Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

South American Sea Lions are widely-distributed, occurring more or less continuously from northern Peru south to Cape Horn, and north up the east coast of the continent to southern Brazil. They also occur in the Falkland/Malvinas Islands. The northernmost breeding distribution on the Pacific side is Isla Lobos de Tierra (6º26’S; Peru). No breeding colonies occur in Brazil. The northernmost breeding rookery in the Atlantic is Isla de Lobos, on the Uruguayan coast.

South American Sea Lions are primarily a coastal species, found in waters over the continental shelf and slope; they occur only infrequently in deeper waters. This species ventures into fresh water and can be found around tidewater glaciers and up rivers. Vagrants have been found as far north as 13°S, near Bahia Brazil and in the Galápagos Archipelago (Ecuador).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Otaria flavescens inhabits South American coastlines from Rio de Janeiro (23 degrees south latitude) on the Atlantic ocean side and coastal Perú (5 degrees south latitude) on the Pacific coast to southernmost South America. There are records of Otaria flavescens inhabiting the Galapagos and Falkland Islands.

Biogeographic Regions: neotropical (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Nowak, R. 1999. Walker's Mammals Of The World. Baltimore: Johns Hopkins University Press.
  • Grzimek, B. 1990. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill Publishing Company.
  • MacDonald, D. 1985. The Encyclopedia of Mammals. New York: Facts on File Publications.
  • Ridgway, S., R. Harrison. 1981. Handbook of Marine Mammals, vol. 1. London: Academic Press.
  • Arias-Schreiber, M., C. Rivas. 1998. Distribución, tamaño y estructura de loa poblaciones de lobos marinos (Arctocephalus australis y Otaria byronia) en el litoral peruano, en noviembre 1996 y marzo de 1997. Inf. Progr. Inst. Mar Perú, 73: 17-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

widely distributed from northern Peru to southern Brazil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Falkland Islands, South America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

South American sea lions (Otaria flavescens), also known as maned seals, are the most sexually dimorphic of the five known sea lion species. Males are approximately three times the size of females.

Adult males range from 2 to 2.5 meters in height and can weigh from 200 to 350 kilograms. The coat is dark brown on the dorsal side and dark yellow to gold on the ventral side. Males have a full mane, which is a paler color than the coat and a larger, more muscled neck than do females. A male's posture is usually upright, with the rostrum turned upward.

Adult females are much smaller in size and weight. They average 2 meters in height and can weigh from 140 to 150 kilograms, roughly half the average weight of an adult male. Their coats are also lighter in color relative to males. Coat color ranges from a fair brown to yellow with some pale markings around the head.

Pups do not exhibit this brown color until about a month after they are born. Neonates are greyish orange ventrally and black dorsally. This coat later turns to a dark chocolate brown color. Sexual dimorphism is shown in pups as well as in adults. According to a study in Peninsula Valdes, Argentina (Capposso et. al 1991), male pups averaged .82 meters in length and 13.7 kilograms in weight. In contrast, female pups averaged .79 meters in length and 12.3 kilograms in weight

Range mass: 140 to 350 kg.

Range length: 2 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Cappozzo, H., C. Campagna, J. Monserrat. 1991. Sexual dimorphism in newborn southern sea lions. Marine Mammal Science, 7(4): 385-394.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
South American Sea Lions are stocky, heavy-bodied otariids that are strongly sexually dimorphic. Adult males reach 2.6 m in length and weights of 300 to 350 kg; females reach 2 m and 144 kg. At birth, pups are 11-15 kg and 75-85 cm long. Pups are born black above and paler below, often with grayish orange tones on the undersides. Pups undergo their first moult approximately 1-2 months after birth, becoming dark brown. This colour fades during the rest of the first year to a pale tan to light brown, with paler areas on the face.

The age of attainment of sexual maturity is 4 years for females and 5-6 years for males. Gestation lasts about one year. Longevity is considered to be about 20 years. Mortality rates for adults are unknown (Reijnders et al 1993). Pup mortality estimated for some Peruvian colonies ranged from 13% before El Niño to 100% during El Niño and was negatively correlated with prey availability (Soto et al. 2004).

The start of the breeding season varies somewhat by location and latitude, with pups being born slightly earlier at more southern rookeries. At most sites, both sexes arrive in mid-December with peak numbers of males ashore just after mid-January and peak numbers of females ashore from mid to late January. Females give birth 2-3 days after their arrival at the rookeries; pups are born from mid-December to early February with a peak in mid-January, coinciding with the timing of peak numbers of females ashore. Estrous occurs 6 days after parturition, and females make their first foraging trip 2-3 days after estrous. From this point on, a cycle of foraging and pup attendance starts and lasts until pups are weaned at 8-10 months old. As is the case for many sea lions, it is not unusual for females to continue to care for a yearling while they are nursing a new pup. Pups gather in large pods on the rookeries while waiting for their mothers to return from 1-4 day long foraging trips. Females usually stay ashore for 2 days between trips.

South American Sea Lions are a highly polygynous species with various strategies employed by males and females during the breeding season that are driven by substrate and terrain at the rookery and thermoregulatory requirements imposed by weather conditions at the site. Adult males tend to establish territories through vocalizing, posturing, and fighting, when rookeries provide shade, have tidal pools that can be used for cooling, or funnel interior areas through narrow beaches between rocks or ledges to the sea. At more homogeneous locations with long shorelines, the male strategy focuses on identifying, defending and controlling individual cows in estrous, wherever they are found. Bulls actively and aggressively work to keep estrous cows close to them by grabbing, dragging, and throwing them back inland, away from the shoreline.

At sea, South American Sea Lions frequently raft alone or in small to large groups. They have been reported in association with feeding cetaceans and seabirds. The mean depth of lactating female foraging dives is about 61 m and the mean duration is just over 3 minutes. The maximum depth recorded for a dive is 175 m and duration 7.7 minutes. Two tagged adult males foraged on the continental shelf prior to the onset of breeding, making 5-6 day trips that covered an average of 600 km before they returned to land to haul-out. Dive depth and length are unknown for males, but these two animals spent about 90% of their time in water depths of 50-100 m.

South American Sea Lions are considered non-migratory, although some may wander long distances away from rookeries during the non-breeding season, and some southerly locations such as the Falkland/Malvinas Islands are largely abandoned during the winter. However, most rookeries are continuously occupied by at least some animals, and the species has been described as sedentary. Animals that reproduce at Península Valdés (northern Argentine Patagonia) move to Uruguay and vice versa (Szapkievich et al. 1999).

South American Sea Lions are opportunistic feeders that take a wide variety of prey that varies by location. Their diet includes many species of benthic and pelagic fishes and invertebrates, some of them of commercial value. Forty-one prey species (including fishes, cephalopods, crustaceans, gastropods, polychetes, sponges, and tunicates) were identified in stomach contents of individuals found dead on beaches and from animals recovered in incidental catches of the fisheries of the Patagonian continental shelf (Koen Alonso et al. 2000). Most important items were Argentine Hake (Merluccius hubbsi), Red Octopus (Enteroctopus megalocyathus), Argentine Shortfin Squid (Illex argentinus), "raneya" (Raneya brasiliensis), Patagonian Squid (Loligo gahi) and Argentine Anchovy (Engraulis anchoita). Differences in diet were found between sexes. Females fed mostly on benthic species, whereas males fed mostly on demersal-pelagic species.

Diet and maternal care patterns reflect inter-annual fluctuations in food availability. In the unpredictable Peruvian upwelling ecosystem, females appeared to adjust their diets and maternal attendance patterns in response to annual changes in the abundance and distribution of prey (Soto et al. 2006). Short times onshore nursing and long times at sea foraging are observed during El Niño in Peru, when prey is not abundant near the rookeries. A larger diversity of prey species (particularly of demersal fishes) are consumed during El Niño, when anchovy and lobster are less available. These observations suggest that South American Sea Lions may be good indicators of relative changes in the distribution and abundance of marine resources.

A small percentage of adult male South American Sea Lions regularly prey on South American Fur Seals, although many that pass by colonies investigate the nearby waters and may attempt to capture a fur seal. Adult male sea lions hunt alone and focus their attacks on fur seal pups and juveniles, which are consumed when caught. This has been observed in almost the entire distribution range. About 17% of attacks are successful, but success varies widely between individual males. Subadult males also attack fur seals, but tend to abduct fur seals to serve as female sea lion substitutes, herding them and attempting to mate with them, usually killing them in the process. Female and juvenile sea lions have not been recorded to hunt fur seals. Sea lions have been observed killing young Southern Elephant Seals in the Falkland Islands. They are also known to take several species of penguins, but the importance of penguins in the diet is unknown.

Predators include Killer Whales, sharks and Leopard Seals, and possibly the Puma. At one now-famous rookery (Punta Norte at Península Valdés), Killer Whales are known to surf in on waves, partially beaching themselves while grabbing predominantly young sea lions off the shoreline. Puma tracks have been observed on a rookery in Patagonia and remains of sea lions have been found in a cave used by a Puma in the area.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South American sea lions reside along shorelines and beaches. These beaches usually consist of sand, gravel, rocks, and/or pebbles. They also inhabit flat rocky shelves or cliffs with tidepools and boulders.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Aquatic Biomes: coastal

Other Habitat Features: intertidal or littoral

  • Campagna, C., B. Le Boeuf, H. Capposso. 1988. Group raids: a mating strategy of male southern sea lions. Behaviour, 105(3-4): 224-249.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

South American sea lions are carnivorous. They feed on fish, cephalopods, crustaceans, and other invertebrates depending on local abundance. These sea lions are typically found hunting in shallower waters, not more than five miles from shore. When looking for prey that travel in schools they hunt in groups. When they catch fish, they usually shake the prey in the air and then sometimes eat it whole. In addition, they have been observed eating penguins and female South American fur seals (Arctocephalus australis) and their pups.

Animal Foods: birds; mammals; fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

  • Harcourt, R. 1992. Factors affecting early mortality in the South American fur seal Arctocephalus australis in Peru density related effects and predation. Journal of Zoology (London), 226(2): 259-270.
  • Harcourt, R. 1993. Individual variation in predation on fur seals by southern sea lions (Otaria byronia) in Peru. Canadian Journal of Zoology, 71(9): 1908-1911.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

Their predators include pumas, sharks, and killer whales.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Otaria byronia preys on:
Arctocephalus australis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

The average lifespan of Southern American sea lions is 16 to 20 years. One captive sea lion, at the Valley Zoo, in Edmonton, Canada, is 30 years old (in 2008).

Range lifespan

Status: captivity:
30 (high) years.

Typical lifespan

Status: wild:
16 to 20 years.

Average lifespan

Status: captivity:
24.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29 years (captivity) Observations: The total gestation time probably includes a period of delayed implantation (Ronald Nowak 2003). One animal lived 29 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Otaria flavescens is known for its polygynous lifestyle. Mating season occurs from early August to December, when males defend territories aggressively and show interest in females. Mating behavior includes mutual vocalizations, snout and mouth contact, smelling, and playful biting. Territories for breeding grounds are usually on beaches of sand, pebbles, or flat rock. Males prevent females from leaving the beaches until they have mated.

Mating System: polygynous

Birth occurs from mid-December to early February in the year after mating, with the bulk of births during mid-January. The gestation period is about 11.75 months. There is typically one pup per birth, which averages .80 to .85 meters in length and 10 to 15 kilograms in weight. Male pups tend to be larger than females. However, since mothers seem to not show any gender-based nursing difference, the gender bias in parental investment occurs only during gestation. The heightened maternal investment in male offspring is important for their reproductive success, as size is important to males in establishing their mating territories.

Mothers fast for 5 to 7 days after giving birth in order to nurse their pup. Soon after giving birth mothers enter oestrus and mate again with the male in whose territory they have given birth. After mating, the mother leaves her pup behind to find food in the sea.

Since individuals mate and breed synchronously with hundreds of other sea lions, pups are protected from both predators and abduction when the mother is away, as they are not left "alone" on the beach. The simultaneous birthing system also promotes group bonding among pups.

There are some negative consequences to mass birthing also. It triggers the mother's aggression level toward other female sea lions in defense for her pup. Mothers return from their feeding trips in intervals to nurse their young. A female is able to locate her pup by first calling to it and finally identifying it by smell.

Sometimes a mother is separated from her pup and is not successful in finding it. This occurs as a result of several factors such as high tide, storms, male abductions, and inexperience of a young mother.

Pup mortality can range from 2 to 50%, depending on the size of the population. Larger populations experience higher pup mortality because of the greater risk of pups being trampled to death by adult sea lions. Pup mortality can be due to predators (such as pumas), diseases, parasites, drowning, subadult males, and starvation (when they lose their mothers).

Pups spend most of their time in groups or pods playing, sleeping, or residing near the water. They rarely swim into the deeper waters unless accompanied by their mothers. They typically first enter the water at about 3 to 4 weeks of age with other sea lions in a large group. They continue to nurse for about 6 to 12 months, until the mother gives birth to another pup. Even then, mothers have been known to nurse both pups simultaneously.

Male pups mature later than female pups. Male pups reach maturity at 6 years of age, whereas females mature at 4 years of age. Both sexes reach their full adult size around 8 years of age.

During development, mothers must be aware of group raids by invading males, who abduct their pups. These raids can take place at any time of the day or night but are correlated with the number of females in oestrus, their location, and the tide level. Raiding and abudction of pups may be timed to occur early during the female's oestrus, in order to attract mothers away from their terrritory for mating purposes. These raids may also signify strength and power. Some pups are killed by the males during raids. Mothers do not usually leave grounds and try to retrieve a pup if it is abducted. The mother is helpless in fighting the male because of his much larger size. Some researchers have suggested that males abduct pups to gain practice in controlling females during the mating season.

Breeding interval: These animals breed annually.

Breeding season: Mating occurs from August through February, at the time when pups are born and females return to estrus.

Average number of offspring: 1.

Range weaning age: 12 (high) months.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 6 (high) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 12500 g.

Average gestation period: 357 days.

Average number of offspring: 1.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Nowak, R. 1999. Walker's Mammals Of The World. Baltimore: Johns Hopkins University Press.
  • Grzimek, B. 1990. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill Publishing Company.
  • MacDonald, D. 1985. The Encyclopedia of Mammals. New York: Facts on File Publications.
  • Campagna, C., C. Bisioli, F. Quintana, F. Perez, A. Vila. 1992. Group breeding in sea lions: pups survive better in colonies. Animal Behaviour, 43: 541-548.
  • Campagna, C., B. Le Boeuf. 1988. Thermoregulatory behavior of southern sea lions and its effects on mating strategies. Behaviour, 107(1-2): 72-90.
  • Campagna, C., B. Le Boeuf, H. Cappozzo. 1988. Pup abduction and infanticide in southern sea lions. Behaviour, 107(1-2): 44-60.
  • Campagna, C., B. Le Boeuf, H. Capposso. 1988. Group raids: a mating strategy of male southern sea lions. Behaviour, 105(3-4): 224-249.
  • Campagna, C., B. Le Boeuf. 1988. Reproductive behavior of southern sea lions. Behaviour, 104(3-4): 233-261.
  • Cappozzo, H., C. Campagna, J. Monserrat. 1991. Sexual dimorphism in newborn southern sea lions. Marine Mammal Science, 7(4): 385-394.
  • Ridgway, S., R. Harrison. 1981. Handbook of Marine Mammals, vol. 1. London: Academic Press.
  • Vila, B., M. Cassini. 1990. Aggressiveness between females and mother-pup seapration in the southern sea lion in Chubut Argentina. Revista Chilena de Historia Natural, 63(2): 169-176.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Otaria byronia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATCGATGATTATTCTCTACAAACCATAAAGATATTGGCACCCTCTATCTACTGTTTGGTGCATGAGCCGGAATGGCTGGCACCGCCCTCAGCCTATTAATCCGTGCGGAATTAGGGCAACCAGGCACCTTACTAGGAGAT---GATCAAATCTATAACGTAATTGTCACCGCCCACGCATTCGTAATAATCTTTTTCATGGTAATACCTATTATAATTGGAGGCTTTGGAAATTGATTGGTGCCCCTAATAATTGGAGCTCCCGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTCTACCCCCCTCCTTCCTACTATTATTAGCCTCTTCTCTAGTTGAAGCCGGCGCAGGTACCGGATGAACGGTTTACCCTCCCCTAGCAGGAAACCTAGCCCATGCAGGAGCTTCCGTAGACTTGACCATTTTCTCCCTTCACCTAGCGGGGGTATCATCTATTCTGGGGGCCATTAACTTTATTACTACCATTATCAACATGAAACCCCCTGCTATGTCCCAATACCAAACTCCTTTGTTCGTGTGATCCGTGCTAATCACAGCCGTACTACTTCTGTTATCCCTACCAGTCCTAGCAGCTGGTATCACTATATTACTTACGGACCGAAATCTAAATACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACATCCAGAAGTATACATTCTCATCTTACCAGGATTTGGGATAATCTCACACATTGTCACCTATTACTCAGGAAAAAAGGAACCCTTTGGTTATATAGGAATAGTTTGAGCAATAATATCTATCGGCTTCTTAGGCTTTATCGTATGAGCGCATCATATATTTACCGTAGGGATAGATGTTGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Otaria byronia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Campagna, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Population numbers are high for most of the distribution range and trends are positive for some of the most important local populations. Thus, globally the South American Sea Lion should remain classified as Least Concern. However, it should be noted that the sea lions in Peru are apparently recovering from a strong El Niño event of 97/98 and the Chilean population is in decline.

IUCN Evaluation of the South American Sea Lion, Otaria flavescens
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

No integrated counts are available. Generation time is roughly estimated to be 7 years. Populations are declining in Chile and increasing in the Argentine northern Patagonian coast. The population in Peru is fluctuating strongly due to El Niño, with counts that oscillate almost on an annual basis. Pup production is negligible in Uruguay and the Falklands/Malvinas, where significant population reductions have been reported in the Islands, compared to data for the 1930s. The causes of the population declines have not ceased (e.g., El Niño in Peru) but the degree of the declines are apparently lower than required for classification as Vulnerable by IUCN.


A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction almost certainly happened in the past due to hunting, but this has been discontinued. In Chile hunting was permitted until recently. There is currently a 5-year suspension, but harvesting may be resumed after this time.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction is not suspected at the species level, but there is no data on the potential effect of climate warming.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction has been observed locally and inferred globally in the past, but not recently.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
The EOO is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The number of mature individuals is > 10,000.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii)
% individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
Does not apply.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction.

Listing recommendationCurrently, this species should be classified as Least Concern. But, it should be noted that declines in some populations in the Pacific linked to causes that may be aggravated in the future, suggest that the species may soon qualify for a classification of NT.

History
  • 1996
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South American sea lions are not presently threatened. They experienced a large population decline during the past 70 years in the Falkland Islands. The reason for this abrupt decline is unknown.

Though they are not currently threatened, they are protected throughout most of their range.

The IUCN rates the species at "Lower Risk."

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total global population is estimated to be over 250,000. In the Atlantic: about 12,000 in Uruguay (1,200 pups per year), no less than 100,000 in continental Argentina, 6,000 in the Falklands-Malvinas. In the Pacific: 90,000-100,000 in Chile, 60,000 in Peru.

Trends are increasing in northern Argentine Patagonia at 5.7% (Dans et al. 2004) and decreasing in Uruguay (4%; Paez 2005) and Chile (16%). Estimates for southern Patagonia (Santa Cruz and Tierra del Fuego Provinces) show a decrease to only 14.5% of the population size reported in the late 1940s. Sealing activities, performed mainly at northern Patagonia and at Tierra del Fuego, are likely responsible for the depletion (Schiavini et al. 2004). Present population in the Falklands-Malvinas represents about 10% of historical numbers at this locale.

The Peruvian population was decimated by the 97/98 El Niño, from ca. 144 000 animals in 1997 to 28 000 during 97/98 (Arias-Schreiber and Rivas 1998, Arias-Schreiber 1998). The population in 2004 was 60 000, a decrease of 25% from the 2003 numbers. Pup production in Peru declined 48% from 2003 to 2004. This population is apparently recovering. However, the stronger and more frequent El Niños that appear to be occurring along the Peruvian coast may put the vulnerable South American Sea Lion population in Peru at greater risk (Soto et al. 2004).

Genetic studies suggest one population of South American Sea Lions extends through Uruguay, continental Argentina and the Falklands/Malvinas Islands (Szapkievich et al.1999, Freilich 2004).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
South American Sea Lions were hunted by native people of South America for thousands of years and have been taken by Europeans as early as the 16th century for food, oil and hides (Rodriguez and Bastida 1998). During the second half of the 19th century coastal zones were rapidly colonized by man and by the turn of the century, sea lion rookeries disappeared from part of their range. Dramatic declines were not only due to spatial competition with man, but also to the indirect effect of pinniped over-exploitation in other areas of the south-western Atlantic. Significant commercial harvests occurred in several countries and sea lion numbers were drastically reduced in the last several hundred years.

The species interacts regularly with fisheries that use a variety of fishing gear and target coastal and pelagic species (Corcuera et al. 1994, Crespo et al. 1994, Sepulveda et al. 2007). During the 1990s, mortality in the fisheries of the Patagonian shelf varied from 150-600 sea lions per year (Crespo et al. 1997, Dans et al. 2003). There is competition with some fisheries (Koen Alonso et al. 2000) and in the case of the Argentine Hake, Merluccius hubbsi, and Argentine Squid, Illex argentinus, interactions may be detrimental at a high level of harvest of the target populations (Koen Alonso y Yodzis 2005).

A longstanding competition for fish has existed in Chile between the South American sea lion and small-scale fisheries. Sea lions, according to fishermen, prey on fish caught in their fishing gear, often causing damage. However, a study of the operational interactions suggests that sea lions do not produce a significant effect on variations in the CPUE obtained by artisanal fishermen (Sepulveda et al. 2007). Sea lions were taken in Chile decades ago for use as bait in crab fisheries. The species is poached in fishing farming operations. Interactions between sea lions and salmon farms in southern Chile are common. No relation was demonstrated between the intensity of attacks and the distance to the nearest colony. Anti-predator nets result in permanent reductions in sea lion attacks (Sepulveda and Oliva 2005).

Intensive trawl fishing for several species in the coastal waters of the southwestern South Atlantic has been implicated in a severe decline of sea lions in the Falkland-Malvinas Islands, where the population has fallen from 30,000 in the 1960s to approximately 15,000 in the 1980s, and possibly to as low as 3,000 in the 1990s.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
South American Sea Lions are protected and managed by laws in most of the countries where they occur. Sea lions have also been afforded protection by the establishment of numerous reserves and protected areas at rookeries and haul out sites, especially in Argentina. However, enforcement of protection regulations is weak in most of the distribution range, particularly in the most isolated areas and at sea. In Chile the species is subject to exploitation. Since 2004 and for five years there has been a moratorium that could be lifted if the interaction with fisheries is shown to be detrimental to the fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

South American sea lions will steal fish from human fishing grounds by following fishing boats and stealing fish from the nets.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Until recently Otaria flavescens was hunted for its fur, meat, and oil.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

South American sea lion

Otaria redirects here. For the continent in Magic: The Gathering, see Otaria.

The South American sea lion (Otaria flavescens, formerly Otaria byronia), also called the southern sea lion and the Patagonian sea lion, is a sea lion found on the Chilean, Peruvian, Uruguayan, Argentine and Southern Brazilian coasts. It is the only member of the genus Otaria. Its scientific name was subject to controversy, with some taxonomists referring to it as Otaria flavescens and others referring to it as Otaria byronia. The former eventually won out,[2] although that may still be overturned.[3] Locally, it is known by several names, most commonly lobo marino (sea wolf) and león marino (sea lion).

Contents

Physical description [edit]

Skeleton of South American sea lion

The South American sea lion is perhaps the archetypal sea lion in appearance. Males have a very large head with a well-developed mane, making them the most lionesque of the eared seals. They are twice the weight of females.[4] Both males and females are orange or brown coloured with upturned snouts. Pups are born greyish orange ventrally and black dorsally and moult into a more chocolate colour.

The South American sea lion's size and weight can vary considerably. Adult males can grow over 2.73 m (9 ft) and weigh up to 350 kg (770 lb).[5] Adult females grow up to 1.8–2 m (6–7 ft) and weigh about half the weight of the males, around 150 kg (330 lb). This species is even more sexually dimorphic than the other sea lions.[6]

Ecology [edit]

Sea lions at Beagle Channel

As its name is the southern, the South American sea lion is found along the coasts and offshore islands of South America. It ranges from Peru south to Chile in the Pacific and then north to southern Brazil in the Atlantic.[7] It travels north during the winter and spring and goes south to breed.[7] Notable breeding colonies include Lobos Island, Uruguay; Peninsula Valdes, Argentina; Beagle Channel and the Falkland Islands. Some individuals wander as far north as southern Ecuador, although apparently they never bred there.

South American sea lions prefer to breed on beaches made of sand, but will breed on gravel, rocky or pebble beaches, as well.[7] They can also be seen on flat rocky cliffs with tidepools.[7] Sea lion colonies tend to be small and scattered, especially on rocky beaches.[7] The colonies make spaces between each individual when it is warm and sunny.[7] They can also be found in marinas and wharves but do not breed there.

South American sea lions consume numerous species of fish, including Argentine hake and anchovies.[7] They also eat cephalopods, such as shortfin squid, Patagonian squid and octopus.[7] They have even been observed preying on penguins, pelicans and young South American fur seals. South American sea lions may forage at the ocean floor for slow moving prey or hunt schooling prey in groups, depending on the area. When captured, the prey is shaken violently and torn apart. South American sea lions have been recorded to take advantage of the hunting efforts of dusky dolphins, feeding on the fish they herd together.[8] The sea lions themselves are preyed on by orcas and sharks, and visited as a handy source of blood by Common Vampire Bats from Isla Pan de Azúcar.[9]

Social behavior and reproduction [edit]

Sea lion colony in Patagonia.

Mating occurs between August and December, and the pups are born between December and February. Males arrive first to establish and defend territories, but then switch to defending females when they arrive.[6] A male will aggressively herd females in its territory and defend both from neighbors and intruders.[6] On rocky beaches, males establish territories were females go to cool off and keep them until estrous.[7] On cobble or sandy beaches, males have territories near the surf and monopolize females trying to get access to the sea.[7] The number of actual fights between males depends on the number of females in heat.[6] The earlier a male arrives at the site the longer his tenure will be and the more copulations he will achieve.[6] Males are usually able to keep around three females in their harem, but some have as many as 18.[6]

Male with harem
Female sea lion and pup

During the breeding season, males that fail to secure territories and harems, most often sub-adults, will cause group raids in an attempt to change the status-quo and gain access to the females.[10] Group raids are more common on sandy beaches than rocky ones.[10] These raids cause chaos in the breeding harems, often splitting mothers from their young. The resident males will try to fight off the raiders and keep all the females in their territorial boundaries. Raiders are often unsuccessful in securing a female, however some are able to capture some females or even stay in the breeding area with one or more females.[10] Sometimes an invading male will abduct pups, possibly as an attempt to control the females.[10] They also take pups as substitutes for mature females.[11] Sub-adults will herd their captured pups and prevent them from escaping, much like what adult males do to females.[11] A pup may be mounted by its abductor but intromission does not occur.[11] While abducting pups does not give males immediate reproductive benefits, these males may gain experience in controlling females.[11] Pups are sometimes severely injured or killed during abductions.[10][11]

Sea lion mothers remain with their newborn pups for nearly a week before making routine of taking three day foraging trips and coming back to nurse the pups.[6][7] They will act aggressively to other females who come close to their pups, as well as alien pups who try to get milk from them.[12] Pups first enter the water at about four weeks and are weaned at about 12 months. This is normally when the mother gives birth to a new pup. Pups gradually spent more time in the nearshore surf and develop swimming skills.[7]

South American sea lions are observed to make various vocalizations and calls which differ between sexes and ages.[13] Adult males will make high-pitched calls during aggressive interactions,[13] barks when establishing territories,[13] growls when interacting with females,[13] and exhalations which are made after agonistic encounters.[13] Females who have pups make what is called a mother primary call when interacting with their pups,[13] and grunts during aggressive encounters with other females.[13] Pups make what are called pup primary calls.[13] Some of those vocalizations and acoustic features may support individuality.[13]

Human interactions [edit]

Urban sea lion colony in the city of Valdivia, Chile.
Sea lion, symbol of Mar del Plata
Sea lion skins

The Moche people of ancient Peru worshipped the sea and its animals. They often depicted South American sea lions in their art.[14] Two statues of this species are the symbol of the city of Mar del Plata.

Indigenous peoples of South America exploited this species for millennia and by Europeans around the 16th century.[15] The hunting has since gone down and the species is no longer threatened. The species is protected in most of its range.[1] Numerous reserves and protected areas at rookeries and haul-out sites exists for the sea lions.[1] Despite this, protection regulations are not effectively enforced in much of animal's range.[1]

The population estimate is 265,000 animals. They are increasing in Argentine Patagonia, but are declining in Chile and Uruguay.[1] Many sea lions of the Peruvian population died in the 1997/1998 el Niño.[1] They still are killed due to the sea lions' habits of stealing fish and damaging fishing nets.[1] Sea lions in the port of Mar del Plata have been found with toxic chemicals and heavy metals in their systems.[16] The overall population of sea lions is considered stable.

See also [edit]

References [edit]

  1. ^ a b c d e f g Campagna, C. (2008). Otaria flavescens. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 30 January 2009.
  2. ^ Rodriguez, D., R. Bastida. 1993. The southern sea lion, Otaria byronia or Otaria flavescens?. Marine Mammal Science, 9(4): 372-381.
  3. ^ Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
  4. ^ Kindersley, Dorling (2001,2005). Animal. DK Publishing. ISBN 0-7894-7764-5.  Unknown parameter |loca tion= ignored (help)
  5. ^ http://www.theanimalfiles.com/mammals/seals_sea_lions/south_american_sea_lion.html
  6. ^ a b c d e f g Campagna, C., B. Le Boeuf. 1988. "Reproductive behavior of southern sea lions". Behaviour, 104(3-4): 233-261.
  7. ^ a b c d e f g h i j k l Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
  8. ^ Würsig, B. and Würsig, M. 1980. "Behavior and ecology of the dusky dolphin, Lagenorhynchus obscurus, in the South Atlantic". Fishery Bulletin 77: 871-890.
  9. ^ http://www.telegraph.co.uk/culture/9426359/The-Dark-Natures-Night-time-World-BBC-Two-9.00pm-preview.html
  10. ^ a b c d e Campagna, C., B. Le Boeuf, H. Capposso. 1988. "Group raids: a mating strategy of male southern sea lions". Behaviour, 105(3-4): 224-249.
  11. ^ a b c d e Campagna, C., B. Le Boeuf, H. Cappozzo. 1988. "Pup abduction and infanticide in southern sea lions". Behaviour, 107(1-2): 44-60.
  12. ^ Esteban Fernández-Juricic and Marcelo H. Cassini. "Intra-sexual female agonistic behaviour of the South American sea lion (Otaria flavescens) in two colonies with different breeding substrates". Acta ethologica, Volume 10, Number 1, 23-28, doi:10.1007/s10211-006-0024-4. (2007)
  13. ^ a b c d e f g h i Esteban Fernández-Juricic, Claudio Campagna, Víctor Enriquez and Charles Leo Ortiz "Vocal Communication and Individual Variation in Breeding South American Sea Lions". Behaviour, Vol. 136, No. 4 (May, 1999), pp. 495-517
  14. ^ Berrin, Katherine & Larco Museum. The Spirit of Ancient Peru:Treasures from the Museo Arqueológico Rafael Larco Herrera. New York: Thames and Hudson, 1997.
  15. ^ Rodriguez, D. and Bastida, R. 1998. "Four hundred years in the history of pinniped colonies around Mar del Plata, Argentina". Aquatic Conservation of Marine and Freshwater Ecosystems 8: 721-735.
  16. ^ Sepulveda, M., M. Alvarado-Rybak, C. Verdugo, E. Quiroz, C. Valencia, C. Munoz-Zanzi, R. Tamayo. Pathogens and heavy metals in Southern sea lions (Otaria flavescens) in Valdivia city, Chile. Arch Med Vet. In review.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!