Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Description

Coyotes are among the most adaptable mammals in North America. They have an enormous geographical distribution and can live in very diverse ecological settings, even successfully making their homes in suburbs, towns, and cities. They are omnivorous, eating plants, animals, and carrion. Socially, coyotes live in a variety of arrangements. Some live alone, others in mated pairs, and others in packs, which may consist of one mated pair, their new young, and offspring from the previous season that have not yet left their parents. Packs are an advantage when preying on larger mammals such as deer, or defending food resources, territory, and themselves.

Adaptation: The upper and lower cheek teeth of a Coyote, Canis latrans, are blade-like, with sharp shearing edges that cut food in scissors-like fashion. The foremost shearing teeth, known as carnassials, are clearly larger than the others.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Say, T., 1823.  in Account of an expedition from Pittsburgh to the Rocky Mountains : performed in the years 1819 and ?20, by order of the Hon. J.C. Calhoun, sec?y of war, under the command of Major Stephen H. Long : from the notes of Major Long, Mr. T. Say, and other gentlemen of the exploring party compiled by Edwin James, botanist and geologist for the expedition; in two vols., H.C. Carey and I. Lea, Philadelphia,1822-23. Vol 1, p 168.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Coyotes were believed to have been restricted to the south-west and plains regions of the U.S. and Canada, and northern and central Mexico, prior to European settlement (Moore and Parker 1992). During the 19th century, coyotes are thought to have expanded north and west. With land conversion and removal of wolves after 1900, coyotes expanded into all of the U.S. and Mexico, southward into Central America, and northward into most of Canada and Alaska (Moore and Parker 1992).

Coyotes continue to expand their distribution and occupy most areas between 8°N (Panama) and 70°N (northern Alaska). They are found throughout the continental United States and Alaska, almost all of Canada (except the far north-eastern regions), south through Mexico and into Central America (Bekoff 1982; Reid 1997; Bekoff and Gese 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Coyotes are native to the Nearctic region. They are found throughout North and Central America. They range from Panama in the south, north through Mexico, the United States, and Canada. They occur as far north as Alaska and all but the northernmost portions of Canada.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Originally ranged throughout western and central North America, perhaps with only widely scattered populations in the southeastern U.S. Range expanded into eastern U.S. with opening of forest and extermination of wolf. Range has also expanded north to northern Alaska and south to Costa Rica. Introduced in Florida and Georgia. (Wozencraft, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Coloration of coyotes varies from grayish brown to a yellowish gray on the upper parts. The throat and belly are whitish. The forelegs, sides of head, muzzle and feet are reddish brown. The back has fulvous colored underfur and long, black-tipped guard hairs that produce a black dorsal stripe and a dark cross on the shoulder area. The tail, which is half the body length, is bottle shaped with a black tip. There is also a scent gland located on the dorsal base of the tail. There is one moult per year, which starts in May with light loss of hair and ends in July after profuse shedding. Coyotes are significantly smaller than gray wolves and much larger than foxes. Coyotes are distinguished from domesticated dogs by their pointed, erect ears and drooping tail, which they hold below their back when running. The eyes have a yellow iris and round pupil. The nose is black and usually less than one inch in diameter. The ears are large in relation to the head and the muzzle is long and slender. The feet are relatively small for the size of the body. The pes has four digits and the manus has five with a small first digit. Coyotes run on their toes (digitigrade). The dental formula is 3/3 1/1 4/4 2/3. The molars are structured for crushing and the canines are rather long and slender.

Range mass: 7 to 21 kg.

Range length: 75 to 100 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 19.423 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 132 cm

Weight: 18100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 750-1,000 mm

Weight:
Range: 8-20 kg males; 7-18 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Coyotes utilize almost all available habitats including prairie, forest, desert, mountain and tropical ecosystems. The ability of coyotes to exploit human resources allows them to occupy urban areas. Water availability may limit Coyote distribution in some desert environments.

Coyotes are opportunistic, generalist predators that eat a variety of food items, typically consuming items in relation to changes in availability. Coyotes eat foods ranging from fruit and insects to large ungulates and livestock. Livestock and wild ungulates may often be represented in coyote stomachs and scats as carrion, but predation on large ungulates (native and domestic) does occur (Andelt 1987). Predation by Coyotes on neonates of native ungulates can be high during fawning (Andelt 1987). Coyotes in suburban areas are adept at exploiting human-made food resources and will readily consume dog food or other human-related items.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Coyotes are extremely adaptable and use a wide range of habitats including forests, grasslands, deserts, and swamps. They are typically excluded from areas with wolves. Coyotes, because of their tolerance for human activities, also occur in suburban, agricultural, and urban settings.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Wetlands: swamp

Other Habitat Features: urban ; suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Found in a wide range of habitats in its extensive range, from open prairies of the west to the heavily forested regions of the Northeast. In cities in some areas.

Examples of some recent habitat studies: In northern Vermont, preferred hardwood forests in winter and spring, farmland in summer and fall (Person and Hirth 1991). In British Columbia, preferred dense spruce forest and/or areas where snowshoe hare was abundant (Murray et al. 1994).

Young are born in a den usually in a burrow (enlarged burrow of other mammal or dug by female), with the opening often oriented toward the south. Dens also may be above ground (e.g., at base of tree under low, overhanging branches; in hollow log or rock crevice), or under building. Commonly uses same den in subsequent years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Adults travel an average of up to 20 km every day. In a pine-oak forest in Durango, Mexico, males (the more mobile sex) traveled an average of 16.5 km during a 24-hour period, more than the 8.1 km recorded in Texas, similar to distances traveled in forested area in Nebraska, and less than the 20.2 km in Nova Scotia (see Servin et al. 2003). Females in Durango averged 12.5 km per 24 hours. Distances varied during different parts of the breeding cycle.

Home ranges variously reported as 8-80 square kilometers (Bekoff 1977); 10-100 square kilometers (Hawthorne 1971); 5-7.2 square kilometers (stable packs in an area of large mammal abundance; Camenzind 1978).

Home range averaged 17-19 sq km for adults in a farm region in Vermont, where all members of individual family groups shared the same home range and core activity areas of adjacent social groups were mutually exclusive (Person and Hirth 1991). Home range may be larger in winter than in summer (Schwartz and Schwartz 1981, Parker and Maxwell 1989); range increases greatly after pups reared (Harrison and Gilbert 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Coyotes are versatile in their eating habits. They are carnivorous; 90% of their diet is mammalian. They eat primarily small mammals, such as eastern cottontail rabbits, thirteen-lined ground squirrels, and white-footed mice. They occasionally eat birds, snakes, large insects and other large invertebrates. They prefer fresh meat, but they consume large amounts of carrion. Part of what makes coyotes so successful at living in so many different places is the fact that they will eat almost anything, including human trash and household pets in suburban areas. Plants eaten include leaves of balsam fir and white cedar, sasparilla, strawberry, and apple. Fruits and vegetables are a significant part of the diet of coyotes in the fall and winter months. Coyotes hunt animals in interesting ways. When on a "mousing" expedition, they slowly stalk through the grass and sniff out the mouse. Suddenly, with all four legs held stiffly together, the coyotes stiffen and pounce on the prey. Hunting deer, on the other hand, calls for teamwork. Coyotes may take turns pursuing the deer until it tires, or they may drive it towards a hidden member of the pack. Coyotes sometimes form "hunting partnerships" with badgers. Because coyotes aren't very effective at digging rodents out of their burrows, they chase the animals while they're above ground. Badgers do not run quickly, but are well-adapted to digging rodents out of burrows. When both hunt together they effectively leave no escape for prey in the area. The average distance covered in a night's hunting is 4 km.

Animal Foods: birds; mammals; reptiles; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: leaves; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: An opportunistic feeder; mainly carrion (including prey killed by other carnivores), small vertebrates, and invertebrates. Occasionally feeds on vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Coyotes help in keeping many small mammal populations in check, such as mice and rabbits. If populations of these small mammals were allowed to become too large it would result in habitat degradation

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Coyotes are very secretive. Especially near human habitations they are active mostly early in the morning and late in the evening. Coyotes keep their young in or near the den while they are young so that the pups aren't killed by predators and competitors such as wolves and mountain lions.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Canis latrans is prey of:
Homo sapiens

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Canis latrans preys on:
Spermophilus richardsonii
Microtus
Spermophilus tridecemlineatus
Thomomys
Leporidae
Microtus ochrogaster
Geomyidae
Spermophilus
Peromyscus
Tamias
Odocoileus
Marmota
Ochotonidae
Arvicolinae
Peromyscus maniculatus
Schismus barbatus
seeds of other plants
leaves
carcass
Chaetodipus penicillatus
Sylvilagus
Neotoma
Dipodomys
Oreoscoptes montanus
Turdus migratorius
Icteridae
Icterus
Mimus polyglottos
Cardinalis cardinalis
Sialia
Apodidae
Onychomys
Cardinalis
Lampropeltis triangulum
Anas strepera
Anas acuta
Anas cyanoptera
Parabuteo unicinctus
Cyrtonyx montezumae
Fulica americana
Zenaida asiatica
Chordeiles minor
Amphispiza bilineata
Corvus corax
Didelphis virginiana
Blarina brevicauda
Blarina carolinensis
Neurotrichus gibbsii
Sylvilagus floridanus
Sylvilagus nuttallii
Marmota monax
Spermophilus beecheyi
Spermophilus lateralis
Spermophilus washingtoni
Glaucomys sabrinus
Ammospermophilus leucurus
Tamias alpinus
Tamias dorsalis
Tamias merriami
Thomomys mazama
Dipodomys compactus
Dipodomys deserti
Dipodomys microps
Dipodomys venustus
Perognathus fasciatus
Peromyscus boylii
Microtus californicus
Ondatra zibethicus
Reithrodontomys megalotis
Sigmodon fulviventer
Neotoma lepida
Onychomys arenicola
Lontra canadensis
Mustela frenata
Procyon lotor
Bassariscus astutus
Canis lupus
Vulpes vulpes
Cervus elaphus
Odocoileus virginianus
Lemmiscus curtatus
Chaetodipus baileyi
Falcipennis canadensis
Peromyscus aztecus
Canis lupus familiaris

Based on studies in:
Canada: Manitoba (Grassland)
USA: Arizona (Forest, Montane)
USA: Montana (Tundra)
USA: Arizona, Sonora Desert (Desert or dune)
USA: New Mexico, Aden Crater (Carrion substrate)
USA: New Mexico, White Sands (Carrion substrate)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Population density generally is around 0.2-1.0 per sq km, though seasonally higher densities have been recorded in Texas. (Knowlton 1972). Most of the population usually is less than 3 years old.

In the north, populations may increase when wolf population is low, decrease when wolf population increases.

In Texas, "interactions between social organization and food availability were implicated in regulation of [a]...lightly exploited high-density population" (Windberg 1995).

In the prairie pothole region, the presence of low numbers of coyotes may benefit ducks by excluding the more destructive red fox (NBS news release, 29 June 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Coyotes use auditory, visual, olfactory and tactile signals to communicate. They are the most vocal of all North American wild mammals, using 3 distinct calls (squeak, distress call and howl call) which consist of a quick series of yelps, followed by a falsetto howl. Howling may act to announce where territories are to other packs. Coyotes also howl when two or more members of a pack re-unite and to announce to each other their location. Their sight is less developed and is used primarily to note movement. They have acute hearing and sense of smell. They use stumps, posts, bushes or rocks as "scent posts" on which they urinate and defecate, possibly to mark territory. Coyotes are very good swimmers but poor climbers.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: choruses ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Mainly crepuscular and nocturnal, though commonly observed during daylight hours in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Coyotes have been known to live a maximum of ten years in the wild and 18 years in captivity.

Range lifespan

Status: wild:
10 (high) years.

Range lifespan

Status: captivity:
18 (high) years.

Average lifespan

Status: captivity:
15.0 years.

Average lifespan

Status: wild:
14.5 years.

Average lifespan

Status: captivity:
21.8 years.

Average lifespan

Status: wild:
21.0 years.

Average lifespan

Status: wild:
14.5 years.

Average lifespan

Status: captivity:
18.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.8 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Courtship lasts for approximately 2 to 3 months. Female coyotes are monoestrous and are in heat for 2 to 5 days between late January and late March. Mating occurs within these 3 months. Once the female chooses a partner, the mates may remain paired for a number of years, but not necessarily for life.

Mating System: monogamous

Spermatogenesis in males takes around 54 days and occurs between January and February depending on geographic location. Gestation lasts from 60 to 63 days. Litter size ranges from 1 to 19 pups; the average is 6. The pups weigh approximately 250 grams. The young are born blind, limp-eared and pug-nosed. After 10 days the eyes open, the pups weigh 600 grams and their ears begin to erect in true coyote fashion. Twenty-one to 28 days after birth, the young begin to emerge from the den and by 35 days they are fully weaned. They are fed regurgitated food by both parents. Male pups disperse from the dens between months 6 and 9, while females usually stay with the parents and form the basis of the pack. Adult size is reached between 9 and 12 months. Sexual maturity is reached by 12 months. Coyotes hybridize with domestic dogs and occasionally with gray wolves.

Breeding interval: Coyotes usually breed once each year.

Breeding season: Breeding occurs from January to March.

Range number of offspring: 1 to 19.

Average number of offspring: 5.7.

Range gestation period: 50 to 65 days.

Range weaning age: 35 to 49 days.

Range age at sexual or reproductive maturity (female): 9 to 10 months.

Range age at sexual or reproductive maturity (male): 9 to 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 250 g.

Average number of offspring: 6.

Female coyotes gestate and nurse their young. Both male and female coyotes bring food to their young after they are weaned and protect their offspring. The young sometimes stay with the pack into adulthood and learn how to hunt during a learning period.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mates in late winter. Gestation lasts 60-65 days. Litter size averages 4-7 in different areas. Young are born March-May. Both parents tend young. Family leaves den when young 8-10 weeks old. Young are on their own by late fall. Sexually mature in 1-2 years. Interbreeds freely with domestic dog.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Canis latrans

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0492-06|DQ480510|Canis latrans| AACCGATGATTGTTCTCTACTAATCACAAAGATATTGGTACTTTATATCTACTGTTTGGAGCATGAGCCGGCATAGTAGGCACTGCCTTG---AGCCTCCTCATCCGAGCCGAGCTAGGTCAGCCCGGTACTTTACTAGGCGAC---GACCAAATTTATAATGTCGTCGTAACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCCATTATAATTGGGGGCTTTGGAAACTGACTGGTGCCATTAATA---ATTGGTGCTCCGGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTTCTTCCTCCATCTTTTCTTCTACTATTAGCATCTTCTATGGTAGAAGCAGGTGCAGGAACGGGATGGACTGTATATCCTCCACTGGCTGGCAATCTGGCCCATGCAGGAGCATCCGTTGATCTT---ACAATTTTCTCCTTACATCTAGCTGGAGTCTCTTCTATTTTAGGGGCAATCAATTTCATCACTACTATTATCAACATAAAACCCCCTGCAATATCCCAGTATCAAACTCCCCTGTTTGTATGATCAGTACTAATTACAGCAGTTCTACTTTTACTATCGCTACCTGTACTGGCTGCT---GGAATTACAATACTTTTAACAGACCGAAATCTTAATACAACATTTTTCGACCCCGCTGGAGGAGGAGACCCTATCTTATATCAACACCTATTCTGATTCTTCGGACATCCTGAAGTTTACATTCTTATCCTGCCCGGATTCGGAATAATTTCTCACATTGTTACTTACTACTCAGGGAAAAAA---GAGCCTTTCGGCTATATAGGAATAGTATGGGCAATAATATCTATTGGGTTTTTAGGCTTTATCGTATGAGCTCACCATATGTTTACCGTAGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Canis latrans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 18
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gese, E.M., Bekoff, M., Andelt,W., Carbyn, L. & Knowlton, F.

Reviewer/s
Sillero-Zubiri, C. & Hoffmann, M. (Canid Red List Authority)

Contributor/s

Justification
The Coyote has a wide distribution throughout North America, Mexico and into Central America. They are abundant throughout their range and are increasing in distribution as humans continue to modify the landscape. The species is very versatile, especially in their ability to exploit human modified environments.

History
  • 2004
    Least Concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Coyotes are common and widespread because of their extraordinary adaptability.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Coyotes are abundant throughout their range and are increasing in distribution as humans continue to modify the landscape. Elimination of wolves may also have assisted Coyote expansion. Coyote density varies geographically with food and climate, and seasonally due to mortality and changes in pack structure and food abundance. Local control temporarily reduces numbers on a short-term basis, but Coyote populations generally are stable in most areas.
Coyote densities in different geographic areas and seasons vary from 0.01–0.09 coyotes/km² in the winter in the Yukon (O'Donoghue et al. 1997) to 0.9/km² in the fall and 2.3/km² during the summer (post-whelping) in Texas (Knowlton 1972, Andelt 1985). Density in different geographic areas and seasons are listed in Sillero-Zubiri (2004).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no current threats to Coyote populations throughout their range. Local reductions are temporary and their range has been expanding. Conservation measures have not been needed to maintain viable populations. Coyotes adapt to human environs and occupy most habitats, including urban areas. Hybridization with dogs may be a threat near urban areas. Genetic contamination between dogs, Coyotes, and Grey Wolves may be occurring in north-eastern U.S. Hybridization between Coyotes and Red Wolves is problematic for Red Wolf recovery in south-eastern U.S.

Coyote fur is still sought by trappers throughout its range, with harvest levels depending upon fur prices, local and state regulations, and traditional uses and practices. Many states and provinces consider Coyotes a furbearing species with varying regulations on method of take, bag limit, and seasons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is not included on the CITES Appendices, and there is no legal protection of the species. Restrictions on harvest and method of harvest depend upon state or provincial regulations.

The Coyote occurs in almost all protected areas across its range.

Occurrence in captivity
Over 2,000 Coyotes occur in captivity in zoos, wildlife centres, etc., throughout their range. They readily reproduce in captivity and survival is high.

Gaps in knowledge
Several gaps in knowledge still remain: coyote reproductive physiology and possible modes of fertility control; selective management of problem animals; effects of control; genetic differentiation from other canids (particularly the red wolf); development of non-lethal depredation techniques; interactions of coyotes and other predators; coyote-prey interactions; human-coyote interactions and conflicts at the urban interface; factors influencing prey selection; communication; adaptations in urban and rural environments; and interactions with threatened and endangered species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: In July 1985, the U.S. EPA registered Compound 1080 for use in Livestock Protection Collars (LPCs) for controlling coyote predation on sheep and goats; experimental data indicate that consuming carcasses of coyotes killed by LPCs poses little if any hazard to golden eagles or stiped skunks (Burns et al. 1991).

In western Texas, intensive coyote control resulted in a decline in rodent species richness and diversity (Henke and Bryant 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Coyotes serves as hosts for a number of diseases, including rabies. They are considered a threat to poultry, livestock, and crops. Coyotes may also compete with hunters for deer, rabbits, and other game species.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Coyotes help to control some agricultural pests, such as rodents. Coyote pelts are also still collected and sold in some areas.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Hunted for sport and for pelt (which in Oklahoma in early 1980s yielded about $20 per pelt) (Caire et al. 1989). Regarded as a pest at certain times in some areas due to occasional predation on deer, poultry, or livestock; occurs especially during denning season.

Rarely has attacked humans in western North America (usually in situations where coyotes have become habituated to humans; Carbyn 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: In Quebec, an expanding coyote population threatened a remnant caribou herd (Crete and Desrosiers 1995). In California, coyotes can have a significant impact on kit fox populations (Ralls and White 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coyote

The coyote (US: /kaɪˈoʊtiː/ or /ˈkaɪ.oʊt/, UK: /kɔɪˈjoʊteɪ/ or /kɔɪˈjoʊt/;[2] Canis latrans), also known as the American jackal or the prairie wolf, is a species of canine found throughout North and Central America, ranging from Panama in the south, north through Mexico, the United States and Canada. It occurs as far north as Alaska and all but the northernmost portions of Canada.[3] There are currently 19 recognized subspecies, with 16 in Canada, Mexico and the United States, and 3 in Central America.[4] Unlike its cousin the gray wolf, which is Eurasian in origin, evolutionary theory suggests the coyote evolved in North America during the Pleistocene epoch 1.81 million years ago[5] alongside the Dire Wolf.[6] Unlike the wolf, the coyote's range has expanded in the wake of human civilization, and coyotes readily reproduce in metropolitan areas.[7][8]

Contents

Name

The name coyote is borrowed from Mexican Spanish, ultimately derived from the Nahuatl word cóyotl.[9] Its scientific name, Canis latrans, means "barking dog" in Latin.[10] Preliminary genetic evidence, however, has shown that "coyotes" in some areas are, genetically speaking, 85–90% Canis latrans, and from 10 to 15% Canis lupus, along with some domestic dog DNA; this prompted one researcher to suggest, jokingly, that they be called "Canis soupus," as they are a "soup" (mixture) of canid species.[11]

Description

Coyote profile
Skull

The color of the coyote's pelt varies from grayish brown to yellowish gray on the upper parts, while the throat and belly tend to have a buff or white color. The forelegs, sides of the head, muzzle and paws are reddish brown. The back has tawny-colored underfur and long, black-tipped guard hairs that form a black dorsal stripe and a dark cross on the shoulder area. The black-tipped tail has a scent gland located on its dorsal base. Coyotes shed once a year, beginning in May with light hair loss, ending in July after heavy shedding. The ears are proportionately large in relation to the head, while the feet are relatively small in relation to the rest of the body.[3] Certain experts have noted that the shape of a domestic dog's brain case is closer to the coyote's in shape than the wolf's. Mountain dwelling coyotes tend to be dark furred while desert coyotes tend to be more light brown in color.[4]

Coyotes typically grow to up to 30–34 in (76–86 cm) in length, not counting a tail of 12–16 in (30–41 cm), stand about 23–26 in (58–66 cm) at the shoulder and, on average, weigh from 15–46 lb (6.8–21 kg).[3][12] Northern coyotes are typically larger than southern subspecies, with the largest coyotes on record weighing 74¾ pounds (33.7 kg) and measuring over five feet in total length.[13]

The coyote's dental formula is I 3/3, C 1/1, Pm 4/4, M usually 2/2, occasionally 3/3, 3/2, or 2/3 × 2 = 40, 44, or 42[14] Normal spacing between the upper canine teeth is 1⅛–1⅜ inches (29–35 mm) and 1–1¼ inches (25–32 mm) between the lower canine teeth.[15]

Dentition
3,1,4,2
3,1,4,2

The upper frequency limit of hearing for coyotes is 80 KHz, compared to the 60 kHz of domestic dogs.[16] Compared to wolves, and similarly to domestic dogs, coyotes have a higher density of sweat glands on their paw pads. This trait, however, is absent in the large New England coyotes, which are thought to have some wolf ancestry.[17]

During pursuit, a coyote may reach speeds up to 43 mph (69 km/h),[18] and can jump a distance of over 13 ft (4 m).[3]

Behavior

Though coyotes have been observed to travel in large groups, they primarily hunt in pairs. Typical packs consist of six closely related adults, yearlings and young. Coyote packs are generally smaller than wolf packs and associations between individuals are less stable,[19] thus making their social behavior more in line with that of the dingo.[20] It has been theorized that this is due to an earlier expression of aggression, and the fact that coyotes reach their full growth in their first year, unlike wolves, which reach it in their second.[19] Common names of coyote groups are a band, a pack, or a rout.[21] Coyotes are primarily nocturnal, but can often be seen during daylight hours.[3] Coyotes were once essentially diurnal, but have adapted to more nocturnal behavior with pressure from humans.[22]

Coyotes are capable of digging their own burrows, though they often prefer the burrows of groundhogs or American badgers. Coyote territorial ranges can be as much as 19 kilometers in diameter around the den, and travel occurs along fixed trails.[3]

In areas where wolves have been exterminated, coyotes usually flourish. For example, as New England became increasingly settled and the resident wolves were eliminated, the coyote population increased, filling the empty ecological niche. Coyotes appear better able than wolves to live among people.[23]

Coyotes have been known to live a maximum of 10 years in the wild and 18 years in captivity.[3] They seem to be better than dogs at observational learning.[17]

Reproduction

Newborn coyote pup
Seven coyote pups

Female coyotes are monoestrous, and remain in heat for 2–5 days between late January and late March, during which mating occurs. Once the female chooses a partner, the mated pair may remain temporarily monogamous for a number of years. Depending on geographic location, spermatogenesis in males takes around 54 days, and occurs between January and February. The gestation period lasts from 60 to 63 days. Litter size ranges from 1 to 19 pups; the average is 6.[3] These large litters act as compensatory measures against the high juvenile mortality rate, with approximately 50–70% of pups not surviving to adulthood.[24] The pups weigh approximately 250 grams at birth, and are initially blind and limp-eared.[3] Coyote growth rate is faster than that of wolves, being similar in length to that of the dhole.[25] The eyes open and ears become erect after 10 days. Around 21–28 days after birth, the young begin to emerge from the den, and by 35 days they are fully weaned. Both parents feed the weaned pups with regurgitated food. Male pups will disperse from their dens between months 6 and 9, while females usually remain with the parents and form the basis of the pack. The pups attain full growth between 9 and 12 months. Sexual maturity is reached by 12 months.[3] Unlike wolves, mother coyotes will tolerate other lactating females in their pack.[26]

Interspecific hybridization

A Coyote-German Shepherd hybrid

Coyotes will sometimes mate with domestic dogs, usually in areas like Texas and Oklahoma, where the coyotes are plentiful and the breeding season is extended because of the warm weather. The resulting hybrids, called coydogs, maintain the coyote's predatory nature, along with the dog's lack of timidity toward humans, making them a more serious threat to livestock than pure-blooded animals. This cross-breeding has the added effect of confusing the breeding cycle. Coyotes usually breed only once a year, while coydogs will breed year-round, producing many more pups than a wild coyote. Differences in the ears and tail are generally what can be used to distinguish coydogs from domestic/feral dogs or pure coyotes.[27] Breeding experiments in Germany with poodles, coyotes, and later on with the resulting dog-coyote hybrids showed that unlike wolfdogs, coydogs show a decrease in fertility, significant communication problems as well as an increase of genetic diseases after three generations of interbreeding.[28]

Coyotes have also been known on occasion to mate with wolves, though this is less common than with dogs, due to the wolf's hostility to the coyote. The offspring, known as a coywolf, is generally intermediate in size to both parents, being larger than a pure coyote, but smaller than a pure wolf. A study showed that of 100 coyotes collected in Maine, 22 had half or more wolf ancestry, and one was 89% wolf. A theory has been proposed that the large eastern coyotes in Canada are actually hybrids of the smaller western coyotes and wolves that met and mated decades ago as the coyotes moved toward New England from their earlier western ranges.[23] Ontario Ministry of Natural Resources research scientist Brent Patterson has revealed findings that most coyotes in Eastern Ontario are wolf-coyote hybrids and that the Eastern wolves in Algonquin Park are, in general, not inter-breeding with coyotes.[29]

The Red Wolf is thought by certain scientists to be in fact a wolf/coyote hybrid rather than a unique species. Strong evidence for hybridization was found through genetic testing, which showed that red wolves have only 5% of their alleles unique from either gray wolves or coyotes. Genetic distance calculations have indicated that red wolves are intermediate between coyotes and gray wolves, and that they bear great similarity to wolf/coyote hybrids in southern Quebec and Minnesota. Analyses of mitochondrial DNA showed that existing red wolf populations are predominantly coyote in origin.[30]

Communication

The calls a coyote makes are high-pitched and variously described as howls, yips, yelps, and barks. These calls may be a long rising and falling note (a howl) or a series of short notes (yips). These calls are most often heard at dusk or night, but may sometimes be heard in the day, even in the middle of the day. Although these calls are made throughout the year, they are most common during the spring mating season and in the fall when the pups leave their families to establish new territories. When a coyote calls his pack together, he howls at one high note. When the pack is together, he howls higher and higher, and then they yip and yelp and also do a yi-yi sound very shrill with the howl.

Ecology

Diet and hunting

Coyote feeding on elk carcass in winter in Lamar Valley

Coyotes are opportunistic, versatile carnivores with a 90% mammalian diet, depending on the season. They primarily eat small mammals, such as voles, prairie dogs, eastern cottontails, ground squirrels, and mice, though they will eat birds, snakes, lizards, deer, javelina, and livestock, as well as large insects and other large invertebrates. The coyote will also target any species of bird that nests on the ground. Though they will consume large amounts of carrion, they tend to prefer fresh meat. Fruits and vegetables are a significant part of the coyote's diet in the autumn and winter months. Part of the coyote's success as a species is its dietary adaptability. As such, coyotes have been known to eat human rubbish and domestic pets. They catch cats and dogs when they come too close to the pack. Urban populations of coyotes have been known to actively hunt cats, and to leap shorter fences to take small dogs. In particularly bold urban packs, coyotes have also been reported to shadow human joggers or larger dogs, and even to take small dogs while the dog is still on a leash. However, this behavior is often reported when normal urban prey, such as brown rats, black rats and rabbits, have become scarce. Yet, confirmed reports of coyotes killing a human have been documented.[3][31]

Though the coyote is the basis for the character of Wile E. Coyote in the Warner Brothers Looney Tunes and Merrie Melodies animated cartoons, especially about the Road Runner, coyotes have not been known as yet to attack Greater Roadrunners for prey.

Coyotes shift their hunting techniques in accordance with their prey. When hunting small animals such as mice, they slowly stalk through the grass, and use their acute sense of smell to track down the prey. When the prey is located, the coyotes stiffen and pounce on the prey in a cat-like manner. Coyotes will commonly work in teams when hunting large ungulates such as deer, which is more common in winter (when large prey is likely weakened) and in larger-bodied Northern coyotes. Coyotes may take turns in baiting and pursuing the deer to exhaustion, or they may drive it towards a hidden member of the pack.[3] When attacking large prey, coyotes attack from the rear and the flanks of their prey. Occasionally they also grab the neck and head, pulling the animal down to the ground. Coyotes are persistent hunters, with successful attacks sometimes lasting as long as 21 hours; even unsuccessful ones can continue more than 8 hours before the coyotes give up. Depth of snow can affect the likelihood of a successful kill.[32] Packs of coyotes can bring down prey as large as adult elk, which usually weigh over 250 kg (550 lbs).[33]

The average distance covered in a night's hunting is 4 km (2½ mi).[3]

Interspecific predatory relationships

Rolf Peterson investigating the carcass of a coyote killed by a wolf in Yellowstone National Park, January 1996

The gray wolf is a significant predator of coyotes wherever their ranges overlap. Since the Yellowstone Gray Wolf Reintroduction in 1995 and 1996, the local coyote population went through a dramatic restructuring. Until the wolves returned, Yellowstone National Park had one of the densest and most stable coyote populations in America due to a lack of human impacts. Two years after the wolf reintroductions, the pre-wolf population of coyotes had been reduced 50% through both competitive exclusion and intraguild predation. In Grand Teton, coyote densities were 33% lower than normal in the areas where they coexisted with wolves, and 39% lower in the areas of Yellowstone where wolves were reintroduced. In one study, about 16% of radio-collared coyotes were preyed upon by wolves. Yellowstone coyotes have had to shift their territories as a result, moving from open meadows to steep terrain. Carcasses in the open no longer attract coyotes; when a coyote is chased on flat terrain, it is often killed. They feel more secure on steep terrain where they will often lead a pursuing wolf downhill. As the wolf comes after it, the coyote will turn around and run uphill. Wolves, being heavier, cannot stop and the coyote gains a large lead. Though physical confrontations between the two species are usually dominated by the larger wolves, coyotes have been known to attack wolves if they outnumber them. Both species will kill each other's pups given the opportunity.[34][35] Wolf urine has been marketed and claimed to be an organic coyote deterrent, such as for deterring attacks on sheep.[36]

Cougars sometimes kill coyotes. The coyote's instinctive fear of cougars has led to the development of anti-coyote sound systems which repel coyotes from public places by replicating the sounds of a cougar.[37] Bears can also rarely kill coyotes, more likely in competitive rather than predatory attacks. However, both cougars and bears have been displaced from carcasses by coyote packs.[38]

In sympatric populations of coyotes and red foxes, fox territories tend to be located largely outside of coyote territories. The principal cause of this separation is believed to be active avoidance of coyotes by the foxes. Interactions between the two species vary in nature, ranging from active antagonism to indifference. The majority of aggressive encounters are initiated by coyotes, and there are few reports of red foxes acting aggressively toward coyotes except when attacked or when their pups were approached. Conversely, foxes and coyotes have sometimes been seen feeding together.[39] In southern California, coyotes frequently kill gray foxes, and these smaller canids tend to avoid areas with high coyote densities.[40]

Coyotes will sometimes form a symbiotic relationship with American badgers. Because coyotes are not very effective at digging rodents out of their burrows, they will chase the animals while they are above ground. Badgers on the other hand are not fast runners, but are well-adapted to digging. When hunting together, they effectively leave little escape for prey in the area.[3]

In some areas, coyotes share their ranges with bobcats. It is rare for these two similarly sized species to physically confront one another, though bobcat populations tend to diminish in areas with high coyote densities.[41] However, several studies have demonstrated interference competition between coyotes and bobcats, and in all cases coyotes dominated the interaction.[42] Multiple researchers[40][43][44][45][46][47] all reported instances of coyotes killing bobcats, whereas bobcats killing coyotes is more rare.[42] Coyotes attack bobcats using a bite and shake method similar to that used on medium sized prey. Coyotes (both single individuals and groups) have been known to occasionally kill bobcats – in most cases, the bobcats were relatively small specimens, such as adult females and juveniles.[48] However, coyote attacks (by an unknown number of coyote or coyotes) on adult male bobcats have occurred. In California, coyote and bobcat populations are not negatively correlated across different habitat types, but predation by coyotes is an important source of mortality in bobcats.[40]

Coyotes have also competed with and occasionally eaten Canadian lynxes in areas where both species overlap.[42][49]

Relationship with humans

Adaptation to human environment

A coyote standing by a road in Arizona

Despite being extensively hunted, the coyote is one of the few medium-to-large-sized animals that has enlarged its range since human encroachment began. It originally ranged primarily in the western half of North America, but it has adapted readily to the changes caused by human presence and, since the early 19th century, has been steadily and dramatically extending its range.[50] Sightings now commonly occur in a majority of the United States and Canada.[51] Coyotes inhabit nearly every contiguous U.S. state and Alaska. Coyotes have moved into most of the areas of North America formerly occupied by wolves, and are often observed foraging in suburban garbage bins.

Coyotes thrive in suburban settings and even some urban ones. A study by wildlife ecologists at Ohio State University yielded some surprising findings in this regard. Researchers studied coyote populations in Chicago over a seven-year period (2000–2007), proposing that coyotes have adapted well to living in densely populated urban environments while avoiding contact with humans. They found, among other things, that urban coyotes tend to live longer than their rural counterparts, kill rodents and small pets, and live anywhere from parks to industrial areas. The researchers estimate that there are up to 2,000 coyotes living in "the greater Chicago area" and that this circumstance may well apply to many other urban landscapes in North America.[52] In Washington, D.C.'s Rock Creek Park, coyotes den and raise their young, scavenge roadkill, and hunt rodents. "I don't see it as a bad thing for a park," the assigned National Park Service biologist told a reporter for Smithsonian Magazine (March 2006). "I see it as good for keeping animal populations in control, like the squirrels and the mice."

In another testament to the coyote's habitat adaptability, a coyote nicknamed "Hal" made his way to New York City's Central Park in March 2006, wandering about the park for at least two days before being captured by officials. New York's parks commissioner Adrian Benepe noted this coyote had to be very "adventurous" and "curious" to get so far into the city.[53] An incident also occurred in April 2007 in the Chicago Loop district, where a coyote, later nicknamed "Adrian", quietly entered a Quizno's restaurant during the lunch hours; it was later captured and released at a wildlife rehab center near Barrington, Illinois.[54][55] In February 2010, up to three coyotes were spotted on the Columbia University campus, and another coyote sighting occurred in Central Park.[56]

Attacks on humans

A sign discouraging people from feeding coyotes, which can lead to them habituating themselves to human presence, thus increasing the likelihood of attack

Coyote attacks on humans are uncommon and rarely cause serious injuries, due to the relatively small size of the coyote. However, coyote attacks on humans have increased since 1998 in the state of California. Data from USDA Wildlife Services, the California Department of Fish & Game, and other sources show that while 41 attacks occurred during the period of 1988–1997, 48 attacks were verified from 1998 through 2003. The majority of these incidents occurred in Southern California near the suburban-wildland interface.[57]

Due to an absence of harassment by residents, urban coyotes lose their natural fear of humans, which is further worsened by people intentionally feeding coyotes. In such situations, some coyotes have begun to act aggressively toward humans, chasing joggers and bicyclists, confronting people walking their dogs, and stalking small children.[57] Non-rabid coyotes in these areas will sometimes target small children, mostly under the age of 10, though some adults have been bitten. In June 2010 a 3-year-old girl and a 6-year-old girl were attacked and seriously injured in separate attacks by coyotes in Rye, New York, a suburb of New York City. The 6-year-old was attacked by two coyotes on June 25 and the 3-year-old was attacked by one coyote on June 29. There was no indication the animals were rabid, but the girls were given treatment as a precaution.[58][59] In June 2011 an unattended toddler on a trampoline was attacked by a coyote who attempted to drag her into the woods in North Carolina.[60]

There are only two recorded fatalities in North America from coyote attacks. In 1981 in Glendale, California, a coyote attacked toddler Kelly Keen, who was rescued by her father, but died in surgery due to blood loss and a broken neck.[57][61] In October 2009, Taylor Mitchell, a 19-year-old folk singer on tour, died from injuries sustained in an attack by a pair of coyotes while hiking in the Skyline Trail of the Cape Breton Highlands National Park in Nova Scotia, Canada.[62] Recent studies have shown, however, that the large northeastern coyotes responsible for this attack may in fact be coyote-wolf hybrids (or coywolves) due to absorption of wolves when coyotes moved into eastern North America.[63]

Livestock and pet predation

Coyotes are presently the most abundant livestock predators in western North America, causing the majority of sheep, goat and cattle losses.[15] For example, according to the National Agricultural Statistics Service, coyotes were responsible for 60.5% of the 224,000 sheep deaths that were attributed to predation in 2004.[64] The total number of sheep deaths in 2004 comprised 2.22% of the total sheep and lamb population in the United States.[65] According to the National Agricultural Statistics Service USDA report, "All sheep and lamb inventory in the United States on July 1, 2005, totaled 7.80 million head, 2% above July 1, 2004. Breeding sheep inventory at 4.66 million head on July 1, 2005 was 2% above July 1, 2004."[66] By virtue of the fact that coyote populations are typically many times greater and more widely distributed than those of wolves, coyotes cause more overall predation losses. However, an Idaho census taken in 2005 showed that individual coyotes were one-twentieth as likely to attack livestock than individual wolves.[67]

Coyotes will typically bite the throat just behind the jaw and below the ear when attacking adult sheep or goats, with death commonly resulting from suffocation. Blood loss is usually a secondary cause of death. Calves and heavily-fleeced sheep are killed by attacking the flanks or hind-quarters, causing shock and blood loss. When attacking smaller prey, such as young lambs, the kill is made by biting the skull and spinal regions, causing massive tissue and ossular damage. Small or young prey may be completely carried off, leaving only blood as evidence of a kill. Coyotes will usually leave the hide and most of the skeleton of larger animals relatively intact, unless food is scarce, in which case they may leave only the largest bones. Scattered bits of wool, skin and other parts are characteristic where coyotes feed extensively on larger carcasses.[15]

Coyote with a typical throat hold on domestic sheep

Coyote predation can usually be distinguished from dog or coydog predation by the fact that coyotes partially consume their victims. Tracks are also an important factor in distinguishing coyote from dog predation. Coyote tracks tend to be more oval-shaped and compact than those of domestic dogs, plus, claw marks are less prominent and the tracks tend to follow a straight line more closely than those of dogs. With the exception of sighthounds, most dogs of similar weight to coyotes have a slightly shorter stride.[15] Coyote kills can be distinguished from wolf kills by the fact that there is less damage to the underlying tissues. Also, coyote scats tend to be smaller than wolf scats.[68]

The U.S. government routinely shoots, poisons, traps and kills 90,000 coyotes each year to protect livestock.[69]

Coyotes are often attracted to dog food and animals that are small enough to appear as prey. Items like garbage, pet food, and sometimes feeding stations for birds and squirrels will attract coyotes into backyards. Approximately 3 to 5 pets attacked by coyotes are brought into the Animal Urgent Care hospital of south Orange County (California) each week, the majority of which are dogs, since cats typically do not survive the attacks.[70] Scat analysis collected near Claremont, California revealed that coyotes relied heavily on pets as a food source in winter and spring.[57] At one location in Southern California, coyotes began relying on a colony of feral cats as a food source. Over time, the coyotes killed most of the cats, and then continued to eat the cat food placed daily at the colony site by citizens who were maintaining the cat colony.[57] Coyotes usually attack smaller sized dogs, but they have been known to attack even large, powerful breeds like the Rottweiler in exceptional cases.[71] Dogs larger than coyotes are generally able to drive them off, and have been known to kill coyotes. Smaller breeds are more likely to suffer injury or death.

Pelts

In the early days of European settlement in North Dakota, American Beavers were the most valued and sought after furbearers, though other species were also taken, including coyotes.[72] Coyotes are an important furbearer in the region. During the 1983–86 seasons, North Dakota buyers purchased an average of 7,913 pelts annually, for an average annual combined return to takers of $255,458. In 1986–87, South Dakota buyers purchased 8,149 pelts for a total of $349,674 to takers.[73]

The harvest of coyote pelts in Texas has varied over the past few decades, but has generally followed a downward trend. A study from the Texas Parks and Wildlife Department, however, found that there was no indication of population decline, and suggested that, as pelt prices were not increasing, the decrease in harvest was likely due to decreasing demand, and not increasing scarcity (where pelt prices would go up.) It suggested that fashion, and the changing custom of wearing fur garments, may be significant among these factors.[74]

Today, coyote fur is still used for full coats and trim and is particularly popular for men’s coats.[75]

Character in mythology

Coyote tries to persuade Opossum to let him have some persimmons, in a Caddo story.

Traditional stories from many Native American, First Nations, and Aboriginal cultures include a deity whose name is translated into English as Coyote. Although especially common in stories told by southwestern Native American nations, such as the Diné and Apache, stories about Coyote appear in dozens of Native American nations from Canada to Mexico.

Usually appearing as a trickster, a culture hero or both, Coyote also often appears in creation myths and etiological myths. Although often appearing in stories as male, Coyote can be female, hermaphrodite, or gender changing, in traditional Aboriginal stories.

Contemporary cultural references

The coyote is a popular figure in folklore and popular culture. References may invoke either the animal or the mythological figure. Traits commonly described in pop culture appearances include inventiveness, mischievousness, and evasiveness. By far the best known representation is the animated Wile E. Coyote, Super Genius, whose popularity has spread the three-syllable Spanish pronunciation of the word coyote throughout English-speaking North America.

Coyote is also a slang term for a person who smuggles illegal immigrants over the border from Mexico to the United States.

The Phoenix Coyotes are a National Hockey League franchise based in Arizona.

The mascot of the University of South Dakota is the coyote.

The NBA San Antonio Spurs mascot is "The Coyote" as well.

Taxonomy

Subspecies

There are 19 recognized subspecies of coyote:[76]

Genus controversy

In 1816, in the third volume of Lorenz Oken's Lehrbuch der Naturgeschichte, the author found sufficient similarities in the dentition of coyotesgenus from Canis called Thos after the classical Greek word θώς (jackal). Oken's idiosyncratic nomenclatorial ways, however, aroused the scorn of a number of zoological systematists. Nearly all the descriptive words used to justify the genus division were relative terms without a reference measure, and the argument did not take into account the size differences between the species, which can be considerable. Angel Cabrera, in his 1932 monograph on the mammals of Morocco, briefly touched upon the question of whether or not the presence of a cingulum on the upper molars of the jackals and its corresponding absence in the rest of Canis could justify a subdivision of the genus Canis. In practice, he chose the undivided-genus alternative and referred to the jackals as Canis.[78] A few authors, however, Ernest Thompson Seton being among them, accepted Oken's nomenclature, and went as far as referring to the coyote as American jackal.[79]

The Oken/Heller proposal of the new genus Thos did not affect the classification of the coyote. Gerrit S. Miller still had in his 1924 edition of List of North American Recent Mammals in the section “Genus Canis Linnaeas,” the subordinate heading “Subgenus Thos Oken” and backed it up with a reference to Heller. In the reworked version of the book in 1955, Philip Hershkovitz and Hartley Jackson led him to drop Thos both as an available scientific term and as a viable subgenus of Canis. In his definitive study of the taxonomy of the coyote, Jackson had, in response to Miller, queried whether Heller had seriously looked at specimens of coyotes prior to his 1914 article and thought the characters to be “not sufficiently important or stable to warrant subgeneric recognition for the group”.[78]

See also

Coyotes in popular culture

References

  1. ^ Sillero-Zubiri & Hoffmann (2008). Canis latrans. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on May 5, 2008. Database entry includes justification for why this species is of least concern
  2. ^ Respelled US ky-oh-tee, ky-oht and UK koy-yoh-tay, koy-yoht
  3. ^ a b c d e f g h i j k l m n "Canis latrans". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Canis_latrans.html. Retrieved August 15, 2007. 
  4. ^ a b "Coyote". Lioncrusher's Domain. http://www.lioncrusher.com/animal.asp?animal=11. Retrieved August 15, 2007. 
  5. ^ PaleoBiology Database: ''Canis latrans''. Paleodb.org. Retrieved on 2011-07-09.
  6. ^ "Statement by Valerius Geist pertaining to the death of Kenton Carnegie" (PDF). Wolf Crossing. http://washingtonwolf.info/pdf/dr_valarius_geist_re_carnegie.pdf. Retrieved September 17, 2008. 
  7. ^ Koler-Matznick, Janice (2002). "The Origin of the Dog Revisited". Anthrozoös 15 (2): 98–118. doi:10.2752/089279302786992595. 
  8. ^ Fedriani J. M., T.K. Fuller and R. Sauvajot (2001). "Does availability of anthropogenic foods enhace densities of omnivorous mammals? An example with coyotes in southern California". Ecography 24 (3): 325–331. doi:10.1111/j.1600-0587.2001.tb00205.x. http://www.ebd.csic.es/cani/public_html/Ecography.pdf. 
  9. ^ coyote. Dictionary.reference.com. Retrieved on 2011-07-09.
  10. ^ "Coyote (Canis latrans)". Western Wildlife Conservancy. http://www.westwildcon.org/library_coyotes.html. Retrieved November 29, 2009. 
  11. ^ The yowl of the suburbs. Times Union (2010-08-11). Retrieved on 2011-05-10.
  12. ^ Coyote (Canis latrans). University of Washington, Olympic Natural Resources Center
  13. ^ Coyote. Replay.web.archive.org (2009-04-18). Retrieved on 2011-07-09.
  14. ^ Coyote (Canis latrans), The Mammals of Texas – Online Edition, Texas Tech University
  15. ^ a b c d "Coyote Predation – Description". A. Wade, Dale & E. Bowns, James. Procedures for Evaluating Predation on Livestock and Wildlife. Archived from the original on August 6, 2007. http://web.archive.org/web/20070806144513/http://texnat.tamu.edu/ranchref/predator/coyote/t-coyote.htm. Retrieved August 19, 2007. 
  16. ^ David L. Mech & Luigi Boitani (2003). Wolves: Behavior, ecology and conservation. Chicago: University of Chicago Press. p. 448. ISBN 0226516962. http://books.google.com/books?id=_mXHuSSbiGgC&pg=PA448. 
  17. ^ a b Coppinger, Ray (2001). Dogs: a Startling New Understanding of Canine Origin, Behavior and Evolution. New York: Scribner. p. 352. ISBN 0684855305. 
  18. ^ Speed of Animals, Infoplease.com, sourced from Natural History Magazine, March 1974; The American Museum of Natural History
  19. ^ a b Macdonald, David (1984). The Encyclopedia of Mammals: 1. London: Allen & Unwin. p. 446. ISBN 0-04-500028-x. http://www.amazon.com/dp/0871968711. 
  20. ^ Domestication: the decline of environmental appreciation by Helmut Hemmer, translated by Neil Beckhaus, Edition: 2, illustrated. Published by Cambridge University Press, 1990. ISBN 0-521-34178-7
  21. ^ Collective Nouns: Java Glossary. Mindprod.com (1993-11-01). Retrieved on 2011-07-09.
  22. ^ McClennen, N., R. Wigglesworth, and S. H. Anderson (2001). "The effect of suburban and agricultural development on the activity patterns of coyotes (Canis latrans)". American Midland Naturalist 146: 27–36. doi:10.1674/0003-0031(2001)146[0027:TEOSAA]2.0.CO;2. JSTOR 3083149. 
  23. ^ a b "Eastern Coyotes Are Becoming Coywolves". David Zimmerman. Caledonian record. http://www.propertyrightsresearch.org/2006/articles04/eastern_coyotes_are_becoming_coy.htm. Retrieved August 17, 2007. 
  24. ^ "Coyote (Canis latrans)". Michigan Department of Natural Resources. http://www.michigan.gov/dnr/0,1607,7-153-10370_12145_12205-60378--,00.html. Retrieved March 6, 2008. 
  25. ^ Fox, Michael W. (1984). The Whistling Hunters: Field Studies of the Asiatic Wild Dog (Cuon Alpinus). Albany: State University of New York Press. p. 150. ISBN 0873958438. http://www.amazon.com/dp/0873958438. 
  26. ^ "The Evolution & History of Wolves". Rioghal Kennels. Rioghal Kennels. http://hal_macgregor.tripod.com/kennel/Kennel.htm. Retrieved November 4, 2008. 
  27. ^ CoyoteClub.org: Photos of deceased coydogs
  28. ^ Doris Feddersen-Petersen, Hundepsychologie, 4. Auflage, 2004, Franck-Kosmos-Verlag 2004
  29. ^ Canadian Parks and Wilderness Society – Eastern Wolf
  30. ^ "The red wolf (Canis rufus) – hybrid or not?". Montana State University. http://www.montana.edu/~wwwbi/staff/creel/bio480/The%20red%20wolf.pdf. Retrieved August 4, 2008. 
  31. ^ "Coyotes kill Toronto singer in Cape Breton". CBC News. October 29, 2009. http://www.cbc.ca/canada/nova-scotia/story/2009/10/28/ns-coyote-attack-died.html. 
  32. ^ "Yellowstone National Park- Coyotes". nps.gov. http://www.nps.gov/yell/naturescience/coyotes.htm. Retrieved August 17, 2007. 
  33. ^ Yellowstone National Park – Coyotes (U.S. National Park Service). Nps.gov (2009-06-12). Retrieved on 2011-05-10.
  34. ^ "Weaving A New Web: Wolves Change An Ecosystem", Zoogoer magazine, May/June 1998, Smithsonian National Zoo
  35. ^ "Coyotes Cower in Wolf Territory". Livescience. http://www.livescience.com/animals/070911_wolves_coyotes.html. Retrieved March 20, 2008. 
  36. ^ "Preventing Predation of Your Sheep Flock: Predators and Prey", student project at Purdue University. Ag.ansc.purdue.edu. Retrieved on 2011-07-09.
  37. ^ "Coyote In the Suburbs". Q&A websites. http://www.qawebsites.com/coyote.htm. Retrieved September 2, 2007. 
  38. ^ Yellowstone Wildlife – Coyote. Yellowstonenationalpark.com. Retrieved on 2011-05-10.
  39. ^ "Observed Interactions Between Coyotes and Red Foxes", Northern Prairie Wildlife Research Center, United States Geological Survey
  40. ^ a b c Fedriani, J . M., T. K. Fuller, R. M. Sauvajot, and E. C. York (2000). "Competition and intraguild predation among three sympatric carnivores". Oecologia 125 (2): 258–270. doi:10.1007/s004420000448. http://www.ebd.csic.es/cani/public_html/Oecologia_00.pdf. 
  41. ^ Litvaitis, J. A., and D. J. Harrison (1989). "Bobcat-coyote niche relationships during a period of coyote population increase". Canadian Journal of Zoology 67 (5): 1180–1188. doi:10.1139/z89-170. 
  42. ^ a b c Bunnell, Kevin D.; Flinders, Jerran T.; Wolfe, Michael L. (2006). "Potential Impacts of Coyotes and Snowmobiles on Lynx Conservation in the Intermountain West". Wildlife Society Bulletin 34 (3): 828. doi:10.2193/0091-7648(2006)34[828:PIOCAS]2.0.CO;2. ISSN 0091-7648. JSTOR 3784713. 
  43. ^ Anderson, E. M. 1986. Bobcat behavioral ecology in relation to resource use in southeastern Colorado. Dissertation, Colorado State University, Fort Collins, USA.
  44. ^ Jackson, D. H. 1986. Ecology of bobcats in east-central Colorado. Dissertation, Colorado State University, Fort Collins, USA.
  45. ^ Toweill, D. E. 1986. Resource partitioning by bobcats and coyotes in a coniferous forest. Thesis, Oregon State University, Corvallis, USA
  46. ^ Gipson, P. S., and J. F Kamler. 2002. Bobcat killed by coyote. Southwestern Naturalist4 7:511–514.
  47. ^ Knick, S. T. (1990). "Ecology of bobcats relative to exploitation and a prey decline in southeastern Idaho". Wildlife Monographs 108 (108): 1–42. JSTOR 3830671. 
  48. ^ Philip S. Gipson and Jan F. Kamler (2002). "Bobcat Killed by a Coyote". The Southwestern Naturalist 47 (3): 511–513. doi:10.2307/3672519. JSTOR 3672519. 
  49. ^ "Canada Lynx – Wild cat of the Loomis – and more", Conservation Northwest
  50. ^ Gompper, M. 2002. Top Carnivores in the Suburbs? Ecological and conservation issues raised by colonization of North-eastern North America by coyotes. BioScience 52:185–190.
  51. ^ George A. Feldhamer; Bruce Carlyle Thompson; Joseph A. Chapman (2003). Wild mammals of North America: biology, management, and conservation. JHU Press. pp. 467–. ISBN 9780801874161. http://books.google.com/books?id=-xQalfqP7BcC&pg=PA467. Retrieved 10 May 2011. 
  52. ^ "Thriving under our noses, stealthily: coyotes" URL accessed on January 9, 2006.
  53. ^ Newman, Maria, and Janon Fisher. "Elusive Coyote Is Captured in Central Park." New York Times March 22, 2006. 7 November 2009.
  54. ^ "And the coyote shall lie down with the SoBes ...". Associated Press. April 4, 2007. http://www.msnbc.msn.com/id/17950832/. Retrieved April 4, 2007. 
  55. ^ Meincke, Paul (April 4, 2007). "Coyote captured in Loop to be set free". WLS-TV. http://abclocal.go.com/wls/story?section=news/local&id=5179979. Retrieved April 4, 2007. 
  56. ^ » Three Coyotes Spotted on Columbia’s Campus. Myupperwest.com (2010-02-08). Retrieved on 2011-05-10.
  57. ^ a b c d e "Coyote Attacks: An Increasing Suburban Problem". Archived from the original on September 26, 2007. http://web.archive.org/web/20070926044522/http://www.co.san-diego.ca.us/awm/docs/coyoteattacks.pdf. Retrieved August 19, 2007. 
  58. ^ Coyote Attack – Rye PD Press Conference and Statement. MyRye.com. Retrieved on 2011-05-10.
  59. ^ Play Moves Indoors Near NYC After 2 Coyote Attacks, Associated Press, via ABC News/U.S., June 30, 2010. Retrieved June 30, 2010
  60. ^ "Coyote Attacks Toddler". WGHP News Story. WGHP. http://www.myfox8.com/news/wghp-story-coyote-attacks-toddler-girl-trinity-randolph-110618,0,3125115.story. 
  61. ^ Coyote Attacks on Children. Varmintal.com. Retrieved on 2011-07-09.
  62. ^ "Coyotes kill woman in Cape Breton". CBC News. October 29, 2009. http://www.cbc.ca/canada/nova-scotia/story/2009/10/28/ns-coyote-attack-died.html. Retrieved October 28, 2009. 
  63. ^ A shocking coywolf attack in Cape Breton – updated : Contrarian. Contrarian.ca (2009-10-27). Retrieved on 2011-05-10.
  64. ^ Sheep and Goats Death Loss. National Agricultural Statistics Service. May 6, 2005. http://usda.mannlib.cornell.edu/MannUsda/viewDocumentInfo.do?documentID=1628. Retrieved December 27, 2007. 
  65. ^ National Agricultural Statistics Service
  66. ^ "Sheep and lamb inventory". usda.mannlib.cornell.edu. http://usda.mannlib.cornell.edu/usda/current/Shee/Shee-07-22-2005.txt. Retrieved February 1, 2010. 
  67. ^ Relative risks of predation on livestock posed by individual wolves, black bears, mountain lions and coyotes in Idaho, Mark Collinge, United States Department of Agriculture, Animal and Plant Health Inspection Service, Wildlife Services, Boise, Idaho
  68. ^ Ranchers' Guide to Wolf Depredation, Montana State University
  69. ^ Controlling wily coyotes? Still no easy answers – US news – Environment – msnbc.com. MSNBC (2009-12-07). Retrieved on 2011-05-10.
  70. ^ "For coyotes, pets are prey". Greg Hardesty. Orange County Register. http://www.ocregister.com/ocr/sections/news/focus_in_depth/article_508026.php. Retrieved August 19, 2007. 
  71. ^ "A coyote attacks in Weymouth and kills a dog", WHDH-TV – New England News
  72. ^ History of the Fur Trade, Northern Prairie Wildlife Research Center, USGS
  73. ^ Dakotas Prairie Basin Wetlands, Northern Prairie Wildlife Research Center, USGS
  74. ^ Coyotes As Part Of Texas' Fur Trade, Symposium Proceedings, Coyotes in the Southwest: A Compendium of Our Knowledge December 13–14, 1995, Angelo, Texas
  75. ^ Facts on Fur Types. International Fur Trade Federation
  76. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000718. 
  77. ^ a b c d e f g h i j k l m n o p "Canis latrans". Fire Effects Information System. USDA Forest Service. http://www.fs.fed.us/database/feis/animals/mammal/cala/all.html. Retrieved January 21, 2009. 
  78. ^ a b "Thos vs Canis". Holger Homann’s Home Page. http://www.holgerhomann.us/Thos_vs%20%20Canis.htm. Retrieved March 29, 2008. 
  79. ^ Seton, Ernest Thompson (2006). Art Anatomy of Animals. Mineola, NY: Dover Publications. p. 160. ISBN 0486447472. http://www.amazon.co.uk/dp/0486447472?qisbn=1206802027. 

Further reading

  • "Canis latrans". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180599. Retrieved March 23, 2006. 
  • Robert M. Timm, Hopland Research & Extension Center, University of California, Hopland, California; Rex O. Baker, California State Polytechnic University-Pomona (retired), Corona, California; Joe R. Bennett, USDA APHIS Wildlife Services, Taft, California; and Craig C. Coolahan, USDA APHIS Wildlife Services, Sacramento, California, "Coyote Attacks: An Increasing Suburban Problem" (March 3, 2004). Hopland Research & Extension Center. Paper timm_baker_P047.
  • Bekoff, Marc. 1977. Canis Latrans, Species Account. American Society of Mammalogists.
  • Moehlman, P., and H. Hofer. 1997. "Cooperative breeding, reproductive suppression, and body mass in canids", chapter in Cooperative Breeding in Canids, ed. N. G. Solomon and J. A. French. Cambridge University Press, Cambridge, United Kingdom.
  • Morey, Paul. 2004. "Landscape use and diet of coyotes, Canis latrans, in the Chicago metropolitan area", Masters Thesis, Utah State University.
  • Parker, Gerry. 1995. "Eastern Coyote: Story of Its Success", Nimbus Publishing, Halifax, Nova Scotia, Canada.
  • Voigt, D. R., and W. E. Berg. 1999. "Coyote", chapter 28 in Wild Furbearer Management and Conservation in North America, Section IV: Species Biology, Management, and Conservation. Queen's Printer for Ontario, Ontario, Canada.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Recent genetic studies demonstrate that the Coyote, the eastern Gray Wolf (Canis lupus lycaon) and the Red Wolf (Canis rufus) represent a common North American canid lineage distinct from that of the Gray Wolf (Canis lupus), which has a Eurasian origin (Wilson et al. 2000). The Red Wolf/eastern Gray Wolf apparently diverged from the Coyote during the Pleistocene (Wilson et al. 2000). Eastern Gray Wolf (that is, C. lupus lycaon) genes apparently are incorporated into the coyote gene pool in the northeastern U.S.; Red Wolf (C. rufus) genes are incorporated into the coyote gene pool in the southeastern U.S. due to extensive hybridization. Genetic transfer of coyote mitochondrial DNA into wolf populations has occurred through hybridization in a contiguous geographic region in Minnesota, Ontario, and Quebec; the frequency of coyote-type mtDNA in these wolf populations is greater than 50%; no coyotes sampled had a wolf-derived mtDNA genotype; probably hybridization is occurring between male wolves and female coyotes in regions where coyotes only recently have become abundant following conversion of forests to farmlands (Lehman et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!