Articles on this page are available in 3 other languages: Chinese (Simplified) (4), Spanish (2), Dutch (1) (learn more)

Overview

Brief Summary

Description

Red foxes are the most widely distributed wild carnivores in the world, occurring in North America, Asia, Europe, and North Africa. They are also widespread in Australia, where they were introduced in about 1850 so that fox-hunters would have something to hunt. Their range in North America has expanded since colonial times as their competitors, wolves, were eliminated, but their range has also contracted in areas where they are in competition with coyotes. Red foxes prey on voles, rabbits, hares, and other small mammals, and also eat birds, fruits, and invertebrates even beetles and earthworms. A male female pair typically inhabits a territory, and older, usually female, siblings help care for the younger offspring by bringing them food. Red foxes are among the main carriers and victims of rabies.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:40, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Fox have a bad reputation: they are known as chicken-killers and bird-robbers. That is why they have been hunted and chased away for a long time. They eat whatever they can get hold of, from rabbits to dead animals to rubbish from garbage containers. They will also eat berries and fruit. When there is more food than they can eat, a part of the spoils will be buried or hidden. The only Dutch Wadden Island where fox live is on Vlieland.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The red fox is typically active at dusk (crepuscular) or at night (nocturnal), but is often active in the day in more undisturbed areas (3). The diet is extremely broad, and includes small mammals, many invertebrates, and birds, as well as fruit, carrion (3) and items scavenged from dustbins, bird tables and compost heaps (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The size of a small dog, the red fox is the largest member of the genus Vulpes and is well-known for its large bushy tail, which is often tipped with white (3). The fur is variable in colour (3), but is usually reddish-brown to flame-red above and white to black below (5); the lower limbs and the back of the ears are often black (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

More info for the term: hardwood

Red foxes are the most widely distributed carnivore in the world. They
occur throughout most of North America (except in the Great Plains and
the extreme Southeast and Southwest), Europe, and Asia, and are found in
parts of northern Africa. They have spread throughout much of
Australia, where they were introduced in the late 1800's [30,36].

There is some question whether red foxes are native to North America.
Churcher [6] hypothesized that red foxes were native to North America north
of latitude 40 degrees North, but were scarce or absent in most of the
vast hardwood forests where common gray foxes (Urocyon cinereoargenteus)
were abundant. Others believe that the North American red fox originated
from the European red fox, which was introduced into the southeastern
section of the United States around 1750. It may have interbred with
the scarce indigenous population to produce a hybrid population [10].
The distribution of the ten subspecies of red fox is as follows [5]:

V. v. abietorum - Occurs throughout western Canada
V. v. alascensis - Occurs in Alaska, and Yukon Territory, and the
Northwest Territories
V. v. cascadensis - Occurs along the northwest coast of the
United States and British Columbia
V. v. fulva - Occurs in the eastern United States
V. v. harrimani - Occurs on Kodiak Island, Alaska
V. v. kenaiensis - Occurs on the Kenai Peninsula, Alaska
V. v. macroura - Occurs throughout the Rocky Mountains
V. v. necator - Occurs in California and Nevada
V. v. regalis - Ranges from north-central Canada south to
Nebraska and Missouri
V. v. rubricosa - Occurs in southern Quebec and Nova Scotia
  • 5. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 6. Churcher, Charles S. 1959. The specific status of the New World red fox. Journal of Mammalogy. 40(4): 513-520. [25373]
  • 10. Godin, A. J. 1977. Wild mammals of New England. Baltimore, MD: The Johns Hopkins University Press. 304 p. [25267]
  • 30. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 36. Voigt, Dennis R. 1987. Red fox. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch, B., eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 380-393. [25264]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
ID IL IN KS KY LA ME MD MA MI
MN MS MT NE NV NH NJ NM NY NC
ND OH OK OR PA RI SC SD TN TX
UT VT VA WA WV WI WY
AB BC MB NB NF NT NS ON PE PQ
SK YK MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Red foxes are found throughout much of the northern hemisphere from the Arctic circle to Central America, the steppes of central Asia, and northern Africa. This species has the widest distribution of any Canidae. Red foxes have also been introduced to Australia and the Falkland Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); neotropical (Introduced , Native ); australian (Introduced )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Widespread (especially Nile Valley and Delta).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Distributed across the entire northern hemisphere from the Arctic Circle to North Africa, Central America, and the Asiatic steppes, the Red Fox has the widest geographical range of any member of the order Carnivora (covering nearly 70 million km²). Not found in Iceland, the Arctic islands, some parts of Siberia, or in extreme deserts. European subspecies introduced into eastern United States and Canada in 17th century, subsequently mixed with local subspecies. The species was also introduced to Australia in 1800s. Elsewhere introduced to the Falkland Islands (Malvinas) and to the Isle of Man (UK), although it may subsequently have disappeared there.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Red foxes are found throughout much of the northern hemisphere from the Arctic circle to Central America, the steppes of central Asia, and northern Africa. This species has the widest distribution of any canid. Red foxes have also been introduced to Australia and the Falkland Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); neotropical (Introduced , Native ); australian (Introduced )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Holarctic. Throughout North America north of Mexico except for parts of the Southwest (but see Mikesic and Larue 2003) and Rocky Mountains. Though the species is native to North America, introductions were made in eastern North America during colonial times, resulting in increased numbers and/or range expansion in some areas. Range expanded in North Amercia in the 1900s (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Distributed throughout the northern hemisphere from the Arctic Circle in the north, as far south as north Africa (3), including much of North America, all of Europe and most of Asia, including Japan (1). They are found practically everywhere in mainland Britain, as well as on many islands (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red fox fur color ranges from pale yellowish red to deep reddish brown on the upper parts and white, ashy, or slaty on the underside. The lower part of the legs is usually black and the tail usually has a white or black tip. Two other kinds of fur colors are fairly common. Cross foxes have reddish brown fur with a black stripe down the back and another across the shoulders. Silver foxes range from strong silver to nearly black and are the most prized by furriers. These variants are about 25% and 10% of red fox individuals, respectively. Red foxes, like many other Canidae species, have tail glands. The eyes of adult foxes are yellow. The nose is dark brown or black. The length of their jaws is more than half the length of the head. They have sharp canines for grabbing and strong molars for chewing and crushing. They have 5 claws on their front feet and 4 on the rear. Red fox males are larger than females. They range from 827 to 1097 mm in length, with the tail making up 291 to 455 mm of that. They weigh from 3 to 7 kg.

Red foxes are the largest fox species. Head and body length ranges from 455 to 900 mm, tail length from 300 to 555 mm, and weight from 3 to 14 kg. Males are slightly larger than females. Populations in southern deserts and in North America are smaller than European populations.

Range mass: 3 to 14 kg.

Range length: 455 to 900 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 13.731 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Coloration of red foxes ranges from pale yellowish red to deep reddish brown on the upper parts and white, ashy or slaty on the underside. The lower part of the legs is usually black and the tail usually has a white or black tip. Two color variants commonly occur. Cross foxes have reddish brown fur with a black stripe down the back and another across the shoulders. Silver foxes range from strong silver to nearly black and are the most prized by furriers. These variants are about 25% and 10% of red fox individuals, respectively. Red foxes, like many other canid species, have tail glands. In Vulpes vulpes this gland is located 75 mm above the root of the tail on its upper surface and lies within the dermis and subcutaneous tissue. The eyes of mature animals are yellow. The nose is dark brown or black. The dental formula is 3/3 1/1 4/4 2/3. The tooth row is more than half the length of the skull. The premolars are simple and pointed, with the exception of upper fourth premolars, the carnassials. Molar structure emphasizes crushing. The manus has 5 claws and the pes 4 claws. The first digit, or dew claw, is rudimentary but clawed and does not contact the ground.

Red foxes are the largest of the Vulpes species. Head and body length ranges from 455 to 900 mm, tail length from 300 to 555 mm, and weight from 3 to 14 kg. Males are slightly larger than females. Populations in southern deserts and in North America are smaller than European populations. Body mass and length among populations also varies with latitude (being larger in the north, according to Bergmann's rule).

Range mass: 3 to 14 kg.

Range length: 455 to 900 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 13.731 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Males can be 15%-25% heavier than females.

Length:
Range: "827-1,097 mm "

Weight:
Range: 3-7 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 103 cm

Weight: 6800 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cover Requirements

More info for the term: cover

Dens - Red foxes may dig their own den; more often they use an abandoned
woodchuck (Marmota spp.) or American badger (Taxidea taxus) burrow
[1,5]. Dens are prepared in late winter at which time the female
restricts her activities to the vicinity of the den site. There is a
preference for loose soils on well-drained sites near or within
vegetative cover. Most red fox dens were located on slopes in Iowa, on
southerly facing slopes in woods in Wisconsin [25], in sandy soils near
the edges of woods in New York, and on islands in Maryland marshes [1].
The same den may be used for many generations, with burrows being added
each year. Most dens have at least two openings. Red fox dens with up
to 19 entrances have been found in Alaska [5].

Foraging cover - Red foxes often hunt in open grassy areas, especially
along streams [34].

Hiding and thermal cover - In agricultural areas, shelterbelts and
fencerows are used for hiding and thermal cover as well as travel
corridors [3].
  • 5. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 1. Ables, E. D. 1971. Ecology of the red fox in North America. In: Fox, M. W., ed. The wild canids. New York: Van Nostand Reinhold Co: 216-235. [25263]
  • 3. Allen, A. W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, J. A.; Obbard, M. E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. Ottawa, ON: Ontario Ministry of Natural Resources: 164-179. [24997]
  • 25. Richards, S. H.; Hines, R. L. 1953. Wisconsin fox populations. Technical Wildlife Bulletin Note. Madison, WI: Wisconsin Conservation Department. 78 p. [25269]
  • 34. Van Gelden, Richard George. 1982. Mammals of the National Parks. Baltimore, MD: Johns Hopkins University Press. 310 p. [20893]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: hardwood, parturition

Red foxes can survive in a variety of habitats. They select areas of
greatest diversity and use edges heavily [1,5,36]. Dense forests are
usually avaoided. In rural areas they prefer diverse habitats
consisting of intermixed cropland, rolling farmland, brush, pastureland,
mixed hardwood stands, and edges of open areas that provide suitable
hunting grounds. Red foxes may also inhabit suburban areas,
particularly parks, golf courses, cemeteries, and large gardens [5].

Home range - The size of individual red fox home range varies. Home
ranges are generally not more than 5 miles (8 km) in diameter. During
the period of parturition and for a few weeks afterwards, adult red
foxes usually remain within 0.5 mile (0.8 km) of the den. Ranges are
largest during the winter [1]. Red fox home ranges tend to be
elliptical [5]. Storm [32] found that one adult male had a home range
1.9 miles (3.1 km) long by 1.4 miles (2.2 km) wide. Schofield [27]
followed tracks in the snow and estimated red fox home ranges to be 1 to
1.5 miles (1.6-2.4 km) in radius in Wisconsin. In Ontario red fox home
ranges in farmland averaged 2,224 acres (900 ha) but ranged from 1,235
to 4,940 acres (500-2,000 ha) [36]. In the arctic, home ranges are as
large as 8,400 acres (3,400 ha) [16]. Adult foxes may remain in the
same home range for life [1].
  • 5. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 1. Ables, E. D. 1971. Ecology of the red fox in North America. In: Fox, M. W., ed. The wild canids. New York: Van Nostand Reinhold Co: 216-235. [25263]
  • 16. Jones, Donald M.; Theberge, John B. 1982. Summer home range and habitat utilization of the red fox (Vulpes vulpes) in a tundra habitat, northwest British Columbia. Canadian Journal of Zoology. 60: 807-812. [25372]
  • 27. Schofield, Raymond D. 1960. A thousand miles of fox trails in Michigan's ruffed grouse range. Journal of Wildlife Management. 24(4): 432-434. [25434]
  • 32. Storm, G. L. 1965. Movements and activities of foxes as determined by radio-tracking. Journal of Wildlife Management. 29(1): 1-13. [25375]
  • 36. Voigt, Dennis R. 1987. Red fox. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch, B., eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 380-393. [25264]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

Although red foxes can survive in many habitats ranging from arctic
barren areas to temperate deserts, they prefer areas with a mixture of
plant communities [1,5,30,36]. Red foxes are commonly associated with
grasslands, boreal forests, coniferous forests, deciduous forests, and
tundra [30]. In developed regions, red foxes are generally associated
with agricultural areas where woodlots are interspersed with cropland
and pastureland [36].

Schofield [27] found that red foxes in Michigan preferred lowland brush
and oak (Quercus spp.) woodlands but avoided swamps. In the Sierra
Nevada, California, red foxes are found primarily in upper elevation
forests associated with the Sierra Nevada Crest. During the summer they
prefer meadows interspersed with mature Jeffrey pine (Pinus jeffreyi),
lodgepole pine (P. contorta), or Shasta red fir (Abies magnifica var.
shastensis) forests. In winter red foxes prefer mixed-conifer and
ponderosa pine (P. ponderosa) forests [35]. In British Columbia red
foxes are most common in mixed forests that are interspersed with
meadows. Iowa red foxes are most numerous in hilly, wooded regions, but
they are also common in the flatter prairie corn belt. One of the
densest populations of red foxes in North America is in southwestern
Wisconsin where they inhabit areas which contain a mosaic of woodlots,
croplands, pasturelands, and stream bottoms [1].
  • 5. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 1. Ables, E. D. 1971. Ecology of the red fox in North America. In: Fox, M. W., ed. The wild canids. New York: Van Nostand Reinhold Co: 216-235. [25263]
  • 27. Schofield, Raymond D. 1960. A thousand miles of fox trails in Michigan's ruffed grouse range. Journal of Wildlife Management. 24(4): 432-434. [25434]
  • 30. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 35. Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station. 439 p. [10237]
  • 36. Voigt, Dennis R. 1987. Red fox. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch, B., eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 380-393. [25264]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the term: cover

Red foxes probably occur in most SRM (rangeland) cover types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

Red foxes probably occur in most SAF cover types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

Red foxes probably occur in most Kuchler plant associations.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red foxes utilize a wide range of habitats including forest, tundra, prairie, desert, mountains, farmlands, and urban areas. They prefer mixed vegetation communities, such as edge habitats and mixed scrub and woodland. They are found from sea level to 4500 meters elevation.

Range elevation: 0 to 4500 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Red Foxes have been recorded in habitats as diverse as tundra, desert and forest, as well as in city centres (including London, Paris, Stockholm, etc.). Natural habitat is dry, mixed landscape, with abundant "edge" of scrub and woodland. They are also abundant on moorlands, mountains (even above the treeline, known to cross alpine passes), deserts, sand dunes and farmland from sea level to 4,500 m. In the UK, they generally prefer mosaic patchworks of scrub, woodland and farmland. Red foxes flourish particularly well in urban areas. They are most common in residential suburbs consisting of privately owned, low-density housing and are less common where industry, commerce or council rented housing predominates (Harris and Smith 1987). In many habitats, foxes appear to be closely associated with man, even thriving in intensive agricultural areas.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red foxes utilize a wide range of habitats including forest, tundra, prairie, desert, mountains, farmlands, and urban areas. They prefer mixed vegetation communities, such as edge habitats and mixed scrub and woodland. They are found from sea level to 4500 meters elevation.

Range elevation: 0 to 4500 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Various open and semi-open habitats. Usually avoids dense forest, although open woodlands frequently are used. Sometimes occurs in suburban areas or even cities (e.g., in England). May range onto sea ice (Labrador). Maternity dens are in burrows dug by fox or abandoned by other mammals, often in open fields or wooded areas, sometimes under rural buildings, in hollow logs, under stumps, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This highly adaptable species is found in many habitats, from sand dunes to mountain tops (2). It also occurs in urban areas (4), and seems to fare particularly well in affluent suburbs (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Red foxes are omnivorous. They eat a variety of animals and plant
materials depending mainly on the availability of the food source.
Small mammals, birds, fruits, and insects comprise the bulk of the diet
[5].

Voles (Microtus spp.), mice (Muridae), woodchucks (Marmota monax) and
several lagomorph species (eastern cottontails [Sylvilagus floridanus],
snowshoe hares [Lepus americanus], and black-tailed jackrabbits [L.
californicus]) are often preferred [36]. In New York and New England,
meadow voles (Microtus pennsylvanicus) were the most commonly eaten prey
item. Rabbits (Sylvilagus spp.) were also commonly eaten. Throughout
most of the year in Ontario, meadow voles are the major prey,
constituting as much as 50 percent of the red fox's diet [36].

Red foxes may also eat squirrels (Spermophilus spp.), young Virginia
opossums (Didelphis virginiana), raccoons (Procyon lotor), skunks
(Mustelidae), domestic cats (Felis catus), domestic dogs (Canis
familiaris), weasels (Mustela spp.), mink (Mustela vison), common
muskrats (Ondatra zibethicus), shrews (Soricidae), moles (Talpidae),
common porcupines (Erethizon dorsatum), pocket gophers (Geomyidae),
songbirds, crows (Corvus spp.), ring-necked pheasants (Phasianus
colchicus), northern bobwhite (Colinus virginianus), grouse
(Tetraoninae), waterfowl (Anseriformes), wild turkeys (Meleagris
gallopavo), domestic chickens, American woodcocks (Scolopax minor),
hawks (Accipitridae), owls (Strigiformes), bird eggs, turtles, and
turtle eggs. Plant foods such as grasses, sedges (Carex spp.), nuts,
berries, pears, apples, grapes, and corn, wheat, and many other grains
are eaten by red foxes. Livestock and big game are sometimes eaten as
carrion [1,5,30,36].

Seasonal variations are prominent in the diet of red foxes. The diet
generally changes from mostly animal matter in the winter to insects and
fruit in the summer and fall [5]. Red foxes show a strong preference
for certain wild berries and fruits. During seasons of abundance,
blueberries (Vaccinium spp.), raspberries (Rubus spp.) and black
cherries (Prunus serotina) may constitute almost 100 percent of the diet
[1].
  • 5. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 1. Ables, E. D. 1971. Ecology of the red fox in North America. In: Fox, M. W., ed. The wild canids. New York: Van Nostand Reinhold Co: 216-235. [25263]
  • 30. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 36. Voigt, Dennis R. 1987. Red fox. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch, B., eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 380-393. [25264]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Red foxes are essentially omnivores. They mostly eat Rodentia, Sylvilagus floridanus, Insecta, and fruit. They will also eat carrion. Red foxes also store food and are very good at relocating these caches. Red foxes have a characteristic manner of hunting Peromyscus leucopus. The fox stands motionless, listening and watching intently for a mouse it has detected. It then leaps high and brings the forelimbs straight down forcibly to pin the mouse to the ground. They eat between 0.5 and 1 kg of food each day.

Animal Foods: birds; mammals; reptiles; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: fruit

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Red foxes are essentially omnivores. They mostly eat rodents, eastern cottontail rabbits, insects, and fruit. They will also eat carrion. Red foxes also store food and are very good at relocating these caches. Red foxes have a characteristic manner of hunting mice. The fox stands motionless, listening and watching intently for a mouse it has detected. It then leaps high and brings the forelimbs straight down forcibly to pin the mouse to the ground. They eat between 0.5 and 1 kg of food each day.

Animal Foods: birds; mammals; reptiles; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: fruit

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic omnivore; eats whatever is available--small mammals, carrion, birds, insects, fruit, human refuse, etc. Rabbits and mice are common prey. Often uses same foraging route.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Gray wolves (Canis lupus) and lynx (Lynx lynx) sometimes kill red foxes
[1,5]. Other large predators such as mountain lions (Felis concolor),
bobcats (Lynx rufus), and coyotes (Canis latrans) probably also
occasionally kill red foxes. Humans hunt and trap red foxes [1,5,36].
  • 5. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 1. Ables, E. D. 1971. Ecology of the red fox in North America. In: Fox, M. W., ed. The wild canids. New York: Van Nostand Reinhold Co: 216-235. [25263]
  • 36. Voigt, Dennis R. 1987. Red fox. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch, B., eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 380-393. [25264]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Animal / dung saprobe
apothecium of Ascobolus brassicae is saprobic in/on dung or excretions of dung of Vulpes vulpes

Animal / vector
Capillaria hepatica is spread by Vulpes vulpes

Animal / dung saprobe
perithecium of Chaetomium crispatum is saprobic in/on dung or excretions of dung of Vulpes vulpes
Other: unusual host/prey

Animal / dung/debris feeder
larva of Geotrupes vernalis feeds on dung/debris buried dung of Vulpes vulpes

Animal / vector
Leptospira is spread by Vulpes vulpes

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus dilutellus is saprobic in/on dung or excretions of dung of Vulpes vulpes

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella minima is saprobic in/on dung or excretions of dung of Vulpes vulpes

Animal / parasite / endoparasite
usually solitary tapeworm of Taenia taeniaeformis endoparasitises small intestine of Vulpes vulpes

In Great Britain and/or Ireland:
Animal / predator
adult of Vulpes vulpes is predator of adult of Timarcha tenebricosa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Red foxes help to control populations of their prey animals, such as rodents and rabbits. They also may disperse seeds by eating fruit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most red foxes that are taken by natural predators are young pups. Pups are kept in and near a den and protected by their family to avoid this. Adult red foxes may also be attacked by Canis latrans, Canis lupus, or other predators, but this is rarely in order to eat them. The most significant predators on red foxes are humans, who hunt foxes for their fur and kill them in large numbers as pests.

Known Predators:

  • eagles (Accipitridae)
  • coyotes (Canis_latrans)
  • gray wolves (Canis_lupus)
  • bears (Ursidae)
  • mountain lions (Puma_concolor)
  • humans (Homo_sapiens)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Red foxes help to control populations of their prey animals, such as rodents and rabbits. They also may disperse seeds by eating fruit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most red foxes that are taken by natural predators are young pups. Pups are kept in and near a den and protected by their family to avoid this. Adult red foxes may also be attacked by coyotes, wolves, or other predators, but this is rarely in order to eat them. The most significant predators on red foxes are humans, who hunt foxes for their fur and kill them in large numbers as pests.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Vulpes vulpes is prey of:
Accipitridae
Ursidae
Homo sapiens
Canis lupus
Canis latrans
Puma concolor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: fire suppression, shrubs

Red foxes commonly inhabit areas with a high proportion of edge. Fire
that creates a mosaic of burned and unburned areas is probably the most
beneficial to red foxes. Periodic fire may help to maintain habitat for
many prey species of red fox. Many small mammal populations increase
rapidly in response to an increase in food availability subsequent to
burning [14,19,22]. In Alaska red foxes should benefit during the
first 10 to 20 years following fire due to the increase in northern
red-backed voles (Clethrionomys rutilus) and meadow voles [38]. Fire
often improves hare and rabbit forage quality and quantity for two or
more growing seasons [19]. Wagle [37] reported that fire suppression in
grasslands is detrimental to populations of small bird and mammal
herbivores due to organic matter accumulation and reduced plant vigor.

Many fruiting shrubs that are important late summer and fall foods of
red foxes such as blackberries (Rubus spp.), blueberries, and
raspberries, do not fruit the year of burning but produce the most fruit
2 to 4 years after fire pruning [14,19].
  • 14. Hon, Tip. 1981. Effects of prescribed fire on furbearers in the South. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings of a symposium; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 121-128. [14818]
  • 19. Landers, J. Larry. 1987. Prescribed burning for managing wildlife in southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene, eds. Managing southern forests for wildlife and fish: a proceedings; [Date of conference unknown]
  • 22. Nichols, R.; Menke, J. 1984. Effects of chaparral shrubland fire on terrestrial wildlife. In: DeVries, Johannes J., ed. Shrublands in California: literature review and research needed for management. Contribution No. 191. Davis, CA: University of California, Water Resources Center: 74-97. [5706]
  • 37. Wagle, R. F. 1981. Fire: its effects on plant succession and wildlife in the Southwest. Tucson, AZ: University of Arizona. 82 p. [4031]
  • 38. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Yukon Wildlife Branch: 1-36. [14071]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: litter, polygamous

Breeding season - Red foxes are monestrous [1,5]. The red fox breeding
season generally lasts from December to March [1,5,36]. However, the
onset of breeding varies in different parts of red fox range, earlier in
the south and later in the north. Breeding in Ontario occurs from late
January to late March [36]. Breeding peaks occur from late December to
early January in Iowa, late January in Wisconsin, and late January and
early February in New York. The earliest recorded breeding dates for
red foxes in the United States are early December and the latest are in
April [1].

It is not known whether red foxes in the wild are normally polygamous.
However, it is common to see several males near a female during estrus
[36]. Estrus last 1 to 6 days. Females may breed at 10 months of age.
However, not all females breed their first year. Most males are capable
of breeding their first year [5].

Gestation and litter size - Gestation usually lasts 51 to 53 days.
Litters of four to seventeen have been reported, with a mean of five
[5,13,36]. Generally only one litter is produced per year.

Development of young - Newborn pups remain at the den for the first
month of life. They first open their eyes at 9 days of age. Red fox
parents may move the pups from one den to another as many as three times
before they are 6 weeks old. Litters are sometimes split with half the
litter residing in one den and half in another. Pups are weaned at 8 to
10 weeks. When pups are 10 weeks old they may travel short distances
from the den without being accompanied by a parent. At about 12 weeks
of age pups begin to explore their parents' home range independently or
with a parent [5].

Dispersal - By mid-September or early October pups begin to disperse.
Male red foxes usually disperse before females and move greater
distances [5]. Most red foxes disperse from their parents' home range
before their first birthday [36]. The mean distance dispersed by males
in Iowa and Illinois was 18 miles (29 km) [23]. In Ontario,
straight-line dispersal distances as great as 76 miles (122 km) were
recorded, but most males dispersed a straight-line distance of about 19
miles (30 km) during the first 15 days after leaving the den. Females
dispersed an average of 5 miles (8 km) in Ontario and 10 miles (16 km)
in Iowa and Illinois [23,36].

Social organization - The red fox social unit is comprised of pups and
either one male and one female or a group of one male and several
females [21]. When a group contains several females they are generally
kin. In much of North America, social groups are just pairs. Where
groups include additional adult females, the largest groups occur in
rural-suburban habitat and average more than three females. Only a
minority of females in large groups rear pups. Nonbreeding females
tend to be socially subordinate to breeding ones, and some act as
helpers. Where more than one female breeds within a social group,
communal denning and nursing are common [36].

Life span - Most red foxes in the wild live 3 or 4 years [1].
  • 5. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 1. Ables, E. D. 1971. Ecology of the red fox in North America. In: Fox, M. W., ed. The wild canids. New York: Van Nostand Reinhold Co: 216-235. [25263]
  • 13. Holcomb, Larry C. 1965. Large litter size of red foc. Journal of Mammalogy. 46(3): 530. [25374]
  • 21. McDonald, D. W. 1980. Social factors affecting reproduction amongst red foxes (Vulpes vulpes). In: Zimen, E., ed. The red fox. Biogeographic Vol. 18. The Hague, Netherlands: Dr. W. Junk: 123-175. [25266]
  • 23. Phillips, R. L.; Andrews, R. D.; Storm, G. L.; Bishop, R. A. 1972. Dispersal and mortality of red foxes. Journal of Wildlife Management. 36(2): 237-248. [25433]
  • 36. Voigt, Dennis R. 1987. Red fox. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch, B., eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 380-393. [25264]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Summer home range varies greatly, 142-1280 acres (Ables 1969); winter ranges more extensive; home range diameter usually 2-4 km, up to 8 km or more if food scarce (see Caire et al. 1989). Social groups in a city in England exhibited drifting territoriality; ranges averaged about 40 ha (Doncaster and MacDonald 1991). In Japan, spring-summer home range was 357-631 ha; foxes moved about 6 km each night in going from village to village (Cavallini, 1992, J. Mamm. 73:321-325). Averages one family (about 7 foxes) per 4 sq miles (Baker 1983). May be excluded by coyote from some areas of otherwise suitable habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Red foxes use a variety of vocalizations to communicate among themselves. They also use facial expressions and scent marking extensively. Red foxes have excellent senses of vision, smell, and touch.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Red foxes use a variety of vocalizations to communicate among themselves. They also use facial expressions and scent marking extensively. Scent marking is through urine, feces, anal sac secretions, the supracaudal gland, and glands around the lips, jaw, and the pads of the feet. There have been 28 different kinds of vocalizations described in red foxes and individuals have voices that can be distinguished. Vocalizations are used to communicate with foxes that are both nearby and very fary away. Red foxes have excellent senses of vision, smell, and touch.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Mainly crepuscular and nocturnal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Red foxes have been known to live 10 to 12 years in captivity but live on average 3 years in the wild.

Range lifespan

Status: captivity:
12.0 (high) years.

Average lifespan

Status: wild:
3.0 years.

Average lifespan

Status: wild:
7.0 years.

Average lifespan

Status: captivity:
15.0 years.

Average lifespan

Status: wild:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Red foxes have been known to live 10 to 12 years in captivity but live on average 3 years in the wild.

Range lifespan

Status: captivity:
12.0 (high) years.

Average lifespan

Status: wild:
3.0 years.

Average lifespan

Status: wild:
7.0 years.

Average lifespan

Status: captivity:
15.0 years.

Average lifespan

Status: wild:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.3 years (captivity) Observations: One wild born female was still living in captivity at an estimated 21.3 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Red foxes may breed in male/female pairs or in groups with one breeding male and multiple females. Females in the same group may share a den and help each other raise their young.

Mating System: monogamous ; polygynous ; cooperative breeder

Breeding season varies from region to region but usually begins in December or January in the south, January to February in the central regions, and February to April in the north. Females are pregnant usually for 51 to 53 days and give birth to about 5 pups, although some litters have been as large as 13 pups! Just before and for a time after giving birth the female remains in or around the den. The male will give his mate food but does not go into the maternity den. Young red foxes are between 50 and 150 g in weight when they are born. The pups are born blind but open their eyes 9 to 14 days after birth. Pups leave the den 4 or 5 weeks after birth and are fully weaned by 8 to 10 weeks. Mothers and pups remain together until the autumn after birth. Red foxes are fully grown by 10 months old.

Breeding interval: Red foxes breed once yearly.

Breeding season: Breeding season varies from region to region but usually begins in December or January in the south, January to February in the central regions, and February to April in the north.

Range number of offspring: 1 to 9.

Average number of offspring: 4.59.

Range gestation period: 49 to 55 days.

Range weaning age: 56 to 70 days.

Average age at sexual or reproductive maturity (female): 10.0 months.

Average age at sexual or reproductive maturity (male): 10.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 100 g.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
304 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
304 days.

Red fox males and females, and sometimes their older offspring, cooperate to care for the pups. Young remain in the den for 4 to 5 weeks, where they are cared for and nursed by their mother. They are nursed for 56 to 70 days and are provided with solid food by their parents and older siblings. The young remain with their parents at least until the fall of the year they were born in and will sometimes remain longer, especially females.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red fox mating behavior varies substantially. Often males and females are monogamous, but males with multiple female mates are also know, as are male/female pairs that use non-breeding female helpers in raising their young. Females mated to the same male fox may share a den. Red fox groups always have only one breeding male, but that male may also seek mating outside of the group.

Mating System: monogamous ; polygynous ; cooperative breeder

The annual estrous period of female red foxes last from 1 to 6 days. Ovulation is spontaneous and does not require copulation to occur. The exact time of estrous and breeding varies across the broad geographic range of the species: December-January in the south, January-February in the central regions, and February-April in the north. Males will fight during the breeding season. Males have a cycle of fecundity, with full spermatogenesis only occurring from November to March. Females may mate with a number of males but will establish a partnership with only one male. Copulation usually lasts 15 or 20 minutes and is often accompanied by a vocal clamor. Implantation of the fertilized egg occurs between 10 and 14 days after a successful mating. Just before and for a time after giving birth the female remains in or around the den. The male partner will provision his mate with food but does not go into the maternity den. Gestation is typically between 51 and 53 days but can be as short as 49 days or as long as 56 days. Litters vary in size from 1 to 13 pups with an average of 5. Birth weight is between 50 and 150 g. The pups are born blind but open their eyes 9 to 14 days after birth. Pups leave the den 4 or 5 weeks after birth and are fully weaned by 8 to 10 weeks. Mother and pups remain together until the autumn after the birth. Sexual maturity is reached by 10 months.

Breeding interval: Red foxes breed once yearly.

Breeding season: Breeding season varies from region to region but usually begins in December or January in the south, January to February in the central regions, and February to April in the north.

Range number of offspring: 1 to 9.

Average number of offspring: 4.59.

Range gestation period: 49 to 55 days.

Range weaning age: 56 to 70 days.

Average age at sexual or reproductive maturity (female): 10.0 months.

Average age at sexual or reproductive maturity (male): 10.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 100 g.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
304 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
304 days.

Red fox males and females, and sometimes their older offspring, cooperate to care for the pups. Young remain in the den for 4 to 5 weeks, where they are cared for and nursed by their mother. They are nursed for 56 to 70 days and are provided with solid food by their parents and older siblings. The young remain with their parents at least until the fall of the year they were born in and will sometimes remain longer, especially females.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in winter. Gestation lasts 51-56 (average 53) days. Litter of 1-10 (average 4-5) young is born in March-April. Young are weaned in 8-10 weeks, when young leave den and learn to hunt with parents. Male and female may divide young between two dens. Young become independent in fall. Sexually mature the winter after their birth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vulpes vulpes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCTACTAACCACAAAGACATCGGTACTTTATATTTGCTATTCGGAGCATGAGCCGGTATAGTAGGCACTGCCCTAAGCCTCCTAATTCGAGCCGAATTAGGTCAACCCGGCACCTTATTAGGGGAC---GATCAGATTTATAACGTAATCGTAACCGCACATGCCTTCGTAATAATCTTCTTCATGGTCATACCAATTATAATTGGGGGATTTGGGAACTGATTAGTTCCCCTGATAATTGGTGCCCCAGACATAGCATTTCCTCGGATAAATAACATAAGCTTCTGACTACTTCCCCCATCCTTTCTTCTACTATTAGCATCTTCCATAGTAGAAGCGGGTGCGGGAACTGGGTGAACCGTATATCCCCCATTAGCTGGTAACCTGGCTCATGCTGGAGCATCAGTGGACCTTACAATTTTCTCCCTGCACCTGGCCGGAGTCTCTTCAATTTTAGGAGCTATTAATTTCATCACTACTATTATCAATATAAAACCTCCCGCCATATCCCAATACCAAACCCCCCTATTTGTGTGATCAGTCCTAATTACAGCTGTTCTATTACTACTATCACTACCAGTACTGGCTGCTGGAATTACTATGCTTCTGACAGACCGTAACCTTAACACGACATTTTTTGATCCTGCTGGAGGAGGGGACCCTATTTTATACCAACACTTGTTTTGATTCTTCGGACACCCTGAAGTCTACATTTTAATCTTGCCTGGGTTTGGTATAATCTCCCACATCGTTACTTATTATTCAGGAAAGAAAGAGCCCTTCGGTTACATGGGAATGGTATGAGCAATAATGTCTATCGGATTCTTAGGCTTTATCGTATGAGCTCACCACATATTCACTGTAGGAATAGATGTGGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vulpes vulpes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent changes
in status may not be included.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

U.S. Federal Legal Status

Vulpes vulpes necator is Under Review for listing [39].
  • 39. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Three subspecies are listed in CITES appendix III. Overall, red fox populations are stable and they have expanded their range in response to human changes in habitats.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: appendix iii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Macdonald, D.W. & Reynolds, J.C.

Reviewer/s
Sillero-Zubiri, C. & Hoffmann, M. (Canid Red List Authority)

Contributor/s

Justification
The Red Fox has the widest geographical range of any member of the order Carnivora, being distributed across the entire northern hemisphere from the Arctic Circle to North Africa, Central America, and the Asiatic steppes. Red Foxes are adaptable and opportunistic omnivores and are capable of successfully occupying urban areas. In many habitats, foxes appear to be closely associated with man, even thriving in intensive agricultural areas. The species currently is not under threat.

History
  • 2004
    Least Concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Three subspecies are listed in CITES appendix III. Overall, red fox populations are stable and they have expanded their range in response to human changes in habitats.

US Federal List: no special status

CITES: appendix iii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

No legislative protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Red Fox density is highly variable. In the UK, density varies between one fox per 40 km² in Scotland and 1.17/km² in Wales, but can be as high as 30 foxes per km² in some urban areas where food is superabundant (Harris 1977; Macdonald and Newdick 1982; Harris and Rayner 1986). Social group density is one family per km² in farmland, but may vary between 0.2-5 families per km² in the suburbs and as few as a single family per 10 km² in barren uplands (Macdonald 1981; Lindsay and Macdonald 1986). Fox density in mountainous rural areas of Switzerland is three foxes per km² (Meia 1994). In northern boreal forests and Arctic tundra, they occur at densities of 0.1/km², and in southern Ontario, Canada at 1/km² (Voigt 1987). The average social group density in the Swiss mountains is 0.37 family per km² (Weber et al. 1999).

The pre-breeding British fox population totals an estimated 240,000 (Harris et al. 1995). Mean number of foxes killed per unit area by gamekeepers has increased steadily since the early 1960s in 10/10 regional subdivisions of Britain, but it is not clear to what extent this reflects an increase in fox abundance. Although an increase in fox numbers following successful rabies control by vaccination was widely reported in Europe (e.g., fox bag in Germany has risen from 250,000 in 1982–1983 to 600,000 in 2000–2001), no direct measures of population density have been taken.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The main threats include habitat degradation, loss, and fragmentation, and exploitation, and direct and indirect persecution. However, the Red Fox's versatility and eclectic diet are likely to ensure their persistence despite changes in landscape and prey base. Culling may be able to reduce numbers well below carrying capacity in large regions (Heydon and Reynolds 2000), but no known situations exist where this currently threatens species persistence on any geographical scale. There are currently bounties on subspecies V. v. pusilla (desert foxes) in Pakistan to protect game birds such as Houbara bustards (Chlamydotis undulata macqueenii), with a high hunting value.

The number of foxes raised for fur (although much reduced since the 1900s) exceeds that of any other species, except possibly mink (Mustela vison) (Obbard 1987). Types farmed are particularly colour variants ("white", "silver" and "cross") that are rare in the wild.

Worldwide trade in ranched red fox pelts (mainly "silver" pelts from Finland) was 700,000 in 1988–1989 (excluding internal consumption in the USSR). Active fur trade in Britain in 1970s was negligible.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Foxes are perceived as important predators of ground nesting birds, gamebirds, and livestock, and are therefore widely controlled (6). Most deaths are caused by road accidents, shooting and other methods of control, and secondary poisoning may also be a factor resulting in mortality (4). Furthermore, foxes are hunted with hounds in Britain; this is a contentious issue (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the term: prescribed fire

Prescribed fire that favors small mammals by enhancing forage and fruit
production would probably maximize the abundance of food for red foxes.
Red foxes would probably benefit from prescribed fire that increases the
proportion of edge and the complexity of the vegetation mosaic.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the terms: cover, shrubs

Habitat management - To enhance or maintain habitat quality for red
foxes, managers should maintain woodlots in agricultural areas with
minimal grazing or disturbance; this ensures diversity of understory
vegetation and foods. Establishment of fruit producing shrubs and trees
should be encouraged. Shelterbelts and fencerows should be maintained
to provide cover and travel corridors [3]. Timber harvest areas should
have irregular shapes to maximize edge effect [5].

Diseases - Red foxes are particularly susceptible to rabies. Rabies may
cause from 60 to 80 percent mortality in a population during an
outbreak. Red foxes are also susceptible to canine distemper,
parvovirus, toxoplasmosis, canine hepatitis, tularemia, leptospirosis,
staphylococcal infections, encephalitis viruses, and mange [2,5,33,36].
Red foxes host a large number of parasites (hookworms and roundworms)
typical of carnivores that feed on small prey [36].

Studies of the effects of red fox predation in the prairie pothole
region of North America have indicated that although the consumption of
mallards (Anas platyrhynchos) may not be high, the effect on the mallard
population may be critical [7,26]. Red fox predation on mice and
woodchucks has been beneficial to most agricultural areas. Red foxes
may play a role in controlling population explosions of rodents and
rabbits [36].
  • 5. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 2. Addison, E. M.; Baker, I. K.; Hunter, D. B. 1987. Diseases and parasites of furbearers. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch, B., eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: [Pages unknown]
  • 3. Allen, A. W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, J. A.; Obbard, M. E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. Ottawa, ON: Ontario Ministry of Natural Resources: 164-179. [24997]
  • 7. Cowardin, Lewis M.; Gilmer, David S.; Shaiffer, Charles W. 1985. Mallard recruitment in the agricultural environment of North Dakota. Wildlife Monographs. 92: 1-37. [25560]
  • 26. Sargeant, Alan B. 1978. Red fox prey demands and implications to prairie duck production. Journal of Wildlife Management. 42(3): 520-527. [25435]
  • 33. Trainer, Daniel O.; Hale, James B. 1969. Sarcoptic mange in red foxes and coyotes of Wisconsin. Bulletin of the Wildlife Disease Association. 5: 387-391. [25437]
  • 36. Voigt, Dennis R. 1987. Red fox. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch, B., eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 380-393. [25264]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Not listed in CITES Appendices at species level. V. v. necator in the Sierra Nevada, California, USA, is rare, possibly declining (Nowak 1991). The subspecies griffithi, montana and pusilla (=leucopus) are listed as CITES – Appendix III (India).

Present in most temperate-subarctic conservation areas with the exception of some inaccessible islands in the Old World and South America. Widely regarded as a pest and unprotected. Most countries and/or states where trapping or hunting occurs have regulated closed versus open seasons and restrictions on methods of capture. In the European Union, Canada, and the Russian Federation, trapping methods are regulated under an agreement on international trapping standards between these countries, which was signed in 1997. Other countries are signatories to ISO/DIS 10990-5.2 animal (mammal) traps, which specifies standards for trap testing.

Foxes are highly persecuted and heavily hunted in Afghanistan, however, it is an adaptable species that produces large litters. Therefore the Government of Afghanistan has listed V. vulpes as a harvestable species (with regular monitoring of populations to ensure hunting does not qualify the fox for a protected status in the future).

In Europe and North America, hunting traditions and/or legislation impose closed seasons on fox hunting. In the UK and a few other European countries, derogation from these provisions allows breeding season culling for pest-control purposes. Here, traditional hunting ethics encouraging restrained "use" may be at odds with harder hitting pest-control ambitions. This apparent conflict between different interest groups is particularly evident in the UK, where fox control patterns are highly regionally variable (Macdonald et al. 2003). In some regions, principal lowland areas where classical mounted hunting operates, limited economic analyses suggest that the principal motive for these communal fox hunts is as a sport – the number killed is small compared with the cost of the hunting. In these regions, most anthropogenic mortality is by individual farmers shooting foxes. The mounted communal hunts do exhibit restraint – hunting takes place for a limited season, and for a prescribed number of days per week. Elsewhere, in upland regions, communal hunting by foot with guns and dogs may make economic sense, depending on the number of lambs lost to foxes (data on this is poor), and also on the current value of lost lambs. This type of fox hunting may also be perceived as a sport by its participants.

An individual deciding whether or not to control foxes, and by what means, has a complex set of factors to consider, including other interest groups, practicality and economics. For some farmers, there is evidence that a decision to control foxes may be economically perverse. Macdonald et al. (2003) modelled the interactions between foxes, rabbits, and rabbit-induced crop damage. For some farmers at least, a decision to kill a fox may, in some circumstances, cost that farmer a significant amount of crop loss to the rabbits that the fox and its descendants would have killed.

In addition to fur farms, Red Foxes are widely kept in small wildlife parks and zoos, but there appears to be no systematic data on their breeding success. Being extremely shy they are often poor exhibits.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Sterile red foxes have been used to eliminate introduced arctic foxes from Alaskan islands (to restore habitat for birds) (Bailey 1992, 1993).

Control of red fox predation on duck nests in the prairie pothole region can be facilitated by managing for the presence of low number of coyotes, which exclude the more destructive foxes (NBS news release, 29 June 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The red fox is legislatively widely regarded as vermin and is therefore unprotected (3). In Britain, it is protected by closed seasons against hunting (3). No conservation measures are in place (3). Research into fox predation and control is being carried out by the Game Conservancy Trust (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Red foxes are considered by many to be threats to poultry. In general, foxes hunt their natural prey, but individual foxes may learn to target domestic birds if they are not adequately protected. Foxes are known vectors for rabies and can transmit the disease to humans and other animals.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red foxes are important fur bearers and more are raised on farms than any other wild fur bearing mammal. Red foxes also help to control populations of small rodents and rabbits and may disperse seeds.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Red foxes are considered by many to be threats to poultry. In general, foxes hunt their natural prey, but individual foxes may learn to target domestic birds if they are not adequately protected. Foxes are known vectors for rabies and can transmit the disease to humans and other animals.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red foxes are important fur bearers and more are raised on farms than any other wild fur bearing mammal. Red foxes also help to control populations of small rodents and rabbits and may disperse seeds.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Harvested for pelt in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: In California, expanding non-native red fox populations pose a threat to endangered kit fox populations (Ralls and White 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red fox

The red fox (Vulpes vulpes) is the largest of the true foxes and the most geographically spread member of the Carnivora, being distributed across the entire Northern Hemisphere from the Arctic Circle to North Africa, Central America and Asia. Its range has increased alongside human expansion, having been introduced to Australia, where it is considered harmful to native mammal and bird populations. Because of these factors, it is listed as Least Concern for extinction by the IUCN.[1] Due to its presence in Australia, it is included among the IUCN's list of the "world's 100 worst invasive species".[3]

The red fox originated from smaller-sized ancestors from Eurasia during the Middle Villafranchian period,[4] and colonised North America shortly after the Wisconsin glaciation.[5] Among the true foxes, the red fox represents a more progressive form in the direction of carnivory.[6] Apart from its large size, the red fox is distinguished from other fox species by its ability to adapt quickly to new environments and, unlike most of its related species, is not listed as endangered anywhere. Despite its name, the species often produces individuals with abnormal colourings, including albinos and melanists.[7] Forty-five subspecies are currently recognised,[8] which are divided into two categories: the large northern foxes, and the small, primitive southern foxes of Asia and the Middle East.[9]

Red foxes are social animals, whose groups are led by a mated pair which monopolises breeding[clarification needed]. Subordinates within a group are typically the young of the mated pair, which remain with their parents to assist in caring for new kits.[10] The species primarily feeds on small rodents, though it may also target leporids, game birds, reptiles, invertebrates[11] and young ungulates.[12] Fruit and vegetable matter is also eaten on occasion.[13] Although the red fox tends to displace or even kill smaller predators, it is nonetheless vulnerable to attack from larger predators, such as wolves, coyotes, golden jackals and medium- and large-sized felines.[14]

The species has a long history of association with humans, having been extensively hunted as a pest and furbearer for centuries, as well as being prominently represented in human folklore and mythology. Because of its widespread distribution and large population, the red fox is one of the most important furbearing animals harvested for the fur trade.[15]

Contents

Evolution [edit]

Comparative illustration of skulls of red fox (left) and Rüppell's fox (right): Note the more developed facial area of the former.

The red fox is considered a more specialised, progressive form of Vulpes than the Afghan, corsac and Bengal foxes in the direction of size and adaptation to carnivory; the skull displays much fewer neotenous traits than in other species, and its facial area is more developed.[6] It is, however, not as maximally adapted for a carnivorous diet as the Tibetan fox.[16]









Arctic fox



Kit fox





Corsac fox




Rüppell's fox



Red fox[17](Fig. 10)






Cape fox





Blanford's fox



Fennec fox





Raccoon dog





Bat-eared fox





Origins [edit]

The species is Eurasian in origin, and may have evolved from either Vulpes alopecoides or the related Chinese V. chikushanensis, both of which lived during the Middle Villafranchian.[4] The earliest fossil specimens of V. vulpes were uncovered in Barany, Hungary dating from between 3.4 and 1.8 million years ago.[18] The ancestral species was likely smaller than the current one, as the earliest red fox fossils are smaller than modern populations.[4] The earliest fossil remains of the modern species date back to the mid-Pleistocene in association with the refuse of early human settlements. This has led to the theory that the red fox was exploited by primitive humans as both a source of food and pelts.[19]

Colonisation of North America [edit]

Red foxes colonized the North American continent in two waves: during or before the Illinoian glaciation, and during the Wisconsinan glaciation.[20] In the far north, red fox fossils have been found in Sangamonian deposits in the Fairbanks District and Medicine Hat. Fossils dating from the Wisconsian are present in 25 sites in Arkansas, California, Colorado, Idaho, Missouri, New Mexico, Tennessee, Texas, Virginia and Wyoming. Although they ranged far south during the Wisconsian, the onset of warm conditions shrank their range toward the north, and have only recently reclaimed their former American ranges because of human-induced environmental changes.[5] Genetic testing indicates two distinct red fox refugia exist in North America, which have been separated since the Wisconsian. The northern (or boreal) refugium occurs in Alaska and western Canada, and consists of the large subspecies V. v. alascensis, V. v. abietorum, V. v. regalis and V. v. rubricosa. The southern (or montane) refugium occurs in the Rocky Mountains' subalpine parklands and alpine meadows, the Cascade Range and Sierra Nevada. It encompasses the subspecies V. v. macroura, V. v. cascadensis and V. v. necator. The latter clade has been separated from all other red fox populations since the last glacial maximum, and may possess unique ecological or physiological adaptations.[20]

Subspecies [edit]

Skull of a northern fox
Skull of a southern grey desert fox

As of 2005,[8] 45 subspecies are recognised. In 2010, another possible distinct subspecies was discovered in Sacramento Valley through mitochondrial haplotype studies.[21]

Substantial gene pool mixing between different subspecies is known; British red foxes have crossbred extensively with foxes imported from Germany, France, Belgium, Sardinia, and possibly Siberia and Scandinavia.[22] European foxes were introduced to portions of the USA in the 18th century, thus crossbreeding with local North American populations.[23] Also, introduced eastern red foxes in California may be interbreeding with local V. v. necator populations.[24] Red fox subspecies are divided into two categories:[9]

  • Northern foxes are large and brightly coloured.
  • Southern grey desert foxes include the Asian subspecies V. v. griffithi, V. v. pusilla and V. v. flavescens. These foxes display transitional features between northern red foxes and smaller fox species; their skulls possess more primitive, neotenous traits than the northern forms,[16] and are also much smaller; the maximum sizes attained by southern foxes are invariably less than the average sizes of northern foxes. Their limbs are also longer, and their ears larger.[25]

Red foxes living in Middle Asia show physical traits intermediate to the northern and southern forms.[26]

Description [edit]

Build [edit]

Red fox (left) and corsac fox (right) yawning

The red fox has an elongated body and relatively short limbs. The tail, which is longer than half the body length[54] (70% of head and body length),[55]) is long, fluffy and reaches the ground when in a standing position. Their pupils are oval and vertically oriented.[54] Nictitating membranes are present, but move only when the eyes are closed. The forepaws have five digits, while the hind feet have only four and lack dewclaws.[56] They are very agile, being capable of jumping over 2 metre high fences and swim well.[57] Vixens have three pairs of teats,[54] though vixens with 7, 9 or 10 teats are not uncommon.[56] The testes of males are smaller than those of Arctic foxes.[58]

Their skulls are fairly narrow and elongated with small braincases. Their canine teeth are relatively long. Sexual dimorphism of the skull is more pronounced than in corsac foxes, with female red foxes tending to have smaller than average skulls than males, with wider nasal regions and hard palates, as well as having larger canines.[59] Their skulls are distinguished from those of dogs by their narrower muzzles, less crowded premolars, more slender canine teeth and their concave rather than convex profiles.[60]

Dimensions [edit]

Red foxes are the largest species of the genus Vulpes.[61] However, relative to dimensions, red foxes are much lighter than similarly sized dogs of the Canis genus. Their limb bones, for example, weigh 30% less per unit area of bone than expected for similarly sized dogs.[62] They display significant individual, sexual, age and geographical variation in size. On average, adults measure 35–50 cm (14–20 in) high at the shoulder and 45 to 90 cm (18 to 35 in) in body length with tails measuring 32 to 53 cm (13 to 21 in). The ears measure 7.7–12.5 cm (3–5 in) and the hind feet 12–18.5 cm (5–7 in). They weigh 2.2 to 14 kg (4.9 to 31 lb), with vixens typically weighing 15–20% less than males.[63][64] Adult red foxes have skulls measuring 129–167 mm, while those of vixens measure 128–159 mm.[6] The forefoot print measures 60 mm in length and 45 mm in width, while the hind foot print measures 55 mm long and 38 mm wide. They trot at a speed of 6–13 km/h, and have a maximum running speed of 50 km/h. They have a stride of 25–35 cm when walking at a normal pace.[65] North American red foxes are generally lightly built, with comparatively long bodies for their mass and have a high degree of sexual dimorphism. British red foxes are heavily built, but short, while continental European red foxes are closer to the general average among red fox populations.[66] The largest red fox on record in Great Britain was a 17.2 kg (38.1 lbs), 1.4m long male, killed in Aberdeenshire, Scotland in early 2012.[67]

Fur [edit]

The winter fur is dense, soft, silky and relatively long. In northern foxes, the fur is very long, dense and fluffy, but is shorter, sparser and coarser in southern forms.[54] Among northern foxes, the North American varieties generally have the silkiest guard hairs,[68] while most Eurasian red foxes have coarser fur.[69] There are three main colour morphs; red, silver/black and cross (see Mutations).[55] In the typical red morph, their coats are generally bright reddish-rusty with yellowish tints. A stripe of weak, diffuse patterns of many brown-reddish-chestnut hairs occurs along the spine. Two additional stripes pass down the shoulder blades which, together with the spinal stripe, form a cross. The lower back is often a mottled silvery colour. The flanks are lighter coloured than the back, while the chin, lower lips, throat and front of the chest are white. The remaining lower surface of the body is dark, brown or reddish.[54] During lactation, the belly fur of vixens may turn brick red.[56] The upper parts of the limbs are rusty-reddish, while the paws are black. The frontal part of the face and upper neck is bright brownish-rusty red, while the upper lips are white. The backs of the ears are black or brownish-reddish, while the inner surface is whitish. The top of the tail is brownish-reddish, but lighter in colour than the back and flanks. The underside of the tail is pale grey with a straw coloured tint. A black spot, the location of the supracaudal gland, is usually present at the base of the tail. The tip of the tail is white.[54]

Mutations [edit]

Various red fox colour mutations
White morph red foxes may be distinguished from Arctic foxes by their 25% greater size, longer muzzles, and longer, pointed ears [70] This example shows the dark pigment of the eyes, nose, and lips that would not occur in an albino. Complete albinism in red foxes is rare and primarily occurs in southern forest zones. Typically, albinism is accompanied by deformations and usually develops in years of insufficient food.[71]

Atypical colourations in red foxes usually represent stages toward full melanism,[7] and mostly occur in cold regions.[72]

Colour variantImageDescription
RedRed fox fur skin (Sweden).jpgThe typical colouration. See Fur
GreyThe rump and spine is brown or grey with light yellowish bands on the guard hairs. The cross on the shoulders is brown, rusty brown or brownish-reddish. The limbs are brown[7]
CrossVulpes vulpes (cross fox) Norway & Canada.jpgThe fur has a darker colouration to the former. The rump and lower back are dark brown or dark grey, with varying degrees of silver on the guard hairs. The cross on the shoulders is black or brown, sometimes with light silvery fur. The feet and head are brown[7]
Blackish-brownThe melanistic form of the Eurasian red fox. Has blackish-brown or black skin with a light-brownish tint. The skin usually has an admixture of various amounts of silver. Reddish hairs are either completely absent or in small quantities[73]
SilverVulpes vulpes - silver fox fur skin.jpgThe melanistic form of the North American red fox, but introduced to the Old World by the fur trade. Characterised by pure black colour with a variable admixture of silver (covering 25–100% of the skin area)[73]
PlatinumVulpes vulpes (Platinum fox) fur skin.jpgDistinguished from the silver morph by its late pale, almost silver-white fur with a bluish cast[74]
AmberVulpes vulpes (Amber fox) fur skin.jpg
SamsonVulpes vulpes Mutation.jpgDistinguished by its woolly pelt which lacks guard hairs[70][75]

Senses [edit]

Red foxes have binocular vision,[56] but their sight reacts mainly to movement. Their auditory perception is acute, being able to hear black grouses changing roosts at 600 paces, the flight of crows at 1/4-1/2 km and the squeaking of mice at about 100 metres.[76] They are capable of locating sounds to within one degree at 700–3,000 Hz, though less accurately at higher frequencies.[57] Their sense of smell is good, but weaker than that of specialized dogs.[76]

Scent glands [edit]

Red foxes have a pair of anal sacs lined by sebaceous glands, both of which open through a single duct. The anal sacs act as fermentation chambers in which aerobic and anaerobic bacteria convert sebum into odorous compounds, including aliphatic acids. The oval-shaped caudal gland is 25 mm long and 13 mm wide, and reportedly smells of violets.[56][77] The presence of foot glands is equivocal. The interdigital cavities are deep, with a reddish tinge and smell strongly. Sebaceous glands are present on the angle of the jaw and mandible.[56]

Behaviour [edit]

A pair of European red foxes at the British Wildlife Centre, Surrey, England

Social and territorial behaviour [edit]

Red foxes either establish stable home ranges within particular areas or are itinerant with no fixed abode.[78] They use their urine to mark their territories.[79][80][81][82][83] A male fox raises one hind leg and his urine is sprayed forward in front of him, whereas a female fox squats down so that the urine is sprayed in the ground between the hind legs.[84] Urine is also used to mark empty cache sites, used to store found food, as reminders not to waste time investigating them.[85][86][87] They use various postures[clarify] to urinate, depending on where they are leaving a scent mark.[88] Red foxes live in family groups sharing a joint territory. In favourable habitats and/or areas with low hunting pressure, subordinate foxes may be present in a range. Subordinate foxes may number 1-2, sometimes up to 8 in one territory. These subordinates could be formerly dominant animals, but are mostly young from the previous year, who act as helpers in rearing the breeding vixen's kits. Alternatively, their presence has been explained as being in response to temporary surpluses of food unrelated to assisting reproductive success. Non-breeding vixens will guard, play, groom, provision and retrieve kits,[10] an example of kin selection. Red foxes may leave their families once they reach adulthood if the chances of winning a territory of their own are high. If not, they will stay with their parents, at the cost of postponing their own reproduction.[89]

European red fox kit, still in dark, woolly neonatal fur

Reproduction and development [edit]

A pair of Cascade mountain foxes (V. v. cascadensis) mating in Washington D.C.

Red foxes reproduce once a year in spring. Two months prior to oestrus (typically December), the reproductive organs of vixens change shape and size. By the time they enter their oestrus period, their uterine horns double in size, and their ovaries grow 1.5-2 times larger. Sperm formation in males begins in August–September, with the testicles attaining their greatest weight in December–February.[90] The vixen's oestrus period lasts 3 weeks,[91] during which the dog-foxes mate with the vixens for several days, often in burrows. Copulation is accompanied by a copulatory tie which may last for more than an hour.[91] The copulatory tie occurs when the bulbus glandis at the base of the male fox's penis enlarges.[92] The gestation period lasts 49–58 days.[93] Though foxes are largely monogamous, DNA evidence from one population indicated large levels of polygyny, incest and mixed paternity litters.[91] Subordinate vixens may become pregnant, but usually fail to whelp, or have their kits killed postpartum by either the dominant female or other subordinates.[94]

The average litter size consists of four to six kits, though litters of up to 13 kits have occurred.[93] Large litters are typical in areas where fox mortality is high.[95] Kits are born blind, deaf and toothless, with dark brown fluffy fur. At birth, they weigh 56–110 g and measure 14.5 cm in body length and 7.5 cm in tail length. At birth, they are short-legged, large-headed and have broad chests.[96] Mothers remain with the kits for 2–3 weeks, as they are unable to thermoregulate. During this period, the fathers or barren vixens feed the mothers.[94] Vixens are very protective of their kits, and have been known to even fight off terriers in their defence.[97] If the mother dies before the kits are independent, the father takes over as their provider.[98] The kit's eyes open after 13–15 days, during which time their ear canals open and their upper teeth erupt, with the lower teeth emerging 3–4 days later.[96] Their eyes are initially blue, but change to amber at 4–5 weeks. Coat colour begins to change at 3 weeks of age, when the black eye streak appears. By one month, red and white patches are apparent on their faces. During this time, their ears erect and their muzzles elongate.[94] Kits begin to leave their dens and experiment with solid food brought by their parents at the age of 3–4 weeks. The lactation period lasts 6–7 weeks.[90] Their woolly coats begin to be coated by shiny guard hairs after 8 weeks.[94] By the age of 3–4 months, the kits are long-legged, narrow-chested and sinewy. They reach adult proportions at the age of 6–7 months.[96] Some vixens may reach sexual maturity at the age of 9–10 months, thus bearing their first litters at one year of age.[90] In captivity, their longevity can be as long as 14 years, though in the wild they typically do not survive past 1.5 years of age.[99]

Denning behaviour [edit]

Side and above view of a red fox den

Outside the breeding season, most red foxes favour living in the open, in densely vegetated areas, though they may enter burrows to escape bad weather.[10] Their burrows are often dug on hill or mountain slopes, ravines, bluffs, steep banks of water bodies, ditches, depressions, gutters, in rock clefts and neglected human environments. Red foxes prefer to dig their burrows on well drained soils. Dens built among tree roots can last for decades, while those dug on the steppes last only several years.[100] They may permanently abandon their dens during mange outbreaks, possibly as a defence mechanism against the spread of disease.[10] In the Eurasian desert regions, foxes may use the burrows of wolves, porcupines and other large mammals, as well as those dug by gerbil colonies. Compared to burrows constructed by Arctic foxes, badgers, marmots and corsac foxes, red fox dens are not overly complex. Red fox burrows are divided into a den and temporary burrows, which consist only of a small passage or cave for concealment. The main entrance of the burrow leads downwards (40–45°) and broadens into a den, from which numerous side tunnels branch. Burrow depth ranges from 0.5–2.5 metres, rarely extending to ground water. The main passage can reach 17 metres in length, standing an average of 5–7 metres. In spring, red foxes clear their dens of excess soil through rapid movements, first with the forepaws then with kicking motions with their hind legs, throwing the discarded soil over 2 metres from the burrow. When kits are born, the discarded debris is trampled, thus forming a spot where the kits can play and receive food.[100] They may share their dens with woodchucks[101] or badgers.[102] Unlike badgers, which fastidiously clean their earths and defecate in latrines, red foxes habitually leave pieces of prey around their dens.[103] The average sleep time of a captive red fox is said to be 9.8 hours per day.[104]

Communication [edit]

Body language [edit]

A European red fox (V. vulpes crucigera) in an inquisitive posture

Red fox body language consists of movements of the ears, tail and postures, with their body markings emphasising certain gestures. Postures can be divided into aggressive/dominant and fearful/submissive categories. Some postures may blend the two together.[89]

A pair of Wasatch mountain foxes (V. v. macroura) squabbling

Inquisitive foxes will rotate and flick their ears whilst sniffing. Playful individuals will perk their ears and rise on their hind legs. Male foxes courting females, or after successfully evicting intruders, will turn their ears outwardly, and raise their tails in a horizontal position, with the tips raised upward. When afraid, red foxes grin in submission, arching their backs, curving their bodies, crouching their legs and lashing their tails back and forth with their ears pointing backwards and pressed against their skulls. When merely expressing submission to a dominant animal, the posture is similar, but without arching the back or curving the body. Submissive foxes will approach dominant animals in a low posture, so that their muzzles reach up in greeting. When two evenly matched foxes confront each other over food, they approach each other sideways and push against each other's flanks, betraying a mixture of fear and aggression through lashing tails and arched backs without crouching and pulling their ears back without flattening them against their skulls. When launching an assertive attack, red foxes approach directly rather than sideways, with their tails aloft and their ears rotated sideways.[89] During such fights, red foxes will stand on each other's upper bodies with their forelegs, using open mouthed threats. Such fights typically only occur among juveniles or adults of the same sex.[105]

Vocalisations [edit]

Red foxes have a wide vocal range, and produce different sounds spanning five octaves, which grade into each other.[106] Recent analyses identify 12 different sounds produced by adults and 8 by kits.[105] The majority of sounds can be divided into "contact" and "interaction" calls. The former vary according to the distance between individuals, while the latter vary according to the level of aggression.[106]

  • Contact calls: The most commonly heard contact call is a 3–5 syllable barking "wow wow wow" sound, which is often made by two foxes approaching one another. This call is most frequently heard from December to February (when they can be confused with the territorial calls of tawny owls). The "wow wow wow" call varies according to individual; captive foxes have been recorded to answer pre-recorded calls of their pen-mates, but not those of strangers. Kits begin emitting the "wow wow wow" call at the age of 19 days, when craving attention. When red foxes draw close together, they emit trisyllabic greeting warbles similar to the clucking of chickens. Adults greet their kits with gruff huffing noises.[106]
  • Interaction calls: When greeting one another, red foxes emit high pitched whines, particularly submissive animals. A submissive fox approached by a dominant animal will emit an ululating siren-like shriek. During aggressive encounters with conspecifics, they emit a throaty rattling sound, similar to a ratchet, called "gekkering". Gekkering occurs mostly during the courting season from rival males or vixens rejecting advances.[106]

Another call which does not fit into the two categories is a long, drawn out, monosyllabic "waaaaah" sound. As it is commonly heard during the breeding season, it is thought to be emitted by vixens summoning males. When danger is detected, foxes emit a monosyllabic bark. At close quarters, it is a muffled cough, while at long distances it is sharper. Kits make warbling whimpers when nursing, these calls being especially loud when they are dissatisfied.[106]

Ecology [edit]

Diet, hunting and feeding behaviour [edit]

Red fox with rodent prey in Canada

Red foxes are omnivores with a highly varied diet. In the former Soviet Union, up to 300 animal and a few dozen plant species are known to be consumed by them.[11] They primarily feed on small, mouse-like rodents like voles, mice, ground squirrels, hamsters, gerbils,[11] woodchucks, pocket gophers and deer mice.[13] Secondary prey species include birds (with passeriformes, galliformes and waterfowl predominating), leporids, porcupines, raccoons, opossums, reptiles, insects, other invertebrates and flotsam (marine mammals, fish and echinoderms).[11][13] On very rare occasions, they may attack young or small ungulates.[12] They typically target mammals up to about 3.5 kg in weight, and require 500 grams of food daily.[57] Red foxes readily eat plant material and in some areas, fruit can amount to 100% of their diet in autumn. Commonly consumed fruits include blueberries, blackberries, raspberries, cherries, persimmons, mulberries, apples, plums, grapes and acorns. Other plant material includes grasses, sedges and tubers.[13]

Red foxes prefer to hunt in the early morning hours before sunrise and late evening.[107] When hunting mouse-like prey, they first pinpoint their prey's location by sound, then leap, sailing high above their quarry, steering in mid-air with their tails, before landing on target up to five metres away.[62] They typically only feed on carrion in the late evening hours and at night.[108] They are extremely possessive of their food, and will defend their catches from even dominant animals.[109] Red foxes may occasionally commit acts of surplus killing; during one breeding season, four foxes were recorded to have killed circa 200 black-headed gulls each, with peaks during dark, windy hours when flying conditions were unfavourable. Losses to poultry and penned game birds can be substantial because of this.[91][110] Red foxes seem to dislike the taste of moles, but will nonetheless catch them alive and present them to their kits as playthings.[111]

Enemies and competitors [edit]

Red fox confronting grey fox, San Joaquin National Wildlife Refuge.
Golden eagle feeding on red fox, Navasrky, Czech Republic

Red foxes typically dominate other fox species. Arctic foxes generally escape competition from red foxes by living farther north, where food is too scarce to support the larger-bodied red species. Although the red species' northern limit is linked to the availability of food, the Arctic species' southern range is limited by the presence of the former. Red and Arctic foxes were both introduced to almost every island from the Aleutian Islands to the Alexander Archipelago during the 1830s–1930s by fur companies. The red foxes invariably displaced the Arctic foxes, with one male red fox having been reported to have killed off all resident Arctic foxes on a small island in 1866.[112] Where they are sympatric, Arctic foxes may also escape competition by feeding on lemmings and flotsam, rather than voles, as favoured by red foxes. Both species will kill each other's kits, given the opportunity.[113] Red foxes are serious competitors of corsac foxes, as they hunt the same prey all year. The red species is also stronger, is better adapted to hunting in snow deeper than 10 cm and is more effective in hunting and caching medium to large-sized rodents. Corsac foxes seem to only outcompete red foxes in semi-desert and steppe areas.[114] In Israel, Blanford's foxes escape competition with red foxes by restricting themselves to rocky cliffs and actively avoiding the open plains inhabited by red foxes.[112] Red foxes dominate kit and swift foxes. Kit foxes usually avoid competition with their larger cousins by living in more arid environments, though red foxes have been increasing in ranges formerly occupied by kit foxes due to human induced environmental changes. Red foxes will kill both species, and compete for food and den sites.[115] Grey foxes are exceptional, as they dominate red foxes wherever their ranges meet. Historically, interactions between the two species were rare, as grey foxes favoured heavily wooded or semiarid habitats as opposed to the open and mesic ones preferred by red foxes. However, interactions have become more frequent due to deforestation allowing red foxes to colonise grey fox inhabited areas.[115]

Wolves may kill and eat red foxes in disputes over carcasses.[116][117] In areas in North America where red fox and coyote populations are sympatric, fox ranges tend to be located outside of coyote territories. The principal cause of this separation is believed to be active avoidance of coyotes by the foxes. Interactions between the two species vary in nature, ranging from active antagonism, to indifference. The majority of aggressive encounters are initiated by coyotes, and there are few reports of red foxes acting aggressively toward coyotes except when attacked or when their kits were approached. Foxes and coyotes have sometimes been seen feeding together.[118] In Israel, red foxes share their habitat with golden jackals. Where their ranges meet, the two canids compete due to near identical diets. Foxes ignore jackal scents or tracks in their territories, and avoid close physical proximity with jackals themselves. Studies show that in areas where jackals become very abundant, the population of foxes decreases significantly, apparently because of competitive exclusion.[119]

Red foxes dominate raccoon dogs, sometimes killing their kits or biting adults to death. Cases are known of foxes killing raccoon dogs entering their dens. Both species compete for mouse-like prey. This competition reaches a peak during early spring, when food is scarce. In Tartaria, red fox predation accounted for 11.1% of deaths among 54 raccoon dogs, and amounted to 14.3% of 186 raccoon dog deaths in north-western Russia.[120]

They may kill small mustelids like weasels,[115] stone martens,[121] pine martens, stoats, kolonoks, polecats and young sables. Eurasian badgers may live alongside red foxes in isolated sections of large burrows.[102] It is possible that the two species tolerate each other out of commensalism; foxes provide badgers with food scraps, while badgers maintain the shared burrow's cleanliness.[103] However, cases are known of badgers driving vixens from their dens and destroying their litters without eating them. Wolverines may kill red foxes, often whilst the latter are sleeping or near carrion. Foxes in turn may kill unattended young wolverines.[102]

Red foxes may compete with striped hyenas on large carcasses. Red foxes may give way to hyenas on unopened carcasses, as the latter's stronger jaws can easily tear open flesh which is too tough for foxes. Foxes may harass hyenas, using their smaller size and greater speed to avoid the hyena's attacks. Sometimes, foxes seem to deliberately torment hyenas even when there is no food at stake. Some foxes may mistime their attacks, and are killed.[122] Fox remains are often found in hyena dens, and hyenas may steal foxes from traps.[123]

In Eurasia, they may be preyed upon by leopards, caracals and Eurasian lynxes. The lynxes chase red foxes into deep snow, where their longer legs and larger paws give them an advantage over foxes, especially when the depth of the snow exceeds one metre.[124] In the Velikoluki district in Russia, red foxes are absent or are seen only occasionally where lynxes establish permanent territories.[124] However, researchers consider lynxes to represent considerably less danger to red foxes than wolves do.[125] North American felid predators of red foxes include cougars, Canadian lynxes and bobcats.[55]

Occasionally, large raptors such as Eurasian eagle owls will prey on young foxes,[126] while golden eagles have been known to kill adults.[127]

Range [edit]

Red foxes are wide ranging animals, whose range covers nearly 70 million km2. They are distributed across the entire northern hemisphere from the Arctic Circle to North Africa, Central America, and Asia. They are absent in Iceland, the Arctic islands, some parts of Siberia, and in extreme deserts.[1]

Red foxes are not present in New Zealand and are classed as a "prohibited new organism" under the Hazardous Substances and New Organisms Act 1996 preventing them from being imported.[128]

Australia [edit]

A feral fox with a native Mountain Brushtail Possum in its mouth on a property in South East Queensland.

In Australia, current estimates indicate that there are more than 7.2 million[129] red foxes with a range extending throughout most of the continental mainland.[130] The species became established in Australia through successive introductions by settlers in 1830s in the British colonies of Van Diemen's Land (as early as 1833) and the Port Phillip District of New South Wales (as early as 1845) for the purpose of the traditional English sport of fox hunting. Curiously a permanent fox population was not established on the island of Tasmania and it is widely held that they were outcompeted by the Tasmanian Devil.[131] On the mainland, however, the species was successful as an apex predator. It is generally less common in areas where the dingo is more prevalent, however it has, primarily through its burrowing behaviour, achieved niche differentiation with both the feral dog and the feral cat. As such it has become one of the continent's most invasive species. The red fox has been implicated in the extinction and decline of several native Australian species, particularly those of the Potoroidae family including the Desert rat-kangaroo.[132] The spread of red foxes across the southern part of the continent has coincided with the spread of rabbits in Australia and corresponds with declines in the distribution of several medium-sized ground-dwelling mammals, including brush-tailed bettongs, burrowing bettongs, rufous bettongs, bilbys, numbats, bridled nailtail wallabys and quokkas.[133] Most of these species are now limited areas (such as islands) where red foxes are absent or rare. Local eradication programs exist, although eradication has proven difficult due to the denning behaviour and noctural hunting, so the focus is on management with the introduction of state bounties.[134] According to the Tasmanian government, red foxes were introduced to the previously fox free island of Tasmania in 1999 or 2000, posing a significant threat to native wildlife including the Eastern Bettong and an eradication program conducted by the Tasmanian Department of Primary Industries and Water has been established.[135][136]

Sardinia [edit]

The origin of the Sardinian ichnusae subspecies is uncertain, as it is absent from Pleistocene deposits in their current homeland. It is possible it originated during the Neolithic following its introduction to the island by humans. It is likely then that Sardinian fox populations stem from repeated introductions of animals from different localities in the Mediterranean. This latter theory may explain the subspecies' phenotypic diversity.[19]

Diseases and parasites [edit]

European red fox with mange

Red foxes are the most important rabies vector in Europe. In London, arthritis is not uncommon in foxes, being particularly frequent in the spine.[137] Foxes may be infected with leptospirosis and tularemia, though they are not overly susceptible to the latter. They may also fall ill from listerellosis and spirochetosis, as well as acting as vectors in spreading erysipelas, brucellosis and tick-born encephalitis. A mysterious fatal disease near Lake Sartlan in the Novosibirsk Oblast was noted among local red foxes, but the cause was undetermined. The possibility was considered that it was caused by an acute form of encephalomyelitis, which was first observed in captive bred silver foxes. Individual cases of foxes infected with Yersina pestis are known.[138]

Red foxes are not overly infested with fleas. Species like Spilopsyllus cuniculi are probably only caught from the fox's prey species, while others like Archaeopsylla e. erinacei are caught whilst travelling. Fleas which actively feed on red foxes include Pulex irritans, Ctenocephalides canis and Paraceras melis. Ticks such as Ixodes ricinus and I. hexagonus are not uncommon in foxes, and are typically found on nursing vixens and kits still in their earths. The louse Trichodectes vulpis specifically targets foxes, but is found infrequently. The mite Sarcoptes scabiei is the most important cause of mange in red foxes. It causes extensive hair loss, starting from the base of the tail and hindfeet, then the rump before moving on to the rest of the body. In the final stages of the condition, foxes can lose most of their fur, 50% of their body weight and may gnaw at infected extremities. In the epizootic phase of the disease, it usually takes foxes 4 months to die after infection. Other endoparasites include Demodex folliculorum, Notoderes, Otodectes cynotis (which is frequently found in the ear canal), Linguatula serrata (which infects the nasal passages) and ringworms.[137][138]

Eucoleus aerophilus (orCapillaria aerophila), agent of pulmonary capillariasis in foxes

Up to 60 helminth species are known to infect foxes in fur farms, while 20 are known in the wild. Several coccidian species of the genera Isospora and Eimeria are also known to infect them.[138] The most common nematode species found in fox guts are Toxocara canis and Uncinaria stenocephala, Capillaria aerophila [139] and Crenosoma vulpis, the latter two infect their lungs. Capillaria plica infect the fox's bladder. Trichinella spiralis rarely affects them. The most common cestode species in foxes are Taenia spiralis and T. pisiformis. Others include Echinococcus granulosus and E. multilocularis. Eleven trematode species infect red foxes.[137]

Relationships with humans [edit]

In folklore and mythology [edit]

Reynard the Fox in an 1869 children's book.
Nine-tailed fox, from the Qing edition of the Shan Hai Jing

Red foxes feature prominently in the folklore and mythology of human cultures with which they are sympatric. In Greek mythology, the Teumessian fox[140] or Cadmean vixen, was a gigantic fox that was destined never to be caught. The fox was one of the children of Echidna.

In Celtic mythology, the red fox is a symbolic animal. In the Cotswolds, witches were thought to take the shape of foxes in order to steal butter from their neighbours.[141] In later European folklore, the figure of Reynard the Fox symbolises trickery and deceit. He originally appeared (then under the name of "Reinardus") as a secondary character in the 1150 poem Ysengrimus. He reappeared in 1175 in Pierre Saint Cloud's Le Roman de Renart, and made his debut in England in Geoffrey Chaucer's The Nun's Priest's Tale. Many of Reynard's adventures may stem from actual observations on fox behaviour ; he is an enemy of the wolf and has a fondness for blackberries and grapes.[142]

Chinese folk tales tell of fox-spirits called huli jing that may have up to nine tails, or kumiho as they are known in Korea.[143] In Japanese mythology, the kitsune are fox-like spirits possessing magical abilities that increase with their age and wisdom. Foremost among these is the ability to assume human form. While some folktales speak of kitsune employing this ability to trick others, other stories portray them as faithful guardians, friends, lovers, and wives.[144]

In Arab folklore, the fox is considered a cowardly, weak, deceitful and cunning animal, said to feign death by filling its abdomen with air in order to appear bloated, then lies on its side, awaiting the approach of unwitting prey.[145]

The animal's cunning was noted by the authors of the Bible, and applied the word "fox" to false prophets (Ezekiel 13:4) and the hypocrisy of Herod Antipas (Luke 13:32).[146]

The cunning Fox is commonly found in Native American mythology, where it is portrayed as an almost constant companion to coyote. Fox, however, is a deceitful companion who often steals Coyote's food. In the Achomawi creation myth, Fox and Coyote are the co-creators of the world, who leave just before the arrival of humans. The Yurok tribe believed that Fox, in anger, captured the sun, and tied him to a hill, causing him to burn a great hole in the ground. An Inuit story tells of how Fox, portrayed as a beautiful woman, tricks a hunter into marrying her, only to resume her true form and leave after he offends her. A Menominee story tells of how Fox is an untrustworthy friend to the Wolf.[147]

Hunting [edit]

Beagle and Fox (1885) by Bruno Liljefors

The earliest historical records of fox hunting come from the 4th century BC ; Alexander the Great is known to have hunted foxes and a seal dated from 350 BC depicts a Persian horseman in the process of spearing a fox. Xenophon, who viewed hunting as part of a cultured man's education, advocated the killing of foxes as pests, as they distracted hounds from hares. The Romans were hunting foxes by 80 AD. During the Dark Ages in Europe, foxes were considered secondary quarries, but gradually grew in importance. Cnut the Great reclassed foxes as Beasts of the Chase, a lower category of quarry than Beasts of Venery. Foxes were gradually hunted less as vermin and more as Beasts of the Chase, to the point that by the late 13th century, Edward I had a royal pack of foxhounds and a specialised fox huntsman. In this period, foxes were increasingly hunted above ground with hounds, rather than underground with terriers. Edward, Second Duke of York assisted the climb of foxes as more prestigious quarries in his The Master of Game. By the Renaissance, fox hunting became a traditional sport of the nobility. After the English Civil War saw a drop in deer populations, fox hunting grew in popularity. By the mid 17th century, Britain was divided into fox hunting territories, with the first fox hunting clubs being formed (the first being the Charlton Hunt Club in 1737). The popularity of fox hunting in Britain reached a peak during the 18th century.[148] Although already native to North America, red foxes from England were imported for sporting purposes to Virginia and Maryland in 1730 by prosperous tobacco planters.[149] These American fox hunters considered the red species more sporting than grey species.

The grays furnished more fun, the reds more excitement. The grays did not run so far, but usually kept near home, going in a circuit of six or eight miles. 'An old red,' generally so called irrespective of age, as a tribute to his prowess, might lead the dogs all day, and end by losing them as evening fell, after taking them a dead stretch for thirty miles. The capture of a gray was what men boasted of ; a chase after 'an old red' was what they 'yarned' about.

[150]

Red foxes are still widely persecuted as pests, with human-caused deaths being among the highest causes of mortality in the species. Annual fox kills are: UK 21,500–25,000 (2000); Germany 600,000 (2000–2001); Austria 58,000 (2000–2001); Sweden 58,000 (1999–2000); Finland 56,000 (2000–2001); Denmark 50,000 (1976–1977); Switzerland 34,832 (2001); Norway 17,000 (2000–2001); Saskatchewan (Canada) 2,000 (2000–2001); Nova Scotia (Canada) 491 (2000–2001); New Mexico (USA) 69 (1999–2000).[121]

Fur use [edit]

Red fox skins

Because of their abundance, red foxes are among the most important furbearing animals harvested by the fur trade. Their pelts are used for trimmings, scarfs, muffs, jackets and coats. They are principally used as trimming for both cloth coats and fur garments, including evening wraps.[15] The pelts of silver-morph foxes are popular as capes,[151] while cross foxes are mostly used for scarfs and very rarely trimming.[152] The number of sold fox scarfs exceeds the total number of scarfs made from other furbearers. However, this amount is overshadowed by the total number of fox pelts used for trimming purposes.[15] The silver morphs are the most valued by furriers, followed by the cross and red morphs respectively.[153] In the early 20th century, over 1,000 American fox skins were imported to Britain annually, while 500,000 were exported annually from Germany and Russia.[154] The total worldwide trade of wild red foxes in 1985–86 was 1,543,995 pelts. Foxes amounted to 45% of US wild-caught pelts worth $50 million.[121]

North American red foxes, particularly those of northern Alaska, are the most valued for their fur, as they have guard hairs of a very silky texture which, after dressing, allow the wearer unrestricted mobility. Red foxes living in southern Alaska's coastal areas and the Aleutian Islands are an exception, as they have extremely coarse pelts which rarely exceed one third of the price of their northern Alaskan cousins.[68] Most European peltries have very coarse textured fur compared to North American varieties. The only exceptions are the Nordic and Far Eastern Russian peltries, but they are still inferior to North American peltries in terms of silkiness.[69]

Livestock, game and pet predation [edit]

Red foxes are implicated in the destruction of game and song birds, hares, rabbits, muskrats and young ungulates, particularly in preserves, reserves, and hunting farms where ground nesting birds are protected and raised, as well as in poultry farms.[155] Foxes may on occasions prey on lambs. Usually, lambs targeted by foxes tend to be physically weakened specimens, but not invariably. Lambs belonging to small breeds, such as blackface, are more vulnerable than larger breeds such as merino. Twins may be more vulnerable to foxes than singlets, as ewes cannot effectively defend both simultaneously. Crossbreeding small, upland ewes with larger, lowland rams can cause difficult and prolonged labour for ewes due to the heaviness of the resulting offspring, thus making the lambs more at risk to fox predation. Lambs born from gimmers (ewes breeding for the first time) are more often killed by foxes than those of experienced mothers, who stick closer to their young.[156] It is often the case that the extent of game and livestock predation by red foxes is exaggerated, since the degree of fox damage is usually determined by the remains of food found at their burrows.[155] In Australia, foxes may prey on 10–30% of lambs, costing Australian sheep breeders more than A$100 million annually.[157] In areas where foxes are a problem, a Coordinated Fox Control Project is held in conjunction with the local Rural Lands Protection Board (RLPB) and National Parks and Wildlife Service (NPWS) to facilitate a neighbourhood baiting campaign.[158]

Red foxes may prey on domestic rabbits and guinea pigs if they are kept in open runs or are allowed to range freely in gardens. This problem is usually averted by housing them in robust hutches and runs. Urban foxes frequently encounter cats and may feed alongside them. In physical confrontations, the cats usually have the upper hand. Authenticated cases of foxes killing cats usually involve kittens. Although most foxes do not prey on cats, some may do so, and may treat them more as competitors rather than food.[159]

Attacks on humans [edit]

  • On 26 June 2002, a fox attacked a 14-week-old boy in Dartford, Kent, UK, grabbing the child's head and attempting to drag him outside before being chased off by the boy's parents.[160][161]
  • In June 2010, an urban fox entered a family home in London, UK, and attacked twin baby girls, who were sleeping in their cots.[162]
  • In October 2010, it was alleged in the press that a fox bit off the nose and 2½ fingers of a comatose 37-year-old man in Inveresk, East Lothian, UK.[163][164]
  • In June 2011, a fox bit two young children who were playing outside in upstate New York.[165]
  • In February 2013, a fox bit a baby in its cot in Bromley, southeast London causing facial injuries and severing a finger.[166]

Taming and domestication [edit]

In their unmodified wild state, red foxes are generally unsuitable as pets. Many supposedly abandoned kits are adopted by well-meaning people during the spring period, though it is unlikely that vixens would abandon their young. Actual orphans are rare, and the ones that are adopted are likely kits that simply strayed from their den site. Kits require almost constant supervision; when still suckling, they require milk at four-hour intervals day and night. Once weaned, they may become destructive to leather objects, furniture and electric cables.[167] Though generally friendly toward people when young, captive red foxes become fearful of humans, save for their handlers, once they reach 10 weeks of age.[168] They maintain their wild counterpart's strong instinct of concealment, and may pose a threat to domestic birds, even when well fed.[169] Although suspicious of strangers, they can form bonds with cats and dogs, even ones bred for fox hunting. Practical uses for tame foxes are few, though they can be encouraged to kill rats and mice in granaries. Tame foxes were once used to draw ducks close to hunting blinds.[170]

A strain of truly domesticated red foxes was introduced by Russian geneticist Dmitry Konstantinovich Belyaev who, over a 40-year period, bred several generations of silver morph foxes on fur farms, selecting only those individuals that showed the least fear of humans. Eventually, Belyaev's team selected only those that showed the most positive response to humans, thus resulting in a population of foxes whose behaviour and appearance was significantly changed. After about ten generations of controlled breeding, these foxes no longer showed any fear of humans, and often wagged their tails and licked their human caretakers to show affection. These behavioural changes were accompanied by physical alterations, which included piebald coats, floppy ears in pups, and curled tails, similar to traits that distinguish domestic dogs from wolves.[171] During the post-Soviet economic crisis of the 1990s, the project ran into funding constraints and was forced to reduce the number of animals from 700 to 100 and began funding the ongoing efforts in part through sales of the strain as pets in addition to looking into other ways to support the project.

Urban foxes [edit]

Red foxes thrive particularly well in urban environments.[57] Throughout the twentieth century, they established themselves in many Australian, European, Japanese, and North American cities. The species first colonised British cities during the 1930s, entering Bristol and London during the 1940s and later establishing themselves in Cambridge and Norwich. In Australia, red foxes were recorded in Melbourne as early as the 1930s, while in Zurich, Switzerland, they only starting appearing in the 1980s.[172] Urban red foxes are most common in residential suburbs consisting of privately owned, low-density housing, but are rare in areas where industry, commerce or council rented houses predominate.[57]

In 2006 it was estimated that there were 10,000 foxes in London.[173] City-dwelling foxes may have the potential to consistently grow larger than their rural counterparts, as a result of abundant scraps and a relative dearth of predators. While foxes will scavenge successfully in the city (and the foxes tend to eat anything that the humans eat) some urban residents will deliberately leave food out for the animals, finding them endearing. Some researchers speculate that the urban fox is evolving into a different species from its countryside cousin, as it has a different diet of mainly man-made food, different survival skills (for example, the ability to cross roads), different places to live (under buildings rather than trees), a lack of their natural fear of humans, and a larger size.[174]

The urban fox has become quite a problem for some people. Disrupting rubbish bins, stealing chickens and wrecking gardens, the urban fox causes a nuisance. In the UK, hunting them is banned and shooting them in an urban environment is not suitable. One alternative has been to trap them, which appears to be an effective method.[175]

Notes [edit]

  1. ^ a b c Macdonald, D.W. & Reynolds, J.C. (2008). Vulpes vulpes. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2006-08-09. Database entry includes justification for why this species is of least concern
  2. ^ Linnæus, Carl (1758). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin) (10 ed.). Holmiæ (Stockholm): Laurentius Salvius. p. 40. Retrieved 23 November 2012. 
  3. ^ "100 of the World's Worst Invasive Alien Species". Invasive Species Specialist Group. 
  4. ^ a b c Kurtén 1968, pp. 115–16
  5. ^ a b Kurtén 1980, pp. 96, 174
  6. ^ a b c Heptner & Naumov 1998, p. 480
  7. ^ a b c d Heptner & Naumov 1998, pp. 475–77
  8. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  9. ^ a b Heptner & Naumov 1998, p. 473
  10. ^ a b c d Harris & Yalden 2008, p. 413
  11. ^ a b c d Heptner & Naumov 1998, pp. 513–24
  12. ^ a b Heptner, V. G. (Vladimir Georgievich); Nasimovich, A. A; Bannikov, Andrei Grigorevich; Hoffmann, Robert S, Mammals of the Soviet Union, v. 1 (1988), Washington, D.C. : Smithsonian Institution Libraries and National Science Foundation
  13. ^ a b c d Feldhamer, Thompson & Chapman 2003, p. 529
  14. ^ Fedriani, J.M., Palomares, F., Delibes, M (1999). "Niche relations among three sympatric Mediterranean carnivores". Oecologia 121: 138–148. doi:10.1007/s004420050915. JSTOR 4222449. 
  15. ^ a b c Bachrach 1953, pp. 229–30
  16. ^ a b Heptner & Naumov 1998, p. 482
  17. ^ Lindblad-Toh et al.; Wade, CM; Mikkelsen, TS; Karlsson, EK; Jaffe, DB; Kamal, M; Clamp, M; Chang, JL et al. (2005). "Genome sequence, comparative analysis and haplotype structure of the domestic dog". Nature 438 (7069): 803–819. doi:10.1038/nature04338. PMID 16341006. 
  18. ^ PaleoDatabase collection No. 35369, authorized by Alan Turner, Liverpool John Moores University. Entry by H. O'Regan, December 8, 2003
  19. ^ a b Spagnesi & De Marina Marinis 2002, p. 222
  20. ^ a b Aubry, Keith B./Statham, Mark J., Sacks, Benjamin N., Perrines, John D. & Wisely, Samantha M. (2009). "Phylogeography of the North American red fox: vicariance in Pleistocene forest refugia". Molecular Ecology 18 (12): 2668–2686. doi:10.1111/j.1365-294X.2009.04222.x. PMID 19457180. 
  21. ^ Sacks, Benjamin N.; Statham, Mark J.; Perrine, John D.; Wisely, Samantha M. and Aubry, Keith B. (2010). "North American montane red foxes: expansion, fragmentation, and the origin of the Sacramento Valley red fox". Conservation Genetics 11 (4): 1523–1539. doi:10.1007/s10592-010-0053-4. 
  22. ^ Dale 1906, p. 140
  23. ^ Feldhamer, Thompson & Chapman 2003, p. 511
  24. ^ Feldhamer, Thompson & Chapman 2003, p. 514
  25. ^ Heptner & Naumov 1998, pp. 490–92
  26. ^ Heptner & Naumov 1998, p. 479
  27. ^ Heptner & Naumov 1998, p. 496
  28. ^ Merriam 1900, p. 669
  29. ^ Merriam 1900, p. 668
  30. ^ a b Heptner & Naumov 1998, p. 499
  31. ^ a b Merriam 1900, p. 667
  32. ^ a b c Heptner & Naumov 1998, pp. 499–500
  33. ^ Merriam 1900, p. 665
  34. ^ a b Heptner & Naumov 1998, pp. 497–98
  35. ^ a b Spagnesi & De Marina Marinis 2002, p. 221
  36. ^ Harris & Yalden 2008, p. 411
  37. ^ Heptner & Naumov 1998, pp. 501–2
  38. ^ Merriam 1900, p. 663
  39. ^ Pocock 1941, p. 121
  40. ^ a b Merriam 1900, pp. 670–71
  41. ^ Allen 1938
  42. ^ Dale 1906, p. 6
  43. ^ a b Heptner & Naumov 1998, p. 501
  44. ^ a b Merriam 1900, p. 664
  45. ^ Pocock 1941, p. 111
  46. ^ Hoath, Richard, A Field Guide to the Mammals of Egypt, American Univ in Cairo Press, 2009, ISBN 977-416-254-4
  47. ^ Osborn & Helmy 1980, p. 376
  48. ^ Pocock 1941, pp. 123–4
  49. ^ Pocock 1941, p. 129
  50. ^ Merriam 1900, p. 672
  51. ^ Merriam 1900, p. 666
  52. ^ Miller, Gerrit Smith (1912) Catalogue of the mammals of Western Europe (Europe exclusive of Russia) in the collection of the British museum, British Museum (Natural History). Department of Zoology.
  53. ^ Allen 1938, p. 353
  54. ^ a b c d e f Heptner & Naumov 1998, p. 472
  55. ^ a b c Larivière & Pasitschniak-Arts 1996
  56. ^ a b c d e f Harris & Yalden 2008, p. 409
  57. ^ a b c d e Sillero-Zubiri, Hoffman & MacDonald 2004, pp. 132–33
  58. ^ Heptner & Naumov 1998, p. 341
  59. ^ Heptner & Naumov 1998, p. 478
  60. ^ Harris & Yalden 2008, p. 408
  61. ^ Sillero-Zubiri, Hoffman & MacDonald 2004, p. 129
  62. ^ a b Macdonald 1987, pp. 122–23
  63. ^ Lariviere, S. and Pastitschniak-Art, M. (1996). Vulpes vulpes 537. pp. 1–11. 
  64. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  65. ^ Macdonald 1987, p. 36
  66. ^ Sillero-Zubiri, Hoffman & MacDonald 2004, p. 130
  67. ^ Largest fox killed in UK' shot on Aberdeenshire farm', David Wilkes, 5th March 2012, BBC News Online
  68. ^ a b Bachrach 1953, pp. 231–32
  69. ^ a b Bachrach 1953, p. 235
  70. ^ a b Sillero-Zubiri, Hoffman & MacDonald 2004, p. 131
  71. ^ Heptner & Naumov 1998, p. 477
  72. ^ Feldhamer, Thompson & Chapman 2003, p. 516
  73. ^ a b Heptner & Naumov 1998, p. 476
  74. ^ Bachrach 1953, p. 251
  75. ^ Bachrach 1953, p. 230
  76. ^ a b Heptner & Naumov 1998, p. 561
  77. ^ In a freshly killed animal, this gland, especially in freezing weather, gives off the odor of violet. This odor is not strong and rapidly disappears especially in a dead animal taken into a warm location. This explains why the presence of the "violet" odor is sometimes negated. Heptner & Naumov 1998, p. 474
  78. ^ Macdonald 1987, p. 117
  79. ^ http://link.springer.com/article/10.1007/s10164-012-0348-7, Journal of Ethology, November 2012, John K. Fawcett, Jeanne M. Fawcett, Carl D. Soulsbury
  80. ^ MacDonald, D. W. (2010). "Some Observations and Field Experiments on the Urine Marking Behaviour of the Red Fox, Vulpes vulpes L". Zeitschrift für Tierpsychologie 51: 1–0. doi:10.1111/j.1439-0310.1979.tb00667.x.  edit
  81. ^ Jorgenson, J. W.; Novotny, M.; Carmack, M.; Copland, G. B.; Wilson, S. R.; Katona, S.; Whitten, W. K. (1978). "Chemical Scent Constituents in the Urine of the Red Fox (Vulpes vulpes L.) During the Winter Season". Science 199 (4330): 796–798. doi:10.1126/science.199.4330.796. PMID 17836296.  edit
  82. ^ Whitten, W. K.; Wilson, M. C.; Wilson, S. R.; Jorgenson, J. W.; Novotny, M.; Carmack, M. (1980). "Induction of marking behavior in wild red foxes (Vulpes vulpes L.) by synthetic urinary constituents". Journal of Chemical Ecology 6: 49. doi:10.1007/BF00987526.  edit
  83. ^ Harrington, Fred H. (1981). "Urine-Marking and Caching Behavior in the Wolf". Behaviour 76 (3/4): 280–288. JSTOR 4534102. 
  84. ^ Walters, Martin; Bang, Preben; Dahlstrøm, Preben (2001). Animal tracks and signs. Oxford: Oxford University Press. pp. 202–3. ISBN 0-19-850796-8. 
  85. ^ Macdonald 1987, p. 125
  86. ^ Henry, J. David (1977). "The Use of Urine Marking in the Scavenging Behavior of the Red Fox (Vulpes vulpes)". Behaviour 61 (1/2): 82–106. JSTOR 4533812. 
  87. ^ Andersen, K. F.; Vulpius, T. (1999). "Urinary Volatile Constituents of the Lion, Panthera leo". Chemical Senses 24 (2): 179–189. doi:10.1093/chemse/24.2.179. PMID 10321819.  edit
  88. ^ Lawrence Mark Elbroch; Michael Raymond Kresky; Jonah Wy Evans (11 February 2012). Field Guide to Animal Tracks and Scat of California. University of California Press. pp. 189–. ISBN 978-0-520-25378-0. Retrieved 3 December 2012. 
  89. ^ a b c Macdonald 1987, pp. 140–41
  90. ^ a b c Heptner & Naumov 1998, p. 537
  91. ^ a b c d Harris & Yalden 2008, p. 417
  92. ^ George A. Feldhamer; Bruce C. Thompson; Joseph A. Chapman (21 October 2003). Wild Mammals of North America: Biology, Management, and Conservation. JHU Press. ISBN 978-0-8018-7416-1. Retrieved 28 March 2013. 
  93. ^ a b Heptner & Naumov 1998, p. 538
  94. ^ a b c d Harris & Yalden 2008, pp. 418–19
  95. ^ Macdonald 1987, p. 93
  96. ^ a b c Heptner & Naumov 1998, pp. 542–44
  97. ^ Dale 1906, pp. 21–22
  98. ^ Dale 1906, p. 13
  99. ^ Macdonald 1987, p. 144
  100. ^ a b Heptner & Naumov 1998, p. 526
  101. ^ Feldhamer, Thompson & Chapman 2003, pp. 528–30
  102. ^ a b c Heptner, V. G. (Vladimir Georgievich), 1901–1975; Nasimovich, A. A; Bannikov, Andrei Grigorevich; Hoffmann, Robert S Mammals of the Soviet Union Volume: v. 2, pt. 1b (2001) Washington, D.C. : Smithsonian Institution Libraries and National Science Foundation
  103. ^ a b Dale 1906, pp. 15–17
  104. ^ "40 Winks?" Jennifer S. Holland, National Geographic Vol. 220, No. 1. July 2011.
  105. ^ a b Harris & Yalden 2008, p. 414
  106. ^ a b c d e Macdonald 1987, p. 28
  107. ^ Heptner & Naumov 1998, p. 530
  108. ^ Heptner & Naumov 1998, p. 531
  109. ^ Macdonald 1987, p. 58
  110. ^ Macdonald 1987, p. 164
  111. ^ Macdonald 1987, p. 41
  112. ^ a b Macdonald 1987, pp. 84–85
  113. ^ Heptner & Naumov 1998, pp. 364–65
  114. ^ Heptner & Naumov 1998, pp. 453–54
  115. ^ a b c Feldhamer, Thompson & Chapman 2003, p. 527
  116. ^ Heptner & Naumov 1998, pp. 357, 455 & 545
  117. ^ Mech, L. David; Boitani, Luigi (2003). Wolves: Behaviour, Ecology and Conservation. p. 269. University of Chicago Press. ISBN 0-226-51696-2
  118. ^ Sargeant, Alan B and Allen, Stephen H (1989). "Observed Interactions Between Coyotes and Red foxes". Journal of Mammology 70 (3): 631–633. doi:10.2307/1381437. JSTOR 1381437. 
  119. ^ Scheinin, Shani ; Yom-Tov, Yoram ; Motro, Uzi & Geffen, Behavioural responses of red foxes to an increase in the presence of golden jackals: a field experiment, ANIMAL BEHAVIOUR, 2006, 71, 577–584
  120. ^ Heptner & Naumov 1998, p. 115
  121. ^ a b c Sillero-Zubiri, Hoffman & MacDonald 2004, p. 134
  122. ^ Macdonald 1987, pp. 77–79
  123. ^ Heptner, V. G. and Sludskii, A. A. 1992. Mammals of the Soviet Union. Vol. II, part 2, Carnivores(Feloidea), Leiden, E. J. Brill. ISBN 90-04-08876-8
  124. ^ a b Heptner, V. G. and Sludskii, A. A. 1992. Mammals of the Soviet Union. Vol. II, part 2, Carnivores(Feloidea), Leiden, E. J. Brill. ISBN 90-04-08876-8, pp. 627–8
  125. ^ Heptner & Naumov 1998, pp. 545
  126. ^ Eurasian Eagle Owl – Bubo bubo. owlpages.com
  127. ^ Watson, Jeff (2011). The Golden Eagle: Second Edition. ISBN 1408114208. 
  128. ^ "Hazardous Substances and New Organisms Act 2003 – Schedule 2 Prohibited new organisms". New Zealand Government. Retrieved 26 January 2012. 
  129. ^ "Impacts of Feral Animals". Game Council of New South Wales. Retrieved 2012-05-29. 
  130. ^ Macdonald 1987, p. 14
  131. ^ Bostanci, A. (2005). "WILDLIFE BIOLOGY: A Devil of a Disease". Science 307 (5712): 1035–1020. doi:10.1126/science.307.5712.1035. PMID 15718445.  edit
  132. ^ Short, J. (1998). "The extinction of rat-kangaroos (Marsupialia:Potoroidae) in New South Wales, Australia". Biological Conservation 86 (3): 365–201. doi:10.1016/S0006-3207(98)00026-3.  edit
  133. ^ "Threat Abatement Plan for Predation by the Red Fox (Vulpes vulpes)". SW National Parks and Wildlife Service. 2001. Retrieved 2012-05-29. 
  134. ^ Millen, Tracey (Oct–Nov 2006). "Call for more dingoes to restore native species" (PDF). ECOS 133.  (Refers to the book Australia's Mammal Extinctions: a 50,000 year history. Christopher N. Johnson. ISBN 978-0-521-68660-0.)
  135. ^ "Hard Evidence of Foxes Discovered in Tasmania". Department of Primary Industries and Water, Tasmania website. Retrieved 2007-12-19. 
  136. ^ Saunders, G., Lane, C., Harris, S., and Dickman, C. (2006). Foxes in Tasmania: A Report on the Incursion of an Invasive Species
  137. ^ a b c Harris & Yalden 2008, pp. 421–22
  138. ^ a b c Heptner & Naumov 1998, p. 547
  139. ^ Lalošević, V., Lalošević, D., Čapo, I., Simin, V., Galfi, A. & Traversa, D. 2013: High infection rate of zoonotic Eucoleus aerophilus infection in foxes from Serbia. Parasite, 20, 3. doi:10.1051/parasite/2012003 (open access PDF)
  140. ^ Ancient Greek: Τευμησ(σ)ία ἀλώπηξ (Teumēs(s)íā alôpēx), gen.: Τευμησίας ἀλώπεκος, also known as ἀλώπηξ τῆς Τευμησσοῦ "fox of Teumessos"; Teumessos was an ancient city in Boeotia.
  141. ^ Monaghan, Patricia (2004), The encyclopedia of Celtic mythology and folklore, pp. 199–200, Infobase Publishing, ISBN 0-8160-4524-0
  142. ^ Macdonald 1987, pp. 32–33
  143. ^ Goff, Janet, Foxes in Japanese culture: beautiful or beastly?, Japan Quarterly 44:2 (April–June 1997)
  144. ^ Smyers, Karen Ann, The fox and the jewel: shared and private meanings in contemporary Japanese inari worship, University of Hawaii Press, 1999, ISBN 0-8248-2102-5
  145. ^ Osborn & Helmy 1980, p. 379
  146. ^ Bright, Michael (2006). Beasts of the Field: The Revealing Natural History of Animals in the Bible. London: Robson Books. pp. 120–27. ISBN 1-86105-831-4. 
  147. ^ Bastian, Dawn Elaine & Mitchell, Judy K., Handbook of Native American mythology, pp. 99–100, ABC-CLIO, 2004. ISBN 1-85109-533-0
  148. ^ Macdonald 1987, p. 21
  149. ^ Potts 1912, p. 7
  150. ^ Potts 1912, p. 38
  151. ^ Bachrach 1953, p. 246
  152. ^ Bachrach 1953, p. 252
  153. ^ Dale 1906, p. 207
  154. ^ Dale 1906, p. 204
  155. ^ a b Heptner & Naumov 1998, p. 562
  156. ^ Macdonald 1987, pp. 166–67
  157. ^ Southern New England Landcare Group, Foxchat No. 71, June–July 2009
  158. ^ SNELC Retrieved on 20 October 2008
  159. ^ Macdonald 1987, pp. 180–81
  160. ^ MacCormick, Alex (2003). "Reynard the Fox". In Alex MacCormick. The mammoth book of maneaters. Carroll & Graf Publishers. ISBN 978-0-7867-1170-3. 
  161. ^ "Baby 'attacked by fox'". BBC News. 2002-07-01. 
  162. ^ "'Nightmare' over fox attack twins". BBC News. 2010-06-07. 
  163. ^ "Human Prey". The Sun. 2010-10-28. 
  164. ^ "Fox attack man on road to recovery". Edinburgh Evening News. 2010-10-28. 
  165. ^ "Fox attacks two children in Otego". The Daily Star. 2011-06-29. 
  166. ^ "Fox Bites Off Baby's Finger In Cot Attack". Sky News. 2013-02-10. 
  167. ^ Macdonald 1987, p. 56
  168. ^ Macdonald 1987, p. 61
  169. ^ Dale 1906, p. 122
  170. ^ Dale 1906, pp. 132–33
  171. ^ Trut, Lyudmila N. Early Canid Domestication: The Farm-Fox Experiment, American Scientist, Volume 87, 1999 March–April
  172. ^ Urban foxes. The fox website. Retrieved on 2011-09-15.
  173. ^ 10,000 Foxes Roam London. News.nationalgeographic.com (2010-10-28). Retrieved on 2011-09-15.
  174. ^ Lindsay-Smith, Bruce (2011-01-27). "Yes, urban foxes are getting bigger... and more deadly. As a 4ft fox is shot in Kent, a marksman who culls them for a living issues a chilling warning". Daily Mail (London). 
  175. ^ "Fieldsports Britain : How to call in great big bucks". Fieldsportschannel.tv. Retrieved 25 October 2012. 

References [edit]

Further reading [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Domesticated silver fox

The domesticated silver fox (marketed as the Siberian fox) is a domesticated form of the silver morph of the red fox. As a result of selective breeding, the new foxes became tamer and more dog-like.

The result of over 50 years of experiments in the Soviet Union and Russia, the breeding project was set up in 1959[1] by Soviet scientist Dmitri Belyaev. It continues today at The Institute of Cytology and Genetics at Novosibirsk, under the supervision of Lyudmila Trut. They also morph into different colors (such as white), in the breeding program.

Contents

Initial experimentation [edit]

The experiment was initiated by scientists who were interested in the topic of domestication and the process by which wolves became tame domesticated dogs. They saw some retention of juvenile traits by adult dogs, both morphological ones, such as skulls that were unusually broad for their length, and behavioral ones, such as whining, barking, and submission.

In a time when Lysenkoism was an official state doctrine, Belyaev's commitment to classical genetics had cost him his job as head of the Department of Fur Animal Breeding at the Central Research Laboratory of Fur Breeding in Moscow in 1948.[2] During the 1950s, he continued to conduct genetic research under the guise of studying animal physiology.

Belyaev believed that the key factor selected for in the domestication of dogs was not size or reproduction, but behavior; specifically, tameability. Since behavior is rooted in biology, selecting for tameness and against aggression, means selecting for physiological changes in the systems that govern the body's hormones and neurochemicals. Belyaev decided to test his theory by domesticating foxes; in particular, the silver fox, a dark color form of the red fox. He placed a population of them under strong selection pressure for inherent tameness.[3]

As Lyudmilla Trut says in her 1999 American Scientist article [1], The least domesticated foxes, those that flee from experimenters or bite when stroked or handled, are assigned to Class III. Foxes in Class II let themselves be petted and handled but show no emotionally friendly response to experimenters. Foxes in Class I are friendly toward experimenters, wagging their tails and whining. In the sixth generation bred for tameness we had to add an even higher-scoring category. Members of Class IE, the "domesticated elite," are eager to establish human contact, whimpering to attract attention and sniffing and licking experimenters like dogs. They start displaying this kind of behavior before they are one month old. By the tenth generation, 18 percent of fox pups were elite; by the 20th, the figure had reached 35 percent. Today elite foxes make up 70 to 80 percent of our experimentally selected population.

Belyaev and Trutt believe that selecting for tameness mimics the natural selection that must have occurred in the ancestral past of dogs, and more than any other quality, must have determined how well an animal would adapt to life among humans.

The result is that Russian scientists now have a number of domesticated foxes that are fundamentally different in temperament and behavior from their wild forebearers. Some important changes in physiology and morphology are now visible, such as mottled or spotted colored fur. Many scientists believe that these changes related to selection for tameness are caused by lower adrenaline production in the new breed, causing physiological changes in very few generations and thus yielding genetic combinations not present in the original species. This indicates that selection for tameness (i.e. low flight distance) produces changes that are also influential on the emergence of other "dog-like" traits, such as raised tail and coming into heat every six months rather than annually.

The project also investigated breeding vicious foxes to study aggressive behavior. These foxes snap at humans and otherwise show no fear.

Similar research was carried out in Denmark with mink (Mustela vison).[4]

Current project status [edit]

Following the demise of the Soviet Union, the project has run into serious financial problems. In 1996, there were 700 domesticated foxes, but in 1998, without enough funds for food and salaries, the number had to be reduced to 100. Most of the project expenses are covered by selling the foxes as pets, but the project remains in a difficult situation and is looking for new sources of revenue from outside sources.

In an article published in Current Biology about the genetic differences between the two fox populations,[5] an experiment was reported in which DNA microarrays were used to detect differential gene expression between domesticated foxes, non-domesticated foxes raised at the same farm as the tame foxes, and wild foxes. Forty genes were found to differ between the domesticated and non-domesticated farm-raised foxes, although about 2,700 genes differed between the wild foxes and either set of farm-raised foxes. The authors did not analyze the functional implications of the gene expression differences they observed.

In another study published in Behavior Genetics,[6] a system of measuring fox behavior was described that is expected to be useful in QTL mapping to explore the genetic basis of tame and aggressive behavior in foxes.

See also [edit]

References [edit]

  1. ^ Trut, Lyudmila (1999). "Early Canid Domestication: The Farm-Fox Experiment". American Scientist 87 (2): 160. doi:10.1511/1999.2.160. 
  2. ^ Ratliff, Evan. "Animal Domestication: Taming the Wild", "National Geographic", March 2011.
  3. ^ Adams, J. (2008). "Genetics of dog breeding". Nature Education 1 (1). 
  4. ^ [1]
  5. ^ Lindberg, Julia; Björnerfeldt, Susanne; Saetre, Peter; Svartberg, Kenth; Seehuus, Birgitte; Bakken, Morten; Vilà, Carles; Jazin, Elena (2005). "Selection for tameness has changed brain gene expression in silver foxes". Current Biology 15 (22): R915–6. doi:10.1016/j.cub.2005.11.009. PMID 16303546. 
  6. ^ Kukekova, Anna V.; Trut, L. N.; Chase, K.; Shepeleva, D. V.; Vladimirova, A. V.; Kharlamova, A. V.; Oskina, I. N.; Stepika, A. et al. (2007). "Measurement of Segregating Behaviors in Experimental Silver Fox Pedigrees". Behavior Genetics 38 (2): 185–94. doi:10.1007/s10519-007-9180-1. PMC 2374754. PMID 18030612. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: American populations formerly known as V. fulva or V. fulvus, now are regarded as conspecific with Old World red fox (V. vulpes).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!