Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"Gray wolves usually live in packs, led by an ""alpha pair."" The pack includes some of the alpha pair's offspring and may include some unrelated wolves. A pack's territory can be as large as 13,000 square km. Howling probably helps advertise who ""owns"" a particular piece of territory. When pups are born, the mother stays near them for the first three weeks, and her mate and others in the pack bring food to her. The pups are weaned when they about nine weeks old. As adults, they may travel as far as 72 km a day with their pack and run as fast as 70 km per hour."

Adaptation: This transparent view of the wolf braincase shows how the brain is situated within. The large feature projecting from the front of the brain is the olfactory lobe, an important center related to the sense of smell.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition. Laurentii Salvii, Stockholm, 1:39, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Description

Typical large canine, long limbed with a rather narrow head. Coat gen­erally short, longer on the back, neck, and tail but at no point shag­gy. Fur grizzled gray, below more uniformly pale. Forelimbs lanky, tinged buff on upper leg to shoulder. Inside leg grayish. Hindquarters pale gray, tinged rust particularly at front of thigh. Head narrow, angular, and rather elongated. Forehead gray. Ears large and rather pointed, inside pale buff, tinged orange toward crown. Back of ears pale gray, tinged rust toward base. Upper side of muzzle gray, sides pale with black whiskers. Gray from muzzle continues around lower part of the eyes and up center of the head. There is a pale patch slightly above and inside each eye. Eyes roundish, amber-beige with dark brown pupils. Tail longer furred than most of body, grayish above, pale below with a black tip.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description of Canis familiaris

The domestic dog. This is regarded by most people as a subspecies of Canis lupus, see Canis lupus for a description.
Creative Commons Attribution 3.0 (CC BY 3.0)

David

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description of Canis lupus

There are about 40 suspecies of Canis lupus (dogs and wolves) , including two domesticated subspecies (Canis lupus dingo in Australia and Canis lupus familiaris - mans best frirned). Many subspecies of wolf occur throughout the Northern hemisphere. Canis lupus is assessed as Least Concern by the IUCN, as its relatively widespread range and stable population trend mean that the species, at global level, does not meet, or nearly meet, any of the criteria for the threatened categories. However, some local populations are classified as Endangered and some subspecies are endangered or extinct. The domestic dogs were derived from the gray wolf domestication about 15,000 years ago. The dog may have been the first animal to be domesticated, and has been the most widely kept working, hunting, and companion animal in human history. They quickly became widespread across world cultures. Dogs perform many roles for people, such as hunting, herding, pulling loads, protection, assisting police and military, companionship, and, more recently, aiding handicapped individuals. In some cultures, dogs are also an important source of meat. In 2001, there were estimated to be 400 million dogs in the world. Over the 15,000-year span in which the dog has been domesticated, it has diverged into a handful of landraces, groups of similar animals whose morphology and behavior have been shaped by environmental factors and functional roles.Selective breeding has produced hundreds of varied breeds, showing more behavioral and morphological variation than any other land mammal. Height measured to the withers ranges from a few inches in the Chihuahua to a few feet in the Irish Wolfhound; color varies from white through grays (usually called blue) to black, and browns from light (tan) to dark (red or chocolate) in a wide variation of patterns.
Creative Commons Attribution 3.0 (CC BY 3.0)

David

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Originally, the Grey Wolf was the world's most widely distributed mammal, living throughout the northern hemisphere north of 15°N latitude in North America and 12°N in India. It has become extinct in much of Western Europe (Boitani 1995), in Mexico and much of the USA (Mech 1970). Their present distribution is more restricted: wolves occur primarily in wilderness and remote areas, especially in Canada, Alaska and northern USA, Europe, and Asia from about 75°N to 12°N.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The original range of Canis lupus consisted of the majority of the Northern hemisphere -- from the Arctic continuing south to a latitude of 20° S, which runs through southern Central Mexico, northern Africa, and southern Asia. However, due to habitat destruction, environmental change, persecution by humans, and other barriers to population growth, gray wolf populations are now found only in a few areas of the contiguous United States, Alaska, Canada, Mexico (a small population), and Eurasia.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

No authenticated specimens known from Sinai, although a long Bedouin tradition exists and several scientific claims of sightings, including a camera-trap photo from St Katherine in 2005; very difficult
to exclude the possibility of feral dogs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Localized? (South Sinai).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Sp is Widespread (Holarctic, south to Mexico, Arabian Peninsula, India); ssp Narrow (Arabian Peninsula, Palestine/ Israel).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Formerly throughout North America south through much of Mexico; also Europe and Asia. Replaced by the red wolf in the southeastern United States. Today found south of Canada only in northern Mexico (no recent confirmed reports; extirpated or maybe a few in eastern Sonora, Chihuahua, and/or Zacatecas?), a few areas in the Rocky Mountains (northwestern Montana, reintroduction sites in Wyoming and Idaho), northwestern Great Lakes region (northeastern third of Minnesota, northern Wisconsin, Michigan Upper Peninsula), and Cascade Mountains of northern Washington. Formerly much more numerous in the Rocky Mountain states than in the southwestern U.S. (Johnson 1991). Extirpated in much of southern Canada (see Theberge [1992] and Can. Field-Nat. 106:138 for range/status map); remains in 85% of former total Canadian range (Theberge 1991).

In 1995, wolf reintroductions were initiated in the Yellowstone ecosystem and in central Idaho (nonessential experimental populations) (USFWS 1994; Federal Register, 16 August 1994; Bangs and Fritts 1993; End. Sp. Bull. 20(4):4-5). See Bangs et al. (1998) for information on the status of gray wolf restoration in Montana, Idaho, and Wyoming. In 1998, USFWS (Federal Register, 12 January 1998) announced its intention to reintroduce the Mexican gray wolf (subspecies baileyi) into Arizona and New Mexico (Apache and Gila national forests, also possibly White Sands Missile Range).

Wolf observations in the Dakotas have increased in recent years, likely related to range expansion and population increases in adjacent areas, especially Minnesota; most occurrences have been of young individuals, suggesting dispersal (Licht and Fritts 1994).

Grewal et al. (2004) used genetic data to determine that the wolf population in Algonquin Provincial Park in Ontario, Canada, is a southern part of a larger metapopulation of Canis lycaon (or Canis lupus lycaon).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:

Holarctic

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The largest of approximately 41 wild species of canids, gray wolves vary in size based primarily on geographic locality, with southern populations generally smaller than northern populations. Total body length, from tip of the nose to tip of the tail, is from 1000 to 1300 mm in males, and 870 to 1170 mm in females. Tail length ranges between 350 to 520 mm. Males can weigh from 30 to 80 kg, with an average of 55 kg, females can weigh from 23 to 55 kg, with an average of 45 kg. Height (measured from base of paws to shoulder) generally ranges from 60 to 90 cm. Distance between the canines is around 4 cm.

Fur color of gray wolves also varies geographically, ranging from pure white in Arctic populations, to mixtures of white with gray, brown, cinammon, and black to nearly uniform black in some color phases.

North American populations have three distinct color phases. The normal phase is characterized by varying mixtures of white with shades of black, gray, cinnamon, and brown on the upper parts of the animal. The back is usually more profoundly black, and the muzzle, ears, and limbs have cinammon coloration as well. Under parts are whitish and the tail is conspicuously black over the tail gland, and paler below to the tip, which is nearly pure black. The black phase of North American populations is characterized by the upper parts varying from brown to black, with specks of white; the underparts are paler in tone, and there is often a pure white medial pectoral spot. The third color phase occurs during the first pelage of young wolves. The upper parts are drab-gray, overlaid with brownish-black. The underparts are paler as well, and the ears vary from black to buffy, depending on the subspecies (Young 1944).

Gray wolves have a dense underfur layer, providing them with excellent insulation against cold conditions.

Gray wolves can be distinguished from red wolves (Canis rufus) by their larger size, broader snout, and shorter ears. They are distinguished from coyotes (Canis latrans) by being 50 to 100% larger and having a broader snout and larger feet.

Range mass: 23.0 to 80 kg.

Range length: 870 to 1300 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length 82-109 cm, weight 12-23 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 205 cm

Weight: 40000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Average: 1,100 mm males; 1,050 kg, females
Range: 1,000-1,300 mm males; 870-1,170 mm females

Weight:
Average: 55 kg males; 45 kg females
Range: 30-80 kg males; 23-55 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the coyote in larger nose pad (greater than 1 inch vs. less than 1 inch), more rounded ears, larger anteroposterior diameter of upper canine at gum level (more than 11 mm vs. less than 11 mm), larger heel pad on forefoot (more than 1.25 inches vs. less than 1.25 inches), longer skull (more than 215 mm and 2.5 mm vs. less than 215 mm and 205 mm, for males and females, respectively), and relatively shorter canines (in coyote, tips of upper canines extend below level of anterior mental foramina when lower jaw is in place); also, gray wolf holds the tail high when running, coyote holds it low (see Hall 1981 and Hoffmeister 1986 for further details). In some parts of central and eastern North America, coyote approaches wolf in certain characteristics, due to interbreeding. Differs from the red wolf in larger size, longer skull (condylobasal length more than 213 mm and 203 mm vs. less than these measurements for males and females, respectively), and in certain features og the molars (see Hall 1981); however, the red wolf actually may be a coyote-gray wolf hybrid (see GTAXCOM for Canis rufus). Differs from the domestic dog in generally larger size, broader nose pad, more massive skull with heavier teeth, rostrum relatively longer, supraoccipital shield larger and projecting farther posteriorly, front foot track longer and narrower (Hoffmeister 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Taxonomy

Taxonomically difficult due to dog domestication and subsequent hybridization in many places.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Ranges in all northern habitats where there is suitable food (Mech 1970), densities being highest where prey biomass is highest (Fuller 1989). Food is extremely variable, but the majority comprises large ungulates (moose, caribou, deer, elk, wild boar, etc.). Wolves will also eat smaller prey items, livestock, carrion, and garbage.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Gray wolves are one of the most wide ranging land animals. They occupy a wide variety of habitats, from arctic tundra to forest, prairie, and arid landscapes.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; chaparral ; forest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Plains and rocky wadis in mountains.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No particular habitat preference. In Minnesota and Wisconsin, usually occurs in areas with few roads, which increase human access and incompatible land uses (Thiel 1985, Mech et al. 1988, Mech 1989) but apparently can occupy semi-wild lands if ungulate prey are abundant and if not killed by humans (see Mladenoff et al. 1997). Minimum of 10,000-13,000 sq km (with low road density) might be necessary to support a viable population (USFWS 1990); a single pack does not constitute a "minimum viable population" (USFWS 1990). Young are born in an underground burrow that has been abandoned by another mammal or dug by wolf. In Northwest Territories, dens were most commonly located witin 50 km of northern tree line, which resulted in maximal availability of caribou during the denning and pup rearing period; within the tundra zone, dens were not preferentially located near caribou calving grounds (Heard and Williams 1992). In Minnesota, dens usually were not near territory boundaries; den use was traditional in most denning alpha females studied for more than 1 year; possibly the availability of a stable food supply source helped determine den location (Ciucci and Mech 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Wolves in far northwestern North America may move as required to remain with migratory caribou.

Home ranges very large but very variable as well, generally ranging from less 100 to 10,000s of square kilometers. In Minnesota, Fritts and Mech (1981) found territory sizes ranging from 195 to 555 square kilometers; in south to central Alaska, Ballard et al. (1987) reported territory sizes from 943 to 2541 square kilometers; in the southern Yukon, Hayes (1992) found territory sizes of 583 to 794 km square kilometers; in the Kenai Peninsula, Alaska, Peterson et al. (1984) found average territory sizes of 638 square kilometers; and in coastal forests of Vancouver Island, Atkinson and Janz (1994) found territory sizes from 100 to 400 square kilometers. Packs that depend on barren ground caribou migrate with the caribou as far as 360 km (Kuyt 1972; Mech 1970, 1974). In the Glacier National Park area, territory size averages around 780 sq km (Bangs and Fritts 1993).

In the Northwest Territories and western Nunavut, Walton et al. (2001) fitted 23 wolves in 19 different packs with collar-mounted satellite transmitters. Annual home-range sizes (95% minimum convex polygon) averaged 63,058 sq km for males and 44,936 sq km for females. Straight-line distances from the most distant location on the winter range to the den site averaged 508 km in 1997-1998 and 265 km in 1998-1999 (wolves followed caribou). All but 2 of 15 wolves returned to within 25 km of a previous den, and 2 wolves returned to the same den site.

Dispersing young may move several hundred kilometers. In Minnesota, most dispersers left when they were 11-12 months old; dispersal occurred mainly in February-April and October-November; 35% of known-age wolves remained in their natal territory for more than 2 years (Gese and Mech 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Gray wolves are carnivores. They hunt prey on their own, in packs, steal the prey of other predators, or scavenge carrion. Prey is located by chance or scent. Animals included in the diet of gray wolves varies geographically and depends on prey availability. Wolves primarily hunt in packs for large prey such as moose, elk, bison, musk oxen, and reindeer. Once these large ungulates are taken down, the wolves attack their rump, flank, and shoulder areas. Wolves control prey populations by hunting the weak, old, and immature. A wolf can consume up to 9 kg of meat at one meal. Wolves usually utilize the entire carcass, including some hair and bones. Smaller prey such as beavers, rabbits, and other small mammals are usually hunted by lone wolves, and they are a substantial part of their diet. Wolves may also eat livestock and garbage when it is available.

Animal Foods: mammals; carrion

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Predominant prey: ungulates. When these are low or seasonally unavailable, eats alternative prey, such as beaver, snowshoe hare, rodents, and carrion. Commonly hunts in packs, but lone wolves and pairs are able to kill prey as large as adult moose (Thurber and Peterson 1993). In the vicinity of Glacier National Park, feeds primarily on white-tailed deer; sometimes kills mountain lions and sometimes usurps ungulate prey killed by lions (Bangs and Fritts 1993). White-tailed deer and moose carrion were the primary prey in southern Ontario (Forbes and Theberge 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As top predators, gray wolves are important in regulating populations of their prey animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Few animals prey on gray wolves. Wolves and coyotes are highly territorial animals so wolves from other packs and coyotes will attack wolves that are alone or young. They will kill pups if they find them.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Canis lupus is prey of:
Canis lupus
Canis latrans

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Because wolves are wide-ranging it is difficult to estimate the number of distinct occurrences. The 30-km separation between EOs given in EOSPECS is a compromise figure. It could have been smaller in the northern USA where pack home ranges in Minnesota were 130 km2, or larger in Alaska where home ranges up to 13,000 km2 are reported (Mech and Frenzel 1971, Burkholder 1959).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Canada: about 50,000-58,500 in 1990; subject to hunting and trapping in all but a few percent of the range (Cohn 1990, Theberge 1991).

Alaska: about 6000 (Theberge 1991).

In 1998, there were at least 65 wolves in northwestern Montana, at least 122 in central Idaho, and 116 in the Greater Yellowstone Area (Bangs et al. 1998). In 2004, the northern Rocky Mountains population included more than 800 wolves (USFWS 2006).

Isle Royale population was about 14-16 in 1995. Michigan Upper Peninsula population was 112 in 1996/1997 (End. Sp. Bull. 22(3):21). Wisconsin: 150 in 1997-1997 (End. Sp. Bull. 22(3):21). Minnesota: nearly 2000 in mid-1990s (Mladenoff et al. 1997).

Southwestern U.S. and Mexico: none in the U.S. and very few if any in Mexico.

See Jhala and Giles (1991) for information on status in northwestern India (several hundred remain). Population estimates for the 1980s: former Soviet Union, 88,000; Inner Mongolia, less than 10,000; Yugoslavia, 2000-5000; Poland, about 1000; Spain, about 1000; 2000 or less in each of Iran, Afganistan, India, and Romania (see Theberge 1991). Population in the USSR in the mid-1940s was about 200,000-300,000; reduced to lowest numbers in history by the 1960s; increased to 1940s level by the 1980s; about 40,000 in Russia in 1995 (Yuli Gabur 1996, Natural Areas News 1(2):8-9).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Territorial throughout the year in most areas (but see Migration/Mobility comments). Packs consist of one or more family groups (generally 2-8 members, up to 21) with dominance hierarchy. In the Glacier National Park area, packs generally include 8-12 individuals (Bangs and Fritts 1993). Not uncommonly solitary; lone wolves may move through territories of established packs (e.g., see Thurber and Peterson 1993).

Population density is low; at Isle Royale National Park, Michigan, peak density was 9/100 sq km. Population density on Isle Royale followed trends in food supply (moose), with lag of 2-3 years (Peterson and Page 1988).

Generally wolves are not instrumental in causing prey declines; effect varies with other circumstances. In Quebec, winter weather appeared to affect deer population trend more than did wolf predation (Potvin et al. 1992). In south-central Alaska, wolf predation may have limited caribou recruitment (Bergerud and Ballard 1988), though winter starvation also was proposed as a significant poplation control. May take livestock as secondary prey when deer fawns (the primary summer prey) are less vulnerable due to better prenatal nutrition resulting from mild winter (USFWS 1990). In Minnesota, snow-induced changes in deer distribution and mobility resulted in changes in wolf movement patterns, sociality, and feeding behavior (when snow was shallow, wolves traveled farther and more often, spent less time with pack members, and used conifer cover less and killed fewer deer there) (Fuller 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Rank is communicated among wolves by body language and facial expressions, such as crouching, chin touching, and rolling over to show their stomach.

Vocalizations, such as howling allows pack members to communicate with each other about where they are, when they should assemble for group hunts, and to communicate with other packs about where the boundaries of their territories are. Scent marking is ordinarily only done by the alpha male, and is used for communication with other packs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Nocturnal. Omnivorous, feeding on gazelle, hare, fox, reptiles, sheep and goats, also eat garbage. Live solitarily or in pairs in territories of up to 60 km²; range widely, up to 10.5 km per day. Mating occur  in Jan. Up to 6 young born end of April after gestation of 9 weeks. Suckle for 8-10 weeks and reach sexual maturity at 22-46 months. Lives up to 16 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Mainly nocturnal. In fall-winter in Minnesota, spends most of time sleeping, resting, or traveling, little time feeding (Mech, 1992, J. Mamm. 73:570-571). In south-central Alaska, den site activity was mainly nocturnal; there was a high probability that groups of wolves would be present at the den at midday (Ballard et al., 1991, Can. Field-Nat. 105:497-504).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Gray wolves may live thirteen years in the wild, though average lifespan is 5 to 6 years.  As adults they usually die from old age or from injuries received while hunting or fighting with other wolves.  In captivity they may live to be fifteen years of age.

Range lifespan

Status: wild:
13.0 (high) years.

Average lifespan

Status: wild:
5.0 years.

Range lifespan

Status: captivity:
15.0 (high) years.

Average lifespan

Status: wild:
10.0 years.

Average lifespan

Status: captivity:
20.0 years.

Average lifespan

Sex: female

Status: wild:
13.7 years.

Average lifespan

Sex: female

Status: captivity:
16.0 years.

Average lifespan

Status: wild:
16.0 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.6 years (captivity) Observations: In the wild, 10 year-old females have been known to give birth and record longevity is 13.7 years (Ronald Nowak 1999). One wild born male was around 20.6 years old when he died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The dominant pair in a grey wolf pack are the only members that breed. This pair is monogamous although, with the death of an alpha individual, a new alpha male or female will emerge and take over as the mate.

Mating System: monogamous ; cooperative breeder

Breeding occurs between the months of January and April, with northern populations breeding later in the season than southern populations. Female gray wolves choose their mates and often form a life-long pair bond. Gray wolf pairs spend a great deal of time together. Female gray wolves come into estrus once each year and lasts 5 to 14 days, mating occurs during this time. After mating occurs, the female digs a den in which to raise her young. The den is often dug with an entrance that slopes down and then up again to a higher area to avoid flooding. Pups are born in the den and will remain there for several weeks after birth. Other dens are under cliffs, under fallen trees, and in caves.

The gestation period lasts between 60 and 63 days, litter size ranges from one to fourteen, with the average size being six or seven pups. Pups remain in the den until they are 8 to 10 weeks old. Females stay with their pups almost exclusively for the first 3 weeks. Pups are cared for by all members of the pack. Until they are 45 days old the pups are fed regurgitated food by all pack members. They are fed meat provided by pack members after that age.

Female pups reach maturity at two years of age, while males will not reach full maturity until three years of age. Most young gray wolves disperse from their natal pack when they are between 1 and 3 years old.

Breeding interval: Gray wolves breed once each year.

Breeding season: Gray wolves breed between January and March, depending on where they are living.

Range number of offspring: 5.0 to 14.0.

Average number of offspring: 7.0.

Range gestation period: 63.0 (high) days.

Average weaning age: 45.0 days.

Range age at sexual or reproductive maturity (female): 2.0 to 3.0 years.

Range age at sexual or reproductive maturity (male): 2.0 to 3.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 450 g.

Average number of offspring: 6.

Gray wolf pups are born blind and deaf. They weigh approximately 0.5 kg and depend on the mother for warmth. At ten to fifteen days of age, the pups' blue eyes open, but they only have control over their front legs, thus crawling is their only mode of mobility. Five to ten days later, the young are able to stand, walk, and vocalize.  Pups are cared for by all members of the pack. Until they are 45 days old the pups are fed regurgitated food by all pack members. They are fed meat provided by pack members after that age. During the 20th to 77th day, the pups leave the den for the first time and learn to play fight. Interactions at this time, as well as the dominance status of the mother, ultimately determines their position in the pack hierarchy. Wolf pups develop rapidly, they must be large and accomplished enough to hunt with the pack with the onset of winter. At approximately ten months old, the young begin to hunt with the pack.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning; maternal position in the dominance hierarchy affects status of young

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds late fall/early winter in south, February-March in north. Gestation lasts about 2 months. Young are born in March and early April in the south (Hoffmeister 1986), late April in northwestern Montana, late May-early June in Northwest Territories (Heard and Williams 1992). Litter size is 4-10 (average 6-7); 1 litter/year. Only the dominant male/female mate and rear offspring. Pups emerge from the den in about 3 weeks. Pups are weaned in 50 days (also reported as 5 weeks). Young and parents vacate the den when young are about 3 months old (Hoffmeister 1986). Some offspring remain with the pack, others disperse as they mature. Breeding first occurs in the second or third year (Hoffmeister 1986). Lone wolves generally do not successfully rear young, but they may if food is abundant (Boyd and Jimenez, 1994, J. Mamm. 75:14-17).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Senses detect epileptic seizures: dog
 

Dogs can determine when their owners are about to have an epileptic seizure by sensing subtle cues.

   
  "The British Epilepsy Association believes that epilepsy-prescient dogs such as these are sensing two very subtle clues to impending epilepsy attacks. One is a high-pitched sound emitted by epileptics up to half an hour before an attack takes place, which is thought to be linked to the abnormal electrical impulses in the brain that occur prior to a seizure. The other is an exceedingly faint odor emitted by epileptics at about the same time as the sound, whose origin is as yet unexplained. Both clues cannot be detected by humans, but can be discerned by the dogs' more acute senses of hearing and smell." (Shuker 2001:226)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Nose sniffs out cancer: dog
 

The noses of some domestic dogs can detect some forms of cancer in humans via an acute sense of smell.

   
  "In the course of some bibliographical research during the early 1990s, Dr. Armand Cognetta, a dermatologist based in Florida, was surprised to discover in the medical literature a number of confirmed cases in which patients had been found to possess hitherto-unsuspected skin cancers that were detected after their pet dogs (usually for several months before the diagnosis) had been compulsively sniffing the area of skin containing the malignancy. Indeed, in each case it had been the behavior of the dog that had finally prompted the owner to seek medical advice in order to find out why their pet was acting so strangely." (Shuker 2001:227)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Canis lupus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 284 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0334-06|AY656749|Canis lupus| AACCGATGATTGTTCTCCACTAATCACAAGGATATTGGTACTTTATACTTACTATTTGGAGCATGAGCCGGTATAGTAGGCACTGCCTTG---AGCCTCCTCATCCGAGCCGAACTAGGTCAGCCCGGTACTTTACTAGGTGAC---GATCAAATTTATAATGTCATCGTAACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCCATCATAATTGGGGGCTTTGGAAACTGACTAGTGCCGTTAATA---ATTGGTGCTCCGGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTCCTTCCTCCATCCTTTCTTCTACTATTAGCATCTTCTATGGTAGAAGCAGGTGCAGGAACGGGATGAACCGTATACCCCCCACTGGCTGGCAATCTGGCCCATGCAGGAGCATCCGTTGACCTT---ACAATTTTCTCCTTACACTTAGCCGGAGTCTCTTCTATTTTAGGGGCAATTAATTTCATCACTACTATTATCAACATAAAACCCCCTGCAATATCCCAGTATCAAACTCCCCTGTTTGTATGATCAGTACTAATTACAGCAGTTCTACTCTTACTATCCCTGCCTGTACTGGCTGCT---GGAATTACAATACTTTTAACAGACCGGAATCTTAATACAACATTTTTTGATCCCGCTGGAGGAGGAGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGGCATCCTGAAGTTTACATTCTTATCCTGCCCGGATTCGGAATAATTTCTCACATTGTCACTTACTACTCAGGGAAAAAA---GAGCCTTTCGGTTATATAGGAATAGTATGAGCAATAATATCTATTGGGTTTTTAGGCTTTATCGTATGAGCTCACCATATGTTTACCGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Canis lupus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 284
Species: 296
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Mech, L.D. & Boitani, L. (IUCN SSC Wolf Specialist Group)

Reviewer/s
Sillero-Zubiri, C. & Hoffmann, M.

Contributor/s

Justification

Originally, the Grey Wolf was the world's most widely distributed mammal. It has become extinct in much of Western Europe, in Mexico and much of the USA, and their present distribution is more restricted; wolves occur primarily but not exclusively in wilderness and remote areas. Their original worldwide range has been reduced by about one-third by deliberate persecution due to depredation on livestock and fear of attacks on humans. Since about 1970, legal protection, land-use changes and rural human population shifts to cities have arrested wolf population declines and fostered natural recolonization in parts of its range and reintroduction in three areas of USA. Continued threats include competition with humans for livestock and game species, exaggerated concern by the public regarding the threat and danger of wolves, and fragmentation of habitat, with resulting areas becoming too small for populations with long-term viability.

Although the Grey Wolf still faces some threats, its relatively widespread range and stable population trend mean that the species, at global level, does not meet, or nearly meet, any of the criteria for the threatened categories. Therefore, it is assessed as Least Concern (LC). However, at regional level, several wolf populations are seriously threatened. In North America, some of the reintroduced populations are still threatened; and in Europe, http://www.iucnredlist.org/apps/redlist/details/3746/1, http://www.iucnredlist.org/apps/redlist/details/3746/3, the species is classified as LC globally but several regional populations, such as the Western-Central Alps population, are classified as Endangered (http://www.lcie.org/).


History
  • 2004
    Least Concern
    (IUCN 2004)
  • 1996
    Lower Risk/least concern
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

"Few animals have ever haunted our dreams or fired our imaginations more than the wolf. Unfortunately, by the early part of this century, man had almost exterminated the wolf from the lower 48 states. The recovery of the wolf is becoming an impressive conservation success story and a gift to future generations" (Bruce Babbitt, Secretary of the Interior).

Wolves play an important role in the ecosystem by controlling natural prey populations and removing weak individuals. As settlement increased, the belief that livestock was endangered by wolf populations also increased. As such, the frequency of hunting the gray wolf exploded. The populations were nearly eradicated.  Currently in the lower 48 United States, about 2,600 gray wolves exist, with nearly 2,000 in Minnesota (compared to the few hundred living there in the mid-20th century). Successful recovery plans have been developed throughout the country. These plans evaluate the populations to determine distribution, abundance, and status.  The main cause of population declines has been habitat destruction and persecution by humans. But the reintroduction of gray wolves into protected lands has greatly increased the likelihood of their survival in North America.  Populations in Alaska and Canada have remained steady and are fairly numerous. Currently the State of Alaska manages 6,000 to 8,000 gray wolves and Canada's populations are estimated at about 50,000. The wolves in Canada are managed by provincial governments and are not currently threatened.

In western Eurasia gray wolf populations have been reduced to isolated remnants in Poland, Scandinavia, Russia, Portugal, Spain, and Italy. Wolves were exterminated from the British Isles in the 1700's and nearly disappeared from Japan and Greenland in the 20th century. Greenland's wolf populations seem to have made a full recovery. The status of wolf populations throughout much of eastern Eurasia is poorly known, but in many areas populations are probably stable.

Gray wolves are listed were until recently listed as endangered by the U.S. Fish and Wildlife Service and as threatened by the state of Michigan DNR. Most U.S. populations of gray wolves have now been delisted, except for experimental populations of Mexican gray wolves in the southwest. They are in CITES Appendix II, except for populations in Bhutan, India, Nepal and Pakistan, which are in Appendix I.

US Federal List: endangered

CITES: appendix i; appendix ii

State of Michigan List: threatened

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Data Deficient.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Rare.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Holarctic distribution; survives in wilderness that is not subject to human population pressures; extirpated from most of contiguous U.S. due to human-caused direct mortality; reintroduced populations in Yellowstone and central Idaho have been increasing rapidly; many (tens of thousands) remain in Canada/Alaska, about 2000 south of Canada, 100,000+ in Palearctic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/11/1967
Lead Region:   Mountain-Prairie Region (Region 6)   
Where Listed: Lower 48 States, except MN, MT, ID, portions of eastern OR, eastern WA, north-central UT, and where EXPN. Mexico.

Status: Threatened
Date Listed: 04/10/1978
Lead Region:   Great Lakes-Big Rivers Region (Region 3)   
Where Listed: MN

Status: Experimental Population, Non-Essential
Date Listed: 05/05/2011
Lead Region:   Mountain-Prairie Region (Region 6)   
Where Listed: WY, EXPN population

Status: Experimental Population, Non-Essential
Date Listed: 01/12/1998
Lead Region:   Southwest Region (Region 2)   
Where Listed: Mexican gray wolf, EXPN population

Status: Delisted due to Recovery
Date Listed: 05/05/2011
Lead Region:   Mountain-Prairie Region (Region 6)   
Where Listed: Northern Rocky Mountain DPS (delisted, except WY)

Status: Under Review
Date Listed: 05/05/2011
Lead Region:   Great Lakes-Big Rivers Region (Region 3)   
Where Listed: Western Great Lakes DPS


Population detail:

Population location: U.S.A. (WY see 17.84 (i) and (n))
Listing status: EXPN

Population location: U.S.A. (MN)
Listing status: T

Population location: U.S.A. (portions of AZ, NM and TX - see section 17.84(k))
Listing status: EXPN

Population location: U.S.A., conterminous (lower 48) States, except: (1) Where listed as an experimental population below; (2) Minnesota; (3) MT, ID, WY (however, see experimental population designation below), eastern WA (that portion of WA east of the centerline of Highway 97 and Highway 17 north of Mesa and that portion of WA east of the centerline of Highway 395 south of Mesa), eastern OR (portion of OR east of the centerline of Highway 395 and Highway 78 north of Burns Junction and that portion of OR east of the centerline of Highway 95 south of Burns Junction), and north central UT (that portion of UT east of the centerline of Highway 84 and north of Highway 80). Mexico.
Listing status: E

For most current information and documents related to the conservation status and management of Canis lupus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Because of the diversity in climate, topography, vegetation, human settlement and development of wolf range, wolf populations in various parts of the original range vary from extinct to relatively pristine. Wolf densities vary from about one/12 km² to one/120 km².

Sillero et al. (2004) provide details, for each range country, on subspecies present, population status, approximate numbers, the percentage of former range occupied at present, main prey (where known), legal status, and cause of decline.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Their original worldwide range has been reduced by about one-third, primarily in developed areas of Europe, Asia, Mexico, and the United States by poisoning and deliberate persecution due to depredation on livestock. Since about 1970, legal protection, land-use changes, and rural human population shifts to cities have arrested wolf population declines and fostered natural recolonization in parts of Western Europe and the United States, and reintroduction in the western United States. Continued threats include competition with humans for livestock, especially in developing countries, exaggerated concern by the public concerning the threat and danger of wolves, and fragmentation of habitat, with resulting areas becoming too small for populations with long-term viability. There is sustainable utilization of the species' fur in Canada, Alaska, and the former Soviet Union and Mongolia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Exterminated from large areas through trapping, shooting, poisoning, and reduction in prey populations (ungulate herds). Threatened by direct human-caused mortality and possibly habitat loss. Landscape change resulting from development may interfere with restoration in some areas (Carroll et al. 2003). Heavily persecuted in former Soviet Union and in China.

The threats to the northern Rocky Mountain wolf population have been reduced or eliminated as evidenced by the
population exceeding the numerical, distributional, and temporal recovery goals each year since 2002 (USFWS 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is included in CITES Appendix II, except populations from Bhutan, India, Nepal and Pakistan, which are listed on Appendix I. There is extensive legal protection in many European countries; however, enforcement is variable and often non-existent.

The species now receives legal protection in Afghanistan, having been listed by the Afghan Government on the country's 2009 Protected Species List. This prohibits all hunting and trade of C. lupus within Afghanistan.

It occurs in many protected areas across its range.

Occurrence in captivity:
The species lives and breeds well in captivity and is common in many zoological gardens.

Gaps in knowledge:
One of the most important questions still remaining about wolves involves the nature of their interaction with prey populations. The conditions under which wolves limit, regulate, or control their population is still open and important (Mech and Boitani 2003). Of more academic interest are questions involving wolf genetics, scent-marking behaviour, pseudo pregnancy and diseases (Mech 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: Natural recolonization from populations to the north may not be sufficient for restoration of wolf populations in the southern Rocky Mountains. Due to predicted reductions in carrying capacity resulting from development trends and likely landscape change, active reintroduction to two sites within the southern Rocky Mountain region may be necessary to ensure low extinction probability (Carroll et al. (2003).

Management Requirements: See Mladenoff et al. (1997) for a discussion of management related to wolf recovery in the Great Lakes region versus other aspects of biodiversity (e.g., wolves depend on high densities of deer, which can have negative impacts on natural communities and their constituent species). See Cohn (1990) and Matthews and Moseley (1990) for brief discussions of issues related to reintroduction (e.g., compensation for livestock losses, wolf protection status, state vs. federal jursidiction over wolf management). See Fritts et al. (1992) for information on management of wolf-livestock conflicts in Minnesota. See USFWS (1994, Final EIS) and Federal Register (16 August 1994) for an extensive discussion of all issues related to reintroduction in Yellowstone and central Idaho. See Jhala and Giles (1991) for management recommendations for populations in northwestern India. See Theberge (1991) for information on management in Canada.

Limit access of humans and livestock in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Packs and habitat are protected in at least Isle Royal National Park (Michigan), Denali National Park (Alaska), and Algonquin Provincial Park (Ontario).

Needs: Need to protect several large tracts of lands as rangeland for wolf packs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Gray wolves may sometimes kill livestock. The extent of livestock loss to wolves is often overstated, wolves typically prefer their wild prey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Historically, the fur of grey wolves was used for warmth. As top predators in many ecosystems, wolves are important in controlling populations of their prey.

Wolves are important in our culture, many people believe they symbolize the spirit of wilderness. Wolf products, including posters, books, and t-shirts are very popular. Wolf ecotourism is a major source of revenue for parks and reserves.

Positive Impacts: body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: See Gasaway et al. (1983) for information on wolf-prey-human relations in interior Alaska. Wolves sometimes prey on livestock or game ungulates, especially during the wolf denning period. Wolf depredation on livestock increased in the late 1980s and reached a record high level in Minnesota by 1990, and wolf sightings in a designated "no wolf" zone dramatically increased (USFWS 1990; see also Fritts et al. 1992). In recent years the USDA Animal and Plant Health Inspection Service has killed 6-42 wolves annually in livestock-depredation control actions in the northcentral U.S. (USFWS 1990). As of 1990, wolf depredation control was to continue, though possibly limited by funding shortfalls. See Fritts (1982) for information on control of predation on livestock in Minnesota. In Canada, recent annual kill by humans was estimated at 7% of population (Theberge 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gray wolf

The gray wolf, grey wolf, or common wolf[3] (Canis lupus) is the largest extant member of the dog family of mammals, the Canidae. Though once abundant over much of Eurasia, North Africa and North America, the gray wolf inhabits a reduced portion of its former range due to widespread destruction of its habitat, human encroachment, and the resulting human-wolf encounters that sparked broad extirpation. Although the species still faces some threats, it is relatively widespread with a stable population trend and has therefore been assessed as Least Concern by IUCN since 2004.[1] Today, wolves are protected in some areas, hunted for sport in others, or may be subject to population control or extermination as threats to livestock, people, and pets. They occur primarily but not exclusively in wilderness and remote areas.

The gray wolf has a slender but powerful build. Its head is large and heavy, with wide foreheads, strong jaws and long and blunt muzzles. The ears are relatively small and triangular and the limbs are long and robust, with comparatively small paws. The animal's size varies depending on the region, with northern wolves being larger. Despite its name, the gray wolf's coat colour ranges from almost pure white to black. Wolves are social predators that live in nuclear families consisting of a mated pair, their offspring and, occasionally, adopted immature wolves.

Wolves communicate over long distances by howling. Other forms of communication include growls, barks, whines and various body postures. Wolves primarily feed on ungulates, which they hunt by wearing them down in short chases. They are typically apex predators throughout their range, with only humans and tigers posing significant threats to them.

Genetic studies reaffirm that the gray wolf is the ancestor of the domestic dog. A number of other Canis lupus subspecies have been identified, though the actual number of subspecies is still open to discussion. In areas where human cultures and wolves both occur, wolves frequently feature in the folklore and mythology of those cultures, both positively and negatively.

Contents

Evolution

Timeline of canids including Canis lupus in red (Tedford & Xiaoming Wang)
Skull of Canis etruscus from the Montevarchi Paleontological Museum

The most likely ancestral candidate of Canis lupus is Canis lepophagus, a small, narrow skulled North American canid of the Miocene era, which may have also given rise to coyotes. Some larger, broader skulled C. lepophagus fossils found in northern Texas may represent the ancestral stock from which true wolves derive. The first true wolves began to appear at the end of the Blancan North American Stage and the onset of the early Irvingtonian. Among them was Canis priscolatrans, a small species closely resembling the red wolf, which colonised Eurasia by crossing the Bering land bridge. The new Eurasian C. priscolatrans population evolved into Canis etruscus, then Canis mosbachensis.[4]

This primitive wolf closely resembled the modern southern wolf populations of the Arabian Peninsula and South Asia, which were once distributed in Europe in the early Quaternary glaciation until about 500,000 years ago (see Subspecies).[5] C. mosbachensis evolved in the direction of Canis lupus, and recolonised North America in the late Rancholabrean era. There, a larger canid species called Canis dirus was already established, but it became extinct 8,000 years ago after the large prey it relied on was wiped out. Competition with the newly arrived gray wolf for the smaller and swifter prey that survived may have contributed to its decline. With the extinction of dire wolf, gray wolf became the only large and widespread canid species left.[4]

The North American recolonisation likely occurred in several waves, with the most distinctive populations occurring in the periphery of the range. These populations (C. l. arctos on the high arctic islands, C. l. lycaon in the eastern forests, C. l. baileyi in the far south and C. l. rufus at the continental corner opposite the point of invasion) may represent survivors of early migrations from Eurasia. C. l. baileyi, C. l. lycaon and C. l. rufus display some primitive traits and systematic affinity to one another. Fossil remains from the late Pleistocene of large bodied wolves similar to C. l. arctos and C. l. albus occur in coastal southern California, indicating that large North American gray wolf subspecies were once widespread, and may have been driven southward by glaciation, though wolves no longer reside there. Fossils of small bodied wolves similar to C. l. baileyi have been found in a range encompassing Kansas and southern California. This indicates a late Pleistocene population flux, in which large, Arctic forms of wolf moved farther south, with smaller, warmth adapted wolves expanding as the climate moderated.[6]

The now extinct Japanese wolves were descended from large Siberian wolves which colonised the Korean Peninsula and Japan, before it separated from mainland Asia, 20,000 years ago during the Pleistocene. During the Holocene, the Tsugaru Strait widened and isolated Honshu from Hokkaidō, thus causing climactic changes leading to the extinction of most large bodied ungulates inhabiting the archipelago. Japanese wolves likely underwent a process of island dwarfism 7,000–13,000 years ago in response to these climatological and ecological pressures. C. l. hattai (formerly native to Hokkaidō) was significantly larger than its southern cousin C. l. hodophilax, as it inhabited higher elevations and had access to larger prey, as well as a continuing genetic interaction with dispersing wolves from Siberia.[7]

Subspecies

A Eurasian wolf (Canis lupus lupus), an example of the "northern" wolf clade

Since 2005, 37 subspecies of wolf are recognised, including the red wolf and not including two Canis lupus subspecies: Canis lupus dingo and Canis lupus familiaris. Wolf subspecies are divided into two categories:[8]

"Northern wolves": large-sized, large-brained wolves with strong carnassials which inhabit North America, Europe and northern Asia.[9]

An Arabian wolf (Canis lupus arabs), an example of the "southern" wolf clade

"Southern wolves": native to North Africa, the Arabian Peninsula and South Asia. They are characterised by their smaller size, skull and teeth, and a short and thin coat without appreciable underwool.[10] They may represent a relict population of early wolves, as they closely resemble fossil European wolves.[5] The rate of changes observed in their DNA sequences date them to about 800,000 years, as opposed to the American and European lineages which stretch back only 150,000.[11] The vocalisations of southern wolves have a higher proportion of short, sharp barking,[9] and they seldom howl.[12] It is likely that dogs and dingoes stem from this group.[9][13]

Wolves in Central and East Asia are intermediate in form and size to northern and southern wolves.[5] Differences in brain size are well defined in different wolf populations, with wolves in northern Eurasia having the highest values, North American wolves having slightly smaller brains, and the southern wolves having the smallest. Southern wolves have brains 5–10% smaller than northern wolves.[14]

Domestication

Skulls of a St. Bernard dog and a lap dog. Though varied in appearance, domestic dog skulls can be consistently distinguished from wolf skulls by their shortened muzzles, broader palates, crowded teeth and the broad, heavy frontal shields at the top of their skulls.[15]

Studies on the genetic distance for mitochondrial DNA on dogs and Eurasian wolves confirmed that wolves are the exclusive ancestral species to dogs. Domestic dogs possess four mtDNA lineages, suggesting four independent domestication events.[16] A later study identified mtDNA evidence suggesting a common origin from a single East Asian gene pool for all dog populations,[17] while another, using a much larger data set of nuclear markers, points to the Middle East as the source of most of the genetic diversity in the domestic dog and a more likely origin of domestication events.[18] A study by the Kunming Institute of Zoology found that the domestic dog is descended from wolves tamed less than 16,300 years ago south of the Yangtse river in China.[19] Morphological comparisons have narrowed the likely ancestral subspecies of gray wolf to wolves of the Middle Eastern and South Asian variety.[5]

The actual domestication process is a source of debate. Although it is popularly assumed that dogs are the result of artificial selection, the general intractability of adult wolves to human handling has led certain experts to theorise that the domestication process occurred through natural selection when Mesolithic human communities began building permanent settlements in which a new ecological niche (middens and landfills) was opened to wolves. These wolves would have formed a commensal relationship with humans, feeding on their waste over many generations, with natural selection favouring assertive wolves with shorter flight distances in human presence, and causing physical changes related to the redundancy of features adapted for hunting big game.[20][21]

Although dogs are the most closely related canids to gray wolves (the sequence divergence between gray wolves and dogs is only 1.8%, as opposed to over 4% between gray wolves, Ethiopian wolves and coyotes),[22] there are a number of physical and behavioural differences. Comparative studies on dog and wolf behaviour and anatomy have shown that dog physiology and most dog behaviours are comparable to those of young wolves, an example of neoteny and pedomorphism.[23]

The tympanic bullae are large, convex and almost spherical in wolves, in contrast to dogs whose bullae are smaller, compressed and slightly crumpled.[24] Compared to equally sized dogs, wolves tend to have 20% larger skulls and 10% bigger brains.[25] The reduction lies in the parts of the brain that deal with sense impressions.[26] The teeth of wolves are also proportionately larger than those of dogs; premolars and molars of wolves are much less crowded, and have more complex cusp patterns.[27] Dogs lack a functioning pre-caudal gland, and most enter estrus twice yearly, unlike wolves which only do so once annually.[15]

The forelegs of wolves are closer to each other than those of dogs, with the former's tracks being further apart. Their tails hang straight or in a slight curve toward the body when neutral, whereas dogs carry their tails in a slight curl. Wolf paws are generally larger than dog paws,[21] though it is almost impossible to distinguish similarly sized wolf and dog prints with certainty, though most dogs tend to have rounder paw prints than wolves.[28]

Physical description

Skeleton from the Museo del Lupo in Abruzzo National Park

Anatomy

Gray wolves are slender, powerfully built animals with large, deeply descending ribcages and sloping backs. Their abdomens are pulled in, and their necks heavily muscled. Their limbs are long and robust, with comparatively small paws.[29] The front paws have five toes each, while the back paws have four. The forelimbs are seemingly pressed into the chest, with the elbows pointed inward, and the feet outward.[24] Females tend to have narrower muzzles and foreheads, thinner necks, slightly shorter legs and less massive shoulders than males.[30] Wolves are very strong for their size, possessing sufficient strength to turn over a frozen horse or moose carcass.[31]

Skull of a Mexican wolf. Note the proportionately larger teeth than the dog's.

They are also capable of running at speeds of 56–64 kilometres per hour (35–40 mph), and can continue running for more than 20 minutes, though not necessarily at that speed.[32] In cold climates, wolves can reduce the flow of blood near their skin to conserve body heat. The warmth of the footpads is regulated independently of the rest of the body, and is maintained at just above tissue-freezing point where the pads come in contact with ice and snow.[33] The intestines of adult wolves measure 460–575 cm, the ratio to body length being 4.13–4.62.[34] The stomach can hold 7–9 kg (15–20 lb) of food[24] and up to 7.5 litres (8 U.S. qt) of water.[35] The liver is relatively large, weighing 0.7–1.9 kg (1.6–4.2 lb) in males and 0.68–0.82 kg (1.5–1.8 lb) in females.[24]

Wolves' heads are large and heavy, with wide foreheads, strong jaws and long, blunt muzzles. The ears are relatively small and triangular. Wolves usually carry their heads at the same level as their backs, raising their heads only when alert.[29] The sagittal and lambdoid crests are well developed, the former dividing just in front of the bregma into two ridges curving outward to form posterior border of postorbital processes. The interorbital region is moderately elevated and well defined, with distinct longitudinal concavity between raised and thickened postorbital processes.[36] The dental formula is:

Dentition
3.1.4.2
3.1.4.3
Stuffed gray wolf and golden jackal at The Museum of Zoology, St. Petersburg. Note the wolf's larger size and broader muzzle.

The teeth are heavy and large, being better suited to bone crushing than those of other extant canids, though not as specialised as those found in hyenas.[37][38] The canine teeth are robust and relatively short (26 mm).[24] The animal can develop a crushing pressure of perhaps 1,500 lbf/in2 compared to 750 lbf/in2 for a German shepherd. This force is sufficient to break open most bones,[39] as well as cut through half inch lassos with one snap.[40]

They generally resemble German shepherds or huskies in bodily configuration, but are distinguishable from them by their orbital angle of 40°–45° rather than 53°–60°,[24] and the greater size of their heads and teeth (see Domestication).[41] Compared to coyotes, wolves are larger and have broader snouts, shorter ears, and a proportionately smaller brain case[24] and lack sweat glands on their pawpads.[42] Compared to golden jackals, wolves are larger and heavier, and have proportionately longer legs, shorter torsos and longer tails.[43] The teeth are overall less trenchant than the jackal's, particularly in the upper molars, which have lower cusps, are broader, and are more terete.[44]

Dimensions

Gray wolves are the largest extant members of the Canidae, excepting certain large breeds of domestic dog.[24] Gray wolf weight and size can vary greatly worldwide, tending to increase proportionally with latitude as predicted by Bergmann's Rule.[45] Adult wolves are 105–160 cm (41–63 in) in length and 80–85 cm (32–34 in) in shoulder height.[46] The tail is ⅔ the length of the head and body,[47] measuring 29–50 cm (11–20 in) in length. The ears are 90–110 millimeters (3.5–4.3 in) in height, and the hind feet are 220–250 mm.[46] Wolf weight varies geographically; on average, European wolves may weigh 38.5 kilograms (85 lb), North American wolves 36 kilograms (79 lb), Indian and Arabian wolves 25 kilograms (55 lb)[48] and North African wolves 13 kilograms (29 lb).[49]

Females in any given wolf population typically weigh 5–10 lbs less than males.[50] Wolves weighing over 54 kg (120 lbs) are uncommon, though exceptionally large individuals have been recorded in Alaska, Canada,[50] and the former Soviet Union.[46][51] The heaviest recorded gray wolf in North America was killed on 70 Mile River in east-central Alaska on July 12, 1939 and weighed 79.4 kilograms (175 lb),[50] while the heaviest recorded wolf in Eurasia was killed after World War II in the Kobelyakski Area of the Poltavskij Region, Ukrainian SSR, and weighed 86 kilograms (190 lb).[51]

Fur

Wolf foot and nose, as illustrated in Pocock's The Fauna of British India, including Ceylon and Burma – Mammalia Vol 2
Gray wolves molt some of their coats in late spring or early summer

Gray wolves have very dense and fluffy winter fur, with short underfur and long, coarse guard hairs.[29] Most of the underfur and some of the guard hairs are shed in the spring and grow back in the autumn period.[48] The longest hairs occur on the back, particularly on the front quarters and neck. Especially long hairs are found on the shoulders, and almost form a crest on the upper part of the neck. The hairs on the cheeks are elongated and form tufts. The ears are covered in short hairs which strongly project from the fur. Short, elastic and closely adjacent hairs are present on the limbs from the elbows down to the calcaneal tendons.[52]

The winter fur is highly resistant to cold; wolves in northern climates can rest comfortably in open areas at −40° by placing their muzzles between the rear legs and covering their faces with their tail. Wolf fur provides better insulation than dog fur, and, as with wolverines, it does not collect ice when warm breath is condensed against it.[48] In warm climates, the fur is coarser and scarcer than in northern wolves.[29]

Female wolves tend to have smoother furred limbs than males, and generally develop the smoothest overall coats as they age. Older wolves generally have more white hairs in the tip of the tail, along the nose and on the forehead. The winter fur is retained longest in lactating females, though with some hair loss around their nipples.[30] Hair length on the middle of the back is 60–70 mm. Hair length of the guard hairs on the shoulders generally does not exceed 90 mm, but can reach 110–130 mm.[53]

Coat colour ranges from almost pure white through various shades of blond, cream, and ochre to grays, browns, and blacks.[54] Differences in coat colour between sexes are largely absent,[55] though females may have redder tones.[56] Fur colour does not seem to serve any camouflage purpose, with some scientists concluding that the blended colors have more to do with emphasizing certain gestures during interaction.[57] Black coloured wolves (which occur through wolf-dog hybridisation) rarely occur in Eurasia, where interactions with domestic dogs has been reduced over the past thousand years due to the depletion of wild wolf populations.[58] They are more common in North America; about half of the wolves in the reintroduced wolf population in Wyoming's Yellowstone National Park are black.[58] In southern Canada and Minnesota the black phase is more common than the white, though gray coloured wolves predominate.[54]

Senses

Their sense of smell is relatively weakly developed when compared to that of some hunting dog breeds, being able to detect carrion upwind no farther than 2–3 km. Because of this, they rarely capture hidden hares or birds, though they can easily follow fresh tracks.[59] Captive wolves are known to be able to detect what foods their handlers have eaten by smell.[60] Their auditory perception is very sharp, being able to hear up to a frequency of 26 kHz,[61] and is greater than that of foxes. Their hearing is sharp enough to register the fall of leaves in the autumn period.[59] The legend that wolves fear the sound of string instruments may have a basis in fact, as captive wolves in the Regent's Park Zoo were shown to exhibit signs of intense distress when hearing low minor chords.[62] Their eyesight is not as powerful as that of dogs, though their night vision is the most advanced of the Canidae.[59]

Behaviour

Social structure

A northern wolf pack in Yellowstone National Park

In popular literature, wolf packs are often portrayed as strictly hierarchical social structures with a breeding "alpha" pair which climbs the social ladder through fighting, followed by subordinate "beta" wolves and a low ranking "omega" which bears the brunt of the pack's aggression. This terminology is based heavily on the behaviour of captive wolf packs composed of unrelated animals, which will fight and compete against each other for status. Also, as dispersal is impossible in captive situations, fights become more frequent than in natural settings. In the wild, wolf packs are little more than nuclear families whose basic social unit consists of a mated pair, followed by its offspring.[63] Northern wolf packs tend not to be as compact or unified as those of African wild dogs and spotted hyenas,[64] though they are not as unstable as those of coyotes.[65] Southern wolves are more similar in social behaviour to coyotes and dingoes, living largely alone or in pairs.[66] The average pack consists of 5–11 animals; 1–2 adults, 3–6 juveniles and 1–3 yearlings,[67] though exceptionally large packs consisting of 42 wolves are known. Wolf packs rarely adopt other wolves into their fold, and typically kill them. In the rare cases where strange wolves are adopted, the adoptee is almost invariably a young animal of 1–3 years of age, while killed wolves are mostly fully grown.[68] The adoption of a new member can be a lengthy process, and can consist of weeks of exploratory, non-fatal attacks in order to establish whether or not the newcomer is trustworthy.[69] During times of ungulate abundance (migration, calving etc.), different wolf packs may temporarily join forces.[70] Wolves as young as five months and as old as five years have been recorded to leave their packs to start their own families, though the average age is 11–24 months. Triggers for dispersal include the onset of sexual maturity and competition within the pack for food and breeding.[71]

Reproduction

A pair of Korean wolves mating at the Tama zoo

In areas with low wolf densities, wolves are generally monogamous.[72] Mated pairs usually remain together for life if one of the wolves does not die. Upon the death of one mated wolf, pairs are quickly re-established. Since males often predominate in any given wolf population, unpaired females are a rarity.[73] Polygamy does occur, but primarily in captive situations. Multiple litters are rarely successful, due to infanticide by the pack's females.[74] The age of first breeding in wolves depends largely on environmental factors; when food is abundant, or when wolf populations are heavily managed, wolves can rear pups at younger ages in order to exploit the newly available resources. Captive wolves have been known to breed as soon as they reach 9–10 months, while the youngest recorded breeding wolves in the wild were 2 years old. Females are capable of producing pups every year, with one litter annually being the average. Unlike coyotes, wolves never reach reproductive senescence before they die.[75] Incest rarely occurs, though inbreeding has been reported in Saskatchewan[76] and Isle Royale.[77]

Wolf nursing her pups

Estrus typically occurs in late winter, with older, multiparous females entering estrus 2–3 weeks earlier than younger females. Before the rut ensues, wolf packs will temporarily dissolve until the end of the mating season.[73] When receptive, females will avert the base of their tails to one side, exposing the vulva. During mating, the pair is locked into a copulatory tie which may last 5–36 minutes. Because estrus in wolves only lasts a month, the males do not abandon their mates to find other females to inseminate as dogs do. During pregnancy, female wolves will remain in a den located away from the peripheral zone of their territories, where violent encounters with other packs are more likely.[78] Old females usually whelp in the den of their previous litter, while younger females typically den near their birthplace. The gestation period lasts 62–75 days, with pups usually being born in the summer period.[79] The average litter consists of 5–6 pups. Litters of 14–17 occur 1% of the time.[80] Litter sizes tend to increase in areas where prey is abundant.[81] Wolves bear relatively large pups in small litters compared to other canid species.[82] Pups are born blind and deaf, and are covered in short soft grayish-brown fur. They weigh 300–500 grams at birth, and begin to see after 9–12 days. The milk canines erupt after one month. Pups first leave the den after 3 weeks. At 1.5 months of age, they are agile enough to flee from danger. Mother wolves do not leave the den for the first few weeks, relying on the fathers to provide food for them and their young.[82][83] Unlike wolf mothers, the fathers do not regurgitate the pups' food, but carry them pieces from a kill. If the mother dies prior to the pups' weaning period, they are suckled by the pack's other females.[84] Pups begin to eat solid food at the age of 3–4 weeks. Pups have a fast growth rate during their first four months of life: during this period: a pup's weight can increase nearly 30 times.[82][83]

The reproductive behaviour of introduced wolf packs in Yellowstone is unusual, as they often have multiple breeding females who mate with lone male wolves that encroach upon the pack territories during the mating season. These so called "Casanova wolves" are young males that, having failed to procure mates or territories after leaving their natal pack, mate with the daughters of already established breeding pairs from other packs. Unlike males from established packs, Casanova wolves do not form pair bonds with the females they mate with. Because of the great abundance of prey in Yellowstone, female wolves there can bear multiple litters in this fashion.[85]

Denning and sheltering behaviour

Wolves use different places for their diurnal rest; places with cover are preferred during cold, damp and windy weather, while wolves in dry, calm and warm weather readily rest in the open. During the autumn-spring period, when wolves are more active, they willingly lie out in the open, whatever their location. Actual dens are usually constructed for pups during the summer period. When building dens, females make use of natural shelters such as fissures in rocks, cliffs overhanging riverbanks and holes thickly covered by vegetation. Sometimes, the den is the appropriated burrow of smaller animals such as foxes, badgers or marmots. An appropriated den is often widened and partly remade. On rare occasions, female wolves will dig burrows themselves, which are usually small and short with 1–3 openings.[86] Wolves do not line their denning places, a likely precaution against parasites.[87] The den is usually constructed not more than 500 metres away from a water source. Resting places, play areas for the pups and food remains are commonly found around wolf dens. The odour of urine and rotting food emanating from the denning area often attracts scavenging birds such as magpies and ravens. As there are few convenient places for burrows, wolf dens are usually occupied by animals of the same family. Though they mostly avoid areas within human sight, wolves have been known to nest near domiciles, paved roads and railways.[86]

Territorial behaviour

Wolves scent-roll to bring scents back to the pack

Wolves are highly territorial animals, and generally establish territories far larger than they require to survive in order to assure a steady supply of prey. Territory size depends largely on the amount of prey available: in areas with an abundance of prey, the territories of resident wolf packs are smaller. Wolf packs travel constantly in search of prey, covering roughly 9% of their territory per day (average 25 km/d or 15 mi/d). The core of their territory is on average 35 km2 (14 sq mi), in which they spend 50% of their time.[88] Prey density tends to be much higher in the territory's surrounding areas. Despite this higher abundance of prey, wolves tend to avoid hunting in the fringes of their territory unless desperate, due to the possibility of fatal encounters with neighboring packs.[89] The size of their territory may increase when the pack's pups reach the age of 6 months, and thus have the same nutritional requirements as adults. The smallest territory on record was held by a pack of six wolves in northeastern Minnesota, which occupied an estimated 33 km2 (13 sq mi). The largest was held by an Alaskan pack of ten wolves encompassing a 6,272 km2 (2,422 sq mi) area. In some areas, wolves may shift territories during their prey's migration season.[90]

Wolves defend their territories from other packs through a combination of scent marking, direct attacks and howling (see Communication). Scent marking is used for territorial advertisement, and involves urination, defecation and ground scratching.[6] Scent marks are generally left every 240 metres throughout the territory on regular travelways and junctions. Such markers can last for 2–3 weeks,[90] and are typically placed near rocks, boulders, trees or the skeletons of large animals.[91] When scent marking and howling fail to deter strange wolf packs from entering another's territory, violent interactions can ensue.[90] Territorial fights are among the principal causes of wolf mortality: one study on wolf mortality in Minnesota and the Denali National Park and Preserve concluded that 14–65% of wolf deaths were due to predation by other wolves.[92] In fact, 91% of wolf fatalities occur within 3.2 km (2.0 mi) of the borders between neighboring territories.[93] Because the consequences of trespassing can be fatal, such incursions are thought to be largely due to desperation or deliberate aggressiveness.[90]

Hunting and feeding behaviours

An American Bison standing its ground, thereby increasing its chance of survival
A bull elk running, thereby decreasing its chance of survival

Although wolf packs do cooperate strategically in bringing down prey, they do not do so as frequently or as effectively as lionesses do; unlike lions, wolves rarely remain with their pack for more than two years, thus they have less time to learn how to hunt cooperatively. Contrary to lion prides, food acquisition per wolf decreases with pack size.[94] Overall, single wolves or mated pairs typically have higher success rates in hunting than do large packs. Single wolves have occasionally been observed to kill large prey such as moose, bison and muskoxen unaided.[95] When hunting, wolves will attempt to conceal themselves as they approach their prey. With ungulate herds, they then either attempt to break up the herd, or isolate one or two animals from it.[96] If the targeted animal stands its ground, the wolves either ignore it, or try to intimidate it into running.[97] When chasing small prey, wolves will attempt to catch up with their prey as soon as possible. With larger animals, the chase is prolonged, in order to wear the selected prey out.[95] Wolves usually give up chases after 1–2 km (0.62–1.3 mi), though one wolf was recorded to chase a deer for 21 km (13 mi).[32] Sometimes, a single wolf will distract the herd with its presence, acting as a decoy, while its pack mates attack from behind.[62] Wolf packs may also set up ambush trails; Indian wolves have been observed to chase gazelle herds through ravines where other wolves lie in wait within holes dug prior to the hunt,[98] while Russian wolves will set up ambushes near water holes, sometimes using the same site repeatedly.[96] Both Russian and North American wolves have been observed to drive prey onto crusted ice, precipices, ravines, slopes and steep banks to slow them down.[99]

Mature wolves usually avoid attacking large prey frontally, instead focusing on the rear and sides of the animal. They kill large prey by biting large chunks of flesh from the soft perineum area, causing massive blood loss. Such bites can cause wounds 10–15 cm in length, with three such bites to the perineum usually being sufficient to bring down a large deer in optimum health.[99] When attacking moose, they occasionally bleed it to death by biting its soft nose.[100] With medium-sized prey such as roe deer or sheep, northern wolves kill by biting the throat, severing nerve tracks and the carotid artery, thus causing the animal to die within a few seconds to a minute.[101] Southern wolves may grab the animal by the neck and stun it by jerking its head downward, hitting its nose on the ground.[10] When prey is vulnerable and abundant, wolves may occasionally surplus kill. Such instances are common in domestic animals, but rare in the wild. In the wild, surplus killing primarily occurs during late winter or spring, when snow is unusually deep (thus impeding the movements of prey)[102] or during the denning period, when wolves require a ready supply of meat when denbound.[103] Medium-sized prey are especially vulnerable to surplus killing, as the swift throat-biting method by which they are killed allows wolves to quickly kill one animal and move on to another.[101] Surplus killing may also occur when adult wolves are teaching their young to hunt.[104]

The breeding pair typically monopolizes food in order to continue producing pups. When food is scarce, this is done at the expense of other family members, especially pups.[105][106] This is in marked contrast to the feeding behaviours of some other canids like dholes, who give priority to their pups when feeding.[107] The breeding pair typically eats first, though as it is they who usually work the hardest in killing prey, they may rest after a long hunt and allow the rest of the family to eat unmolested. Once the breeding pair has finished eating, the rest of the family will tear off pieces of the carcass and transport them to secluded areas where they can eat in peace. Wolves typically commence feeding by consuming the larger internal organs of their prey, such as the heart, liver, lungs and stomach lining. The kidneys and spleen are eaten once they are exposed, followed by the muscles.[108]

Communication

An Arabian wolf in a defensive posture

Body language

Postural communication in wolves is composed of a variety of facial expressions, tail positions and piloerection.[61] Aggressive or self assertive wolves are characterised by their slow and deliberate movements, high body posture and raised hackles, while submissive ones carry their bodies low, sleeken their fur and lower their ears and tail.[109] When breeding males encounter subordinate family members, they may stare at them, standing erect and still with their tails horizontal to their spine.[110] The pre-caudal scent glands may play a role in expressing aggression, as combative wolves will raise the base of their tails whilst drooping the tip, thus positioning the scent glands at the highest point.[111]

Two forms of submissive behaviour are recognised: passive and active. Passive submission usually occurs as a reaction to the approach of a dominant animal, and consists of the submissive wolf lying partly on its back and allowing the dominant wolf to sniff its anogenital area. Active submission occurs often as a form of greeting, and involves the submissive wolf approaching another in a low posture, and licking the other wolf's face.[112]

Howling adult wolf at the UK Wolf Conservation Trust.

When wolves are together, they commonly indulge in behaviours such as nose pushing, jaw wrestling, cheek rubbing and facial licking. The mouthing of each other's muzzles is a friendly gesture, while clamping on the muzzle with bared teeth is a dominance display. Dominant wolves may assert themselves by straddling over a subordinate family member.[113] At a kill, wolves will protect the carcass from afar from other wolves by flattening their ears outwardly, thus indicating that they are covering something belonging to them.[114]

Howling

Wolves howl to assemble the pack (usually before and after hunts), to pass on an alarm (particularly at a den site), to locate each other during a storm or unfamiliar territory and to communicate across great distances.[115] Howling consists of a fundamental frequency which may lie between 150 and 780 Hz, and consists of up to 12 harmonically related overtones. The pitch usually remains constant or varies smoothly, and may change direction as many as four or five times.[24]

Wolves from different geographic locations may howl in different fashions; the howls of European wolves are much more protracted and melodious than those of North American wolves, whose howls are louder and have a stronger emphasis on the first syllable. The two are however mutually intelligible, as North American wolves have been recorded to respond to European-style howls made by biologists.[116]

Wolf howls are generally indistinguishable from those of large dogs.[117] Male wolves give voice through an octave, passing to a deep bass with a stress on "O", while females produce a modulated nasal baritone with stress on "U". Pups almost never howl, while yearling wolves produce howls ending in a series of dog-like yelps.[118] Howls used for calling pack mates to a kill are long, smooth sounds similar to the beginning of the cry of a horned owl. When pursuing prey, they emit a higher pitched howl, vibrating on two notes. When closing in on their prey, they emit a combination of a short bark and a howl.[117] When howling together, wolves harmonize rather than chorus on the same note, thus creating the illusion of there being more wolves than there actually are.[115] Lone wolves typically avoid howling in areas where other packs are present.[119] Wolves do not respond to howls in rainy weather and when satiated.[118]

Other vocalisations

Other vocalisations of wolves are usually divided into three categories: growls, barks and whines.[120] Barking has a fundamental frequency between 320–904 Hz,[24] and is usually emitted by startled wolves. Wolves do not bark as loudly or continuously as dogs do, but will bark a few times and retreat from perceived danger.[120] In captivity, wolves may learn to bark more often if they hear dogs doing so.[121]

Growling has a fundamental frequency of 380–450 Hz,[24] and is usually emitted during food challenges. Pups commonly growl when playing. One variation of the howl is accompanied by a high pitched whine, which precedes a lunging attack.[115] Whining is associated with situations of anxiety, curiosity, inquiry and intimacy such as greeting, feeding pups and playing.[120]

Ecology

Diet

Wolves primarily feed on medium to large sized ungulates (up to the size of bison 10–15 times larger than themselves[26]), though they are not fussy eaters. Medium and small sized animals that may supplement the diet of wolves include marmots, beaver, hares, badgers, foxes, weasels, ground squirrels, mice, hamsters, voles and other rodents, as well as insectivores. They frequently eat waterfowl (particularly during their moulting period and winter, when their greasy and fatty meat helps wolves build up their fat reserves) and their eggs.[122][105]

When such foods are insufficient, they will prey on lizards, snakes, frogs, rarely toads and large insects as available. In times of scarcity, wolves will readily eat carrion, visiting cattle burial grounds and slaughter houses.[122] Wolf packs in Astrakhan will hunt Caspian seals on the Caspian Sea coastline.[123] Some wolf packs in Alaska and Western Canada have been observed to feed on salmon.[124] Cannibalism is not uncommon in wolves; during harsh winters, packs often attack weak or injured wolves, and may eat the bodies of dead pack members.[125][100][126] However, they are not known to eat their young as coyotes sometimes do.[84]

Humans are rarely, but occasionally preyed upon (see Attacks on humans).[127][128][129][130] Wolves will supplement their diet with fruit and vegetable matter; they willingly eat the berries of mountain ash, lily of the valley, bilberries, blueberries and cowberry. Other fruits include nightshade, apples and pears. They readily visit melon fields during the summer months.[125] Wolves can survive without food for long periods; two weeks without food will not weaken a wolf's muscle activity.[35]

In Eurasia, many wolf populations are forced to subsist largely on livestock and garbage in areas with dense human activity, though wild ungulates such as moose, red deer, roe deer and wild boar are still the most important food sources in Russia and the more mountainous regions of Eastern Europe. Other prey species include reindeer, argali, mouflon, wisent, saiga, ibex, chamois, wild goats, fallow deer and musk deer.[131] The prey animals of North American wolves have largely continued to occupy suitable habitats with low human density, and cases of wolves subsisting largely on garbage or livestock are exceptional. Animals preferred as prey by North American wolves include moose, white-tailed deer, elk, mule deer, bighorn sheep, Dall's sheep, American bison, muskox and caribou.[132] In North Africa, wolves feed on various cultivated crops and vegetables and domestic animals.[49]

Enemies and competitors

Wolf barking at a brown bear in Juraparc, Vallorbe, Vaud, Switzerland.

Wolves typically dominate other canid species in areas where they both occur. In North America, incidences of wolves killing coyotes are common, with such incidences being especially common in winter, when coyotes feed on wolf kills. Wolves may attack coyote den sites, digging out and killing the pups. They rarely eat the coyotes they kill. There are no records of coyotes killing wolves, though coyotes may chase wolves if they outnumber them.[133][134]

Near identical interactions have been observed in Eurasia between wolves and golden jackals, with the latter's numbers being comparatively small in areas with high wolf densities.[133][135][136] Wolves are the most important predator of raccoon dogs, killing large numbers of them in the spring and summer periods.[137] Wolves also kill red, arctic and corsac foxes, usually in disputes over carcasses. They may eat the foxes they kill.[138][139] In Asia, they may compete with dholes.[140]

Brown bears are encountered by wolves in both Eurasia and North America. Generally, the outcome of such encounters depends on context: brown bears typically prevail against wolf packs in disputes over carcasses, while wolf packs mostly prevail against bears when defending their den sites. While a brown bear is much larger and more powerful than a single wolf, wolves can match them via their strength in numbers. Both species will kill each other's young. Wolves will eat the brown bears they kill, while brown bears seem to only eat young wolves.[141]

American black bears occur solely in the Americas. Wolf interactions with black bears are much rarer than with brown bears, due to differences in habitat preferences. The majority of black bear encounters with wolves occur in the species' northern range, with no interactions being recorded in Mexico. Wolves have been recorded on numerous occasions to actively seek out black bears (mainly cubs) in their dens and kill them without eating them. Unlike brown bears, black bears frequently lose against wolves in disputes over kills.[142]

While encounters with brown and black bears appear to be common, polar bears are rarely encountered by wolves, though there are two records of wolf packs killing polar bear cubs.[143] Wolves will also kill the cubs of Asian black bears.[144] When attacking bears in daylight, wolf packs have been known to harry their quarry and wait till nightfall before making the final assault, as wolves have better night vision than bears.[145]

Wolves may encounter striped hyenas in Israel and Central Asia, usually in disputes over carcasses. Hyenas feed extensively on wolf-killed carcasses in areas where the two species interact. On a one-to-one basis, hyenas dominate wolves, though wolf packs can drive off single hyenas.[146]

Large wolf populations limit the numbers of small to medium sized felines. Wolves encounter cougars along portions of the Rocky Mountains and adjacent mountain ranges. Wolves and cougars typically avoid encountering each other by hunting on different elevations. In winter however, when snow accumulation forces their prey into valleys, interactions between the two species become more likely. Although they rarely interact, wolves and cougars will kill each other, with packs of the former sometimes usurping the latter's kills.[147] They hunt steppe cats, and may pose a threat to snow leopards.[148] Wolves may also reduce Eurasian lynx populations.[149]

Other than humans, tigers appear to be the only serious predators of wolves.[148][150][151][152] In areas where wolves and tigers share ranges, such as the Russian Far East, the two species typically display a great deal of dietary overlap, resulting in intense competition. Wolf and tiger interactions are well documented in Sikhote-Alin, which until the beginning of the 20th century, held very few wolves. It is thought by certain experts that wolf numbers increased in the region after tigers were largely eliminated during the Russian colonization in the late 19th and early 20th centuries. This is corroborated by native inhabitants of the region claiming that they had no memory of wolves inhabiting Sikohte-Alin until the 1930s, when tiger numbers decreased. Tigers depress wolf numbers, either to the point of localized extinction or to such low numbers as to make them a functionally insignificant component of the ecosystem. Wolves appear capable of escaping competitive exclusion from tigers only when human persecution decreases the latter's numbers. Today wolves are considered scarce in tiger inhabited areas, being found in scattered pockets, and usually seen traveling as loners or in small groups. First hand accounts on interactions between the two species indicate that tigers occasionally chase wolves from their kills, while wolves will scavenge from tiger kills. Proven cases of tigers killing wolves are rare and attacks appear to be competitive rather than predatory in nature, although there are four proven records of tigers killing wolves without consuming them.[153] This competitive exclusion of wolves by tigers has been used by Russian conservationists to convince hunters in the Far East to tolerate the big cats, as they limit ungulate populations less than wolves, and are effective in controlling the latter's numbers.[154]

Hybridisation

Wolf-dogs

Llop, an Arctic wolf/Alaskan malamute hybrid, Lobo Park, Antequera, Spain.
Genetic research has shown that black-furred wolves owe their colouration to a mutation that first arose in domestic dogs

Although dogs and wolves are genetically very close, and have shared vast portions of their ranges for millennia, the two generally do not voluntarily interbreed in the wild. They can produce viable offspring, with all subsequent generations being fertile,[15] as opposed to coydogs and jackal-dog hybrids.[155] The captive breeding of wolf-dog hybrids has proliferated in the United States, with 300,000 such animals being present there.[15] The most commonly used dog breeds for this purpose are of the spitz group.[156]

Although wolves normally kill dogs, lone wolves may fraternise with guard or herding dogs as surrogate pack members.[157][158] Most wolf-dog matings in the wild involve female wolves soliciting male dogs.[15] Wolf-hybrids may be bolder than pure wolves, and thus more dangerous to livestock and human life.[159] In the wild, hybrids may preferentially associate and mate with dogs and other hybrids[158] and live on the periphery of human settlements more readily.[159]

Although wolf-dog hybridisation in Europe has raised concern among conservation groups fearing for the wolf's purity, an analysis on the mtDNA sequences show that introgression of dog genes into European wolf populations does not pose a significant threat. Also, as wolf and dog mating seasons do not fully coincide, the likelihood of wild wolves and dogs mating and producing surviving offspring is small.[160] Like pure wolves, hybrids breed annually, though their mating season occurs 3 months earlier, with pups mostly being born in the winter period, thus lessening their chances of survival.[15]

Although it is popularly believed that some Inuit tribes mate their sled dogs to wolves in order to improve their stamina, this is probably untrue, as wolf hybrids are generally unable to cooperate effectively in pulling harnesses, and their stamina is much less than that of sled dogs.[161] At least two wolf-dog breeds have been created in Europe, the Saarlooswolfhond and the Czechoslovakian Wolfdog, both by crossing wolves with German shepherds.[156]

The red wolf is thought by some scientists to be a wolf/coyote hybrid.[162]

Coywolves

The offspring is generally intermediate in size to both parents, being larger than a pure coyote, but smaller than a pure wolf. A study showed that of 100 coyotes collected in Maine, 22 had half or more wolf ancestry, and one was 89 percent wolf. A theory has been proposed that the large eastern coyotes in Canada are actually hybrids of the smaller western coyotes and wolves that met and mated decades ago as the coyotes moved toward New England from their earlier western ranges.[163] These eastern coyote populations also have fewer sweat glands in their pawpads than western coyotes, but have more than wolves.[42] Researchers in the Northeast and Canada say the population of coywolf hybrids is growing in the Northeast region.[164]

The red wolf is thought by certain scientists to be in fact a wolf/coyote hybrid rather than a unique species. Strong evidence for hybridization was found through genetic testing which showed that red wolves have only 5% of their alleles unique from either gray wolves or coyotes. Genetic distance calculations have indicated that red wolves are intermediate between coyotes and gray wolves, and that they bear great similarity to wolf/coyote hybrids in southern Quebec and Minnesota. Analyses of mitochondrial DNA showed that existing red wolf populations are predominantly coyote in origin.[162]

Range and populations

Present and past distribution of the gray wolf

The gray wolf was once the world's most widely distributed mammal, living north of 15°N latitude in North America and 12°N in Eurasia.[165] Wolves tend to have difficulty adapting to human induced changes, and are often referred to as an indicator species; a species delineating an ecoregion or indicating an environmental condition such as a disease outbreak, pollution, species competition, or climate change. Wolves do not seem to be able to adapt as readily to expanding civilization the way coyotes do. While human expansion has seen an increase in the latter's numbers, it has caused a drop in those of the former.[166]

Beyond the environmental factors of human encroachment on natural habitats effecting wolf populations, wolves are have suffered as one of the world's most widely persecuted wild animals. Wolves have been readily killed on sight, for the reasons of gathering their furs, out of competition for ungulate prey, for protection of livestock and human lives (although, in areas where healthy populations of prey exist, wolves rarely attack livestock and even more seldomly attack humans) or for pleasure, the latter reason fueled by the view of many people of wolves as loathsome and bloodthirsty.[167]

Despite not being at risk for extinction, local populations of wolves are still threatened. One such threat is genetic bottlenecking caused by population fragmentation.[160] Human populations have isolated small pockets of animals, which then suffer the effects of inbreeding. Studies have shown that the reproduction rate in wolves is strongly related to genetic diversity.[168] Isolated wolf populations are greatly affected by the introduction of the alleles of even a single additional wolf.[160]

With the exception of Great Britain and Ireland, wolves were widespread in Europe during the 18th century. Wolves were exterminated from all central and northern European countries during the 19th century and the post World War II period. Remnant populations remain in Portugal, Spain, Italy, Greece and Finland, though Eurasian wolves have been recovering naturally in several parts of Europe; recolonising France, Germany, Sweden and Norway. Several sightings of wolves in The Netherlands have been reported since 2011. [169][170] The largest populations now occur in eastern Europe, primarily in Romania, the Balkans and Poland.[171]

Wolf populations generally seem to be stable or increasing in most, but not all, Bern Convention nations. Limiting factors in member nations include a lack of acceptance of wolves (particularly in areas where they have made a comeback) due to concerns on livestock and dog predation and competition with hunters. Although properly regulated wolf harvests and control have been largely accepted as compatible with maintaining wolf numbers to economically acceptable levels, overhunting and poaching are recognised as the main limiting factor in European wolf populations.[172]

With the exception of Israel and Saudi Arabia, there is little information available on wolves in the Middle East. The Arabian Peninsula is home to an estimated 300–600 wolves which, though hunted year round in all Middle Eastern countries except Israel, are relatively stable and protected by the inaccessibility of the northern mountains and central and northern deserts. In India, wolves are classed as endangered, and number an estimated 800-3,000 individuals scattered among several remnant populations. In China and Mongolia, wolves are not protected except in reserves.[173]

Wolves once ranged over much of North America north of Mexico City. In the United States, the gray wolf's historic range stretched from the West Coast, including all of California[174], east to a line from Texas to central Pennsylvania, southeast of that line the gray wolf was replaced by the Red wolf (Canis lupus rufus) to the Atlantic coast and Gulf of Mexico.[175] Today, their status varies by country, state and province. In the contiguous United States, wolves were almost completely extirpated by the turn of 20th century including every state east of Michigan where they were once distributed.[176]

Canadian and Alaskan wolves number in thousands and remain in excellent biological condition. Wolves have expanded from Canada to the northern Rocky Mountains some since the 1970s, establishing themselves southward in the northern portions of Montana, Washington, Idaho and Wyoming. In 1994, wolves from Alberta and British Columbia were captured and introduced into Yellowstone National Park, where they had been extinct since the 1930s. A similar introduction took place in 1998 in the Apache-Sitgreaves National Forest in Arizona.[177]

A small, isolated group of wolves on Isle Royale is believed to be suffering from the effects of reduced genetic variability. In 1991, the population was reduced from 50 to 12 wolves. Studies have shown that this reduction has coincided with a 50% loss of allozyme heterozygosity.[178]

The presence of wolves in Egypt, Libya and Ethiopia was confirmed in 2011, when a comparison was made between the MtDNA sequences of golden jackals, Holarctic wolves (most modern wolves are of this ancestry), the Indian wolf, and the Himalayan wolf (which are considered older lineages than the main Holarctic wolf lineage) revealed that North African wolves are more closely related to Indian and Himalayan wolves than they are to golden jackals, a species which they were associated with in the past.[179]

Diseases and parasites

Illustration of the diseased jawbone of a young wolf from Oreston.

Because wolves travel great distances, they may play an important role in spreading and maintaining diseases in certain areas. Infectious diseases spread by wolves include brucellosis, tularemia, listeriosis and anthrax. Wolves may also suffer from rabies: wolves are a major host for the disease in Russia, Iran, Afghanistan, Iraq and India.[180] Canine distemper seems to only pose a serious problem for wolves in Canada and Alaska.[181] Wolves also carry the Canine coronavirus, with infections being most prevalent in winter months.[182]

However, gray wolf populations are remarkably[which?] resilient against disease outbreaks. Usually, a wolf displaying the first symptoms of disease will leave its pack, thus preventing the sickness from spreading to its pack mates[citation needed]. Wolves in the former Soviet Union have been recorded to carry over 50 different parasite species.[180]

Ticks carried by wolves include Ixodes ricinus and Dermacentor pictus. Although wolves are host to Sarcoptes scabiei (or mange mite) they rarely develop full blown mange, unlike foxes. Other ectoparasites include biting lice, sucking lice and the fleas Pulex irritans and Ctenocephalides canis. Endoparasites include nematodes such as Toxascaris leonina and T. canis.[183] Wolves are also carriers of Trichinella spiralis, the prevalence of which is significantly related to age.[184]

Other endoparasites include cestodes such as Taenia pisiformis, T. hydatigena, Echinococcus granulosus, Mesocestoidea lineatus, Dioctophyme renale and the adult phase of Multiceps multiceps.[183] Wolves may carry Neospora caninum, which is of particular concern to farmers, as the disease can be spread to livestock; infected animals being three to thirteen times more likely to abort than those not infected.[185] Wolves suffering from tapeworms may deliberately forego eating fresh meat in favour of putrified flesh, in order to rid themselves of the parasites.[186]

Relationships with humans

Folklore and mythology

Wolves appear prominently in the folklore and mythology of human cultures. In Norse and Japanese mythology, wolves were portrayed as almost god-like. In Japan, grain farmers worshiped wolves at shrines and left food offerings near their dens, beseeching them to protect their crops from wild boars and deer,[7] while the wolf Fenrir of Norse mythology was depicted as the son of Loki. Certain cultures portrayed wolves as part of their foundation myths. In Roman mythology, the Capitoline Wolf nurses the future founders of Rome, Romulus and Remus. In the mythology of the Turks,[187] Mongols and Ainu, wolves were believed to be the ancestors of their race,[7] while the Dena’ina believed wolves were once men, and viewed them as brothers.[188] Wolves were linked to the sun in some Eurasian cultures. The Ancient Greeks and Romans associated wolves with the sun god Apollo,[188] while the wolf Sköll in Norse mythology was depicted pursuing the setting sun.[189] Wolves were sometimes associated with witchcraft in both northern European and some Native American cultures. In Norse mythology, the völva (witch) Hyndla and the giantess Hyrrokin are both portrayed as using wolves as mounts. In Navajo culture, wolves were feared as witches in wolf's clothing.[190] Similarly, the Tsilhqot'in believed that contact with wolves could cause mental illness and death.[188] According to the Pawnee creation myth, the wolf was the first animal to experience death.[191] According to the Avesta, wolves are a creation of the evil spirit Ahriman, and are ranked among the most cruel of animals.[192] Wolves are referenced thirteen times in the Bible as symbols of greed and destructiveness.[193]

Livestock and dog predation

Waiting for a Chinook, by Charles Marion Russell, depicting wolves harassing a steer

Livestock depredation has been one of the primary reasons for hunting wolves, and can pose a severe problem for wolf conservation. As well as causing economic losses, the threat of wolf predation causes great stress on livestock producers, and no foolproof solution of preventing such attacks short of exterminating wolves has been found. Wolves typically resort to attacking livestock when wild prey is depleted: in Eurasia, a large part of the diet of some wolf populations consists of livestock, while such incidences are rare in North America, where healthy populations of wild prey have been largely restored.[194] However, certain wolves may become "addicted" to livestock, as the stomach lining of domestic ungulates has a higher calorific value than that of wild herbivores[clarification needed].[186] The majority of losses occur during the summer grazing period. Untended livestock in remote pastures are the most vulnerable to wolf predation.[195] Some nations help offset economic losses to wolves through compensation programmes or state insurance.[196] Sheep are the most commonly taken livestock species in Europe, domestic reindeer in northern Scandinavia, cattle and turkeys in North America, goats in India and horses in Mongolia.[194] As wolves tend to attack large prey from behind, cattle may be more vulnerable to wolves than horses because the latter are better able to defend their hind quarters with powerful kicks.[197] Different subspecies of wolf may preferentially target different animals: small bodied wolves rarely molest adult cattle, while large northern wolves are able to kill fully grown steers and sometimes horses unaided.[198] The number of animals killed in single attacks varies according to species: most attacks on cattle and horses result in one death, while turkeys, sheep and domestic reindeer may be killed in surplus.[199] Wolves mainly attack livestock when the animals are grazing, though they will occasionally break into fenced enclosures.[99] Injuries caused by wolves on large bodied livestock include docked ears and tails, as well as slash wounds on the lower legs.[157] In some cases, wolves do not need to physically attack livestock in order to negatively affect them; the stress livestock experiences in being vigilant for wolves may result in miscarriages, decreased weight gain, and a decrease in meat quality.[185]

Wolves will kill dogs on occasion, with some wolf populations relying on dogs as an important food source.[194] Wolves generally outmatch dogs, even large ones, in physical confrontations, because of their larger heads and teeth and stronger bites.[200][201] Also, the fighting styles of wolves and dogs differ significantly; while dogs typically limit themselves to attacking the head, neck and shoulder, wolves will make greater use of body blocks, and attack the extremities of their opponents.[202] In Croatia, wolves kill more dogs than sheep, and wolves in Russia appear to limit stray dog populations. Wolves may display unusually bold behaviour when attacking dogs accompanied by people, sometimes ignoring nearby humans.[194] Wolf attacks on dogs may occur both in house yards and in forests.[203] On village outskirts, wolves may set up ambushes for dogs, with one wolf soliciting the dog to follow it and lead it to another wolf.[204] In some areas, livestock guardian dogs are fitted with wolf collars in order to protect themselves from wolf attacks. Wolves however may learn to avoid the spiked collars just as they do the antlers of ungulate prey, and still kill guard dogs.[205] Wolf attacks on hunting dogs are considered a major problem in Scandinavia and Wisconsin.[194][203] The most frequently killed hunting breeds in Scandinavia are harriers, with older animals being most at risk, likely because they are less timid than younger animals, and react differently to the presence of wolves. Wolf-caused injuries on dogs are often located on the back, thighs and hind legs. The fatal wound is mostly a bite to the back of the neck. Large hunting dogs such as Swedish elkhounds are more likely to survive wolf attacks due to their better ability to defend themselves.[203]

Attacks on humans

Wolves attacking a sleigh (1890) by Alfred Wierusz-Kowalski

Wolves are generally not dangerous to humans, as long as they are in low numbers, have sufficient food, have little contact with humans and are occasionally hunted.[206] The number of people attacked and killed by wolves varies geographically.

Wolf attacks on humans were a rare, but occasional feature of life in pre-20th century Europe: among one of the earliest historic references to wolves attacking people in Ireland occurs in the Annals of Tigernach under the year 1137: The Blind one of ... that is, Giolla Muire, was killed by wolves.[207] Under the year 1420 in the Annála Connacht is the statement "Wolves killed many people this year." [208].

In France, historical records indicate that during the period 1580–1830, 3,069 people were killed by wolves, of whom 1,857 were killed by non-rabid wolves.[209] Church and administrative accounts from Italy indicate that 440 humans were killed by wolves during the 15th and 19th centuries, occurring in the central part of the Po Valley, which once encompassed part of modern day Switzerland.[210] Prior to 1882, 94 children under the age of 12 were killed in Fennoscandia by non-rabid wolves in a 300 year period.[211]

Between 1840 and 1861, 273 non-rabid attacks resulting in the deaths of 169 children and 7 adults occurred throughout Russia,[212] while between 1944 and 1950, 22 children between the ages of 3 and 17 were killed by wolves in the Kirov Oblast (see Kirov wolf attacks).[213] There are numerous documented accounts of wolf attacks in the Asian continent, with three Indian states reporting a large number of non-rabid attacks in recent decades. These attacks were well documented by trained biologists.[214] In Hazaribagh, Bihar, 100 children were injured and 122 killed from 1980 to 1986.[129] The North American continent has very few recorded incidences of such,[127] though the oral history of some Native American tribes confirms that wolves occasionally did kill humans. Tribes living in woodlands feared wolves more than their tundra-dwelling counterparts, as they could encounter wolves suddenly and at close quarters.[215] It is thought that the reason why so few attacks are recorded in North America than in Eurasia is linked to the former's historically greater availability of firearms, whose usage taught North American wolves to fear humans more than their Eurasian counterparts.[216][217][218] However, encounters with aggressive wolves in North America seem to be on the increase. One study revealed 80 events in Alaska and Canada where wolves closely approached or attacked people, finding 39 cases of aggression by apparently healthy wolves, and 29 cases of fearless behavior by nonaggressive wolves.[219]

Recorded incidences of rabid wolves in Eurasia go far back as the 13th century. The number of cases of rabid wolves are however low when compared to other species. Wolves do not serve as primary reservoirs of the disease, but can catch it from other animals such as dogs, jackals and foxes. Cases of rabies in wolves are very rare in North America, though numerous in the eastern Mediterranean, Middle East and Central Asia. Wolves apparently develop the "furious" phase of rabies to a very high degree. This, coupled with their size and strength, make rabid wolves perhaps the most dangerous of rabid animals,[220] with bites from rabid wolves being 15 times more dangerous than those of rabid dogs.[221] Rabid wolves usually act alone, travelling large distances and often biting large numbers of people and domestic animals. Most rabid wolf attacks occur in the spring and autumn periods. Unlike with predatory attacks, the victims of rabid wolves are not eaten, and the attack generally only lasts a day.[222] Also, the victims are chosen at random, though the majority of cases involve adult men.[223]

Predatory attacks usually involve single wolves or packs that learn to exploit humans as prey. Such attacks may be preceded by a long period of habituation, in which wolves gradually lose their fear of humans.[224] The victims are generally attacked in a sustained manner around the neck and face, and are then dragged off and consumed, unless the wolves are disturbed. Such attacks tend to cluster in time and space until the offending animals are killed.[222] Predatory attacks can occur at any time of the year, with a peak in the June–August period, when the chances of people entering forested areas (for livestock grazing or berry and mushroom picking) increase,[223] though cases of non-rabid wolf attacks in winter have been recorded in Belarus, the Kirovsk and Irkutsk districts, Karelia and Ukraine.[225] Also, wolves with pups experience greater food stresses during this period. The majority of victims of predatory wolf attacks are children under the age of 18 and, in the rare cases where adults are killed, the victims are almost always women.[223] Non-rabid wolves are able to distinguish between armed and unarmed people,[226] and will typically avoid investigating people who display self confident demeanors typical of being armed.[206]

Wolves may react aggressively in self defense, though such attacks are mostly limited to quick bites on extremities, and the attacks are not pressed.[227]

Hunting

Wolf hunt on skis
Mounted cowboys roping a wolf in Wyoming, 1887

Wolves are notoriously difficult to hunt due to their elusiveness, their sharp senses, their high endurance in the chase and ability to quickly incapacitate and kill hunting dogs.[228] Historically, many methods have been devised to hunt wolves.[229][230] In areas where wolves are a threat to livestock, the destruction of spring-born litters in their dens is a sure way of keeping wolf populations to a minimum.[231] When hunting wolves with dogs, usually combinations of sighthounds, bloodhounds and fox terriers are used. The sighthounds chase and immobilise wolves until the arrival of the heavier dogs which do most of the fighting.[232] Still hunting of wolves (alternately walking quietly and waiting concealed in the pursuit of game) is primarily practised in areas where the terrain is too rough for hunting with dogs,[233] though wolves are almost as hard to hunt with this method as cougars are.[228] Because of their sharp hearing, wolves are almost impossible to stalk, even when asleep.[59] Poisoning with strychnine was once practised, but is now generally unpopular, as it can cause the unintentional deaths of animals other than wolves, and wolves generally learn to recognise and avoid poisoned baits.[234] The ideal time for wolf poisoning was during the late summer and early autumn period, when pups were more likely to stray from their mothers and consume objects which they had yet to learn to avoid.[235] Foothold traps are effective, as long as no long lasting human odours are present on them.[236] Many Native American tribes favoured deadfall traps in capturing wolves.[237] Wolf traps are sometimes accompanied by scents (usually beaver or musk deer musk and wolf urine) or baits (venison or horse meat).[238] Traps however are not foolproof; because of their excellent vision, wolves can detect the flaws in hidden traps, even at night,[226] and wolves with prior experience of being trapped can teach their young to avoid them.[239] Hunting blinds can be effective against wolves, though they are seldom used, as their use requires much patience.[240] A popular method of wolf hunting in Russia involves trapping a pack within a small area by encircling it with flag poles carrying a human scent. This method relies heavily on the wolf's fear of human scents, though it can lose its effectiveness when wolves become accustomed to the smell.[241] Some hunters are able to lure wolves by imitating their calls, a method which is especially useful in winter and the mating season.[242] In Kazakhstan and Mongolia, wolves are traditionally hunted with eagles and falcons, though this practise is declining, as experienced falconers are becoming few in number.[243] Shooting wolves from aircraft is highly effective, as it allows greater visibility of wolves than hunting on the ground,[244] though this method is controversial, as it allows wolves little chance to escape or defend themselves.[245]

Fur use

Wolf pelts are primarily used for scarfs and the trimmings of women's garments, though they are occasionally used for jackets, short capes, coats,[246] mukluks and rugs.[24] The quality of wolf peltries rests on the density and strength of the fur fibre, which keeps the fur upright and gives the pelt an appealing bushy aspect. These characteristics are mostly found in northern wolf populations, but gradually lessen further south in warmer climates. North American wolf pelts are among the most valuable, as they are silkier and fluffier than Eurasian peltries.[246] The pelts of wolves killed by poison are mostly worthless.[247]

In Medieval Europe, pelts were considered the only practical aspect of wolves, though they were seldom used, due to the skin's foul odour.[248] In Scandinavian folklore, wolf-skin girdles assisted in transforming the wearers into werewolves.[249] Several Native American tribes used wolf pelts for medicinal purposes,[237] though some Inuit tribes favour dog skin over wolf skin, as the latter is thinner, and more prone to tearing when sewn.[250] The Pawnee wore wolf skins as capes when exploring enemy territories.[251] The United States Army used wolf skin for parkas during the later stages of WWII and the Korean War to protect the faces of soldiers from frostbite.[246] In the Soviet Union, between 1976 and 1988, 30,000 wolf pelts were produced annually. Recent statistics from CITES indicate that 6,000–7,000 wolf skins are internationally traded each year, with Canada, the former Soviet Union, Mongolia and China being the largest exporters, and the United States and Great Britain being the largest importers. Overall, the harvesting of wolves for their fur has little impact on their population, as only the northern varieties (whose numbers are stable) are of commercial value.[252] Wolf trapping for fur remains a lucrative source of income for many Native Americans.[24]

Wolves as pets

Captive wolves following hand gestures at the Wolf Science Center in Austria

Keeping wolves as pets has grown in popularity. In the United States alone, there are an estimated 80,000-2 million privately owned wolves. Tame wolves tend to be less predictable and manageable than dogs.[253] While dogs typically alter their behaviours to accommodate their handlers, the opposite is true for tame wolves.[254] While dog pups still have the ability to be socialised at up to ten weeks of age, nineteen days may be too long to wait to begin socializing a wolf pup.[255] Because wolf milk contains more arginine than can be found in puppy milk substitutes, an arginine supplement is needed when feeding pups below the weaning age. Failure to do so can result in the pups developing cataracts.[256] Wolves lack any alteration of their predatory behaviour, and can thus not be fully trusted in situations where their prey drive can be given adequate stimulation. In contrast to dogs, which are usually accepting of strangers, treating them almost as an extension of their pack, wolves become increasingly xenophobic and intolerant of strangers not part of their immediate pack as they age.[202] While dogs readily, and actively form social bonds with humans, wolves can only do so in the absence of adult conspecifics.[257] Pups under one year of age are generally not aggressive toward strangers, though their aggression increases with age, particularly during the mating season. Males may be more aggressive and difficult to handle than females.[213] Wolves are difficult to contain in standard kennels, as they exceed dogs in observational learning and are able to quickly learn how to undo latches by simply watching their handlers do so.[258] Once wolves learn how to escape confinement, it becomes near impossible to contain them.[259]

Though wolves are trainable, they lack the same degree of tractability seen in dogs. They are generally not as responsive as dogs are to coercive techniques involving fear, aversive stimuli and force. Generally, far more work is required to obtain the same degree of reliability seen in most dogs. Even then, once a certain behavior has been repeated several times, wolves may get bored and ignore subsequent commands. Wolves are most responsive toward positive conditioning and rewards,[260] though simple praise is not sufficient as in most dogs.[261] Unlike dogs, wolves tend to respond more to hand signals than voice.[261]

See also

References

Notes

  1. ^ a b Mech, L.D., Boitani, L. (IUCN SSC Wolf Specialist Group) (2010). "Canis lupus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/3746. 
  2. ^ Macdonald, David; Claudio Sillero-Zubiri (2004). The Biology and Conservation of Wild Canids. Oxford: Oxford University Press. pp. 45–46. ISBN 0-19-851556-1. 
  3. ^ http://onlinelibrary.wiley.com/doi/10.1111/j.1096-3642.1948.tb00558.x/abstract
  4. ^ a b Mech & Boitani 2003, pp. 239–45
  5. ^ a b c d Hemmer 1990, pp. 38–40
  6. ^ Mech & Boitani 2003, pp. 245–250
  7. ^ a b c Walker, Brett L. (2005). The Lost Wolves Of Japan. ISBN 0-295-98492-9. 
  8. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000738. 
  9. ^ a b c Hemmer 1990, p. 40
  10. ^ a b Pocock, R. I. (1941). "Canis lupus". The Fauna of British India, including Ceylon and Burma. − Mammalia. Volume II.. Taylor and Francis. http://www.archive.org/stream/PocockMammalia2/pocock2#page/n97/mode/2up. 
  11. ^ Sharma, D. K., Maldonaldo, J. E., Jhala, Y. V., Fleischer, R. C. (2003). Ancient wolf lineages in India. Proceedings of the Royal Society, London B (Supplement) Biology Letters 271: S1–S4.
  12. ^ Lopez 1978, p. 15
  13. ^ Corbett, L. K. (1995). The dingo in Australia and Asia. Comstock/Cornell, ISBN 0-8014-8264-X
  14. ^ Hemmer 1990, p. 107
  15. ^ a b c d e f Mech & Boitani 2003, p. 257
  16. ^ Vila, C.; et al. (June 13, 1997). "Multiple and ancient origins of the domestic dog.". Science 276 (5319): 1687. doi:10.1126/science.276.5319.1687. PMID 9180076. http://www.idir.net/~wolf2dog/wayne1.htm. 
  17. ^ Savolainen, Peter; Ya-ping Zhang, Jing Luo, Joakim Lundeberg, and Thomas Leitner (2002-11-22). "Genetic Evidence for an East Asian Origin of Domestic Dogs". Science 298 (5598): 1610–1613. Bibcode 2002Sci...298.1610S. doi:10.1126/science.1073906. PMID 12446907. 
  18. ^ vonHoldt, Bridgett; et al. (2010-03-17). "Genome-wide SNP and haplotype analyses reveal a rich history underlying dog domestication". Nature 464 (7290): 898–902. doi:10.1038/nature08837. PMID 20237475. 
  19. ^ Pang et al (September 1, 2009). "mtDNA Data Indicate a Single Origin for Dogs South of Yangtze River, Less Than 16,300 Years Ago, from Numerous Wolves". Molecular Biology and Evolution. http://mbe.oxfordjournals.org/cgi/content/full/26/12/2849. Retrieved 2010-01-07. 
  20. ^ Coppinger & Coppinger 2001, pp. 39–67
  21. ^ a b Eckersley, Dominic Thyroxine’s Role in the Pre-Domestication of the Dog from Wild Dogs and Wolves; a Unique Opportunity to Reexamine Man’s and Dog’s Migration to the Americas, New York City, 2003.
  22. ^ Mech & Boitani 2003, p. 225
  23. ^ Hemmer 1990, p. 83
  24. ^ a b c d e f g h i j k l m Mech 1974
  25. ^ Coppinger & Coppinger 2001, pp. 54–5
  26. ^ a b Zimen 1981, p. 9
  27. ^ Clutton-Brock 1987, p. 24
  28. ^ Zimen 2003, p. 324
  29. ^ a b c d Heptner & Naumov 1998, p. 166
  30. ^ a b Lopez 1978, p. 23
  31. ^ Graves 2007, p. 41
  32. ^ a b Mech & Boitani 2003, p. 119
  33. ^ Lopez 1978, pp. 19–20
  34. ^ Heptner & Naumov 1998, p. 172
  35. ^ a b Graves 2007, p. 37
  36. ^ Miller 1912, p. 309
  37. ^ Therrien, F., Mandibular force profiles of extant carnivorans and implications for the feeding behaviour of extinct predators, Journal of Zoology Volume 267, Part 3, November 2005
  38. ^ Mech & Boitani 2003, p. 112
  39. ^ Lopez 1978, p. 26
  40. ^ Seton 1909, p. 778
  41. ^ Miller 1912, p. 313
  42. ^ a b Coppinger & Coppinger 2001, p. 15 & 173
  43. ^ Heptner & Naumov 1998, p. 129
  44. ^ Miller 1912, p. 318
  45. ^ Heptner & Naumov 1998, p. 197
  46. ^ a b c Heptner & Naumov 1998, p. 174
  47. ^ Pocock 1941, p. 80
  48. ^ a b c Lopez 1978, p. 19
  49. ^ a b Obsorn, Dale. J.; Helmy, Ibrahim (1980). The contemporary land mammals of Egypt (including Sinai). Field Museum of Natural History. http://www.archive.org/details/contemporaryland05osbo. 
  50. ^ a b c Lopez 1978, p. 18
  51. ^ a b Graves 2007, p. 35
  52. ^ Heptner & Naumov 1998, p. 167
  53. ^ Heptner & Naumov 1998, p. 169
  54. ^ a b Lopez 1978, p. 21
  55. ^ Heptner & Naumov 1998, p. 168
  56. ^ Lopez 1978, p. 22
  57. ^ Lopez 1978, p. 45
  58. ^ a b Anderson et al. Molecular and Evolutionary History of Melanism in North American Gray Wolves Science 6 March 2009: Vol. 323. no. 5919, pp. 1339–1343
  59. ^ a b c d Heptner & Naumov 1998, p. 243
  60. ^ Ellis 2010, p. 45
  61. ^ a b Lopez 1978, p. 43
  62. ^ a b Cornish, Charles J.; Selous, Frederick C.; Johnston, Harry H.; Maxwell, Herbert (1902). The living animals of the world; a popular natural history with one thousand illustrations. Dodd, Mead and Company. http://www.archive.org/stream/livinganimalsofw01cornrich#page/n7/mode/2up. 
  63. ^ Mech, L. David ''Whatever happened to the term alpha wolf?'', International Wolf, Winter 2008. (PDF) . Retrieved on 2011-09-16.
  64. ^ Kruuk, Hans (1972). The Spotted Hyena: A study of predation and social behaviour. New York: Parkwest. pp. 277–79. ISBN 0-563-20844-9. 
  65. ^ Bekoff, Marc (1977). "Canis latrans". Mammalian Species 79: 1–9. http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-079-01-0001.pdf. 
  66. ^ Hemmer 1990, p. 96
  67. ^ Heptner & Naumov 1998, p. 222
  68. ^ Mech & Boitani 2003, p. 2
  69. ^ Ellis 2010, p. 46
  70. ^ Heptner & Naumov 1998, p. 225
  71. ^ Mech & Boitani 2003, pp. 12–13
  72. ^ Mech & Boitani 2003, p. 38
  73. ^ a b Heptner & Naumov 1998, p. 248
  74. ^ Mech & Boitani 2003, p. 59
  75. ^ Mech & Boitani 2003, p. 175
  76. ^ "Wolves in national park becoming isolated, say biologists". CBC.news.ca. 2005-01-10. http://www.cbc.ca/health/story/2005/01/10/wolves-inbreeding050110.html. Retrieved 2008-08-30. 
  77. ^ "In Long Running Wolf-Moose Drama, Wolves Recover from Disaster". Michigan Technological University. http://www.admin.mtu.edu/urel/PressReleases/feature/wolves/wolf.html. Retrieved 2008-08-30. 
  78. ^ Mech & Boitani 2003, pp. 42–46
  79. ^ Heptner & Naumov 1998, p. 249
  80. ^ Graves 2007, p. 42
  81. ^ Mech & Boitani 2003, p. 176
  82. ^ a b c Mech & Boitani 2003, pp. 46–49
  83. ^ a b Heptner & Naumov 1998, pp. 253–54
  84. ^ a b Seton 1909, pp. 761–2
  85. ^ Smith, Douglas W. (2006) Decade of the Wolf: Returning the Wild to Yellowstone, Lyons Press, 2006, ISBN 1-59228-886-3
  86. ^ a b Heptner & Naumov 1998, pp. 234–39
  87. ^ Seton 1909, p. 760
  88. ^ W Jedrzejewski, K Schmidt, J Theuerkauf, BJ edrzejewska and R Kowalczyk. Territory size of wolves Canis lupus: linking local (Białowieża Primeval Forest, Poland) and Holarctic-scale patterns. 
  89. ^ Mech, David. "Wolf-pack Buffer Zones as Prey Reservoirs". Science 198 (4314). doi:10.1126/science.198.4314.320. PMID 17770508. 
  90. ^ a b c d Mech & Boitani 2003, pp. 19–26
  91. ^ Heptner & Naumov 1998, p. 226
  92. ^ Huber, Đuro Huber; Josip Kusak, Alojzije Frković, Goran Gužvica. "Causes of wolf mortality in Croatia in the period 1986–2001" (PDF). Veterinarski Arhiv 72 (3): 131–139. http://www.environmental-studies.de/Wolf_mortality_Croatia.pdf. Retrieved 2007-07-20. 
  93. ^ Mech, D, L. D. (1 February 1994). "Buffer zones of territories of gray wolves as regions of intraspecific strife". Journal of mammalogy 75 (1): 199. doi:10.2307/1382251. ISSN 00222372. JSTOR 1382251. 
  94. ^ Mech & Boitani 2003, p. 122
  95. ^ a b Mech & Boitani 2003, p. 121
  96. ^ a b Graves 2007, p. 43
  97. ^ Mech & Boitani 2003, p. 120
  98. ^ ''NATURAL HISTORY OF THE Mammalia OF INDIA AND CEYLON'' by Robert A. Sterndale, THACKER, SPINK, AND CO. BOMBAY: THACKER AND CO., LIMITED. LONDON: W. THACKER AND CO. 1884. Gutenberg.org (2006-10-16). Retrieved on 2011-09-16.
  99. ^ a b c Graves 2007, p. 45
  100. ^ a b Graves 2007, p. 46
  101. ^ a b Zimen 1981, pp. 217–218
  102. ^ Mech & Boitani 2003, p. 144
  103. ^ Lopez 1978, pp. 54–55
  104. ^ Graves 2007, p. 67
  105. ^ a b Ellis 2010, p. 50
  106. ^ Mech & Boitani 2003, p. 58
  107. ^ Fox, Michael W. (1984) The Whistling Hunters: Field Studies of the Indian Wild Dog (Cuon alpinus), p.86-7, State University of New York Press, ISBN 0-87395-862-4
  108. ^ Mech & Boitani 2003, pp. 122–5
  109. ^ Mech & Boitani 2003, p. 90
  110. ^ Lopez 1978, p. 44
  111. ^ Seton 1909, p. 773
  112. ^ Mech & Boitani 2003, p. 93
  113. ^ Lopez 1978, p. 47
  114. ^ Ellis 2010, p. 51
  115. ^ a b c Lopez 1978, p. 38
  116. ^ Zimen 1981, p. 73
  117. ^ a b Seton 1909, p. 770
  118. ^ a b Heptner & Naumov 1998, p. 262
  119. ^ Mech & Boitani 2003, p. 16
  120. ^ a b c Lopez 1978, pp. 39–41
  121. ^ Mivart 1890, p. 5
  122. ^ a b Heptner & Naumov 1998, p. 213
  123. ^ Graves 2007, p. 75
  124. ^ Woodford, Riley. "Alaska's Salmon-Eating Wolves". Wildlifenews.alaska.gov. http://www.wildlifenews.alaska.gov/index.cfm?adfg=wildlife_news.view_article&articles_id=86. Retrieved 2010-03-16. 
  125. ^ a b Heptner & Naumov 1998, p. 214
  126. ^ Klein, D. R. 1995. The introduction, increase, and demise of wolves on Coronation Island, Alaska. Pages 275–280 in L. N. Carbyn, S. H. Fritts, and D. R. Seip, editors. Ecology and conservation of wolves in a changing world. Canadian Circumpolar Institute, Occasional Publication No. 35.
  127. ^ a b Linnell 2002
  128. ^ Heptner & Naumov 1998, pp. 267–68
  129. ^ a b Rajpurohit, K.S. 1999. Child lifting: Wolves in Hazaribagh, India. Ambio 28:162–166.
  130. ^ Pocock 1941, p. 94
  131. ^ Mech & Boitani 2003, p. 107
  132. ^ Mech & Boitani 2003, p. 109
  133. ^ a b Mech & Boitani 2003, pp. 266–68
  134. ^ Jim Robbins (1998). "Weaving A New Web: Wolves Change An Ecosystem". Smithsonian National Zoological Park. http://nationalzoo.si.edu/Publications/ZooGoer/1998/3/weavingwolfweb.cfm. Retrieved 2007-08-10. 
  135. ^ Conservation Action Plan for the golden jackal (Canis aureus) in Greece. (PDF) . Retrieved on 2011-09-16.
  136. ^ Heptner & Naumov 1998, p. 158
  137. ^ Heptner & Naumov 1998, pp. 114–115
  138. ^ Mech & Boitani 2003, p. 269
  139. ^ Heptner & Naumov 1998, pp. 357, 455 & 545
  140. ^ Heptner & Naumov 1998, p. 585
  141. ^ Mech & Boitani 2003, pp. 261–63
  142. ^ Mech & Boitani 2003, pp. 263–64
  143. ^ "Wolf (Canis lupus) Predation of a Polar Bear (Ursus maritimus) Cub on the Sea Ice off Northwestern Banks Island, Northwest Territories, Canada" (PDF). Arctic 59 (3): 322–324. 2006. http://pubs.aina.ucalgary.ca/arctic/Arctic59-3-322.pdf. Retrieved 2010-03-16. 
  144. ^ Heptner & Naumov 1998, p. 730
  145. ^ Ellis 2010, p. 39
  146. ^ M. G. L. Mills; Gus Mills; Heribert Hofer (January 1998). Hyaenas: status survey and conservation action plan. IUCN. pp. 24–25. ISBN 978-2-8317-0442-5. http://books.google.com/books?id=aO2gTeLBLZYC&pg=PA24. Retrieved 16 September 2011. 
  147. ^ Mech & Boitani 2003, pp. 264–65
  148. ^ a b Heptner, V. G. & Sludskii, A. A. Mammals of the Soviet Union: Carnivora (hyaenas and cats), Volume 2 (1992), BRILL, ISBN 90-04-08876-8
  149. ^ Sunquist, Melvin E. & Sunquist, Fiona Wild cats of the world, University of Chicago Press, 2002, p. 167 ISBN 0-226-77999-8
  150. ^ Lopez 1978, p. 29
  151. ^ Heptner & Naumov 1998, p. 255
  152. ^ Mech & Boitani 2003, p. 265
  153. ^ Miquelle, D.G., Stephens, P.A., Smirnov, E.N., Goodrich, J.M., Zaumyslova, O.Yu. & Myslenkov, A.I. 2005. Tigers and Wolves in the Russian Far East: Competitive Exclusion, Functional Redundancy and Conservation Implications. In Large Carnivores and the Conservation of Biodiversity. Ray, J.C., Berger, J., Redford, K.H. & Steneck, R. New York: Island Press. pp. 179–207.
  154. ^ Fulbright, Timothy E. & Hewitt, David G. Wildlife Science: Linking Ecological Theory and Management Applications, CRC Press, 2007, ISBN 0-8493-7487-1, p. 118
  155. ^ Feddersen-Petersen, Doris, Hundepsychologie, 4. Auflage, 2004, Franck-Kosmos-Verlag 2004
  156. ^ a b Cusdin, P. A. The Keeping of Wolf-Hybrids in Great Britain, RSPCA 2000
  157. ^ a b Graves 2007, p. 10
  158. ^ a b Zimen 2003, pp. 363–370
  159. ^ a b Graves 2007, pp. 32 & 52–3
  160. ^ a b c Vilà, Carles & Wayne, Robert K., Hybridization between Wolves and Dogs, Conservation Biology, Pages 195–198, Vol. 13, No. 1. February 199
  161. ^ Coppinger & Coppinger 2001, p. 186
  162. ^ a b "The red wolf (Canis rufus) – hybrid or not?" (PDF). Montana State University. http://www.montana.edu/~wwwbi/staff/creel/bio480/The%20red%20wolf.pdf. Retrieved 2010-02-01. 
  163. ^ Zimmerman, David. "Eastern Coyotes Are Becoming Coywolves". Caledonian-Record. http://ncmg.blogspot.com/2005/07/coy-dogs-maybe-not.html. Retrieved 2010-02-01. 
  164. ^ Johnson, Edie (February 10, 2006). "Coywolf: Are they a suburban legend, or a natural fact?". The Chronicle. Straus Newspapers. http://www.strausnews.com/articles/2006/02/13/the_chronicle/news/4ch.txt. Retrieved 2010-02-01. 
  165. ^ "IUCN Red List – Canis Lupus". http://www.iucnredlist.org/apps/redlist/details/3746/0/full. 
  166. ^ Coppinger & Coppinger 2001, p. 23
  167. ^ [1]
  168. ^ "Olof Liberg et al." (2005). "Severe inbreeding depression in a wild wolf (Canis lupus) population". Biology letters. doi:10.1098/rsbl.2004.0266. PMC 1629062. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1629062. 
  169. ^ Powned.nl, Wolf opnieuw gezien
  170. ^ Eerste wolf in Nederland? [2]
  171. ^ Boitani, L. Action plan for the conservation of wolves in Europe (Canis lupus), Nature and environment, Issue 113, Council of Europe, 2000 ISBN 92-871-4425-7. Retrieved on 2011-09-16.
  172. ^ Salvatori, V. & Linnel, J. Report on the conservation status and threats for wolf (Canis lupus) in Europe, CONVENTION ON THE CONSERVATION OF EUROPEAN WILDLIFE AND NATURAL HABITATS, Strasbourg, 7 November 2005. (PDF) . Retrieved on 2011-09-16.
  173. ^ Mech & Boitani 2003, pp. 326–8
  174. ^ Robert H. Schmidt (Spring, 1991). "Gray Wolves in California". California Fish and Game: 79–85. http://www.archive.org/stream/californiafishga77_2cali/californiafishga77_2cali_djvu.txt. Retrieved 2011-12-30. 
  175. ^ Paul C. Paquet, Ludwig N. Carbyn (2003). George A. Feldhamer, Bruce Carlyle Thompson, Joseph A. Chapman. ed. Wild Mammals of North America. Johns Hopkins University Press. p. 184. ISBN 978-0-8018-7416-1. http://books.google.com/books?id=-xQalfqP7BcC&printsec=frontcover&dq=wild+mammals+of+north+america&hl=en&sa=X&ei=BSL-TtCXBMaKiALd5ciaDQ&ved=0CDAQ6AEwAA#v=onepage&q=gray%20wolf&f=false. Retrieved 2011-12-30. 
  176. ^ [3] (2011).
  177. ^ Mech & Boitani 2003, pp. 321–4
  178. ^ Wayne, R.K., et al. (1991). "Conservation Genetics of the Endangered Isle Royale Gray Wolf". Conservative Biology 5 (1): 41. doi:10.1111/j.1523-1739.1991.tb00386.x. 
  179. ^ Rueness E K, Asmyhr M G, Sillero-Zubiri C, Macdonald D W, Bekele A, et al. (2011) The Cryptic African Wolf: Canis aureus lupaster is not a golden jackal and is not endemic to Egypt. PLoS ONE 6(1): e16385. doi:10.1371/journal.pone.0016385
  180. ^ a b Graves 2007, pp. 77–85
  181. ^ Mech & Boitani 2003, p. 209
  182. ^ "Serologic survey for canine coronavirus in wolves from Alaska, Journal of Wildlife Diseases, 37(4), 2001, pp. 740–745, Wildlife Disease Association 2001" (PDF). http://www.jwildlifedis.org/cgi/reprint/37/4/740.pdf. Retrieved 2010-03-16. 
  183. ^ a b Heptner & Naumov 1998, pp. 254–55
  184. ^ "Trichinella sp. in Wolves from Interior Alaska, Journal of Wildlife Diseases, 35(1), 1999, pp. 94–97, Wildlife Disease Association 1999" (PDF). http://www.jwildlifedis.org/cgi/reprint/35/1/94.pdf. Retrieved 2010-03-16. 
  185. ^ a b "Effects of Wolves and Other Predators on Farms in Wisconsin: Beyond Verified Losses" (PDF). Wisconsin Department of Natural Resources. http://dnr.wi.gov/org/land/er/publications/pdfs/wolf_impact.pdf. Retrieved 2008-10-20. 
  186. ^ a b Ellis 2010, pp. 173–74
  187. ^ André Wink. Al-Hind: The Making of the Indo-Islamic World. Brill Academic Publishers, 2002. ISBN 0-391-04173-8. Page 65.
  188. ^ a b c Mech & Boitani 2003, p. 292
  189. ^ Lindow, John, Norse mythology: a guide to the Gods, heroes, rituals, and beliefs, Oxford University Press US, 2002, ISBN 0-19-515382-0
  190. ^ Lopez 1978, p. 123
  191. ^ Lopez 1978, p. 133
  192. ^ Yasna, ix. 18–21
  193. ^ Bright, Michael (2006). Beasts of the Field: The Revealing Natural History of Animals in the Bible. London: Robson Books. pp. 115–20. ISBN 1-86105-831-4. 
  194. ^ a b c d e Mech & Boitani 2003, p. 305
  195. ^ Mech & Boitani 2003, p. 307
  196. ^ Mech & Boitani 2003, p. 309
  197. ^ Harding 1909, pp. 38–39
  198. ^ Roosevelt 1909, pp. 185–86
  199. ^ Mech & Boitani 2003, p. 306
  200. ^ Roosevelt 1909, pp. 192–3
  201. ^ Coppinger & Coppinger 2001, pp. 134–5
  202. ^ a b Lindsay 2000, p. 18
  203. ^ a b c Backeryd, Jessica (2007) Wolf attacks on dogs in Scandinavia 1995 – 2005: Will wolves in Scandinavia go extinct if dog owners are allowed to kill a wolf attacking a dog?, Examensarbete i ämnet naturvårdsbiologi 20 poäng
  204. ^ Graves 2007, p. 36
  205. ^ Ellis 2010, pp. 170–71
  206. ^ a b Geist, Valerius (2006) When do Wolves become Dangerous to Humans?, The University of Calgary
  207. ^ [4]
  208. ^ [5]
  209. ^ (French) Moriceau, Jean-Marc (2007). Histoire du méchant loup : 3 000 attaques sur l'homme en France. Paris: Fayard. ISBN 2-213-62880-7. 
  210. ^ (Italian) Cagnolaro L., M. Comencini, A. Martinoli, A. Oriani, 1996. Dati storici sulla presenza e su casi di antropofagia del lupo nella Padania centrale. In F. Cecere (ed.) 1996, Atti del Convegno "Dalla parte del lupo", serie atti e studi de WWF Italia n° 10, 83:99.
  211. ^ "Is the fear of wolves justified? A Fennoscandian perspective." (PDF). Linnel, John D.C.. Acta Zoologica Lituanica, 2003, Volumen 13, Numerus 1. http://www.lcie.org/Docs/Regions/Baltic/Linnell%20AZL%20Wolf%20attacks%20in%20Fennoscandia.pdf. Retrieved 2008-05-09. 
  212. ^ Korytin, S. A. 1997 Sex and age structure of people attacked by wolves in different seasons. Proceedings of the scientific conference [Issues of applied ecology, game management and fur farming], 27–28 May 1997, Kirov p-143-146
  213. ^ a b "Pavlov, Mikhail P., "The Danger of Wolves to Humans" (pp 136–169) (Translated from Russian by Valentina and Leonid Baskin, and Patrick Valkenburg. Edited by Patrick Valkenburg and Mark McNay)" (PDF). http://westinstenv.org/wp-content/appendix-a-pavlov.pdf. Retrieved 2012-01-26. 
  214. ^ Linnell 2002, p. 26
  215. ^ Lopez 1978, p. 69 & 123
  216. ^ Roosevelt 1909, p. 185
  217. ^ Seton 1909, p. 767
  218. ^ Graves 2007, p. 8
  219. ^ McNay, Mark A Case History of Wolf-Human Encounters in Alaska and Canada (2002), Alaska Department of Fish and Game Wildlife Technical Bulletin. Wildlife.alaska.gov. Retrieved on 2011-09-16.
  220. ^ Linnell 2002, p. 14
  221. ^ Heptner & Naumov 1998, p. 267
  222. ^ a b Linnell 2002, p. 15
  223. ^ a b c Linnell 2002, p. 37
  224. ^ Linnell 2002, p. 36
  225. ^ Heptner & Naumov 1998, p. 268
  226. ^ a b Heptner & Naumov 1998, p. 244
  227. ^ Linnell 2002, p. 16
  228. ^ a b Roosevelt 1909, p. 182 & 192
  229. ^ Harding 1909
  230. ^ Graves 2007, pp. 121–40
  231. ^ Harding 1909, pp. 65–75
  232. ^ Harding 1909, pp. 76–85
  233. ^ Harding 1909, pp. 86–98
  234. ^ Harding 1909, pp. 99–108
  235. ^ Seton 1909, p. 766
  236. ^ Harding 1909, pp. 109–23
  237. ^ a b Lopez 1978, p. 108
  238. ^ Harding 1909, pp. 124–132
  239. ^ Seton 1909, p. 764
  240. ^ Harding 1909, pp. 189–95
  241. ^ Graves 2007, p. 121
  242. ^ Graves 2007, p. 122
  243. ^ Graves 2007, p. 124
  244. ^ Graves 2007, pp. 125–36
  245. ^ Lopez 1978, pp. 159–60
  246. ^ a b c Bachrach, M. (1953). Fur: a practical treatise. New York: Prentice-Hall,. pp. 206–13. 
  247. ^ Harding 1909, p. 108
  248. ^ Griffin, Emma (2007). Blood sport: hunting in Britain since 1066. Yale University Press. p. 65. ISBN 0-300-11628-4. 
  249. ^ Woodward, Ian The Werewolf Delusion (1979) p. 121, Paddington Press Ltd. ISBN 0-448-23170-0
  250. ^ Coppinger & Coppinger 2001, p. 55
  251. ^ Lopez 1978, pp. 111–2
  252. ^ Mech & Boitani 2003, p. 329
  253. ^ Mech & Boitani 2003, p. 304
  254. ^ Coppinger & Coppinger 2001, p. 43
  255. ^ Coppinger & Coppinger 2001, p. 42
  256. ^ Mech & Boitani 2003, p. 197
  257. ^ Lindsay 2000, p. 20
  258. ^ Coppinger & Coppinger 2001, pp. 46–7
  259. ^ Lindsay 2000, p. 19
  260. ^ "Are wolves and wolfdog hybrids trainable?". Wolf Park. Archived from the original on 2008-06-15. http://web.archive.org/web/20080615124627/http://www.wolfpark.org/wolfdogs/Poster_section7.html. Retrieved 2008-10-30. 
  261. ^ a b "Wolf Training and Socialisation: Example #1". Wolf Park. Archived from the original on February 10, 2008. http://web.archive.org/web/20080210012443/http://www.wolfpark.org/training/Example-1.html. Retrieved 2008-10-30. 

Bibliography

Further reading

  • (Italian) Apollonio, Marco; Mattioli, Luca (2006). Il Lupo in Provincia di Arezzo. Editrice Le Balze. ISBN 88-7539-123-8. 
  • (Russian) Bibikov, D. I. (1985). The Wolf: History, Systematics, Morphology, Ecology. Nauka, Moscow, USSR.. ASIN B001A1TKK4. 
  • Busch, Robert H. (2009). Wolf Almanac. The Lyons Press. ISBN 1-59921-069-X. 
  • Dutcher, Jim; Dutcher, Jamie (2003). Wolves at Our Door: The Extraordinary Story of the Couple Who Lived with Wolves. William Andrew. ISBN 0-7434-0049-6. 
  • Ellis, Shaun (2003). Wolf Talk. Rainbow Publishing. ISBN 1-899057-03-X. 
  • Harrington, Fred H.; Paquet, Paul C. (1982). Wolves of the world: perspectives of behavior, ecology, and conservation. Simon & Schuster. ISBN 0-8155-0905-7. 
  • Mech, L. David (1981). The Wolf: The Ecology and Behaviour of an Endangered Species. University of Minnesota Press. ISBN 0-8166-1026-6. 
  • Musiani, Marco; Boitani, Luigi; Paquet, Paul C. (2010). The World of Wolves: New Perspectives on Ecology, Behaviour, and Management. University of Calgary Press. ISBN 1-55238-269-9. 
  • (Russian) Pavlov, Mikhail P. (1982). The Wolf in Game Management. Agropromizdat, Moscow. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Subspecies of Canis lupus

Skull of a European wolf
Skull of a Canadian wolf
Original distribution of wolf subspecies
Present distribution of wolf subspecies (without domestic dogs)

Canis lupus has 39 subspecies currently described, including two subspecies of domestic dog, Canis lupus dingo and Canis lupus familiaris, and many subspecies of wolf throughout the Northern hemisphere. The nominate subspecies is Canis lupus lupus.

Canis lupus is assessed as Least Concern by the IUCN, as its relatively widespread range and stable population trend mean that the species, at global level, does not meet, or nearly meet, any of the criteria for the threatened categories. However, some local populations are classified as Endangered,[1] and some subspecies are endangered or extinct.

Biological taxonomy is not fixed, and placement of taxa is reviewed as a result of new research. The current categorization of subspecies of Canis lupus is shown below. Also included are synonyms, which are now discarded duplicate or incorrect namings, or in the case of the domestic dog synonyms, old taxa referring to subspecies of domestic dog which, when the dog was declared a subspecies itself, had nowhere else to go. Common names are given but may vary, as they have no set meaning.

Contents

Geographical variations

Wolves show a great deal of dimorphism geographically, though they can interbreed. The Zoological Gardens of London for example once successfully managed to mate a male European wolf to an Indian female, resulting in a cub bearing an almost exact likeness to its sire.[2]

Europe

European wolves tend to have coarse fur with less soft wool intermixed than American wolves. Their heads are narrower, their ears longer, higher placed and somewhat closer to each other. Their loins are more slender, their legs longer, their feet narrower, and their tails more thinly clothed with fur.[3] Pelt colour in European wolves ranges from white, cream, red, grey and black, sometimes with all colours combined. Wolves in central Europe tend to be more richly coloured than those in Northern Europe. Eastern European wolves tend to be shorter and more heavily built than Northern Russian ones.[4]

North America

North American wolves are generally the same size as European wolves, but have shorter legs, larger, rounder heads, broader, more obtuse muzzles, and a sensible depression at the union of nose and forehead, which is more arched and broad. Their ears are shorter and have a more conical form. They typically lack the black mark on the forelegs, as is the case in European races. They have long and comparatively fine fur, mixed with a shorter wooly hair, and are more robust.[3] Fur colour in American wolves ranges from white, black, red, yellow, brown, grey, and grizzled skins, and others representing every shade between, although usually each locality has its prevailing tint. There are pronounced differences in North American wolves of different localities; wolves from Texas and New Mexico are comparatively slim animals with small teeth.[5] Mexican wolves in particular resemble some European wolves in stature, though their heads are usually broader, their necks thicker, their ears longer and their tails shorter.[6] Wolves of the central and northern chains of the Rocky Mountains and coastal ranges are more formidable animals than the more southern plains wolves, and resemble Russian and Scandinavian wolves in size and proportions.[5]

List of subspecies

Canis lupus subspecies

Subspecies as of 2005[7]:

SubspeciesAuthorityDescriptionRangeSynonyms
Eurasian wolf
Canis lupus lupus (nominate subspecies)

Canis lupus lupus qtl1.jpg

Linnaeus 1758[8]Generally a large subspecies measuring 105–160 cm in length and weighing 40–80 kg. The pelt is usually a mix of rusty ocherous and light grey.[9]Has the largest range among wolf subspecies and is the most common in Europe and Asia, ranging through Western Europe, Scandinavia, Russia, China, Mongolia, and the Himalayan Mountainsaltaicus (Noack, 1911), argunensis (Dybowski, 1922), canus (Sélys Longchamps, 1839), communis (Dwigubski, 1804), deitanus (Cabrera, 1907), desertorum (Bogdanov, 1882), flavus (Kerr, 1792), fulvus (Sélys Longchamps, 1839), italicus (Altobello, 1921), kurjak (Bolkay, 1925), lycaon (Trouessart, 1910), major (Ogérien, 1863), minor (Ogerien, 1863), niger (Hermann, 1804), orientalis (Wagner, 1841), orientalis (Dybowski, 1922), signatus (Cabrera, 1907)[10]
Tundra wolf
Canis lupus albus

Волк 3.jpg

Kerr 1792[11]A large subspecies, with adults measuring 112–137 cm, and weighing 36.6–52 kg. The fur is very long, dense, fluffy and soft and is usually very light and grey in colour. The lower fur is lead-grey and the upper fur is reddish-grey.[9]Northern tundra and forest zones in the European and Asian parts of Russia and Kamchatka. Outside Russia, its range includes the extreme north of Scandinavia[9]dybowskii (Domaniewski, 1926), kamtschaticus (Dybowski, 1922),

turuchanensis (Ognev, 1923)[12]

Kenai Peninsula wolf
Canis lupus alces
Goldman 1941[13]A large wolf measuring over 180 cm in length and weighing 45–63 kg. It is thought that its large size was an adaptation to hunting the extremely large moose of the Kenai Peninsula.[14]Kenai Peninsula
Arabian wolf
Canis lupus Arabs

Canis lupus arabic.JPG

Pocock 1934[15]A small, "desert adapted" wolf that is around 66 cm tall and weighs, on average, about 18 kg.[16] Its fur coat varies from short in the summer and long in the winter, possibly because of solar radiation.[17]Southern Israel, Southern and western Iraq, Oman, Yemen, Jordan, Saudi Arabia, and probably some parts of the Sinai Peninsula
Arctic wolf
Canis lupus arctos

Canis lupus arctos qtl1.jpg

Pocock 1935[18]A medium sized wolf that is between 64 and 79 cm tall and 89 to 189 cm long, weighing between 35 and 45 kg on average, though there have been specimens found weighing up to 68 kg.[19][20]Canadian Arctic, Alaska and northern Greenland
Mexican wolf
Canis lupus baileyi

Mexican Wolf 065.jpg

Nelson and Goldman 1929[21]A small subspecies which weighs 25–45 kg and measures 140–170 cm in total length (nose to tip of tail), and 72–80 cm in shoulder height. The pelt contains a mix of grey, black, brown, and rust colors in a characteristic pattern, with white underparts[22]Northern Mexico, western Texas, southern New Mexico, and southeastern and central Arizona[22]
Newfoundland wolf
Canis lupus beothucus
G. M. Allen and Barbour 1937A white coloured subspecies typically measuring 180 cm in length and weighing 45 kg[14]Newfoundland
Bernard's wolf
Canis lupus bernardi
Anderson 1943This subspecies became extinct in 1934, though it was described as "white with black-tipped hair along the ridge of the back".[23]Limited to Banks and Victoria Islands in the arcticbanksianus (Anderson, 1943)[24]
Steppe wolf
Canis lupus campestris
Dwigubski 1804A wolf of average size with short, coarse and sparse fur. The fur is light grey on the sides and rusty, brownish grey on the back[9]Northern Ukraine, southern Kazakhstan, Caucasus and Trans-Caucasus[9]bactrianus (Laptev, 1929), cubanenesis (Ognev, 1923), desertorum (Bogdanov, 1882)[25]
Tibetan wolf
Canis lupus chanco

Canis lupus chanco1.jpg

Gray 1863A small subspecies rarely exceeding 45 kg in weight. It is of a light, whitish-grey colour, with an admixture of brownish tones on the upper part of the body[9]Central Asia from Turkestan, Tien Shan throughout Tibet to Mongolia, Northern China, Shensi, Sichuan, Yunnan, the Western Himalayas in Kashmir from Chitral to Lahul.[26] Also occurs in the Korean peninsula[27]coreanus (Abe, 1923), dorogostaiskii (Skalon, 1936), ekloni (Przewalski, 1883), filchneri (Matschie, 1907), karanorensis (Matschie, 1907), laniger (Hodgson, 1847), niger (Sclater, 1874), tschiliensis (Matschie, 1907)[28]
British Columbia wolf
Canis lupus columbianus
Goldman 1941Yukon, British Columbia, and Alberta
Vancouver Island wolf
Canis lupus crassodon

VIslandWolf.JPG

Hall 1932A medium sized subspecies, it is generally greyish-white or white in fur color. It is a very social subspecies and can usually be found roaming in packs of five to thirty-five individuals.[29]Vancouver Island, British Columbia
Dingo
Canis lupus dingo [domestic dog]

Dingo-australian zoo.jpg

Meyer 1793Generally 52–60 cm tall at the shoulders and measures 117 to 124 cm from nose to tail tip. The average weight is 13 to 20 kg.[30] Descended from feral domesticated dogs, but has evolved into a quite wild animal over much of its range. Fur color is mostly sandy to reddish brown, but can include tan patterns and be occasionally black, light brown, or white[31]Australia, Thailand, India, Indonesia and New Guineaantarcticus (Kerr, 1792), australasiae (Desmarest, 1820), australiae (Gray, 1826), dingoides (Matschie, 1915), macdonnellensis (Matschie, 1915), novaehollandiae (Voigt, 1831), papuensis (Ramsay, 1879), tenggerana (Kohlbrugge, 1896), harappensis (Prashad, 1936), hallstromi (Troughton, 1957)[32]
Domestic dog
Canis lupus familiaris [domestic dog]

YellowLabradorLooking new.jpg

Linnaeus 1758Tends to have a 20% smaller skull and a 30% smaller brain,[33] as well as proportionately smaller teeth than other wolf subspecies[34] The paws of a dog are half the size of those of a wolf, and their tails tend to curl upwards, another trait not found in wolves[16]Worldwideaegyptius (Linnaeus, 1758), alco (C. E. H. Smith, 1839), americanus (Gmelin, 1792), anglicus (Gmelin, 1792), antarcticus (Gmelin, 1792), aprinus (Gmelin, 1792), aquaticus (Linnaeus, 1758), aquatilis (Gmelin, 1792), avicularis (Gmelin, 1792), borealis (C. E. H. Smith, 1839), brevipilis (Gmelin, 1792)

cursorius (Gmelin, 1792) domesticus (Linnaeus, 1758) extrarius (Gmelin, 1792), ferus (C. E. H. Smith, 1839), fricator (Gmelin, 1792), fricatrix (Linnaeus, 1758), fuillus (Gmelin, 1792), gallicus (Gmelin, 1792), glaucus (C. E. H. Smith, 1839), graius (Linnaeus, 1758), grajus (Gmelin, 1792), hagenbecki (Krumbiegel, 1950), haitensis (C. E. H. Smith, 1839), hibernicus (Gmelin, 1792), hirsutus (Gmelin, 1792), hybridus (Gmelin, 1792), islandicus (Gmelin, 1792), italicus (Gmelin, 1792), laniarius (Gmelin, 1792), leoninus (Gmelin, 1792), leporarius (C. E. H. Smith, 1839), major (Gmelin, 1792), mastinus (Linnaeus, 1758), melitacus (Gmelin, 1792), melitaeus (Linnaeus, 1758), minor (Gmelin, 1792), molossus (Gmelin, 1792), mustelinus (Linnaeus, 1758), obesus (Gmelin, 1792), orientalis (Gmelin, 1792), pacificus (C. E. H. Smith, 1839), plancus (Gmelin, 1792), pomeranus (Gmelin, 1792), sagaces (C. E. H. Smith, 1839), sanguinarius (C. E. H. Smith, 1839), sagax (Linnaeus, 1758), scoticus (Gmelin, 1792), sibiricus (Gmelin, 1792), suillus (C. E. H. Smith, 1839), terraenovae (C. E. H. Smith, 1839), terrarius (C. E. H. Smith, 1839), turcicus (Gmelin, 1792), urcani (C. E. H. Smith, 1839), variegatus (Gmelin, 1792), venaticus (Gmelin, 1792), vertegus (Gmelin, 1792)[35]

Florida Black wolf
Canis lupus floridanus
Miller 1912A jet black wolf that is described as being extremely similar to the Red wolf in both size and weight.[36] This subspecies became extinct in 1908.[37]Florida
Cascade Mountain wolf
Canis lupus fuscus
Richardson 1839A cinnamon coloured wolf measuring 165 cm and weighing 36–49 kg[14]Cascade Range
Gregory's wolf
Canis lupus gregoryi
Goldman 1937[38]A medium sized subspecies, though slender and tawny, its coat contains a mixture of various colors, including black, grey, white, and cinnamon.[38]gigas (Townsend, 1850)[39]
Manitoba wolf
Canis lupus griseoalbus
Baird 1858North Alberta, Saskatchewan, and Manitobaknightii (Anderson, 1945)[40]
Hokkaidō wolf
Canis lupus hattai

エゾオオカミ剥製・開拓記念館19840914.jpg

Kishida 1931Hokkaidōrex (Pocock, 1935)[41]
Honshū wolf
Canis lupus hodophilax

Honshu-wolf4.jpg

Temminck 1839Honshū, Shikoku, and Kyūshūhodopylax (Temminck, 1844), japonicus (Nehring, 1885)[42]
Hudson Bay wolf
Canis lupus hudsonicus
Goldman 1941Northern Manitoba and the Northwest Territories
Northern Rocky Mountains wolf
Canis lupus irremotus

Northern Rocky Mountains wolf.jpg

Goldman 1937[38][43]Northern Rocky Mountains
Labrador wolf
Canis lupus labradorius
Goldman 1937[38]Labrador and northern Quebec
Alexander Archipelago wolf
Canis lupus ligoni
Goldman 1937[38]Alexander Archipelago
Eastern wolf
Canis lupus lycaon

Canis lupus lycaon qtl4.jpg

Schreber 1775Mainly occupies the area in and around Algonquin Provincial Park in Ontario, and also ventures into adjacent parts of Quebec, Canada. It also may be present in Minnesota and Manitobacanadensis (de Blainville, 1843), ungavensis (Comeau, 1940)[44]
Mackenzie River wolf
Canis lupus mackenzii
Anderson 1943Northwest Territories
Baffin Island wolf
Canis lupus manningi
Anderson 1943Baffin Island
Mogollon Mountain wolf
Canis lupus mogollonensis
Goldman 1937[38]A dark coloured wolf measuring 135–150 cm in length, and weighing 27–36 kg[14]Arizona and New Mexico
Texas wolf
Canis lupus monstrabilis
Goldman 1937[38]Similar in size and colour to C. lupus mogollonensis[14]Texas and New Mexiconiger (Bartram, 1791)[45]
Buffalo wolf
Canis lupus nubilus
Say 1823Minnesota, Michigan, and Wisconsin. Single wolves have been reported in the Dakotas and as far south as Nebraskavariabilis (Wied-Neuwied, 1841)[46]
Mackenzie Valley wolf
Canis lupus occidentalis

Lobo en el Zoo de Madrid 01 cropped.jpg

Richardson 1829Western Canadasticte (Richardson, 1829), ater (Richardson, 1829)[47]
Greenland wolf
Canis lupus orion
Pocock 1935Greenland
Indian wolf
Canis lupus pallipes

Wolf Islamabad Pakistan.jpg

Sykes 1831A small wolf with pelage shorter than that of northern wolves, and with little to no underfur.[48] Fur colour ranges from greyish red to reddish white with black tips. The dark V shaped stripe over the shoulders is much more pronounced than in northern wolves. The underparts and legs are more or less white.[49]Western India, Iran, Turkey, Saudi Arabia and southern Israel
Yukon wolf
Canis lupus pambasileus
Elliot 1905Alaska and the Yukon
Red wolf
Canis lupus rufus

07-03-23RedWolfAlbanyGAChehaw.jpg

Audubon and Bachman 1851Has a brownish or cinnamon pelt, with grey and black shading on the back and tail. Generally intermediate in size between other American wolf subspecies and coyotes. Like other wolves, it has almond-shaped eyes, a broad muzzle and a wide nosepad, though like the coyote, its ears are proportionately larger. It has a deeper profile, a longer and broader head than the coyote, and has a less prominent ruff than wolves[50]Eastern North Carolina[51]
Alaskan tundra wolf
Canis lupus tundrarum
Miller 1912Has heavier dentition than pambasileusAlaska
Southern Rocky Mountains wolf
Canis lupus youngi
Goldman 1937[38]Southern Rocky Mountains

Disputed subspecies and species

Italian (Apennine) Wolf from the National Park of Abruzzo, Lazio e Molise
Iberian Wolves

Two subspecies not mentioned in the list above are the Italian Wolf (Canis lupus italicus) and the Iberian Wolf (Canis lupus signatus). The wolves of the Italian and Iberian peninsulas have morphologically distinct features from other Eurasian wolves and each are considered by their researchers to represent their own subspecies.[52][53][54]

The genetic distinction of the Italian wolf subspecies was recently supported by analysis which consistently assigned all the wolf genotypes of a sample in Italy to a single group. This population also showed a unique mitochondrial DNA control-region haplotype, the absence of private alleles and lower heterozygosity at microsatellite loci, as compared to other wolf populations.[55]

Recent genetic research suggests that the Indian Wolf populations in the Indian subcontinent may represent a distinct species from their conspecifics. Similar results were obtained for the Himalayan wolf, which is traditionally placed under the Tibetan wolf (Canis lupus chanco).[56]

See also

References

  1. ^ Mech, L.D., Boitani, L. (2008). "Canis lupus". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/3746. Retrieved 12 August 2011. 
  2. ^ The Living Age, published by Littell, Son and Co., 1851
  3. ^ a b Richardson, J., Swainson, W., Kirby, W. (1829) Fauna Boreali-americana, Or, The Zoology of the Northern Parts of British America: Containing Descriptions of the Objects of Natural History Collected on the Late Northern Land Expeditions, Under Command of Captain Sir John Franklin, R.N. J. Murray, London book preview
  4. ^ Hutchinson's animals of all countries: the living animals of the world in picture and story. Volume I. 1923. p. 384. 
  5. ^ a b Hunting the Grisly and Other Sketches by Theodore Roosevelt - Full Text Free Book (Part 3/3)
  6. ^ The Natural History of Dogs: Canidæ Or Genus Canis of Authors. Including Also the Genera Hyæna and Proteles by Charles Hamilton Smith, contributor William Home Lizars, Samuel Highley, W. Curry, Junr. & Co, Published by W.H. Lizars, ... S. Highley, ... London; and W. Curry, jun. and Co. Dublin., 1839
  7. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000738. 
  8. ^ "Canis lupus lupus Linnaeus, 1758". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180598. 
  9. ^ a b c d e f Mammals of the Soviet Union Vol.II Part 1a, Sirenia AND Carnivora (Sea cows; Wolves and Bears), V.G Heptner and N.P Naumov editors, Science Publishers, Inc. USA. 1998. ISBN 1886106819
  10. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000739. 
  11. ^ "Canis lupus albus Kerr, 1792". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=726809. 
  12. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000740. 
  13. ^ "Canis lupus alces Goldman, 1941". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=726810. 
  14. ^ a b c d e The Encyclopedia of Vanished Species by David Day, Universe Books ltd. 1981. ISBN 0947889302
  15. ^ "Canis lupus arabs Pocock, 1934". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=726811. 
  16. ^ a b Lopez, Barry (1978). Of wolves and men. New York: Scribner Classics. p. 320. ISBN 0743249364. 
  17. ^ Fred H. Harrington, Paul C. Paquet (1982). Wolves of the World: Perspectives of Behavior, Ecology, and Conservation. p. 474. ISBN 0815509057. 
  18. ^ "Canis lupus arctos Pocock, 1935". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=726812. 
  19. ^ "White wolf of the North", World Wide Fund for Nature
  20. ^ "Arctic wolf", Toronto Zoo
  21. ^ "Canis lupus baileyi Nelson and Goldman, 1929". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=726813. 
  22. ^ a b "Green Fire" Returns to the Southwest: Reintroduction of the Mexican Wolf- Author(s): David R. Parsons. Source: Wildlife Society Bulletin, Vol. 26, No. 4, Commemorative Issue Celebrating the 50th Anniversary of "A Sand County Almanac" and the Legacy of Aldo Leopold (Winter, 1998), pp. 799-807. Published by: Allen Press
  23. ^ "Bernard, P. and J.", The Eponym Dictionary of Mammals by Bo Beolens, Michael Watkins and Michael Grayson, JHU Press, 2009, Pg. 40
  24. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000746. 
  25. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000747. 
  26. ^ Fauna of British India: Mammals Volume 2 by R. I. Pocock, printed by Taylor and Francis, 1941
  27. ^ Walker, Brett L. (2005). The Lost Wolves Of Japan. p. 331. ISBN 0295984929. 
  28. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000748. 
  29. ^ "Preliminary Investigations of the Vancouver Island Wolf", Wolves of the world: perspectives of behavior, ecology, and conservation by Fred H. Harrington and Paul C. Paquet, William Andrew, 1982, Pg. 54
  30. ^ Ben Allen (2008). "Home Range, Activity Patterns, and Habitat use of Urban Dingoes". 14th Australasian Vertebrate Pest Conference. Invasive Animals CRC. http://www.invasiveanimals.com/downloads/Final-proceedings-with-cover.pdf. Retrieved 2009-04-29. [dead link]
  31. ^ Fleming, Peter; Laurie Corbett, Robert Harden, Peter Thomson (2001). Managing the Impacts of Dingoes and Other Wild Dogs. Commonwealth of Australia: Bureau of Rural Sciences. 
  32. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000751. 
  33. ^ Serpell, James (1995). The Domestic Dog; its evolution, behaviour and interactions with people. Cambridge: Cambridge Univ. Press. p. 35. ISBN 0-521-42537-9. 
  34. ^ Coppinger, Ray (2001). Dogs: a Startling New Understanding of Canine Origin, Behavior and Evolution. New York: Scribner. ISBN 0684855305. 
  35. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000752. 
  36. ^ "The Wolf", Alsatian Shepalute's: A New Breed for a New Millennium by Lois Denny, AuthorHouse, 2004, Pg. 42
  37. ^ Klinkenberg, Jeff, "For saving the Florida panther, it's desperation time", St. Petersburg Times, February 11, 1990
  38. ^ a b c d e f g h "The Wolves of North America", E. A. Goldman, Journal of Mammalogy, Vol. 18, No. 1 (Feb., 1937), pp. 37-45
  39. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000754. 
  40. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000756. 
  41. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000757. 
  42. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000758. 
  43. ^ "Canis lupus irremotus Goldman, 1937". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=726829. 
  44. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000763. 
  45. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000767. 
  46. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000768. 
  47. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000769. 
  48. ^ NATURAL HISTORY OF THE Mammalia OF INDIA AND CEYLON by Robert A. Sterndale, THACKER, SPINK, AND CO. BOMBAY: THACKER AND CO., LIMITED. LONDON: W. THACKER AND CO. 1884.
  49. ^ A monograph of the canidae by St. George Mivart, F.R.S, published by Alere Flammam. 1890
  50. ^ "Red Wolf". canids.org. http://www.canids.org/species/Red_wolf.pdf. 
  51. ^ Red Wolf Recovery Project from the U.S. Fish and Wildlife Services
  52. ^ The wolf in Spain
  53. ^ Canis lupus italicus
  54. ^ J. Vos: Food habits and livestock depredation of two Iberian wolf packs (Canis lupus signatus) in the north of Portugal. Journal of Zoology (2000), 251: 457-462 Cambridge University Press. online abstract
  55. ^ V. LUCCHINI, A. GALOV and E. RANDI Evidence of genetic distinction and long-term population decline in wolves (Canis lupus) in the Italian Apennines. Molecular Ecology (2004) 13, 523–536. abstract online
  56. ^ R. K. Aggarwal, T. Kivisild, J. Ramadevi, L. Singh: Mitochondrial DNA coding region sequences support the phylogenetic distinction of two Indian wolf species. Journal of Zoological Systematics and Evolutionary Research, Volume 45 Issue 2 Page 163-172, May 2007 online
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Based on recent genetic studies, Wilson et al. (2000) concluded that the eastern timber wolf (Canis lupus lycaon) and the red wolf (Canis rufus) are sister taxa and are best considered to be conspecific. Additionally, Wilson et al. found that these two taxa form a North American lineage with the coyote (Canis latrans) that is distinct from that of the gray wolf (Canis lupus), which is Eurasian in origin. Wilson et al. (2000, 2003) proposed that the eastern timber wolf (Canis lycaon) be recognized as a species distinct from the gray wolf (C. lupus). Nowak (2002) presented an analysis of cranial morphology of recent and Pleistocene Canis and concluded that Canis rufus is a valid species and that lycaon may be a hybrid between Canis rufus and western Canis lupus.

In a recent checklist of North American mammals, Baker et al. (2003) accepted C. lycaon and C. lupus as separate species as proposed by Wilson et al. (2000, 2003). Without explanation they retained the red wolf (Canis rufus) as a third North American wolf species. Wozencraft (in Wilson and Reeder 2005) recognized one Northern Hemisphere wolf species (Canis lupus) and listed rufus and lycaon as subspecies, noting that rufus appears to be a hybrid. In view of the unstable taxonomy of North American wolves and pending further information, this database retains the traditional arrangement of two wolf species in North America (C. lupus and C. rufus), with lycaon treated as a subspecies of C. lupus.

Recently, the eastern timber wolf and coyote have come into contact and have subsequently hybridized (Wilson et al. 2000). For example, genetic transfer of coyote mitochondrial DNA into eastern wolf (Canis lupus lycaon) populations has occurred through hybridization in a contiguous geographic region in Minnesota, Ontario, and Quebec; the frequency of coyote-type mtDNA in these wolf populations is greater than 50%; no coyotes sampled had a wolf-derived mtDNA genotype; probably hybridization is occurring between male wolves and female coyotes in regions where coyotes only recently have become abundant following conversion of forests to farmlands (Lehman et al. 1991).

Genetic data from northwestern Canada suggests the existence of a large panmictic population resulting from extensive movements of individuals and packs and from natural and human impacts on pack structure and function (Kennedy et al. 1991).

Wayne et al. (1992) examined mtDNA variability in North America, Europe, and southern Asia and found 18 mtDNA genotypes, seven derived from hybridization with coyotes, four confined to the New World, six confined to the Old World, and one shared by both areas. Genetic differentiation among populations is small but significant. In the Old World most localities have a single unique genotype, whereas in the New World several genotypes occur at most localities and three of the five genotypes are nearly ubiquitous. They concluded that apparent genetic differences among extant wolf populations may be a recent phenomenon reflecting population declines and habitat fragmentation rather than a long history of genetic isolation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!