Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Otaria flavescens inhabits South American coastlines from Rio de Janeiro (23 degrees south latitude) on the Atlantic ocean side and coastal Perú (5 degrees south latitude) on the Pacific coast to southernmost South America. There are records of Otaria flavescens inhabiting the Galapagos and Falkland Islands.

Biogeographic Regions: neotropical (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Arias-Schreiber, M., C. Rivas. 1998. Distribución, tamaño y estructura de loa poblaciones de lobos marinos (Arctocephalus australis y Otaria byronia) en el litoral peruano, en noviembre 1996 y marzo de 1997. Inf. Progr. Inst. Mar Perú, 73: 17-32.
  • Grzimek, B. 1990. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill Publishing Company.
  • MacDonald, D. 1985. The Encyclopedia of Mammals. New York: Facts on File Publications.
  • Nowak, R. 1999. Walker's Mammals Of The World. Baltimore: Johns Hopkins University Press.
  • Ridgway, S., R. Harrison. 1981. Handbook of Marine Mammals, vol. 1. London: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

widely distributed from northern Peru to southern Brazil
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

South American sea lions (Otaria flavescens), also known as maned seals, are the most sexually dimorphic of the five known sea lion species. Males are approximately three times the size of females.

Adult males range from 2 to 2.5 meters in height and can weigh from 200 to 350 kilograms. The coat is dark brown on the dorsal side and dark yellow to gold on the ventral side. Males have a full mane, which is a paler color than the coat and a larger, more muscled neck than do females. A male's posture is usually upright, with the rostrum turned upward.

Adult females are much smaller in size and weight. They average 2 meters in height and can weigh from 140 to 150 kilograms, roughly half the average weight of an adult male. Their coats are also lighter in color relative to males. Coat color ranges from a fair brown to yellow with some pale markings around the head.

Pups do not exhibit this brown color until about a month after they are born. Neonates are greyish orange ventrally and black dorsally. This coat later turns to a dark chocolate brown color. Sexual dimorphism is shown in pups as well as in adults. According to a study in Peninsula Valdes, Argentina (Capposso et. al 1991), male pups averaged .82 meters in length and 13.7 kilograms in weight. In contrast, female pups averaged .79 meters in length and 12.3 kilograms in weight

Range mass: 140 to 350 kg.

Range length: 2 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Cappozzo, H., C. Campagna, J. Monserrat. 1991. Sexual dimorphism in newborn southern sea lions. Marine Mammal Science, 7(4): 385-394.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

South American sea lions reside along shorelines and beaches. These beaches usually consist of sand, gravel, rocks, and/or pebbles. They also inhabit flat rocky shelves or cliffs with tidepools and boulders.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Aquatic Biomes: coastal

Other Habitat Features: intertidal or littoral

  • Campagna, C., B. Le Boeuf, H. Capposso. 1988. Group raids: a mating strategy of male southern sea lions. Behaviour, 105(3-4): 224-249.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

South American sea lions are carnivorous. They feed on fish, cephalopods, crustaceans, and other invertebrates depending on local abundance. These sea lions are typically found hunting in shallower waters, not more than five miles from shore. When looking for prey that travel in schools they hunt in groups. When they catch fish, they usually shake the prey in the air and then sometimes eat it whole. In addition, they have been observed eating penguins and female South American fur seals (Arctocephalus australis) and their pups.

Animal Foods: birds; mammals; fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

  • Harcourt, R. 1992. Factors affecting early mortality in the South American fur seal Arctocephalus australis in Peru density related effects and predation. Journal of Zoology (London), 226(2): 259-270.
  • Harcourt, R. 1993. Individual variation in predation on fur seals by southern sea lions (Otaria byronia) in Peru. Canadian Journal of Zoology, 71(9): 1908-1911.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Their predators include pumas, sharks, and killer whales.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Otaria byronia preys on:
Arctocephalus australis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The average lifespan of Southern American sea lions is 16 to 20 years. One captive sea lion, at the Valley Zoo, in Edmonton, Canada, is 30 years old (in 2008).

Range lifespan

Status: captivity:
30 (high) years.

Typical lifespan

Status: wild:
16 to 20 years.

Average lifespan

Status: captivity:
24.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29 years (captivity) Observations: The total gestation time probably includes a period of delayed implantation (Ronald Nowak 2003). One animal lived 29 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Otaria flavescens is known for its polygynous lifestyle. Mating season occurs from early August to December, when males defend territories aggressively and show interest in females. Mating behavior includes mutual vocalizations, snout and mouth contact, smelling, and playful biting. Territories for breeding grounds are usually on beaches of sand, pebbles, or flat rock. Males prevent females from leaving the beaches until they have mated.

Mating System: polygynous

Birth occurs from mid-December to early February in the year after mating, with the bulk of births during mid-January. The gestation period is about 11.75 months. There is typically one pup per birth, which averages .80 to .85 meters in length and 10 to 15 kilograms in weight. Male pups tend to be larger than females. However, since mothers seem to not show any gender-based nursing difference, the gender bias in parental investment occurs only during gestation. The heightened maternal investment in male offspring is important for their reproductive success, as size is important to males in establishing their mating territories.

Mothers fast for 5 to 7 days after giving birth in order to nurse their pup. Soon after giving birth mothers enter oestrus and mate again with the male in whose territory they have given birth. After mating, the mother leaves her pup behind to find food in the sea.

Since individuals mate and breed synchronously with hundreds of other sea lions, pups are protected from both predators and abduction when the mother is away, as they are not left "alone" on the beach. The simultaneous birthing system also promotes group bonding among pups.

There are some negative consequences to mass birthing also. It triggers the mother's aggression level toward other female sea lions in defense for her pup. Mothers return from their feeding trips in intervals to nurse their young. A female is able to locate her pup by first calling to it and finally identifying it by smell.

Sometimes a mother is separated from her pup and is not successful in finding it. This occurs as a result of several factors such as high tide, storms, male abductions, and inexperience of a young mother.

Pup mortality can range from 2 to 50%, depending on the size of the population. Larger populations experience higher pup mortality because of the greater risk of pups being trampled to death by adult sea lions. Pup mortality can be due to predators (such as pumas), diseases, parasites, drowning, subadult males, and starvation (when they lose their mothers).

Pups spend most of their time in groups or pods playing, sleeping, or residing near the water. They rarely swim into the deeper waters unless accompanied by their mothers. They typically first enter the water at about 3 to 4 weeks of age with other sea lions in a large group. They continue to nurse for about 6 to 12 months, until the mother gives birth to another pup. Even then, mothers have been known to nurse both pups simultaneously.

Male pups mature later than female pups. Male pups reach maturity at 6 years of age, whereas females mature at 4 years of age. Both sexes reach their full adult size around 8 years of age.

During development, mothers must be aware of group raids by invading males, who abduct their pups. These raids can take place at any time of the day or night but are correlated with the number of females in oestrus, their location, and the tide level. Raiding and abudction of pups may be timed to occur early during the female's oestrus, in order to attract mothers away from their terrritory for mating purposes. These raids may also signify strength and power. Some pups are killed by the males during raids. Mothers do not usually leave grounds and try to retrieve a pup if it is abducted. The mother is helpless in fighting the male because of his much larger size. Some researchers have suggested that males abduct pups to gain practice in controlling females during the mating season.

Breeding interval: These animals breed annually.

Breeding season: Mating occurs from August through February, at the time when pups are born and females return to estrus.

Average number of offspring: 1.

Range weaning age: 12 (high) months.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 6 (high) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Average birth mass: 12500 g.

Average gestation period: 357 days.

Average number of offspring: 1.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Campagna, C., B. Le Boeuf, H. Capposso. 1988. Group raids: a mating strategy of male southern sea lions. Behaviour, 105(3-4): 224-249.
  • Campagna, C., B. Le Boeuf, H. Cappozzo. 1988. Pup abduction and infanticide in southern sea lions. Behaviour, 107(1-2): 44-60.
  • Campagna, C., B. Le Boeuf. 1988. Reproductive behavior of southern sea lions. Behaviour, 104(3-4): 233-261.
  • Campagna, C., B. Le Boeuf. 1988. Thermoregulatory behavior of southern sea lions and its effects on mating strategies. Behaviour, 107(1-2): 72-90.
  • Campagna, C., C. Bisioli, F. Quintana, F. Perez, A. Vila. 1992. Group breeding in sea lions: pups survive better in colonies. Animal Behaviour, 43: 541-548.
  • Cappozzo, H., C. Campagna, J. Monserrat. 1991. Sexual dimorphism in newborn southern sea lions. Marine Mammal Science, 7(4): 385-394.
  • Grzimek, B. 1990. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill Publishing Company.
  • MacDonald, D. 1985. The Encyclopedia of Mammals. New York: Facts on File Publications.
  • Nowak, R. 1999. Walker's Mammals Of The World. Baltimore: Johns Hopkins University Press.
  • Ridgway, S., R. Harrison. 1981. Handbook of Marine Mammals, vol. 1. London: Academic Press.
  • Vila, B., M. Cassini. 1990. Aggressiveness between females and mother-pup seapration in the southern sea lion in Chubut Argentina. Revista Chilena de Historia Natural, 63(2): 169-176.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Otaria byronia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AATCGATGATTATTCTCTACAAACCATAAAGATATTGGCACCCTCTATCTACTGTTTGGTGCATGAGCCGGAATGGCTGGCACCGCCCTCAGCCTATTAATCCGTGCGGAATTAGGGCAACCAGGCACCTTACTAGGAGAT---GATCAAATCTATAACGTAATTGTCACCGCCCACGCATTCGTAATAATCTTTTTCATGGTAATACCTATTATAATTGGAGGCTTTGGAAATTGATTGGTGCCCCTAATAATTGGAGCTCCCGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTCTACCCCCCTCCTTCCTACTATTATTAGCCTCTTCTCTAGTTGAAGCCGGCGCAGGTACCGGATGAACGGTTTACCCTCCCCTAGCAGGAAACCTAGCCCATGCAGGAGCTTCCGTAGACTTGACCATTTTCTCCCTTCACCTAGCGGGGGTATCATCTATTCTGGGGGCCATTAACTTTATTACTACCATTATCAACATGAAACCCCCTGCTATGTCCCAATACCAAACTCCTTTGTTCGTGTGATCCGTGCTAATCACAGCCGTACTACTTCTGTTATCCCTACCAGTCCTAGCAGCTGGTATCACTATATTACTTACGGACCGAAATCTAAATACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACATCCAGAAGTATACATTCTCATCTTACCAGGATTTGGGATAATCTCACACATTGTCACCTATTACTCAGGAAAAAAGGAACCCTTTGGTTATATAGGAATAGTTTGAGCAATAATATCTATCGGCTTCTTAGGCTTTATCGTATGAGCGCATCATATATTTACCGTAGGGATAGATGTTGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Otaria byronia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

South American sea lions are not presently threatened. They experienced a large population decline during the past 70 years in the Falkland Islands. The reason for this abrupt decline is unknown.

Though they are not currently threatened, they are protected throughout most of their range.

The IUCN rates the species at "Lower Risk."

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

South American sea lions will steal fish from human fishing grounds by following fishing boats and stealing fish from the nets.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Until recently Otaria flavescens was hunted for its fur, meat, and oil.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

South American sea lion

"Otaria" redirects here. For the fictional continent, see Magic: The Gathering storylines.

The South American sea lion (Otaria flavescens, formerly Otaria byronia), also called the southern sea lion and the Patagonian sea lion, is a sea lion found on the Chilean, Ecuador, Peruvian, Uruguayan, Argentine and Southern Brazilian coasts. It is the only member of the genus Otaria. Its scientific name was subject to controversy, with some taxonomists referring to it as Otaria flavescens and others referring to it as Otaria byronia. The former eventually won out,[2] although that may still be overturned.[3] Locally, it is known by several names, most commonly lobo marino (sea wolf) and león marino (sea lion).

Physical description[edit]

Skeleton of a male South American sea lion

The South American sea lion is perhaps the archetypal sea lion in appearance. Males have a very large head with a well-developed mane, making them the most lionesque of the eared seals. They are twice the weight of females.[4] Both males and females are orange or brown coloured with upturned snouts. Pups are born greyish orange ventrally and black dorsally and moult into a more chocolate colour.

The South American sea lion's size and weight can vary considerably. Adult males can grow over 2.73 m (9 ft) and weigh up to 350 kg (770 lb).[5] Adult females grow up to 1.8–2 m (6–7 ft) and weigh about half the weight of the males, around 150 kg (330 lb). This species is even more sexually dimorphic than the other sea lions.[6]

Ecology[edit]

Sea lions at Beagle Channel

The South American sea lion is found along the coasts and offshore islands of South America, from Peru south to Chile in the Pacific and then north to southern Brazil in the Atlantic.[7] It travels north during the winter and spring and goes south to breed.[7] Notable breeding colonies include Lobos Island, Uruguay; Peninsula Valdes, Argentina; Beagle Channel, and the Falkland Islands. Some individuals wander as far north as southern Ecuador, although apparently they never bred there.

South American sea lions prefer to breed on beaches made of sand, but will breed on gravel, rocky, or pebble beaches, as well.[7] They can also be seen on flat, rocky cliffs with tidepools.[7] Sea lion colonies tend to be small and scattered, especially on rocky beaches.[7] The colonies make spaces between each individual when the weather is warm and sunny.[7] They can also be found in marinas and wharves, but do not breed there.

South American sea lions consume numerous species of fishes, including Argentine hake and anchovies.[7] They also eat cephalopods, such as shortfin squid, Patagonian squid, and octopus.[7] They have even been observed preying on penguins, pelicans, and young South American fur seals.[8] South American sea lions may forage at the ocean floor for slow-moving prey or hunt schooling prey in groups, depending on the area. When captured, the prey is shaken violently and torn apart. South American sea lions have been recorded to take advantage of the hunting efforts of dusky dolphins, feeding on the fish they herd together.[9] The sea lions themselves are preyed on by killer whales and sharks, and visited as a handy source of blood by common vampire bats from Isla Pan de Azúcar.[10]

Social behavior and reproduction[edit]

Sea lion colony in Patagonia

Mating occurs between August and December, and the pups are born between December and February. Males arrive first to establish and defend territories, but then switch to defending females when they arrive.[6] A male aggressively herds females in his territory and defends both from neighbors and intruders.[6] On rocky beaches, males establish territories where females go to cool off and keep them until estrus.[7] On cobble or sandy beaches, males have territories near the surf and monopolize females trying to get access to the sea.[7] The number of actual fights between males depends on the number of females in heat.[6] The earlier a male arrives at the site, the longer his tenure will be and the more copulations he will achieve.[6] Males are usually able to keep around three females in their harems, but some have as many as 18.[6]

Male with harem
Female sea lion and pup

During the breeding season, males that fail to secure territories and harems, most often subadults, will cause group raids in an attempt to change the status quo and gain access to the females.[11] Group raids are more common on sandy beaches than rocky ones.[11] These raids cause chaos in the breeding harems, often splitting mothers from their young. The resident males try to fight off the raiders and keep all the females in their territorial boundaries. Raiders are often unsuccessful in securing a female, but some are able to capture some females or even stay in the breeding area with one or more females.[11] Sometimes, an invading male abducts pups, possibly as an attempt to control the females.[11] They also take pups as substitutes for mature females.[12] Subadults herd their captured pups and prevent them from escaping, much like adult males do to females.[12] A pup may be mounted by its abductor, but intromission does not occur.[12] While abducting pups does not give males immediate reproductive benefits, these males may gain experience in controlling females.[12] Pups are sometimes severely injured or killed during abductions.[11][12]

Sea lion mothers remain with their newborn pups for nearly a week before making a routine of taking three-day foraging trips and coming back to nurse the pups.[6][7] They act aggressively to other females that come close to their pups, as well as alien pups that try to get milk from them.[13] Pups first enter the water at about four weeks and are weaned at about 12 months. This is normally when the mother gives birth to a new pup. Pups gradually spend more time in the nearshore surf and develop swimming skills.[7]

South American sea lions are observed to make various vocalizations and calls which differ between sexes and ages.[14] Adult males make high-pitched calls during aggressive interactions,[14] barks when establishing territories,[14] growls when interacting with females,[14] and exhalations after antagonistic encounters.[14] Females with pups make a mother primary call when interacting with their pups,[14] and grunts during aggressive encounters with other females.[14] Pups make pup primary calls.[14] Some of those vocalizations and acoustic features may support individuality.[14]

Human interactions[edit]

Urban sea lion colony in the city of Valdivia, Chile
Sea lion, symbol of Mar del Plata
Sea lion skins

The Moche people of ancient Peru worshipped the sea and its animals. They often depicted South American sea lions in their art.[15] Two statues of this species are the symbol of the city of Mar del Plata.

Indigenous peoples of South America exploited this species for millennia and by Europeans around the 16th century.[16] The hunting has since gone down and the species is no longer threatened. The species is protected in most of its range.[1] Numerous reserves and protected areas at rookeries and haul-out sites exist for the sea lions.[1] Despite this, protection regulations are not effectively enforced in much of animals' range.[1]

The overall population of sea lions is considered stable; the estimate is 265,000 animals. They are increasing in Argentine Patagonia, but are declining in Chile and Uruguay.[1] Many sea lions of the Peruvian population died in the 1997/1998 el Niño.[1] They still are killed due to their habits of stealing fish and damaging fishing nets.[1] Sea lions in the port of Mar del Plata have been found with toxic chemicals and heavy metals in their systems.[17]

See also[edit]

References[edit]

  1. ^ a b c d e f g Campagna, C. (2008). Otaria flavescens. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 30 January 2009.
  2. ^ Rodriguez, D., R. Bastida. 1993. The southern sea lion, Otaria byronia or Otaria flavescens?. Marine Mammal Science, 9(4): 372-381.
  3. ^ Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
  4. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5.  Check date values in: |date= (help)
  5. ^ http://www.theanimalfiles.com/mammals/seals_sea_lions/south_american_sea_lion.html
  6. ^ a b c d e f g Campagna, C., B. Le Boeuf. 1988. "Reproductive behavior of southern sea lions". Behaviour, 104(3-4): 233-261.
  7. ^ a b c d e f g h i j k l Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
  8. ^ Harcourt, R (1993). "Individual variation in predation on fur seals by southern sea lions (Otaria byronia) in Peru". Canadian Journal of Zoology 71: 1908–1911. doi:10.1139/z93-273. 
  9. ^ Würsig, B. and Würsig, M. 1980. "Behavior and ecology of the dusky dolphin, Lagenorhynchus obscurus, in the South Atlantic". Fishery Bulletin 77: 871-890.
  10. ^ http://www.telegraph.co.uk/culture/9426359/The-Dark-Natures-Night-time-World-BBC-Two-9.00pm-preview.html
  11. ^ a b c d e Campagna, C., B. Le Boeuf, H. Capposso. 1988. "Group raids: a mating strategy of male southern sea lions". Behaviour, 105(3-4): 224-249.
  12. ^ a b c d e Campagna, C., B. Le Boeuf, H. Cappozzo. 1988. "Pup abduction and infanticide in southern sea lions". Behaviour, 107(1-2): 44-60.
  13. ^ Esteban Fernández-Juricic and Marcelo H. Cassini. "Intra-sexual female agonistic behaviour of the South American sea lion (Otaria flavescens) in two colonies with different breeding substrates". Acta Ethologica, Volume 10, Number 1, 23-28, doi:10.1007/s10211-006-0024-4. (2007)
  14. ^ a b c d e f g h i Esteban Fernández-Juricic, Claudio Campagna, Víctor Enriquez and Charles Leo Ortiz "Vocal Communication and Individual Variation in Breeding South American Sea Lions". Behaviour, Vol. 136, No. 4 (May, 1999), pp. 495-517
  15. ^ Berrin, Katherine & Larco Museum. The Spirit of Ancient Peru:Treasures from the Museo Arqueológico Rafael Larco Herrera. New York: Thames and Hudson, 1997.
  16. ^ Rodriguez, D. and Bastida, R. 1998. "Four hundred years in the history of pinniped colonies around Mar del Plata, Argentina". Aquatic Conservation of Marine and Freshwater Ecosystems 8: 721-735.
  17. ^ Sepulveda, M., M. Alvarado-Rybak, C. Verdugo, E. Quiroz, C. Valencia, C. Munoz-Zanzi, R. Tamayo. Pathogens and heavy metals in Southern sea lions (Otaria flavescens) in Valdivia city, Chile. Arch Med Vet. In review.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!