGCCATCAACTTTATTACTACCATTATCAACATGAAACCCCCCGCTATGTCCCAGTACCAAACTCCTTTATTCGTGTGATCCGTACTAATCACAGCAGTACTACTTCTGCTATCCCTACCAGTACTAGCAGCCGGTATCACTATACTACTTACGGACCGAAATCTAAATACAACCTTTTTCGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACATCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTTATCCTACCAGGGTTCGGAATAATCTCTCATATCGTCACATATTATTCAGGAAAAAAGGAACCCTTTGGCTATATAGGAATGGTCTGAGCAATAATATCCATTGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTCACCGTAGGAATAGATGTTGACACGCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Zalophus californianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aurioles, D. & Trillmich, F. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Due to its large and increasing population size, the California Sea Lion should remain classified as Least Concern.

IUCN Evaluation of the California Sea Lions, Zalophus californianus
Prepared by Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Exploitation during the 19th and 20th centuries caused population reductions. The distribution range has not changed since the exploitation era but population numbers have increased mainly in California where the population estimate is around 238,000. The population in Mexico occupies both side of the Baja California Peninsula: the west coast has an estimated population of 75,000 – 87,000, whereas the Gulf of California population is near 30,000. The total population of California sea lions is therefore around 355,000 individuals. The population in California is reaching carrying capacity. Some colonies in the Central Gulf of California have declined by approximately 35% in the last 15 years.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

California Sea Lions are abundant; they are likely reaching carrying capacity in California.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1l.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

No population reduction is inferred in the near future in California or in west coast Baja California. However, some rookeries in the Gulf of California are declining and are likely to continue to decline in the near future.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
Considering recent, frequent sightings of California Sea Lion in the Gulf of Alaska and the end of the Gulf of California as the northern and southern limits of its occurrence (around 6800 km) and a typical coastal distribution of 50 km, the EOO of California Sea Lions is around 340,000 km².

B2. Area of occupancy (AOO): CR
The AOO for the California Sea Lion, determined for the locations in which they breed (around 2,845 km) and 50 km offshore is about 142,250 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR + 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

The California Sea Lion has 13 rookeries from the Channel Islands to the south of Baja California and 13 rookeries inside the Gulf of California. The populations in California and Baja California show population declines during severe El Niño event, but they tend to recover to previous levels within 4-5 years. The Gulf of California does not show such fluctuations; it is genetically isolated from the remaining geographic distribution.

C. Small population size and decline
Number of mature individuals: CR
AND either C1 or C2:
C1. An estimated continuing decline of at least: CR + 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
E. Quantitative Analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

Some quantitative analysis for the probability of extinction is available for rookeries of California sea lions in the Gulf of California, indicating that at least one of the 4 clusters of rookeries shows a risk for being CR > 50% in 15 years.

Listing recommendationThe California Sea Lion population is abundant and probably reaching carrying capacity in most of its wide geographic distribution. A category of Least Concern should be assigned for the global status. However, the Gulf of California Sea Lion population is genetically isolated, relatively small and some colonies have shown recent declines. Some of the local stocks in the Gulf of California should be considered Near Threatened.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zalophus californianus are well protected in most areas. Occasionally, they are trapped with a permit for display in zoos, aquariums, and circuses (Mate, 1979). In Mexico, a few California sea lions are trapped each year, while in the United States they are fully protected under the Marine Mammal Protection Act.

Occasionally California sea lions pose a problem for fishermen by stealing fish from commercial fishermen netting. A significant number of California sea lions have been killed as a result of getting tangled in discarded fishing gear. (Riedman, 1990). From 1983 to 1984, Z. californianus experienced a decline of 60 percent in pup production from previous years. Also during this time food resources declined, which led to inhibited growth and increased mortality. During this time mothers left their pups earlier in search of food, which truncated the lactation period, thus reducing the amount of nutrients a pup received and making it more susceptible to death.

According to IUCN, the following subspecies are recognized:

Zalophus californianus ssp. japonicus (extinct)

Zalophus californianus ssp. wollebaeki (vulnerable)

Zalophus californianus ssp. californianus (no special status).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4N - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The California Sea Lion is abundant and increasing in some parts of its distribution. The total global population (US and Mexico) is probably around 355,000 individuals. Some colonies in the Gulf of California have decreased in the last two decades.

Exploitation during the 19th and 20th centuries caused population reductions. The distribution range has changed little since exploitation era but population numbers have increased mainly in California, where the estimate is around 238,000 individuals (Carretta et al. 2007). The population in Mexico occupies both side of the Baja California Peninsula: the west coast has an estimated population of 75,000 – 87,000 (Lowry and Maravilla 2005), whereas the Gulf of California populations is near 30,000 (Szteren et al. 2006). Total population of California sea lions is therefore around 355,000 individuals.

The California Sea Lion population is apparently reaching carrying capacity in the USA (Carretta et al. 2007) whereas in the Gulf of California the population has decreased by ~20% in the last 15 years (Szteren et al. 2006). The California Sea Lion has 13 rookeries from the Channel Islands to the south of Baja California and 13 rookeries inside the Gulf of California. The population in California and Baja California show declines during severe El Niño events that usually return to previous levels within 4-5 years. The Gulf of California does not show this sort of marked fluctuations but it is genetically isolated from the remaining geographic distribution (Maldonado et al. 1985; Schramm 2003, Bowen et al. 2005).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Numbers have increased in southwestern Canada since the early 1970s (Bigg 1988). Total U.S. population increased steadily over the past two decades (NMFS, Federal Register, 15 March 1996). The number of pups born in the Channel Islands increased from about 19,000 in 1989 to 25,000 in 1990 and 31,000 in 1991 (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
California Sea Lions are abundant, widely distributed and experiencing population increase through most of their range. They were historically important to native people living in coastal areas and on islands used by sea lions for rookeries. Huge middens in southern California and on the Channel Islands, with large numbers of California Sea Lion and other pinniped bones, attest to the past importance of marine mammals in subsistence cultures prior to the changes that followed the arrival of Europeans on the west coast of North America (Porcasi and Fujita 2000). In the 19th and early 20th centuries, California Sea Lions were harvested intensively for a variety of products, and hunted for bounties to reduce their impact on fisheries (Cass 1985).

California Sea Lion mortality occurs in conflicts with fisheries, by poaching, and through entanglement in marine debris (Stewart and Yochem 1987; Aurioles-Gamboa et al. 2003). Prey availability is greatly reduced during El Niño events and large numbers of pups born during these periods die of starvation, as do weaker animals from all age classes (Francis and Heath 1991). The sea lion rookeries inside the Gulf of California do not appear to be greatly effected by El Niño events (Aurioles and Le Boeuf 1991; Wielgus et al. in press).

California Sea Lions accumulate pollutants through the food chain, and large amounts of DDT, and PCBs discharged in the past, continue to accumulate in coastal marine food chains that include this species. Additionally, large amounts of agricultural and urban runoff and waste continue to be discharged into coastal marine habitats annually from numerous sources; this may have effects on sea lion immune systems and overall health. California Sea Lions do sometimes die of paralytic shellfish poisoning caused by domoic acid, a biotoxin produced by diatom blooms that enter the food web through planktivorous fish such as herring and sardine (Silvagni et al. 2005). California Sea Lions experience mortality from a number of diseases, including some such as leptospirosis contracted from terrestrial animals. They are at risk of exposure to additional diseases from contact with feral and domestic dogs and other terrestrial animals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In the early 1980s, as many as 1500/year may have died as a result of entanglement in gill nets or from being shot by commercial fishermen; such mortality continues at an unknown rate. In the late 1960s and early 1970s, premature births were observed in California, evidently the result of DDT and PCB contamination and viral and bacterial infections (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The California sea lion faces a number of threats, most notably through human-animal conflict and climate change. In the 19th and early 20th centuries California sea lions were extensively killed for commercial purposes, and although later afforded some protection, were still killed in large numbers until hunting was banned between 1969 and 1972. Population numbers have now recovered, but growing numbers are being killed in fishing nets. California sea lions are also increasingly thought to be damaging commercial fish stocks and in 1999 the federal National Marine Fisheries Service released a report recommending that Congress allow wildlife managers to kill California sea lions that are preying on endangered fish species (6). California sea lions are also negatively affected byEl Niño, which causes a shortage in food supply and increased mortality (2). Other causes of mortality include infection, disease, poisoning, pollution and toxic phytoplankton blooms (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Protection that began in the mid-20th century in the United States was solidified with the passage of the Marine Mammal Protection Act of 1972 in the United States and similar laws in Mexico. These protective measures provided the impetus for recovery of the population. Tourism at coastal sites and most offshore islands is highly regulated and controlled.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The California sea lion is currently classified as Lower Risk / Least Concern on the IUCN Red List and at present the population is quite capable of recovering from limited conflict with humans and the occasional El Niño event. As long as there is enough food, and some level of protection remains, it is thought that there is no immediate threat to the survival of the California sea lion. The extinction of the Japanese sea lion, however, reminds us that there can be limits to the recovery of populations from high mortality, especially for the smaller population in Mexico, where human interaction combined with natural stress may make recovery more difficult (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

California sea lions are thought by some to seriously reduce stocks of commercially-valuable fish such as salmon. They also may interfere with nets used by fishermen.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Zalophus californianus used to be hunted for their hides and for animal food. California sea lions are also used by the U.S. Navy for retrieval programs, including search and rescue and retrieval of military hardware. They are also used to patrol areas in search of threats. California sea lions are widely used in educational programs throughout the world because of their agility and trainability. They are charming ambassadors for their sea lion cousins.

Positive Impacts: ecotourism ; research and education

  • Mate, B. 1979. California Sea Lion. Pp. 5-8 in FAO Advisory Committee on Marine Resource Research Working Party on Marine Mammals, ed. Mammals in the Sea vol. 2 Pinniped Species Summaries and Report on Sirenians. Rome, Italy: Food and Agriculture Organization of the United Nations.
  • Mate, B. 1978. California Sea Lion. Pp. 172-177 in D Haley, ed. Marine Mammals of Eastern North Pacific and Artic Waters. Seattle, Washington: Pacific Search Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Widely displayed in zoos, aquaria, and circuses.

With increasing populations in southwestern Canada, there have been increased complaints from fisherman about interference with fishing operations and damage to gear and stocks of herring, squid, and cod (Bigg 1988). At Chittendon Locks near Seattle, Washington, since the 1980s, adult males have been a problem by preying on already depleted steelhead populations. Success of translocations of "problem" sea lions preying on steelhead near Seattle, Washington, has been limited by the return of some of the translocated individuals, from release points as far as southern California (Reeves et al. 1992).

See Reeves et al. (1992) for history of exploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

California sea lion

The California sea lion (Zalophus californianus) is a coastal eared seal native to western North America. It is one of five species of sea lion. Its natural habitat ranges from southeast Alaska to central Mexico, including the Gulf of California. Sea lions are sexually dimorphic, males are larger than females, and have a thicker neck and protruding crest. They mainly haul-out on sandy or rocky beaches, but they also frequent manmade environments such as marinas and wharves. Sea lions feed on a number of species of fish and squid, and are preyed on by killer whales and white sharks.

California sea lions have a polygynous breeding pattern. From May to August, males establish territories and try to attract females to mate with. Females are free to move in between territories, and are not coerced by males. Mothers nurse their pups in between foraging trips. Sea lions communicate with numerous vocalizations, notably with barks and mother-pup contact calls. Outside of their breeding season, sea lions spend much of their time at sea, but they come to shore to molt.

Sea lions are particularly intelligent and can be trained to perform various tasks. Because of this, California sea lions are commonly found in public displays in zoos, circuses and oceanariums, where they are known as the classic "seals," and are trained by the US Navy for certain military operations. The International Union for Conservation of Nature (IUCN) lists the species as Least Concern due to its abundance. Sea lions have been considered threats to endangered salmon at Bonneville Dam, where officials have killed several individual offenders.

Contents

Taxonomy [edit]

Taxidermied specimen of Japanese sea lion

The California sea lion was described by René Primevère Lesson, a French naturalist, in 1828. It is grouped with other sea lions and fur seals in the family Otariidae. Otariids, also known as eared seals, differ from true seals in having external ear flaps, and proportionately larger foreflippers and pectoral muscles. Along with the Galapagos sea lion and the extinct Japanese sea lion, the California sea lion belongs to the genus Zalophus, which derives from the Greek words za, meaning "intensive," and lophus, meaning "crest."[2] This refers to the protruding sagittal crest of the males, which distinguishes members of the genus.[3]

Traditionally, the Galapagos sea lion and Japanese sea lion were classified as subspecies of the California sea lion. However, a genetic study in 2007 found that all three are in fact separate species.[4] The lineages of the California and Japanese sea lion appear to have split off 2.2 million years ago during the Pliocene.[5] The California sea lion differs from the Galapagos sea lion in its greater sexual dimorphism.[3] The Steller sea lion is the closest extant relative of the Zalophus sea lions, being a sister taxon.[6]

Appearance, physiology, and movement [edit]

California sea lion skeleton
Sea lion swimming underwater

Being sexually dimorphic, California sea lions differ in size, shape, and coloration between the sexes. Males are typically around 2.4 m (7.9 ft) long and weigh up to 350 kg (770 lb), while females are typically around 1.8 m (5.9 ft) and weigh up to 100 kg (220 lb).[3] Females and juveniles have a tawny brown pelage,[3] although they may be temporarily light gray or silver after molting.[7] The pelage of adult males can be anywhere from light brown to black, but is typically dark brown.[3] The face of adult males may also be light tan in some areas. Pups have a black or dark brown pelage at birth.[7] Although the species has a slender build, adult males have robust necks, chests, and shoulders.[7] Adult males also have a protruding crest which gives them a "high, domed forehead";[8] it is tufted with white hairs.[3] They also have manes, which are less developed than those of adult male South American and Steller sea lions.[8] Both sexes have long, narrow muzzles.[7]

As an otariid, the California sea lion relies on its foreflippers to propel itself when swimming. This form of aquatic locomotion, along with its streamlined body, effectively reduces drag underwater. Its foreflipper movement is not continuous; the animal glides in between each stroke.[9] The flexibility of its spine allows the sea lion to bend its neck backwards far enough to reach its hindflippers. This allows the animal to make dorsal turns and maintain a streamlined posture.[10] When moving on land, the sea lion is able to turn its hindflippers forward and walk on all fours. It moves the foreflippers in a transverse, rather than a sagittal, fashion. In addition, it relies on movements of its head and neck more than its hindflippers for terrestrial locomotion.[11] Sea lions may travel at speeds of around 10.8 km/h (6.7 mph),[12] and can dive at depths of 274 m (0.170 mi) and for up to 9.9 minutes, though most dives are typically 80 m (0.050 mi) and last less than 3 minutes.[13]

Sea lions have color vision, though it is limited to the blue-green area of the color spectrum. This is likely an adaptation for living in marine coastal habitats.[14] Sea lions have fairly acute underwater hearing, with a hearing range of 0.4–32 kHz.[15] Sea lions rely on their whiskers or vibrissae for touch and detection of vibrations underwater. Compared to the harbor seal, the California sea lion's vibrissae are smoother and less specialized and thus perform less when following hydrodynamic trails, although they still perform well.[16]

Ecology [edit]

Range and habitat [edit]

The California sea lion ranges along the western coast and islands of North America, from southeast Alaska to central Mexico. Mitochondrial DNA sequences in 2009 have identified five distinct California sea lion populations: the US or Pacific Temperate stock, the Western Baja California or Pacific Tropical stock, and the Southern, Central, and Northern Gulf of California stocks.[6] The US stock breeds mainly in the Channel Islands, although some breeding sites may be established in northern California, and females are now commonly found there.[1] The Western Baja California stock mainly breeds near Punta Eugenia and at Isla Santa Margarita. The above mentioned stocks are separated by the Ensenada Front. The stocks of the Gulf of California live in the shallow waters of the north (Northern stock), the tidal islands near the center (Central stock), and the mouth of the bay (Southern stock). The stock status of the sea lions at the deep waters of the central bay has not been analyzed.[6]

Sea lion taking a chinook salmon near Bonneville Dam tailrace

During the breeding season, sea lions gather on both sandy and rocky shores. On warm days, they lie closer to the water. At night or in cool weather, they travel farther inland or to higher elevations.[7] Non-breeding individuals may gather at marinas, wharves, or even navigational buoys. California sea lions can also live in fresh water for periods of time, such as near the Bonneville Dam in the Columbia River.[17] In 2004, a healthy sea lion was found sitting on a road in Merced County, California, almost a hundred miles upstream from the San Francisco Bay and half a mile from the San Joaquin River.[18]

Diet and predation [edit]

California sea lions feed on a wide variety of seafood, mainly squid and fish, and sometimes clams. Commonly eaten fish and squid species include salmon, hake, Pacific whiting, anchovy, herring, rockfish, lamprey, dogfish, and market squid.[19] They mostly forage near mainland coastlines, the continental shelf, and seamounts. They may also search along the ocean bottom.[7] California sea lions may eat alone or in small to large groups, depending on the amount of food available. They sometimes cooperate with other predators, such as dolphins, porpoises, and seabirds, when hunting large schools of fish.[20] Sea lions sometimes follow dolphins and exploit their hunting efforts.[3] Adult females feed between 10–100 kilometres (6.2–62 mi) from shore.[12] Males may forage as far as 450 km (280 mi) from shore when water temperatures rise.[21] They also have learned to feed on steelhead and salmon below fish ladders at Bonneville Dam and at other locations in the Columbia River.[22]

Sea lions are preyed on by killer whales and large sharks. At Monterey Bay, California sea lions appear to be the more common food items for transient mammal-eating killer whale pods.[23] The sea lions may respond to the dorsal fin of a killer whale and remain vigilant, even when encountering resident fish-eating pods.[24] Sea lions are also common prey for white sharks. They have been found with scars made by attacks from both white sharks and shortfin mako sharks. Sharks attack sea lions by ambushing them while they are resting at the surface.[25] Sea lions that are attacked in the hindquarters are more likely to survive and make it to the shore.[26]

Life history [edit]

Reproductive behavior and parenting [edit]

Sea lion rookery

California sea lions breed gregariously between May and August, when they arrive at their breeding rookeries. When establishing a territory, the males will try to increase their chances of reproducing by staying on the rookery for as long as possible. During this time, they will fast, relying on a thick layer of fat called blubber for energy. Size and patience allow a male to defend his territory more effectively; the bigger the male, the more blubber he can store and the longer he can wait. A male sea lion usually keeps his territory for around 27 days. Females have long parturition intervals, and thus the males do not establish their territories until after the females give birth. Most fights occur during this time. After this, the males rely on ritualized displays (vocalizations, head-shaking, stares, bluff lunges, and so on) to maintain their territorial boundaries. Since temperatures can reach over 30 °C (86 °F) during this time, males must include water within their territories. Some territories are mostly underwater, particularly those near steep cliffs.[27] Sea lions that fail to establish a territory are driven out to sea or gather at a nearby beach.[3]

Sea lion mother with pup

Before mating begins, females gather into "milling" groups of 2–20 individuals. The females in these groups will mount each other as well as the males. These groups begin to disintegrate as the females begin to mate.[3] The territorial and mating system of the California sea lion has been described as similar to a lek system, as females appear to choose their mates while moving though different territories.[28] They avoid males that are too aggressive or energetic. Males are usually unable to prevent females from leaving their territories,[3] particularly in water.[29] Mating may occur outside the rookeries, between non-territorial males and females, as the latter move to and from the mating site. In some rookeries, copulation may be monopolized by a few males, while at others, a single male may sire no more than four pups.[29]

Female California sea lions have a 12-month reproductive cycle, consisting of a 9-month actual gestation and a 3-month delayed implantation of the fertilized egg before giving birth in May or June. Interbirth intervals are particularly long for this species, being 21 days for sea lions off California and more than 30 days for sea lions in the Gulf of California.[29] Females remain with their pups on shore for 10 days and nurse them. After this, females will go on foraging trips lasting as long as three days, returning to nurse their pups for up to a day. Pups left on shore tend to gather in nurseries to socialize and play.[7] When returning from a trip, females call their pups with distinctive calls to which the pups will rely in kind. A mother and pup can distinguish each other's calls from those of other mothers and pups. At first, reunions largely depend on the efforts of the mothers. However, as pups get older, they get more involved in reunions.[30] Older pups may sometimes join their mothers during their foraging trips.[7] Adult male California sea lions play no role in raising pups, but they do take more interest in them than adult males of other otariid species; they have even been observed to help shield swimming pups from predators.[31] Pups are weaned by a year but can continue to suckle for another year.[3]

Communication [edit]

Sea lions resting on a buoy

California sea lions communicate with a range of barks. The most commonly used one is their characteristic bark. Territorial males are the loudest and most continuous callers, and barks are produced constantly - day and night - during the peak of the breeding season. Sea lions bark especially rapidly when excited. The barks of territorial and non-territorial males sound similar, although those of the former are deeper. Males may bark when threatening other males or during courtship. The only other vocalization made by territorial males is a "prolonged hoarse grunt sound" made when an individual is startled by a human. This vocalization is also made by groups of non-reproductive males.[32]

Female sea lions are less vocal. Their barks, high-pitched and shorter than those made by males, are used in aggressive situations. Other aggressive vocalizations given by females include the "squeal," the "belch," and the "growl." The sound a female sea lion gives when calling her pups is called a "pup-attraction call," described as "loud" and "brawling." Pups respond with a "mother-response call," which is similar in structure. Pups will also bleat or bark when playing or in distress.[32] California sea lions can produce vocalizations underwater. These include "whinny" sounds, barks, buzzings, and clicks.[33]

Nonbreeding activities [edit]

Outside of the breeding season, males migrate to the northern ends of the species range to feed, while females forage near the breeding rookeries.[3] Sea lions can stay at sea for as long as two weeks at a time. They make continuous dives, returning to the surface to rest. Sea lions may travel alone or in groups while at sea and haul-out between each sea trip. Adult females and juveniles molt in autumn and winter; adult males molt in January and February. Gulf of California sea lions do not migrate; they stay in the Gulf year-round.[29]

Intelligence and trainability [edit]

Female balancing a ball on her nose at Blackpool Zoo, England
Zak, a 375 lb (170 kg) Navy sea lion leaps back into the boat after a harbor-patrol training mission.

Marine biologist Ronald J. Schusterman and his research associates have studied sea lions' cognitive ability. They have discovered that sea lions are able to recognize relationships between stimuli based on similar functions or connections made with their peers, rather than only the stimuli's common features.[34] Sea lions have demonstrated the ability to understand simple syntax and commands when taught an artificial sign language. However, the sea lions rarely used the signs semantically or logically.[35]

Because of their intelligence and trainability, California sea lions have been used by circuses and marine mammal parks to perform various tricks such as throwing and catching balls on their noses, running up ladders, or honking horns in a musical fashion. Trainers reward their animals with fish, which motivates them to perform. For ball balancing, trainers toss a ball at a sea lion so it may accidentally balance it or hold the ball on its nose, thereby gaining an understanding of what to do. A sea lion may go through a year of training before performing a trick for the public. However, its memory allows it to perform a trick even after three months of resting.[31] Some organizations, such as the Humane Society of the United States and the World Society for the Protection of Animals, object to using sea lions and other marine mammals for entertainment, claiming the tricks are "exaggerated variations of their natural behaviors" and distract the audience from the animal's unnatural environment.[36]

The California sea lion is used in military applications by the U.S. Navy Marine Mammal Program, including detecting naval mines and enemy divers. In the Persian Gulf, the animals can swim behind divers approaching a US naval ship and attach a clamp with a rope to the diver's leg. Navy officials say the sea lions can do this in seconds, before the enemy realizes what happened.[37]

Ronan, [38] a California sea lion, has displayed "rhythmic entrainment," previously seen only in humans, parrots, and other birds possessing vocal mimicry. [39]

Status [edit]

Photo of sea lions crowded together on dock
Hundreds of California sea lions bask on Pier 39 in San Francisco, where they are welcomed as a tourist attraction.

The IUCN lists the California sea lion as Least Concern due to "its large and increasing population size."[1] The estimated population is 238,000–241,000 for the US or Temperature Pacific stock, 75,000–85,000 for the Western Baja California or Pacific Tropical stock, and 31,393 for the population in the Gulf of California.[6] Off the US coast, sea lions are so numerous that they are close to carrying capacity, while the Gulf of California population declined by 20% by 2008. Sea lions may be killed when in conflict with fishermen, by poaching, and by entanglements in man-made garbage. They are also threatened by pollutants like DDT and PCB which accumulate in the marine food chain.[1]

In the United States, the California sea lion is protected on the Marine Mammal Protection Act (MMPA), passed in 1972, which outlaws hunting, killing, capture, and harassment of the animal. In 2007, the MMPA was amended to permit their lethal removal from salmon runs at Bonneville Dam (HR 1769: Endangered Salmon Predation Prevention Act).[40] The 2007 law seeks to relieve pressure on the crashing Pacific Northwest salmon populations.[41] Wildlife officials have unsuccessfully attempted to ward off the sea lions using bombs, rubber bullets and bean bags.[42] Efforts to chase sea lions away from the area have also proven ineffective.[17] Critics like the Humane Society object to the killing of the sea lions, claiming that hydroelectric dams pose a greater threat to the salmon.[42]

References [edit]

  1. ^ a b c d Aurioles, D. & Trillmich, F. (2008). Zalophus californianus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 30 January 2009.
  2. ^ Allen, Sarah G.; Mortenson, Joe; Webb, Sophie (2011). Field Guide to Marine Mammals of the Pacific Coast: Baja, California, Oregon, Washington, British Columbia. University of California Press. p. 403. ISBN 0520265459. 
  3. ^ a b c d e f g h i j k l Heath, Carolyn B.; Perrin, William F. (2008). "California, Galapagos and Japanese Sea Lions Zalophus californianus, Z. wollebaeki and Z. japonicus". In Perrin, William F.; Würsig, Bernd; Thewissen, J.G.M. Encyclopedia of Marine Mammals (2nd ed.). pp. 170–75. ISBN 012373553X. 
  4. ^ Wolf, Jochen B.W.; Tautz, Diethard; Trillmich, Fritz (2007). "Galápagos and Californian sea lions are separate species: Genetic analysis of the genus Zalophus and its implications for conservation management". Frontiers in Zoology 4: 20. doi:10.1186/1742-9994-4-20. PMC 2072946. PMID 17868473. 
  5. ^ Sakahira, F.; Niimi, M. (2007). "Ancient DNA analysis of the Japanese sea lion (Zalophus californianus japonicus Peters, 1866): preliminary results using mitochondrial control-region sequences". Zoological Science 24 (1): 81–85. doi:10.2108/zsj.24.81. PMID 17409720. 
  6. ^ a b c d Schramm, Yolanda; Mesnick, S.L.; de la Rosa, J.; Palacios, D.M.; Lowry, M.S.; Aurioles-Gamboa, D.; Snell, H.M.; Escorza-Treviño, S. (2009). "Phylogeography of California and Galápagos sea lions and population structure within the California sea lion". Marine Biology 156 (7): 1375–1387. doi:10.1007/s00227-009-1178-1. ISSN 00253162. 
  7. ^ a b c d e f g h Reeves, Randall R.; Stewart, Brent S.; Clapham, Phillip J.; Powell, James A. (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf. pp. 90–93. ISBN 0375411410. 
  8. ^ a b Lavigne, David M.; Harwood, John (2001). "Eared seal species". In David, MacDonald. The Encyclopedia of Mammals (2nd ed.). Oxford University Press. p. 171. ISBN 0760719691. 
  9. ^ Feldkamp, S.D. (1987). "Swimming in the California sea lion: morphometrics, drag and energetics". The Journal of Experimental Biology 131: 117–135. PMID 3694112. 
  10. ^ Fish, Frank E.; Hurley, Jenifer; Costa, Daniel P. (2003). "Maneuverability by the sea lion Zalophus californianus: turning performance of an unstable body design". The Journal of Experimental Biology 206 (Pt 4): 667–674. doi:10.1242/jeb.00144. PMID 12517984. 
  11. ^ English, Arthur Wm. (1976). "Limb movements and locomotor function in the California sea lion (Zalophus californianus)". Journal of Zoology 178 (3): 341–364. doi:10.1111/j.1469-7998.1976.tb02274.x. 
  12. ^ a b Lowry, M.S.; Carretta, J.V. (1999). "Market squid (Loligo opalescens) in the diet of California sea lions (Zalophus californianus) in southern California (1981–1995)". Reports of California Cooperative Oceanic Fisheries Investigations 40: 196–207. 
  13. ^ Feldkamp, Steven D.; DeLong, Robert L.; Antonelis, George A. (1989). "Diving patterns of California sea lions, Zalophus californianus". Canadian Journal of Zoology 67 (4): 872–883. doi:10.1139/z89-129. 
  14. ^ Griebel, U.; Schmid, A. (1992). "Color vision in the California sea lion (Zalophus californianus)". Vision Research 32 (3): 477–482. doi:10.1016/0042-6989(92)90239-F. PMID 1604834. 
  15. ^ Reichmuth, Colleen; Southall, Brandon L. (2012). "Underwater hearing in California sea lions (Zalophus californianus): Expansion and interpretation of existing data". Marine Mammal Science 28 (2): 358–363. doi:10.1111/j.1748-7692.2011.00473.x. 
  16. ^ Gläser, N. et al. (2011). "Hydrodynamic trail following in a California sea lion (Zalophus californianus)". Journal of Comparative Physiology A, Neuroethology, Sensory, Neural, and Behavioral Physiology 197 (2): 141–51. PMID 20959994. 
  17. ^ a b "Columbia River Sea Lion Management: Restoring balance between predators and salmon". Washington Department of Fish & Wildlife. Retrieved 23 May 2012. 
  18. ^ Kay, Jane (10 February 2012). "When good fishing trips go bad: Sea lion swims the Delta – lands on Merced County farm road". San Francisco Chronicle. Retrieved 3 July 2012. 
  19. ^ "Sea Lion Diet". Southwest Fisheries Science Center. Retrieved 2 September 2007. 
  20. ^ Riedman, M. (1991). The Pinnipeds: Seals, Sea lions, and Walruses. University of California Press. p. 168. ISBN 0520064984. 
  21. ^ Weise, Michael J.; Costa, Daniel P.; Kudela, Raphael M. (2006). "Movement and diving behavior of male California sea lion (Zalophus californianus) during anomalous oceanographic conditions of 2005 compared to those of 2004". Geophysical Research Letters 33 (L22S10). doi:10.1029/2006GL027113. 
  22. ^ "California Sea Lion Questions and Answers". Oregon Department of Fish and Wildlife. Retrieved 23 May 2012. 
  23. ^ Ternullo, Richard; Black, Nancy. "Predation Behavior of Transient Killer Whales in Monterey Bay, California". Monterey Bay Whale Watch. Retrieved 23 May 2012. 
  24. ^ Baird, Robin W.; Stacey, Pam J. (1989). "Observations on the reactions of sea lions, Zalophus californianus and Eumetopias jubatus, to killer whales, Orcinus orca; evidence of "prey" having a "search image" for predators". Canadian Field-Naturalist 103 (3): 426–428. Retrieved 23 May 2012. 
  25. ^ Harris, Jeffrey D.; Melin, Sharon R.; DeLong, Robert L. "Shark-inflicted Lesions on California Sea Lions (Zalophus californianus) at San Miguel Island, California: a New Phenomenon". National Marine Mammal Laboratory – Alaska Fisheries Science Center. Retrieved 23 May 2012. 
  26. ^ Long, Douglas J.; Hanni, Krista D.; Pyle, Peter; Roletto, Jan; Jones, Robert E.; Bandar, Raymond (1995). "White Shark Predation on Four Pinniped Species in Central California Waters: Geographic and Temporal Patterns Inferred from Wounded Carcasses". In Klimley, A. Peter; Ainley, David G. Great White Sharks: The Biology of Carcharodon carcharias. Academic Press. pp. 263–274. ISBN 0124150314. 
  27. ^ Odell, D.K. (2001). "The Fight to Mate: Breeding strategy of California sea lions". In MacDonald, David. The Encyclopedia of Mammals (2nd ed.). Oxford University Press. pp. 172–173. ISBN 0760719691. 
  28. ^ García-Aguilar, M.C.; Aurioles-Gamboa, D. (2003). "Breeding season of the California sea lion (Zalophus californianus) in the Gulf of California, Mexico". Aquatic Mammals 29 (10): 67–76. doi:10.1578/016754203101024086. 
  29. ^ a b c d Flatz, Ramona; González-Suárez, Manuela; Young, Julie K.; Hernández-Camacho, Claudia J.; Immel, Aaron J.; Gerber, Leah R. (2012). "Weak Polygyny in California Sea Lions and the Potential for Alternative Mating Tactics". In Fenton, Brock. PLoS ONE 7 (3): e33654. doi:10.1371/journal.pone.0033654. 
  30. ^ Gisiner, Robert; Schusterman, Ronald J. (1991). "California sea lion pups play an active role in reunions with their mothers". Animal Behaviour 41 (2): 364–66. doi:10.1016/S0003-3472(05)80488-9. 
  31. ^ a b Nowak, Ronald M. (2003). Walker's Marine Mammals of the World. Johns Hopkins University Press. pp. 80–83. ISBN 0801873436. 
  32. ^ a b Peterson, Richard S.; Bartholomew, George A. (1969). "Airborne vocal communication in the California sea lion, Zalophus californianus". Animal Behaviour 17 (1): 17–24. doi:10.1016/0003-3472(69)90108-0. 
  33. ^ Schusterman, Ronald J.; Gentry, Roger; Schmook, James (1966). "Underwater Vocalization by Sea Lions: Social and Mirror Stimuli". Science 154 (3748): 540–542. doi:10.1126/science.154.3748.540. 
  34. ^ Schusterman, Ronald J.; Kastak, David (1993). "A California sea lion (Zalophus californianus) is capable of forming equivalence relations". Psychological Record 43: 823–839. ISSN 00332933. 
  35. ^ Gisiner, R.; Schusterman, R.J. (1992). "Sequence, syntax, and semantics: Responses of a language-trained sea lion (Zalophus californianus) to novel sign combinations". Journal of Comparative Psychology 106: 78–91. doi:10.1037/0735-7036.106.1.78. 
  36. ^ "The Case Against Marine Mammals in Captivity". Humane Society of the United States and World Society for the Protection of Animals. p. 3. Retrieved 30 May 2012. 
  37. ^ Leinwand, Donna (17 February 2003). "Sea lions called to duty in Persian Gulf". USA Today. Retrieved 28 April 2010. 
  38. ^ "Our Resident Animals". Pinniped Cognition & Sensory Systems Laboratory and University of California, Santa Cruz. Retrieved 12 April 2013. 
  39. ^ Stephens, Tim (1 April 2013). "Sea lion defies theory and keeps the beat". University of California, Santa Cruz. Retrieved 12 April 2013. 
  40. ^ "Endangered Salmon Predation Prevention Act". Northwest Regional Office, National Oceanic and Atmospheric Administration. 26 July 2012. Retrieved 9 June 2012. 
  41. ^ "Lethal Removal of Sea Lions Necessary to Ensure Survival of Endangered Salmon Populations in Pacific Northwest". United States House Committee on Natural Resources. 14 June 2011. Retrieved 9 June 2012. 
  42. ^ a b Haight, Abby (9 March 2010). "Sea lion death warrants". KATU. Retrieved 9 June 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Zalophus japonicus (Japanese sea lion) and Z. wollebaeki (Galapagos sea lion) sometimes have been regarded as subspecies of Z. californianus. Wozencraft (in Wilson and Reeder 2005) listed them as distinct species.

The English name for sea lions has been inconsistently rendered as sea lion, sealion, and sea-lion (Rice 1998, Wozencraft, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!