Overview

Brief Summary

Biology

Breeding takes place in colonies between November and January (4) (2). Bulls (males) arrive at the breeding beaches in November each year, and start to fight amongst themselves to establish territories. Those that successfully secure and hold a territory are known as 'beach masters' (2) and will have privileged access to a harem of females (5). Throughout the entire breeding season, the beach masters are unable to return to the sea to feed, as this would force them to relinquish their hard-won territory. Instead they rely on their reserves of blubber during this period (5). Pregnant females arrive at the beaches around a month later than males (3). They give birth, usually to a single pup after arriving at the breeding beach, and mate after around a week to ten days (3) (5). Two weeks after giving birth, the mother starts to leave the pup in order to feed at sea, returning to the beach so that the pup can suckle (2) (3). She identifies her own pup by its distinctive calls (5). The pup begins to swim after two or three weeks, but it will suckle for a further eight months or more, and even up to a year (2) (3). Sexual maturity is reached at three to four years in females and five years in males (5). Hooker's sea lion feeds on small fish, squid, octopuses, crabs, mussels and other invertebrates. The occasional penguin may also be taken (3) (4). Whilst feeding, this species makes the deepest and longest dives of any sea lion in the world (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Hooker's sea lion, also known as the New Zealand sea lion, is one of the rarest and most threatened sea lions in the world (2). Adult males are dark blackish-brown in colour and have a distinct light mane that reaches down to their shoulders. Females are grey or buff-coloured, and have a paler belly. Males are much larger than females. Pups are born with a thick covering of dark hair, which is lost at some point after birth (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The primary habitat of New Zealand Sea Lions is several sub-Antarctic islands south of New Zealand and their surrounding waters. The principal breeding colony accounting for 86% of annual births is at the Auckland Islands, with a smaller number breeding at Campbell Island (Chilvers et al. 2007). New Zealand Sea Lions regularly occur in small numbers at Stewart Island and on the southeast coast of the South Island of New Zealand, where there are occasional births (Chilvers et al. 2007). However, most of the animals hauling out on the South Island are males ranging in age from 2-11 years old. Wandering New Zealand Sea Lions also reach Macquarie Island. Historically, New Zealand Sea Lions had a more extensive range that appears to have included most of New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

These sea lions inhabit the subantarctic islands of New Zealand, between latitudes 48 and 53 degrees S. Their population distribution is centered on the Auckland Islands.

Biogeographic Regions: oceanic islands (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Subantarctic islands south of New Zealand
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species has a very restricted range (4) and breeds only on the sub-Antarctic islands of New Zealand (3). Over 95 percent of breeding takes place in just three colonies in the Auckland Islands (2). Outside of the breeding season, these sea lions haul out from the Australian sub-Antarctic Macquarie Island to the south-eastern coast of New Zealand's South Island, with a few sightings of individuals on the North Island (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

New Zealand sea lion pups are born covered with thick, dark hair. It is unknown when they lose this natal coat. Adult males become dark blackish-brown with a well-developed mane reaching to their shoulders. Females have lighter coloration, generally buffy or grey with a lighter ventral side. They may have darker pigmentation around their flippers and muzzle. There is marked sexual dimorphism, also, in size of males and females. Males reach a maximum length of up to 350 cm, while females reach a maximum length of up to 200 cm. Males may weigh as much as 410 kg and females as much as 230 kg.

Dental formula is usually I 3/2, C 1/1, cheekteeth 6/5.

Range mass: 136 to 410 kg.

Average mass: 0.273 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
New Zealand Sea Lions are large heavy-bodied sexually dimorphic animals. Adult males are 1.2-1.5 times longer and 3-4 times heavier than adult females. Adult males are 2.3-2.7 m long and may weigh from 320-450 kg, although these values might be high in the light of recent information that males are probably shorter than previously reported. Adult females are 1.8-2 m long and weigh 90-165 kg. Newborns are approximately 70-100 cm long and weigh 8-10 kg (Chilvers et al. 2006). Pups are born in a thick long dark brown lanugo with a lighter crown, nape, and mystacial area, and with a pale stripe on the top of the muzzle, originating on the crown. Female pups are lighter than male pups. Pups begin to molt their birth coat at 2 months and at the end of the molt look like adult females.

Males become sexually mature at the age of 5 years. The age of maturity for females is 3-4 years. Gestation lasts 12 months. Pup mortality at the end of one year is about 35%. Males live at least 23 years and females to at least 26 years (Reijnders et al 1993, Childerhouse 2007). The average age of reproductive females is 10.75 yrs (Childerhouse 2007).

The breeding season for the New Zealand Sea Lion begins in late November when adult males return and establish themselves on territories through displays, vocalizing, and fighting. Adult females arrive in early December and give birth on average within 2.1 days after returning to the rookery (Chilvers et al. 2006). Males may have as many as 25 females within their territories. The bulls are frequently challenged by newly arriving males and neighbors, and turn-over of males is a regular occurrence. Many territorial bulls depart in mid-January with the end of the pupping period (Robertson et al. 2005).

The onset of estrous occurs 7-10 days after a female gives birth. Prior to this, the mother continuously attends her newborn pup. Following mating, females begin a phase of short foraging trips followed by pup attendance, typical of many otariids. Foraging trips average 2.7 days and are followed by 1.5 days of pup attendance and feeding ashore (Chilvers et al 2005). Also typical of many otariids, pups gather into groups while their mothers are away. Females and pups recognize each other through vocalizations and scent, and a small percentage of females will allow additional pups to nurse along with their own pup, which is unusual behavior for a pinniped. Pups are weaned at approximately 10 months. The primary causes of pup deaths within their first two months of life are trauma (35%), bacterial infections (24%), hookworm infection (13%), starvation (13%), and stillbirth (4%) (Castinel et al. 2007). Adult males are a significant source of mortality to pups, occasionally killing them outright and also through incidents of cannibalism. Pups are also trampled and killed by adult males challenging other males during territorial disputes.

New Zealand Sea Lions do not appear to be migratory, although they disperse widely over their range during the non-breeding season (Robertson et al. 2005). Some animals can be found at the major rookeries and haul-outs year-round. At sea they are active divers that forage on both benthic and pelagic prey. Mean dives for female New Zealand Sea Lions are to 129 m and mean dive duration is 3.9 minutes. Maximum dive depths are over 600 m and dives have been recorded to last as long as 14.5 minutes (Chilvers et al. 2006a).

New Zealand Sea Lions take a wide variety of vertebrate and invertebrate prey. Frequently-taken species include: opalfish, octopus, munida, hoki, oblique-banded rattail fish, salps, squid and crustaceans. Prey is taken in both benthic and pelagic habitats. Antarctic, Subantarctic, and New Zealand Fur Seals are taken as prey by adult male sea lions. Penguins and sea lion pups are also occasionally taken.

Predators include sharks, Leopard Seals, and presumably Killer Whales. Pups are also cannibalized by adult males of their own species.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

New Zealand sea lions inhabit the sandy beaches of New Zealand and its surrounding islands. The pups explore freshwater creeks and pools behind the beach for about their first six months, until their mothers introduce them to the sea. When not in the sea or on the beach, the sea lions can be found resting deep in the forest or on the tops of grass covered cliffs.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Breeding and hauling out occurs on sandy beaches (4). For the fist six months of life, the pups explore the freshwater creeks and pools around the beach (3). The adults often wander as far as two kilometres inland (2) and can be found resting in forests or on grassy cliffs (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The New Zealand sea lions feed on octopus, small fish, crabs, mussels, and penguins. They swallow pebbles (gastroliths) to aid in digestion. Their intestines may contain numerous gastroliths of irregular shapes. They vomit these gastroliths, as many as 20 at a time, along with squid tentacles and small fish. These sea lions will not leave their territory to feed during the breeding season. They have learned to follow fishing vessels and take advantage of discarded or escaped fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: The gestation time probably includes a period of delayed implantation. In the wild, these animals probably live up to 23 years (Ronald Nowak 1999). Little is known about their longevity in captivity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Adult males flock to breeding beaches between October and early November in order to claim their territories. Pregant females arrive one month later. Cows come into estrus six to seven days after giving birth and matings take place from mid December to mid January. Most copulations take place on the sandy beach. Copulation ends when the cow bites at the throat of the bull.

All births take place on the beach. Most births produce only one pup. The pup is nursed by its mother for about a year. Females produce their first pup around age four. Males become sexually mature around age five, but they do not mate until they are around eight years of age.

Average birth mass: 7000 g.

Average gestation period: 365 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2191 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phocarctos hookeri

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0686-06|NC_008418|Phocarctos hookeri| AATCGATGATTATTCTCTACAAACCATAAAGATATTGGTACCCTCTATCTACTATTTGGCGCATGAGCCGGAATGGCTGGCACCGCCCTC---AGCCTATTGATCCGCGCGGAGTTAGGTCAACCAGGCACTCTATTAGGAGAT---GACCAAATCTACAACGTAATTGTCACTGCCCACGCATTCGTAATGATTTTTTTCATGGTGATACCCATTATAATTGGAGGCTTTGGAAATTGATTGGTACCCTTAATA---ATTGGAGCTCCCGACATGGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTTTACCTCCTTCCTTCCTACTGCTACTGGCCTCTTCTCTAGTTGAAGCTGGCGCAGGTACCGGATGAACGGTTTACCCTCCCCTAGCAGGAAACTTAGCCCACGCAGGAGCTTCCGTAGACTTG---ACTATTTTCTCCCTTCACCTAGCAGGGGTATCATCTATTCTGGGAGCCATTAACTTTATTACTACCATTATCAACATGAAACCCCCTGCTATATCCCAATACCAAACTCCTTTATTCGTGTGATCCGTACTGATCACGGCGGTACTACTTCTGCTGTCCCTACCAGTCCTAGCAGCT---GGTATCACCATATTGCTTACGGATCGAGATCTAAATACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTTATTCTACCAGGATTCGGGATAATCTCACACATCGTCACCTACTACTCAGGAAAAAAG---GAACCCTTTGGTTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTCACTGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phocarctos hookeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A3b

Version
3.1

Year Assessed
2008

Assessor/s
Gales, N. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
The New Zealand Sea Lion has a relatively small population (<10,000 mature individuals) and a limited distribution. Most reproduction is restricted to a very few sites. The best population trend data (for pup production) are from 1994. Estimates prior to this are less reliable, and include a smaller proportion of the whole population. There has been a marked (30%) decline in pup production in the last 10 years, at some of the major rookeries. The reason for the decline is not clear, but is likely to be a combination of on-going fisheries by-catch of adult females and a series of bacterial disease outbreaks. New Zealand Sea Lions qualify globally as Vulnerable (VU) under criterion A3b. But, given the seeming increase in incidence and severity of disease outbreaks, and the EN (Endangered) status of some local populations, this species should be reviewed again within a decade.

IUCN Evaluation of the New Zealand Sea Lion, Phocarctos hookeri
Prepared by the Pinniped Specialist Group

A. Population reduction
Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Pup production has declined at the Auckland Island (where 86% of the population breed) by 31% in the period 1997/98 to 2005/06. For the four years prior to this, pup production had increased by about 20% in the same region. Overall pup production has decreased by 17% between 1994/95 and 2005/06 at the Auckland Islands. Regular estimates of pup production prior to the mid 1990s are only available for one of the Auckland Islands (Enderby Island; where about 20% of the population breed) and production numbers at this site show no statistical trend since about 1980. Data from Campbell Island (where almost all of the remaining 14% of the population breed) is too intermittent and of insufficient precision to derive meaningful trends. The mean age of reproduction of female New Zealand Sea Lions is 10.75 yrs, with some females giving birth at 3 yrs and living as long as 27 yrs. Causes of the decrease in pup production since 1997 are not clear, but may be related to the scale of fishery by-catch or three unusual mortality events that resulted in very high pup mortality.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Fishery by-catch of an estimated 1-2% of adult female New Zealand Sea Lions continues in association with the New Zealand squid trawl fishery. The recent, unusual mortality events have been diagnosed to have resulted from bacterial infections, but the underlying reason for their current frequency and scale of effect of not known, nor their potential for future epidemics.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

If pup production since 1997 is primarily driven by by-catch and disease events, and these continue at current rates (mean of 4.1% decline in pup production since 1997), and we assume a three generation period of 30 yrs, then a decline of >70% will have occurred by 2027. This would qualify the species for EN under A3.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

If the rates of population decline since 1997 are less dependent upon the by-catch and epidemics (or these decline), and future rates of change average those prior to 1997, then the current dramatic decrease may be arrested and longer term trends may be <30% over 3 generations.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1.
Extent of occurrence (EOO): CR
The EOO is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The number of mature individuals may be

AND either C1 or C2:
C1.
An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)

Between 2000-2005 pup production at the Auckland Islands decreased by about 27%.

C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90?100%; EN = 95?100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
Does not apply.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction.

Listing recommendation ? The New Zealand Sea Lion has a relatively small population (<10,000 mature individuals) and a limited distribution. Most reproduction is restricted to a very few sites. The best population trend data (for pup production) are from 1994. Estimates prior to this are less reliable, and include a smaller proportion of the whole population. There has been a marked (30%) decline in pup production in the last 10 years, at some of the major rookeries. The reason for the decline is not clear, but is likely to be a combination of on-going fisheries by-catch of adult females and a series of bacterial disease outbreaks. New Zealand Sea Lions qualify globally as Vulnerable (VU) under criterion A3(b). But, given the seeming increase in incidence and severity of disease outbreaks, and the EN (Endangered) status of some local populations, this species should be reviewed again within a decade.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

There are, at most, between 3000 and 4000 New Zealand sea lions in existence. They were abundant at their time of discovery in 1806, but their numbers quickly diminished. They were exploited by settlers and shipwrecked sailors for their hides and oil. Although they have been protected by law since 1894, their numbers have remained unchanged in 70 years.

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) by the IUCN Red List 2007 (1). Listed as a threatened species under New Zealand's Marine Mammals Protection Act (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
New Zealand Sea Lions have a highly restricted distribution and a small population that numbers approximately 11,855 animals (Campbell et al. 2006). This equates to an adult population size of <10,000. Pup production has shown a decline of 30% in the last 10 years, but this was preceded by a few years of growth. Data from one of the main colonies shows no overall trend in pup production over the past 25 years (Chilvers et al. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
New Zealand Sea Lions were once more abundant, with a much more extensive range that included the North and South islands of New Zealand. The Maori people of New Zealand have traditionally hunted sea lions, presumably since first contact, as did Europeans upon their arrival much later. Commercial sealing in the early 19th century decimated the population in the Auckland Islands, but despite this, continued until the mid-20th century, when it was halted. The population may not have fully recovered from this period of overexploitation, although estimates of pre-exploitation population size are difficult to derive.

New Zealand Sea Lions have a highly restricted distribution, a small population, and most of the breeding activity is concentrated in two island groups in New Zealand's sub-Antarctic. This combination makes them vulnerable to disease outbreaks, environmental change, and human activities.

Commercial squid fishing near the two largest rookeries reported their first sea lion bycatch mortalities in 1978. In 1982, the fishery was moved at least 12 nautical miles away from the islands. However, this did not end mortality which from 1988 to 2007 ranged from 17-132 seals taken annually (Wilkinson et al. 2003, Chilvers 2008). Apart from direct mortality there is also the potential for prey competition and habitat modification from the fishing industry in the habitat of the New Zealand Sea Lion's breeding areas. Tourism at mainland sites and remote subantarctic islands can cause disruption to haul-out patterns and breeding activities.

Epizootic disease outbreaks at the Auckland Islands in 1998, 2002 and 2003 led to more than 50%, 33% and 21% early pup mortality respectively, and also led to mortalities of an unknown number of animals from other age classes during 1998. The source of the suspected bacterial agent and cause of the outbreak and subsequent mortality for the 1998 outbreak is unknown, however, the 2002 and 2003 outbreaks have been identified as cause by Klebsiella pneumoniae (Castinel et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

During the nineteenth century, Hooker's sea lion was killed for its hide and oil. Since 1893, however, killing this species has been illegal (2). Rabbits, which were introduced into the breeding islands of Hooker's sea lion, caused a problem as pups were falling into the rabbit burrows, resulting in high pup mortality (4) (2). Rabbits have since been eradicated and their burrows have been filled in (2). Currently, the most serious current threat is accidental by-catch in the nets of the squid fishing industry (2). This fishery has operated in the range of this sea lion since the 1970s, and has been a serious problem since then (2). In January 1998 the Hooker's sea lion population suffered a catastrophic mass mortality event, which is thought to have killed 53 percent of pups and a high percentage of adults that year (7) (2). The cause of this mass mortality is unknown (2). Before this event there were an estimated 12,000 to 14,000 individuals (7). This species is exceptionally vulnerable because its breeding range is so restricted (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The New Zealand government has provided protection to New Zealand Sea Lions with laws that date back to 1881. The Marine Mammal Protection Act of 1978 provided additional measures. The squid fishery responsible for the by-catch of sea lions was moved away from the main colonies in 1982 when the government established a 12 nautical mile exclusion zone around the islands (Wilkinson et al. 2003) and later management plans set maximum levels of fishing related mortalities, which, when exceeded, led to the early withdrawal of the fishery. Sea Lion escape devices (SLEDs) have also been mandated in the fishery. Some concerns remain regarding the health of the sea lions expelled from these devices. The uninhabited Auckland Fauna Reserve forms part of the habitat of New Zealand Sea Lions (Reijnders et al 1993). Tourism is regulated on islands and at some mainland beaches on the South Island. Given the recent steady decrease in pup production at the Auckland Islands, and the uncertainty about the influence of human activities on this trend, it is unknown if the current conservation measures are sufficient to protect the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

At present, a 20 kilometre Marine Mammal Sanctuary exists around the Auckland Islands, and the sub-Antarctic islands of New Zealand were granted UNESCO World Heritage status in 1998 (2). At present, steps are being taken to reduce the threat posed to the species from the squid fishing industry, including closure of the fishery by the Government when the estimated number of sea lions caught in the nets exceeds a set limit each year (2). Marine mammal escape devices are being tested, and there is increasing pressure on the industry to use net-free methods of fishing (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

New Zealand sea lions once provided man with hides, meat, and oil.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

New Zealand sea lion

The New Zealand sea lion (Phocarctos hookeri) also known as Hooker's sea lion or whakahao in Māori is a species of sea lion that breeds around the coast of New Zealand's South Island and Stewart Island/Rakiura to some extent, and to a greater extent around the New Zealand Sub-Antarctic Islands, especially the Auckland Islands. It is monotypic of its genus.

Contents

Characteristics and taxonomy

New Zealand lions, like all otariids, have marked sexual dimorphism. Adult males are 240-350 cm long and weigh 320-450 kg and adult females are 180-200 cm long and weigh 90-165 kg. At birth, pups are 70-100 cm long and weigh 7-8 kg; the natal pelage is a thick coat of dark brown hair that becomes dark gray with cream markings on the top of the head, nose, tail and at the base of the flippers. Adult females' coats vary from buff to creamy gray with darker pigmentation around the muzzle and the flippers. Adult males are blackish-brown with a well-developed black mane of coarse hair reaching the shoulders.[2]

Endangered

As one of the larger New Zealand animals, it has been a protected species since the 1890s, is in decline[3] and considered the most threatened in the world.[4]

It has been inferred from middens that the Hooker's sea lion was made locally extinct in the Chatham Islands due to predation by the Moriori.[5] There was thought to be a population of around 15,000 in the mid-1990s. This may have declined somewhat since an outbreak of disease in 1998 caused the deaths of an estimated 20 percent of adult females and 50 percent of pups that year. Estimates (based on pup-counts) were about 9,000 for 2008.

In 2010 the Department of Conservation - responsible for marine mammal conservation - changed the New Zealand Threat Classification System ranking from Nationally Endangered to Nationally Critical.[6]

Bycatch

A Court of Appeal of New Zealand judgement of 7 April 2004, (with the reasons issued separately on 13 July 2004 (CA39/04)), overturned a decision by the Minister of Fisheries that only 62 sea lions could be taken as bycatch by squid fishers, based on advice from the New Zealand Ministry of Fisheries. The Court increased the bycatch to 124 sea lions in the 2004 season, saying the Minister's imposition of the lower figure (one of the lowest ever imposed in the 20-year history of such restrictions) was going beyond what the law required.

In January 2009 the Fisheries Minister allowed a kill of 113 sea lions by the squid fishery, an increase in 40 percent over the previous season. This was condemned by the Forest and Bird conservation organisation since the sea lion population is under threat and in decline.[3]


Images

EnderbyIsland5.JPGHooker on high.jpgNew zealand sea lion nursing.jpgNzhookerso1.jpg
New Zealand sea lions on an Enderby Island beach.New Zealand sea lions are surprisingly good climbers. This pup has been left by its mother adjacent to a hut on Auckland Is (an altitude of approximately 200 metres).A New Zealand sea lion nursing at Enderby Island, New Zealand.Close up

References

  1. ^ Gales, N. (2008). Phocarctos hookeri. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 30 January 2009. Listed as Vulnerable (VU A3b)
  2. ^ Perrin, William. Encyclopedia of marine mammals. 
  3. ^ a b "Forest & Bird condemns 40% rise in sea lion quota". Forest & Bird. 2008-12-19. http://forestandbird.colo.onesquared.net/what-we-do/publications/media-releases/forest-bird-condemns-40-rise-in-sea-lion-quota. Retrieved 2009-01-27. 
  4. ^ "New Zealand Sea Lion". NZ Department of Conservation. http://www.doc.govt.nz/conservation/native-animals/marine-mammals/seals/nz-sea-lion/. Retrieved 2009-01-27. 
  5. ^ McFadgen, B.G. (March 1994). Archaeology and holocene sand dune stratigraphy on Chatham Island. 24. Royal Society of New Zealand. http://www.rsnz.org/publish/jrsnz/1994/2.php. Retrieved 2008-08-25. [dead link]
  6. ^ "Zero quota urged for sea lion". Radio New Zealand. 19 June 2010. http://www.radionz.co.nz/news/stories/2010/06/19/12480a424c2a. Retrieved 20 June 2010. 

Further reading

  • Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!