Overview

Brief Summary

Biology

Breeding takes place in colonies between November and January (4) (2). Bulls (males) arrive at the breeding beaches in November each year, and start to fight amongst themselves to establish territories. Those that successfully secure and hold a territory are known as 'beach masters' (2) and will have privileged access to a harem of females (5). Throughout the entire breeding season, the beach masters are unable to return to the sea to feed, as this would force them to relinquish their hard-won territory. Instead they rely on their reserves of blubber during this period (5). Pregnant females arrive at the beaches around a month later than males (3). They give birth, usually to a single pup after arriving at the breeding beach, and mate after around a week to ten days (3) (5). Two weeks after giving birth, the mother starts to leave the pup in order to feed at sea, returning to the beach so that the pup can suckle (2) (3). She identifies her own pup by its distinctive calls (5). The pup begins to swim after two or three weeks, but it will suckle for a further eight months or more, and even up to a year (2) (3). Sexual maturity is reached at three to four years in females and five years in males (5). Hooker's sea lion feeds on small fish, squid, octopuses, crabs, mussels and other invertebrates. The occasional penguin may also be taken (3) (4). Whilst feeding, this species makes the deepest and longest dives of any sea lion in the world (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Hooker's sea lion, also known as the New Zealand sea lion, is one of the rarest and most threatened sea lions in the world (2). Adult males are dark blackish-brown in colour and have a distinct light mane that reaches down to their shoulders. Females are grey or buff-coloured, and have a paler belly. Males are much larger than females. Pups are born with a thick covering of dark hair, which is lost at some point after birth (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Subantarctic islands south of New Zealand
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The primary habitat of New Zealand Sea Lions is several sub-Antarctic islands south of New Zealand and their surrounding waters. The principal breeding colony accounting for 86% of annual births is at the Auckland Islands, with a smaller number breeding at Campbell Island (Chilvers et al. 2007). New Zealand Sea Lions regularly occur in small numbers at Stewart Island and on the southeast coast of the South Island of New Zealand, where there are occasional births (Chilvers et al. 2007). However, most of the animals hauling out on the South Island are males ranging in age from 2-11 years old. Wandering New Zealand Sea Lions also reach Macquarie Island. Historically, New Zealand Sea Lions had a more extensive range that appears to have included most of New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

These sea lions inhabit the subantarctic islands of New Zealand, between latitudes 48 and 53 degrees S. Their population distribution is centered on the Auckland Islands.

Biogeographic Regions: oceanic islands (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species has a very restricted range (4) and breeds only on the sub-Antarctic islands of New Zealand (3). Over 95 percent of breeding takes place in just three colonies in the Auckland Islands (2). Outside of the breeding season, these sea lions haul out from the Australian sub-Antarctic Macquarie Island to the south-eastern coast of New Zealand's South Island, with a few sightings of individuals on the North Island (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

New Zealand sea lion pups are born covered with thick, dark hair. It is unknown when they lose this natal coat. Adult males become dark blackish-brown with a well-developed mane reaching to their shoulders. Females have lighter coloration, generally buffy or grey with a lighter ventral side. They may have darker pigmentation around their flippers and muzzle. There is marked sexual dimorphism, also, in size of males and females. Males reach a maximum length of up to 350 cm, while females reach a maximum length of up to 200 cm. Males may weigh as much as 410 kg and females as much as 230 kg.

Dental formula is usually I 3/2, C 1/1, cheekteeth 6/5.

Range mass: 136 to 410 kg.

Average mass: 0.273 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
New Zealand Sea Lions are large heavy-bodied sexually dimorphic animals. Adult males are 1.2-1.5 times longer and 3-4 times heavier than adult females. Adult males are 2.3-2.7 m long and may weigh from 320-450 kg, although these values might be high in the light of recent information that males are probably shorter than previously reported. Adult females are 1.8-2 m long and weigh 90-165 kg. Newborns are approximately 70-100 cm long and weigh 8-10 kg (Chilvers et al. 2006). Pups are born in a thick long dark brown lanugo with a lighter crown, nape, and mystacial area, and with a pale stripe on the top of the muzzle, originating on the crown. Female pups are lighter than male pups. Pups begin to molt their birth coat at 2 months and at the end of the molt look like adult females.

Males become sexually mature at the age of 5 years. The age of maturity for females is 3-4 years. Gestation lasts 12 months. Pup mortality at the end of one year is about 35%. Males live at least 23 years and females to at least 26 years (Reijnders et al 1993, Childerhouse 2007). The average age of reproductive females is 10.75 yrs (Childerhouse 2007).

The breeding season for the New Zealand Sea Lion begins in late November when adult males return and establish themselves on territories through displays, vocalizing, and fighting. Adult females arrive in early December and give birth on average within 2.1 days after returning to the rookery (Chilvers et al. 2006). Males may have as many as 25 females within their territories. The bulls are frequently challenged by newly arriving males and neighbors, and turn-over of males is a regular occurrence. Many territorial bulls depart in mid-January with the end of the pupping period (Robertson et al. 2005).

The onset of estrous occurs 7-10 days after a female gives birth. Prior to this, the mother continuously attends her newborn pup. Following mating, females begin a phase of short foraging trips followed by pup attendance, typical of many otariids. Foraging trips average 2.7 days and are followed by 1.5 days of pup attendance and feeding ashore (Chilvers et al 2005). Also typical of many otariids, pups gather into groups while their mothers are away. Females and pups recognize each other through vocalizations and scent, and a small percentage of females will allow additional pups to nurse along with their own pup, which is unusual behavior for a pinniped. Pups are weaned at approximately 10 months. The primary causes of pup deaths within their first two months of life are trauma (35%), bacterial infections (24%), hookworm infection (13%), starvation (13%), and stillbirth (4%) (Castinel et al. 2007). Adult males are a significant source of mortality to pups, occasionally killing them outright and also through incidents of cannibalism. Pups are also trampled and killed by adult males challenging other males during territorial disputes.

New Zealand Sea Lions do not appear to be migratory, although they disperse widely over their range during the non-breeding season (Robertson et al. 2005). Some animals can be found at the major rookeries and haul-outs year-round. At sea they are active divers that forage on both benthic and pelagic prey. Mean dives for female New Zealand Sea Lions are to 129 m and mean dive duration is 3.9 minutes. Maximum dive depths are over 600 m and dives have been recorded to last as long as 14.5 minutes (Chilvers et al. 2006a).

New Zealand Sea Lions take a wide variety of vertebrate and invertebrate prey. Frequently-taken species include: opalfish, octopus, munida, hoki, oblique-banded rattail fish, salps, squid and crustaceans. Prey is taken in both benthic and pelagic habitats. Antarctic, Subantarctic, and New Zealand Fur Seals are taken as prey by adult male sea lions. Penguins and sea lion pups are also occasionally taken.

Predators include sharks, Leopard Seals, and presumably Killer Whales. Pups are also cannibalized by adult males of their own species.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand sea lions inhabit the sandy beaches of New Zealand and its surrounding islands. The pups explore freshwater creeks and pools behind the beach for about their first six months, until their mothers introduce them to the sea. When not in the sea or on the beach, the sea lions can be found resting deep in the forest or on the tops of grass covered cliffs.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding and hauling out occurs on sandy beaches (4). For the fist six months of life, the pups explore the freshwater creeks and pools around the beach (3). The adults often wander as far as two kilometres inland (2) and can be found resting in forests or on grassy cliffs (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The New Zealand sea lions feed on octopus, small fish, crabs, mussels, and penguins. They swallow pebbles (gastroliths) to aid in digestion. Their intestines may contain numerous gastroliths of irregular shapes. They vomit these gastroliths, as many as 20 at a time, along with squid tentacles and small fish. These sea lions will not leave their territory to feed during the breeding season. They have learned to follow fishing vessels and take advantage of discarded or escaped fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: The gestation time probably includes a period of delayed implantation. In the wild, these animals probably live up to 23 years (Ronald Nowak 1999). Little is known about their longevity in captivity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Adult males flock to breeding beaches between October and early November in order to claim their territories. Pregant females arrive one month later. Cows come into estrus six to seven days after giving birth and matings take place from mid December to mid January. Most copulations take place on the sandy beach. Copulation ends when the cow bites at the throat of the bull.

All births take place on the beach. Most births produce only one pup. The pup is nursed by its mother for about a year. Females produce their first pup around age four. Males become sexually mature around age five, but they do not mate until they are around eight years of age.

Average birth mass: 7000 g.

Average gestation period: 365 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2191 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phocarctos hookeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCTACAAACCATAAAGATATTGGTACCCTCTATCTACTATTTGGCGCATGAGCCGGAATGGCTGGCACCGCCCTCAGCCTATTGATCCGCGCGGAGTTAGGTCAACCAGGCACTCTATTAGGAGAT---GACCAAATCTACAACGTAATTGTCACTGCCCACGCATTCGTAATGATTTTTTTCATGGTGATACCCATTATAATTGGAGGCTTTGGAAATTGATTGGTACCCTTAATAATTGGAGCTCCCGACATGGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTTTACCTCCTTCCTTCCTACTGCTACTGGCCTCTTCTCTAGTTGAAGCTGGCGCAGGTACCGGATGAACGGTTTACCCTCCCCTAGCAGGAAACTTAGCCCACGCAGGAGCTTCCGTAGACTTGACTATTTTCTCCCTTCACCTAGCAGGGGTATCATCTATTCTGGGAGCCATTAACTTTATTACTACCATTATCAACATGAAACCCCCTGCTATATCCCAATACCAAACTCCTTTATTCGTGTGATCCGTACTGATCACGGCGGTACTACTTCTGCTGTCCCTACCAGTCCTAGCAGCTGGTATCACCATATTGCTTACGGATCGAGATCTAAATACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTTATTCTACCAGGATTCGGGATAATCTCACACATCGTCACCTACTACTCAGGAAAAAAGGAACCCTTTGGTTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTCACTGTAGGAATGGATGTTGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phocarctos hookeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A3b

Version
3.1

Year Assessed
2008

Assessor/s
Gales, N. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
The New Zealand Sea Lion has a relatively small population (<10,000 mature individuals) and a limited distribution. Most reproduction is restricted to a very few sites. The best population trend data (for pup production) are from 1994. Estimates prior to this are less reliable, and include a smaller proportion of the whole population. There has been a marked (30%) decline in pup production in the last 10 years, at some of the major rookeries. The reason for the decline is not clear, but is likely to be a combination of on-going fisheries by-catch of adult females and a series of bacterial disease outbreaks. New Zealand Sea Lions qualify globally as Vulnerable (VU) under criterion A3b. But, given the seeming increase in incidence and severity of disease outbreaks, and the EN (Endangered) status of some local populations, this species should be reviewed again within a decade.

IUCN Evaluation of the New Zealand Sea Lion, Phocarctos hookeri
Prepared by the Pinniped Specialist Group

A. Population reduction
Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Pup production has declined at the Auckland Island (where 86% of the population breed) by 31% in the period 1997/98 to 2005/06. For the four years prior to this, pup production had increased by about 20% in the same region. Overall pup production has decreased by 17% between 1994/95 and 2005/06 at the Auckland Islands. Regular estimates of pup production prior to the mid 1990s are only available for one of the Auckland Islands (Enderby Island; where about 20% of the population breed) and production numbers at this site show no statistical trend since about 1980. Data from Campbell Island (where almost all of the remaining 14% of the population breed) is too intermittent and of insufficient precision to derive meaningful trends. The mean age of reproduction of female New Zealand Sea Lions is 10.75 yrs, with some females giving birth at 3 yrs and living as long as 27 yrs. Causes of the decrease in pup production since 1997 are not clear, but may be related to the scale of fishery by-catch or three unusual mortality events that resulted in very high pup mortality.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Fishery by-catch of an estimated 1-2% of adult female New Zealand Sea Lions continues in association with the New Zealand squid trawl fishery. The recent, unusual mortality events have been diagnosed to have resulted from bacterial infections, but the underlying reason for their current frequency and scale of effect of not known, nor their potential for future epidemics.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

If pup production since 1997 is primarily driven by by-catch and disease events, and these continue at current rates (mean of 4.1% decline in pup production since 1997), and we assume a three generation period of 30 yrs, then a decline of >70% will have occurred by 2027. This would qualify the species for EN under A3.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

If the rates of population decline since 1997 are less dependent upon the by-catch and epidemics (or these decline), and future rates of change average those prior to 1997, then the current dramatic decrease may be arrested and longer term trends may be <30% over 3 generations.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR < 100 km²; EN < 5,000 km²; VU < 20,000 km²

The EOO is > 20,000 km².

B2. Area of occupancy (AOO): CR < 10 km²; EN < 500 km²; VU < 2,000 km²

The AOO is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN < 5; VU < 10
(b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR < 250; EN < 2,500; VU < 10,000

The number of mature individuals may be < 10,000, given that total population size (which included the juvenile cohorts) was estimated to be 11,700 and 12,500 respectively in 1994/95 and 1995/96, at a time when pup production was about 17% greater than the most recent 2005/06 estimate. When scaled down to current pup production sizes (9,700 and 10,400 respectively) and juvenile cohorts are removed, then the number of mature individuals is likely to be <10,000.

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)

Between 2000-2005 pup production at the Auckland Islands decreased by about 27%.

C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR < 50; EN < 250; VU < 1,000
or
(a ii) % individuals in one subpopulation: CR = 90?100%; EN = 95?100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR < 50; EN < 250; VU < 1,000 AND/OR restricted area of occupancy typically: AOO < 20 km² or number of locations < 5

Does not apply.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction.

Listing recommendation ? The New Zealand Sea Lion has a relatively small population (<10,000 mature individuals) and a limited distribution. Most reproduction is restricted to a very few sites. The best population trend data (for pup production) are from 1994. Estimates prior to this are less reliable, and include a smaller proportion of the whole population. There has been a marked (30%) decline in pup production in the last 10 years, at some of the major rookeries. The reason for the decline is not clear, but is likely to be a combination of on-going fisheries by-catch of adult females and a series of bacterial disease outbreaks. New Zealand Sea Lions qualify globally as Vulnerable (VU) under criterion A3(b). But, given the seeming increase in incidence and severity of disease outbreaks, and the EN (Endangered) status of some local populations, this species should be reviewed again within a decade.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are, at most, between 3000 and 4000 New Zealand sea lions in existence. They were abundant at their time of discovery in 1806, but their numbers quickly diminished. They were exploited by settlers and shipwrecked sailors for their hides and oil. Although they have been protected by law since 1894, their numbers have remained unchanged in 70 years.

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) by the IUCN Red List 2007 (1). Listed as a threatened species under New Zealand's Marine Mammals Protection Act (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
New Zealand Sea Lions have a highly restricted distribution and a small population that numbers approximately 11,855 animals (Campbell et al. 2006). This equates to an adult population size of <10,000. Pup production has shown a decline of 30% in the last 10 years, but this was preceded by a few years of growth. Data from one of the main colonies shows no overall trend in pup production over the past 25 years (Chilvers et al. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
New Zealand Sea Lions were once more abundant, with a much more extensive range that included the North and South islands of New Zealand. The Maori people of New Zealand have traditionally hunted sea lions, presumably since first contact, as did Europeans upon their arrival much later. Commercial sealing in the early 19th century decimated the population in the Auckland Islands, but despite this, continued until the mid-20th century, when it was halted. The population may not have fully recovered from this period of overexploitation, although estimates of pre-exploitation population size are difficult to derive.

New Zealand Sea Lions have a highly restricted distribution, a small population, and most of the breeding activity is concentrated in two island groups in New Zealand's sub-Antarctic. This combination makes them vulnerable to disease outbreaks, environmental change, and human activities.

Commercial squid fishing near the two largest rookeries reported their first sea lion bycatch mortalities in 1978. In 1982, the fishery was moved at least 12 nautical miles away from the islands. However, this did not end mortality which from 1988 to 2007 ranged from 17-132 seals taken annually (Wilkinson et al. 2003, Chilvers 2008). Apart from direct mortality there is also the potential for prey competition and habitat modification from the fishing industry in the habitat of the New Zealand Sea Lion's breeding areas. Tourism at mainland sites and remote subantarctic islands can cause disruption to haul-out patterns and breeding activities.

Epizootic disease outbreaks at the Auckland Islands in 1998, 2002 and 2003 led to more than 50%, 33% and 21% early pup mortality respectively, and also led to mortalities of an unknown number of animals from other age classes during 1998. The source of the suspected bacterial agent and cause of the outbreak and subsequent mortality for the 1998 outbreak is unknown, however, the 2002 and 2003 outbreaks have been identified as cause by Klebsiella pneumoniae (Castinel et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the nineteenth century, Hooker's sea lion was killed for its hide and oil. Since 1893, however, killing this species has been illegal (2). Rabbits, which were introduced into the breeding islands of Hooker's sea lion, caused a problem as pups were falling into the rabbit burrows, resulting in high pup mortality (4) (2). Rabbits have since been eradicated and their burrows have been filled in (2). Currently, the most serious current threat is accidental by-catch in the nets of the squid fishing industry (2). This fishery has operated in the range of this sea lion since the 1970s, and has been a serious problem since then (2). In January 1998 the Hooker's sea lion population suffered a catastrophic mass mortality event, which is thought to have killed 53 percent of pups and a high percentage of adults that year (7) (2). The cause of this mass mortality is unknown (2). Before this event there were an estimated 12,000 to 14,000 individuals (7). This species is exceptionally vulnerable because its breeding range is so restricted (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The New Zealand government has provided protection to New Zealand Sea Lions with laws that date back to 1881. The Marine Mammal Protection Act of 1978 provided additional measures. The squid fishery responsible for the by-catch of sea lions was moved away from the main colonies in 1982 when the government established a 12 nautical mile exclusion zone around the islands (Wilkinson et al. 2003) and later management plans set maximum levels of fishing related mortalities, which, when exceeded, led to the early withdrawal of the fishery. Sea Lion escape devices (SLEDs) have also been mandated in the fishery. Some concerns remain regarding the health of the sea lions expelled from these devices. The uninhabited Auckland Fauna Reserve forms part of the habitat of New Zealand Sea Lions (Reijnders et al 1993). Tourism is regulated on islands and at some mainland beaches on the South Island. Given the recent steady decrease in pup production at the Auckland Islands, and the uncertainty about the influence of human activities on this trend, it is unknown if the current conservation measures are sufficient to protect the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

At present, a 20 kilometre Marine Mammal Sanctuary exists around the Auckland Islands, and the sub-Antarctic islands of New Zealand were granted UNESCO World Heritage status in 1998 (2). At present, steps are being taken to reduce the threat posed to the species from the squid fishing industry, including closure of the fishery by the Government when the estimated number of sea lions caught in the nets exceeds a set limit each year (2). Marine mammal escape devices are being tested, and there is increasing pressure on the industry to use net-free methods of fishing (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

New Zealand sea lions once provided man with hides, meat, and oil.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

New Zealand sea lion

[1]

The New Zealand sea lion (Phocarctos hookeri) also known as Hooker's sea lion or whakahao in Māori is a species of sea lion that primarily breeds on New Zealand's Sub-Antarctic Auckland and Campbell Islands and to some extent around the coast of New Zealand's South and Stewart Islands.

Recent DNA information indicates the New Zealand sea lion is a lineage previously restricted to sub-Antarctic regions. Somewhere between 1300 and 1500 AD a genetically distinct mainland lineage did not survive hunting by the first human settlers and the sub-Antarctic lineage has since then gradually filled the ecological niche.[3]

The New Zealand sea lion is probably the world's rarest sea lion and numbers around 10,000.[4]

On the Auckland Islands there are three functioning rookeries.[5] Most sea lions are born on Dundas Island. There is a smaller rookery at Sandy Bay on Enderby Island and the smallest rookery is on Figure of Eight Island. An even smaller rookery at South East Point on Auckland Island appears to now have been abandoned. The other major breeding area is the Campbell Islands.

Sea lions are generally philopatric. They are the only species in their genus.

Characteristics and taxonomy[edit]

New Zealand lions, like all otariids, have marked sexual dimorphism. Adult males are 240–350 cm long and weigh 320–450 kg and adult females are 180–200 cm long and weigh 90–165 kg. At birth, pups are 70–100 cm long and weigh 7–8 kg; the natal pelage is a thick coat of dark brown hair that becomes dark gray with cream markings on the top of the head, nose, tail and at the base of the flippers. Adult females' coats vary from buff to creamy gray with darker pigmentation around the muzzle and the flippers. Adult males are blackish-brown with a well-developed black mane of coarse hair reaching the shoulders.[6]

Endangered[edit]

As one of the larger New Zealand animals, it has been a protected species since the 1890s, is in decline[7] and is considered the most threatened sea lion in the world.[8]

It has been inferred from middens that the Hooker's sea lion was made locally extinct in the Chatham Islands due to predation by the Moriori.[9]

There was thought to be a population of around 15,000 in the mid-1990s. Estimates (based on the number of pups born) were about 9,000 for 2008.

In 2010 the Department of Conservation - responsible for marine mammal conservation - changed the New Zealand Threat Classification System ranking from Nationally Endangered to Nationally Critical.[10]

The Department of Conservation estimates that Auckland Islands' sea lions, nearly 80 per cent of the total, could be functionally extinct by 2035.[11][12] However the New Zealand Ministry for Primary Industries considers research on which this prediction is based is low quality and ‘should not be used in management decisions.’[13]

The January 2013 sea lion pup production count on the Auckland Islands showed the number of pups born on the islands has risen to 1931, from the 2012 figure of 1684. The 2013 number is the highest in five years.[14][15] Dead pups are also counted, since the annual pup count is used to assess the population of breeding females, but not future births when the counted pups mature.

The Campbell Islands population 'appears to be increasing slowly' and births here comprise about 20 per cent of the national total.[16] In August 2013 the seasonal southern blue whiting fleet captured 21 male sea lions in fishing grounds more than 100 kilometres off the Campbell Islands. Four were released alive. There were no captures reported by government observers the year before. The government responded to the captures by requesting the vessels trial sea lion exclusion devices (SLEDs) to reduce this by-catch.

Sea lions in the Otago Harbour

For the first time in 150 years sea lions began breeding again on the South Island coast in 1994, on the Otago Peninsula. The Otago sea lion population is currently small but estimated to reach 1000 animals by 2044, leading to issues of ‘marine protected areas, local fishing quotas and numbers management.’ [17]

Other small populations of breeding sea lions have recently begun to establish in various parts of the Stewart Island coastline and sea lions have been observed on the Catlins coast south of the Clutha River.[18]

Bycatch[edit]

In the 1990s, as the volume of squid fishing round the Auckland Islands increased, numbers of sea lions were captured as bycatch and drowned in the squid trawl nets. The government uses a modeling system to set a fishing related mortality limit (FRML) each year. If the limit is predicted to be exceeded, the Minister of Primary Industries may close the fishery. The last time the FRML was exceeded was in 2000, though there were a number of closures in the 1990s.[13]

In late February 2013 the first observed sea lion mortalities in the Auckland Island squid fleet in three years occurred. On two separate occasions, pre-adult sea lions appeared to have slipped through the grid at the opening of the net into its cod end.[19] The 23 cm grid aperture is designed to hold adult sea lions in the SLED and yet still allow squid to pass into the net.[13] In late May 2013 an adult female was also taken as incidental bycatch.[20] In 2014 there have been two sea lions reported captured in the fishery.[21]

The proportion of vessels in the Auckland Island squid fishery with government observers has increased over the years, providing independent reports of bycatch based on observation rather than computer models. In the 2013 season the observers' coverage was of 86 per cent of tows.[22]

Sea Lion Escape Devices[edit]

In 2001, the sea lion exclusion device (SLED) was introduced into the Auckland Island squid fishery to reduce sea lion bycatch.[23] Since 2007, all vessels in the Auckland Islands fishery have been equipped with SLEDS.[13]

Some scientists still do not believe sea lions survive the interaction with a SLED,[24] though the Ministry for Primary Industries (MPI) believes the direct effect of fishing-related mortality on the sea lion population is minimal. MPI has concluded that a sea lion has an 85 per cent change of escaping the SLED and a 97 per cent probability of surviving a SLED escape, though it says this estimate may be 'mildly pessimistic'.[13]

Conservation advocates have supported SLED use to protect other marine animals or sharks. They include the Green Party’s Gareth Hughes and NIWA marine scientist Malcolm Francis.[25][26]

Diseases[edit]

Though the Auckland Island sea lion pup production is highly variable, a decline trend for some years followed the outbreak of the introduced bacterial disease Campylobacter in 1998 which killed an estimated 53 per cent of newborn pups and 20 per cent of adult females. In 2002, another probably introduced bacterial disease Klebsiella pneumoniae killed 32 per cent of pups, and in 2003 another 21 per cent of the pups.[27] Since 2002 Klebsiella pneumoniae bacteria have caused significant mortality in the sea lion pups at Enderby Island. Infected pups have meningitis as well as septicemia.[28]

On 12 March 2014 the Conservation Minister Nick Smith was quoted as saying there was an 'excessive focus on fishing bycatch' and 300 pups had died this summer from an as yet unidentified disease.[29]


References[edit]

  1. ^ "Research revels New Zealand sea lion is a relative newcomer". Otago University. Retrieved 14 May 2014. 
  2. ^ Gales, N. (2008). Phocarctos hookeri. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 30 January 2009. Listed as Vulnerable (VU A3b)
  3. ^ "Research reveals New Zealand sea lion is a relative newcomer". Otago University. 
  4. ^ "Facts about sea lion". Department of Conservation. Retrieved 8 May 2013. 
  5. ^ "DoC: 7 March 2013, CSP Technical Working Group". 
  6. ^ Perrin, William. Encyclopedia of marine mammals. 
  7. ^ "Forest & Bird condemns 40% rise in sea lion quota". Forest & Bird. 2008-12-19. Retrieved 2009-01-27. 
  8. ^ "New Zealand Sea Lion". NZ Department of Conservation. Retrieved 2009-01-27. 
  9. ^ McFadgen, B.G. (March 1994). Archaeology and holocene sand dune stratigraphy on Chatham Island 24 (1). Royal Society of New Zealand. Retrieved 2008-08-25. [dead link]
  10. ^ "Zero quota urged for sea lion". Radio New Zealand. 19 June 2010. Retrieved 20 June 2010. 
  11. ^ "New Zealand sea lion". WWF. Retrieved 25 November 2012. 
  12. ^ "NZ sea lions facing extinction in 24 years - study". nzherald.co.nz. 11 January 2012. Retrieved 25 November 2012. 
  13. ^ a b c d e "SQUID (SQU6T) – FINAL ADVICE PAP". New Zealand Ministry for Primary Industries. Retrieved 2012. 
  14. ^ "DoC: 7 March 2013m CSP Technical Working Group". 
  15. ^ "Seafood NZ: Auckland Island Sea Lion Pup Count Up For Second Year". 
  16. ^ Robertson, Bruce C. "The population decline of the New Zealand sea lion". Mammal Society: 2011. 
  17. ^ Augé, A.A; A.B. Moore, B.L. Chilvers (2012). "Predicting interactions between recolonizing marine mammals and fisheries: defining precautionary management". Fisheries Management and Ecology. doi:10.1111/j.1365-2400.2012.00861.x. 
  18. ^ "Hungry for Answers". National Institute of Water and Atmospheric Research. 
  19. ^ "Accidental Sea Lion Captures Regretable". Ministry for Primary Industries. 
  20. ^ Ministry for Primary Industries, SQU6T Weekly Report for week ending 26 May
  21. ^ Ministry for Primary Industries, SQU6T Weekly Report for week ending 26 Feb
  22. ^ Ministry for Primary Industries, SQU6T Weekly Report for week ending 7 July
  23. ^ "Sea lion bycatch in New Zealand trawl fisheries". Dragonfly Limited. Retrieved 12 February 2013. 
  24. ^ "Plan to end sea lion kill limit criticised". Otago Daily Times. Retrieved 22 February 2013. 
  25. ^ Davidson, Issac (26 Feb 2013). "Plan to save feared predator delves into murky waters". NZ Herald. 
  26. ^ "Shock over accidental catch rates". 3 News. 13 Feb 2013. 
  27. ^ Kate Mulcahy and Raewyn Peart (2012). Wonders of the Sea – the protection of New Zealand’s marine mammals. New Zealand Environmental Defence Society. p. 320. ISBN 978-0-9876660-1-7. 
  28. ^ "Staff Profile; Dr Wendi Roe". Massey University. 
  29. ^ Fox, Rebecca (12 March 2014). "300 sea lion pup deaths prompts search for answers". Otago Daily Times. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!