Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Lynx have dense winter coats, and their large feet, padded with thick fur, let them run atop deep snow. A large portion of their diet consists of snowshoe hares, which are similarly equipped to run on snow. Lynx hunt mostly at dawn and dusk. They are solitary, and maintain nonexclusive territories. The ranges of females overlap more than the ranges of males. Adults scent-mark their territories by urinating and defecating on logs, stumps, and bushes along their travel routes. The chemistry of their urine changes seasonally and this generates different signals, attracting mates during breeding season and repelling other Lynx at other times.

Links:
Mammal Species of the World
  • Original description: In Linnaeus, C. (translated and revised by R. Kerr), 1792. The animal kingdom; or, zoological system of the celebrated Sir Charles Linnaeus. Class I. Mammalia and Class II. Birds.  Being a translation of that part of the Systema Naturae, as lately published with great improvements by Professor Gmelin, together with numerous additions from more recent zoological writers and illustrated with copperplates, 1:157.  J. Murray, London, 644 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The Canada lynx occurs from Alaska south to British Columbia and east to the Atlantic Coast of Canada. The southern portion of the Canada lynx's range extends to isolated portions of Washington, Oregon, Idaho, Montana, Utah, and Colorado. Small populations of Canada lynxes exist in northern Minnesota, northern Wisconsin, New Hampshire, Vermont [28,88,108], and Maine [28]. NatureServe provides a distributional map for the Canada lynx.

Lynx canadensis canadensis occurs in all of the areas listed above except Newfoundland [47,48,106,114], and Lynx canadensis subsolanus occurs in Newfoundland only [47,48,106].

The following lists are speculative and are based on the habitat characteristics and species composition of communities Canada lynxes are known to occupy. There is not conclusive evidence that Canada lynxes occur in all the habitat types listed, and some community types, especially those used rarely, may have been omitted. See Preferred Habitat for more detail.

  • 28. DeGraaf, Richard M.; Rudis, Deborah D. 2001. New England wildlife: habitat, natural history, and distribution. Hanover, NH: University Press of New England. 467 p. [21385]
  • 47. Hall, E. Raymond. 1981. Lynx canadensis: Lynx. In: The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley & Sons: 1050-1051. [54716]
  • 48. Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley and Sons. 1271 p. [14765]
  • 88. Quinn, Norman W. S.; Parker, Gerry. 1987. Lynx. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 683-694. [50683]
  • 106. Tumlison, Renn. 1987. Felis lynx. Mammalian Species. 269: 1-8. [65984]
  • 108. U.S. Department of the Interior, Fish and Wildlife Service. 1994. Endangered and threatened wildlife and plants; animal candidate review for listing as endangered or threatened species; proposed rule. 50 CFR Part 17. Tuesday, November 15, 1994. Federal Register. 59(219): 58982-59028. [24357]
  • 114. Werdelin, Lars. 1981. The evolution of lynxes. Annales Zoologici Fennici. 18: 37-71. [25333]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

States or Provinces

(key to state/province abbreviations)
United States
AK CO ID ME MI MN MT NH OR UT VT WA WI
WY

Canada
AB BC MB NB NF NT NS NU ON PE
PQ SK YK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

BLM PHYSIOGRAPHIC REGIONS [14]:

2 Cascade Mountains

5 Columbia Plateau

6 Upper Basin and Range

8 Northern Rocky Mountains

9 Middle Rocky Mountains

10 Wyoming Basin

12 Colorado Plateau
  • 14. Bernard, Stephen R.; Brown, Kenneth F. 1977. Distribution of mammals, reptiles, and amphibians by BLM physiographic regions and A.W. Kuchler's associations for the eleven western states. Tech. Note 301. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 169 p. [434]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Major populations of Canadian lynx, Lynx_canadensis, are found throughout Canada, in western Montana, and in nearby parts of Idaho and Washington. There are small populations in New England and Utah and possibly in Oregon, Wyoming and Colorado as well.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Throughout North America, Canada lynx are generally considered to be distributed in two broad spatial and demographic patterns. The contiguous Northern Taiga population covers most of Canada east from Newfoundland and Labrador to Alaska. The southern Boreal population consists of small, widely isolated populations south of the 49 degree parallel in the "Lower 48" states of the US, and in Canada including northwestern New Brunswick and Cape Breton island in Nova Scotia (Parker 2001). Its range is coincident with that of their main prey, the snowshoe hare Lepus americanus (Nowell and Jackson 1996, Sunquist and Sunquist 2002). While still occurring in 95% of their historic range in Canada (with the exception of far eastern Canada) (Poole 2003), in the contiguous United States, lynx historically occurred in 24 states (McKelvey et al. 2000), possibly ranging as far down the Rocky mountain chain to include a 25th, New Mexico (Frey 2006). Widely extirpated, the US Fish and Wildlife Service has identified six "core" areas for recovery where there is evidence of lynx reproduction within the last 20 years: northern Maine and New Hampshire; northeastern Minnesota; northwestern Montana and northeastern Idaho; the Kettle and Wedge mountain ranges of Washington state; the northern Cascade range of Washington state; and the Greater Yellowstone area of Wyoming, Montana and Idaho. A reintroduced population in the southern Rocky mountains of Colorado state is another core area; 204 lynx from Canada and Alaska have been released since 1999, and there is evidence of reproduction (Nordstrom et al. 2005) and lynx have ranged up to 4,310 m, with an average elevation of 3,170 m (Wild et al. 2006). A reintroduction in northern New York state was not successful (Sunquist and Sunquist 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Major populations of Canadian lynx, Lynx canadensis, are found throughout Canada, in western Montana, and in nearby parts of Idaho and Washington. There are small populations in New England and Utah and possibly in Oregon, Wyoming and Colorado as well.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout Alaska and Canada (except arctic islands) south through the Rocky Mountains, northern Great Lakes region, and northern New England. Also northern Eurasia if regarded as conspecific with Lynx lynx (=Felis lynx). See U.S. Fish and Wildlife Service (1998) for information on distribution and relative abundance in the contiguous U.S. Considered historically resident in 16 states represented by five ecologically distinct regions: Cascade Range (Washington, Oregon), northern Rocky Mountains (northeastern Washington, southeastern Oregon, Idaho, Montana, western Wyoming, northern Utah), southern Rocky Mountains (southeastern Wyoming, Colorado), northern Great Lakes (Minnesota, Wisconsin, Michigan ), and northern New England (Maine, New Hampshire, Vermont, New York, Pennsylvania, Massachusetts). Resident populations currently exist only in Maine, Montana, Washington, and possibly Minnesota; considered extant but no longer sustaining self-support populations in Wisconsin, Michigan, Oregon, Idaho, Wyoming, Utah, and Colorado; may be extirpated from New Hampshire, Vermont, New York, Pennsylvania, and Massachusetts (U.S. Fish and Wildlife Service 1998). See Stardom (1988 COSEWIC report) for information on distribution and relative abundance in Canada, where still widespread and relatively abundant in most of historic range. See USFWS (2000) for a state-by-state review of historical and current distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Most lynx have long, thick, yellowish-brown fur. The back is more gray, and the belly is lighter. Some have dark spots. Lynx have short, ringed tails with black tips. The ears have long black hairs on the tip. The paws are large and furry, which helps these cats to walk and run on snow.

Most lynx measure between 670 and 1,067 mm from head to tail, and weigh from 4.5 to 17.3 kg. Their tails can be from 51 to 138 mm. Males are a little bigger than females.

Range mass: 4.5 to 17.3 kg.

Range length: 670 to 1,067 mm.

Sexual Dimorphism: male larger

  • Tumlison, R. 1999. Canada lynx| Lynx canadensis . Pp. 233-234 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington D.C.: The Smithsonian Institution Press in Association with the American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The coloration of lynx varies, but is normally yellowish-brown. The upper parts may have a frosted, gray look and the underside may be more buff. Many individuals have dark spots. The tail is quite short and is often ringed and tipped with black. The fur on the body is long and thick. The hair is particularly long on the neck in winter. The triangular ears are tipped with tufts of long black hairs. The paws are quite large and furry, helping to distribute the weight of the animal when moving on snow.

Head-body length is between 670 and 1,067 mm and tail length ranges from 50 to 130 mm. Amimals typically weigh between 4.5 and 17.3 kg. On average, males weigh slightly more than females.

Range mass: 4.5 to 17.3 kg.

Range length: 670 to 1,067 mm.

Sexual Dimorphism: male larger

  • Tumlison, R. 1999. Canada lynx| Lynx canadensis . Pp. 233-234 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington D.C.: The Smithsonian Institution Press in Association with the American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 107 cm

Weight: 18100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly larger than females.

Length:
Range: 670-1,067 mm

Weight:
Range: 4.5-17.3 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: cover, forb

SRM (RANGELAND) COVER TYPES [94]:

109 Ponderosa pine shrubland

110 Ponderosa pine-grassland

409 Tall forb

411 Aspen woodland

901 Alder

904 Black spruce-lichen

920 White spruce-paper birch

921 Willow
  • 94. Shiflet, Thomas N., ed. 1994. Rangeland cover types of the United States. Denver, CO: Society for Range Management. 152 p. [23362]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

SAF COVER TYPES [35]:

1 Jack pine

5 Balsam fir

12 Black spruce

13 Black spruce-tamarack

15 Red pine

16 Aspen

17 Pin cherry

18 Paper birch

20 White pine-northern red oak-red maple

21 Eastern white pine

22 White pine-hemlock

23 Eastern hemlock

24 Hemlock-yellow birch

25 Sugar maple-beech-yellow birch

27 Sugar maple

30 Red spruce-yellow birch

31 Red spruce-sugar maple-beech

32 Red spruce

33 Red spruce-balsam fir

34 Red spruce-Fraser fir

35 Paper birch-red spruce-balsam fir

37 Northern white-cedar

38 Tamarack

52 White oak-black oak-northern red oak

55 Northern red oak

57 Yellow-poplar

58 Yellow-poplar-eastern hemlock

59 Yellow-poplar-white oak-northern red oak

60 Beech-sugar maple

107 White spruce

108 Red maple

201 White spruce

202 White spruce-paper birch

203 Balsam poplar

204 Black spruce

205 Mountain hemlock

206 Engelmann spruce-subalpine fir

207 Red fir

208 Whitebark pine

209 Bristlecone pine

210 Interior Douglas-fir

211 White fir

212 Western larch

213 Grand fir

215 Western white pine

217 Aspen

218 Lodgepole pine

219 Limber pine

221 Red alder

222 Black cottonwood-willow

223 Sitka spruce 

224 Western hemlock

225 Western hemlock-Sitka spruce

227 Western redcedar-western hemlock

228 Western redcedar

229 Pacific Douglas-fir

230 Douglas-fir-western hemlock

237 Interior ponderosa pine

251 White spruce-aspen

252 Paper birch

253 Black spruce-white spruce

254 Black spruce-paper birch
  • 35. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: bog, shrub

KUCHLER [62] PLANT ASSOCIATIONS:

K001 Spruce-cedar-hemlock forest

K002 Cedar-hemlock-Douglas-fir forest

K004 Fir-hemlock forest

K005 Mixed conifer forest

K007 Red fir forest

K008 Lodgepole pine-subalpine forest

K010 Ponderosa shrub forest

K011 Western ponderosa forest

K012 Douglas-fir forest

K013 Cedar-hemlock-pine forest

K014 Grand fir-Douglas-fir forest

K015 Western spruce-fir forest

K018 Pine-Douglas-fir forest

K020 Spruce-fir-Douglas-fir forest

K021 Southwestern spruce-fir forest

K093 Great Lakes spruce-fir forest

K094 Conifer bog

K095 Great Lakes pine forest

K096 Northeastern spruce-fir forest

K099 Maple-basswood forest

K102 Beech-maple forest

K106 Northern hardwoods

K107 Northern hardwoods-fir forest

K108 Northern hardwoods-spruce forest
  • 62. Kuchler, A. W. 1964. United States [Potential natural vegetation of the conterminous United States]. Special Publication No. 36. New York: American Geographical Society. 1:3,168,000; colored. [3455]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

ECOSYSTEMS [41]:

FRES10 White-red-jack pine

FRES11 Spruce-fir

FRES18 Maple-beech-birch

FRES19 Aspen-birch

FRES20 Douglas-fir

FRES21 Ponderosa pine

FRES22 Western white pine

FRES23 Fir-spruce

FRES24 Hemlock-Sitka spruce

FRES25 Larch

FRES26 Lodgepole pine

FRES37 Mountain meadows
  • 41. Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; Lewis, Mont E.; Smith, Dixie R. 1977. Vegetation and environmental features of forest and range ecosystems. Agric. Handb. 475. Washington, DC: U.S. Department of Agriculture, Forest Service. 68 p. [998]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lynx usually live in mature forests with dense undergrowth but can also be found in more open forests, rocky areas or tundra.

Terrestrial Biomes: tundra ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Canada lynx are found only in boreal forest, and their main prey species, the snowshoe hare Lepus americanus, depends largely on patches of sucessional growth (Buskirk et al. 2000). Hares make up 60-97% of their diet, at an average rate of one every 1-2 days (Sunquist and Sunquist 2002). The lynx-hare cycle was first discovered from harvest records of the Hudson’s Bay Company dating back to the early 1800's. Numbers of snowshoe hares peak approximately every ten years in the northern part of their range, and lynx numbers follow the same pattern with a short lag, typically 1-2 years. The fluctuations can be drastic, with hare abundance reaching 2,300/km² during the peaks, and crashing to 12/km² during the lows. While the populations of many prey and predator species are cyclic and roughly synchronous in the northern latitudes, the hare-lynx correlation is particularly close (Nowell and Jackson 1996, Sunquist and Sunquist 2002). Three primary variables drive the cycle: vegetation quality, and both hare and lynx numbers. Historically, lynx trapping pressure also influenced the amplitude of the cycle (Gamarra and Sole 2000).

In the southern parts of their range, predator and prey communities are more diverse, and snowshoe hares are less important as prey species (Buskirk et al. 2000). Ungulates to not figure prominently in the lynx's diet other than as carrion, although they preyed on caribou calves in Newfoundland after the hare population crashed (Bergerud 1983).

Lynx home ranges average 15-50 km², although they can be much larger, and tend to be larger on the southern periphery of their geographic distribution, suggesting that these areas are marginal habitat. Average lynx densities range from 1-45 animals (including young) per 100 km², and fluctuate with hare abundance (Sunquist and Sunquist 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lynx usually live in mature forests with dense undergrowth but can also be found in more open forests, rocky areas or tundra.

Terrestrial Biomes: tundra ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Generally occurs in boreal and montane regions dominated by coniferous or mixed forest with thick undergrowth, but also sometimes enters open forest, rocky areas, and tundra to forage for abundant prey. When inactive or birthing, occupies den typically in hollow tree, under stump, or in thick brush. Den sites tend to be in mature or old growth stands with a high density of logs (Koehler 1990, Koehler and Brittell 1990).

U.S. Forest Service et al. (1993) listed three primary habitat components for lynx in the Pacific Northwest: (1) foraging habitat (15-35-year-old lodgepole pine) to support snowshoe hare and provide hunting cover, (2) denning sites (patches of >200-year-old spruce and fir, generally less than 5 acres, and (3) dispersal/travel cover (variable in vegetation composition and structure).

Major limiting factor is abundance of snowshoe hare, which in turn is limited by availability of winter habitat (in the Pacific Northwest, primarily early successional lodgepole pine with trees at least 6 feet tall) (U.S. Forest Service et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Canada lynxes utilize regenerating forest stands for foraging habitat [2] (see Preferred Habitat). Mammals comprise the largest portion of the Canada lynx's diet, followed by birds [98,110]. Snowshoe hares make up the greatest biomass (35-99%) of prey consumed year-round [28,54,57,58,59,70,72,76,100].

Diversity of Canada lynx prey items increases during the summer and during periods of snowshoe hare scarcity [80]. Prey items may include red squirrels (Tamiasciurus hudsonicus) [52,58,73,100,110], ruffed grouse (Bonasa umbellus) [16,90,110], great gray owls (Strix nebulosa) [33], mice (Peromyscus spp.) [58], voles (Clethrionomys spp. and Microtus spp.) [70], fishers (Martes pennanti) [87], red foxes (Vulpes vulpes) [70,101], and moose (Alces alces) and woodland caribou (Rangifer tarandus caribou) carcasses [70].

Canada lynxes may prey on ungulates such as woodland caribou calves, deer (Odocoileus spp.) calves, and Dall's sheep (Ovis dalli) lambs, but ungulate dietary importance is insignificant [58,91,95,101].

  • 2. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 16. Boag, D. A.; Sumanik, K. M. 1969. Characteristics of drumming sites selected by ruffed grouse in Alberta. Journal of Wildlife Management. 33(3): 621-628. [15648]
  • 28. DeGraaf, Richard M.; Rudis, Deborah D. 2001. New England wildlife: habitat, natural history, and distribution. Hanover, NH: University Press of New England. 467 p. [21385]
  • 33. Duncan, James R. 1987. Movement strategies, mortality, and behavior of radio-marked great gray owls in southeastern Manitoba and northern Minnesota. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 101-107. [65581]
  • 52. Hoving, Christoper L.; Harrison, Daniel J.; Krohn, William B.; Joseph, Ronald A.; O'Brien, Mike. 2005. Broad-scale predictors of Canada lynx occurrence in eastern North America. Journal of Wildlife Management. 69(2): 739-751. [65959]
  • 54. Keith, Lloyd B. 1974. Some features of population dynamics in mammals. In: Proceedings, International Union of Game Biologists. 11: 17-58. [25161]
  • 57. Koch, Peter. 1996. Lodgepole pine commercial forests: an essay comparing the natural cycle of insect kill and subsequent wildfire with management for utilization and wildlife. Gen. Tech. Rep. INT-GTR-342. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 24 p. [27158]
  • 58. Koehler, Gary M. 1990. Population and habitat characteristics of lynx and snowshoe hares in north central Washington. Canadian Journal of Zoology. 68: 845-851. [18030]
  • 59. Koehler, Gary M.; Aubry, Keith B. 1994. Lynx. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 74-98. [29933]
  • 70. Mowat, Garth; Slough, Brian G. 1998. Some observations on the natural history and behaviour of the Canada lynx, Lynx canadensis. The Canadian Field-Naturalist. 112(1): 32-36. [65979]
  • 72. Murray, Dennis L.; Boutin, Stan; O'Donoghue, Mark. 1994. Winter habitat selection by lynx and coyotes in relation to snowshoe hare abundance. Canadian Journal of Zoology. 72(8): 1444-1451. [65983]
  • 73. Nellis, Carl H.; Wetmore, Stephen P., Keith, Lloyd B. 1972. Lynx-prey interactions in central Alberta. Journal of Wildlife Management. 36(2): 320-328. [13711]
  • 76. O'Farrell, Thomas P. 1965. Home range and ecology of snowshoe hares in interior Alaska. Journal of Mammalogy. 46(3): 406-418. [25105]
  • 80. Parker, G. R.; Maxwell, J. W.; Morton, L. D.; Smith, G. E. J. 1983. The ecology of the lynx (Lynx canadensis) on Cape Breton Island. Canadian Journal of Zoology. 61: 770-786. [66527]
  • 87. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]
  • 90. Rusch, Donald H.; Keith, Lloyd B. 1971. Ruffed grouse - vegetation relationships in central Alberta. The Journal of Wildlife Management. 35(3): 417-429. [41743]
  • 91. Saunders, Jack K. 1963. Food habits of the lynx in Newfoundland. Journal of Wildlife Management. 27(3): 384-390. [13710]
  • 95. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 98. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 100. Squires, John R.; Ruggiero, Leonard F. 2007. Winter prey selection of Canada lynx in northwestern Montana. The Journal of Wildlife Management. 71(2): 310-315. [66705]
  • 101. Stephenson, Robert O.; Grangaard, Daniel V.; Burch, John. 1991. Lynx, Felis lynx, predation on red foxes, Vulpes vulpes, caribou, Rangifer tarandus, and Dall sheep, Ovis dalli, in Alaska. Canadian Field-Naturalist. 105(2): 255-262. [25559]
  • 110. van Zyll de Jong, Constantinus Gerhard. 1963. The biology of the lynx, Felis (Lynx) canadensis (Kerr) in Alberta and the Mackenzie District, N.W.T. Edmonton, AB: University of Alberta. 76 p. Thesis. [65985]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Canadian lynx only eat meat. Lepus americanus are a very important food for these cats, and when there are fewer hares to eat, the number of lynx decreases. In some areas, such as Cape Breton Island, lynx eat only hares, but in other areas they also feast on rodents, birds and fish. If they can find a deer that is very weak or sick, lynx will kill and eat it. They also feed off carcasses left by human hunters.

Animal Foods: birds; mammals; fish; carrion

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Canadian lynx are strictly carnivores. Snowshoe hares are of particular importance in the diet of these cats, and populations of the two are known to fluctuate in linked cycles with periods of about 9.6 years. In these cycles, there is a slight lag between hare and lynx populations. Although in some areas, such as Cape Breton Island, lynx prey exclusively on hares, in other areas they also take rodents, birds and fish.

In the fall and winter, lynx will kill and eat deer and other large ungulates that are weakened by the rutting season. They also utilize carcasses left by human hunters.

Canadian lynx only eat meat. Snowshoe hares are a very important food for these cats, and when there are fewer hares to eat, the number of lynx decreases. In some areas, such as Cape Breton Island, lynx eat only hares, but in other areas they also feast on rodents, birds and fish. If they can find a deer that is very weak or sick, lynx will kill and eat it. They also feed off carcasses left by human hunters.

Animal Foods: birds; mammals; fish; carrion

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats primarily small mammals and birds, particularly Lepus americanus. Occasionally feeds on squirrels, small mammals, beaver, deer, moose, muskrat, and birds; some taken as carrion. May cache food for later use.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Gray wolves (Canis lupus) [75,116], mountain lions (Puma concolor) [116], and wolverines [15,75] are predators of Canada lynxes.
  • 15. Berrie, Peter M. 1973. Ecology and status of the lynx in interior Alaska. In: Eaton, Randall L., ed. The world's cats: Vol. 1--Ecology and conservation. Winston, OR: World Wildlife Safari: 4-41. [65989]
  • 75. O'Donoghue, Mark; Boutin, Stan; Krebs, Charles J.; Hofer, Elizabeth J. 1997. Numerical responses of coyotes and lynx to the snowshoe hare cycle. Oikos. 80(1): 150-162. [65980]
  • 116. Whitaker, John O., Jr. 1980. National Audubon Society field guide to North American mammals. New York: Alfred A. Knopf, Inc. 745 p. [25194]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

As predators, Canadian lynx are important in regulating the populations of their prey. This is particularly noticeable in the cycle of populations of lynx and snowshoe hares.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of these cats have not been reported. However, one can assume that young kittens are vulnerable to other large carnivores, such as wolves and bears.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

As predators, Canadian lynx are important in regulating the populations of their prey. This is particularly noticeable in the cycle of populations of lynx and snowshoe hares.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of these cats have not been reported. However, one can assume that young kittens are vulnerable to other large carnivores, such as wolves and bears.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Lynx canadensis preys on:
Amphispiza bilineata
Sciurus carolinensis
Castor canadensis
Falcipennis canadensis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Unknown, but numerous--Nearctic (or Holarctic) distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is unknown, but it varies cyclically with availability of food; total probably is at least in the hundreds of thousands during population peaks, based on annual harvests in Canada that periodically exceed 50,000 (Nowak 1991). British Columbia population was estimated to vary between 200,000 and 250,000 (Goodchild and Munro 1980). See Stardom (1988 COSEWIC report) for information on status in Canada. In the contiguous U.S., total population size is unknown, but probably less than 2,000. Colorado: only 18 positive recordrds; none since 1973; proposing to reintroduce lynx (Colorado Division of Wildlife 1997). Idaho: less than 100 individuals (C. Harris, pers. comm., 1997). Maine: less than 200 individuals (C. McLaughlin, pers. comm., 1997). Oregon: perhaps fewer than 75 individuals (E. Gaines, pers. comm., 1997). Utah: very rare, few if any extant occurrences (G. Oliver, pers. comm., 1997). Montana: 740-1040 individuals (B. Giddings, pers. comm., 1998). Washington: 72-191 individuals (Washington Department of Wildlife 1993, Washington Department of Natural Resources 1996). Wyoming: less than 100 individuals (B. Oakleaf, pers. comm., 1998). Periodic increases in lynx numbers may be accentuated by dispersal of transient animals from Canadian populations (U.S. Fish and Wildlife Service 1998). It has been suggested that, because lynx occurrence throughout much of the continguous U.S. is on the southern periphery of the species' range, the presence of lynx is solely a consequence of dispersal from Canada and that most of the U.S. may never have supported self-sustaining, resident populations over time (U.S. Fish and Wildlife Service 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, fire exclusion, frequency, fresh, fuel, prescribed fire, severity, shrub, shrubs, succession, tundra

Fire is important for maintaining high-quality habitat for Canada lynxes and their primary food source, snowshoe hares [44,86]. In the western portion of the Canada lynx's range, fire exclusion may have contributed to the Canada lynx's decline [71]. Fires that create a mosaic of successional stages are most beneficial for providing foraging and denning areas for Canada lynxes [2,38,60,80,86,88,121,121]. Fire may have negative impacts on Canada lynxes and snowshoe hares in the short term due to reduced food and cover [60,80]. As succession progresses, the amount of browse increases, and snowshoe hares become more abundant [121]. Canada lynx populations increase in response to high snowshoe hare densities [50,60,80,86]. The capacity of burned areas to support high snowshoe hare and Canada lynx densities declines over time. In later stages of succession, less herbage is within reach for snowshoe hares, decreasing their population, and subsequently, the Canada lynx population [38,50]. For more information about HABITAT RELATED FIRE EFFECTS on the snowshoe hare, see the FEIS review of snowshoe hare.

The Canada lynx requires a landscape containing early [31,51,58,60,86] and late-successional [60] habitats and may be positively or negatively affected by fire [56,86,88,121]. In general, wildlife species that are associated with early successional vegetation may benefit from fuel reduction treatments. Species associated with late-successional habitat with features such as a closed canopy, a dense understory, and/or coarse woody debris may be negatively affected by fuel reduction treatments. The Canada lynx requires both, so the effects of fuel reduction on Canada lynxes may vary with the management history of an area, current habitat condition, landscape setting, and prescribed fire attributes such as size, type, frequency, and season. Canada lynxes may not be affected by fuel reduction on the stand level due to their large home ranges [84].

Snowshoe hares often abandon fresh burns if cover is sparse and nutritious browse is available elsewhere [55]. Snowshoe hares attain peak populations 5 to 30 years following fire, especially in habitat dominated by quaking aspen and birch (Betula spp.) [51]. In northern latitudes, stands approximately 40 years old may provide optimal conditions for snowshoe hares. In southern latitudes where succession occurs at a quicker rate, 15- to 30-year-old stands may provide the best habitat for snowshoe hares [38]. Little data exist on the use of recent burns by Canada lynxes [36]. Fifteen- to 30-year-old burned areas provide optimal foraging habitat for Canada lynxes in boreal forests [36,37,51,58,60,61,80,96,105,122], but 5- to 50-year-old burned areas may be used [79,86]. In the western United States, fire creates seral landscapes that are often dominated by lodgepole pine, which benefit snowshoe hares and Canada lynxes [71]. Canada lynxes require mature forests for denning and raising kittens; however, no information is currently available about the optimal age forest age for denning habitat. On the Okanogan National Forest in Washington, female Canada lynxes utilized 250-year-old subalpine fir-Engelmann spruce or lodgepole pine forests to raise kittens [58,60] (see Preferred Habitat).

Thirty-five of 39 Canada lynx dens were located in 29- to 36-year-old burned areas near Whitehorse, Yukon. Seventy-two percent of the 301 km² study area had been burned or partially burned prior the study. Details about the severity of the fire were not included. Regenerating trees and shrubs were predominantly lodgepole pine, white spruce, quaking aspen, subalpine fir, and willow (Salix spp.). Of the 35 Canada lynx dens found in burned areas, 33 were located under the deadfall of fire-killed coniferous trees. Four dens were located in unburned areas: 1 was beneath a mature subalpine fir, 2 were beneath willow thickets, and 1 was beneath a mature white spruce blowdown [96].

In northwestern Montana, Canada lynxes and snowshoe hares were found most often in forest stands on an 80-year-old burn. Twenty-three of 29 radio-telemetry locations for 1 adult male and 1 adult female Canada lynx were in densely stocked stands of young (<80 years old), 100% lodgepole pine stands; 3 locations were in mature (>100-year-old) subalpine fir-Engelmann spruce stands, and 3 locations were in young (<80 years old) Douglas-fir-western larch stringers along stream bottoms [61].

On the Nowitna National Wildlife Refuge, Alaska, Canada lynxes and snowshoe hares preferred a 25- to 28-year-old burned area to a 6- to 9-year-old burn or a 100- to 115-year-old mature forest. The forest in the 3 study areas consisted of predominantly black spruce with scattered white spruce or tamarack. Most of the 25- to 28-year-old burn (197 km²) was in the midsuccessional stage, but severely burned lowlands were in the shrub-sapling stage. Paper birch and quaking aspen dominated the overstory, and conifer saplings <16  feet (5 m) tall began to shade the understory in areas of dense regeneration. Maximum shrub height was 13.5 feet (4.1 m). Median percent canopy cover was 35%, and most debris piles had collapsed but not yet decayed [79].

The 6- to 9-year old burn (133 km²) was in the early successional tall shrub-sapling stage. The overstory was dominated by paper birch and quaking aspen saplings 16 feet (5 m) tall. Black spruce and tamarack seedlings were <3 feet (1 m) tall and grew among dwarf birch (Betula glandulosa) and beauverd spirea (Spiraea stevenii). Severely burned areas were in the moss-herb stage. Unburned areas comprised 5.9% of the area. Maximum shrub height was 9.2 feet (2.8 m). Median percent canopy cover was 5%, and leaning and fallen trees created debris piles ≤ 4.9 feet (1.5 m) tall [79].

Mature, 100- to 150-year-old coniferous forest was dominated by black spruce and tamarack 2 to 8 inches (5-20 cm) DBH. Maximum shrub height was 5.9 feet (1.8 m), and median percent canopy cover was 30%. Despite Canada lynx's preference for midsuccessional, postfire forest, mature forest stands may be important for denning and finding alternative prey items during snowshoe hare scarcity [79].

Coarse woody debris: Following fire, it is important to leave fire-killed trees to stabilize the soil and contribute to wildlife habitat for the Canada lynx and its prey. If salvage logging is implemented, the following are recommended: 1) strictly limit the removal of dead trees to roaded areas within the urban-wildlife interface; 2) use low-impact logging techniques such as high lead cables to minimize soil damage [30]; 3) maintain sufficient densities and diameter classes of woody debris for wildlife use; and 4) avoid sensitive sites such as severely burned areas, roadless and riparian areas, and sites with erosive or fragile soil [21,104].

Canada lynxes require coarse woody debris for denning and raising kittens [18,20,29,42,58,60,119] (see Preferred Habitat). Eliminating slash by broadcast burning following timber harvest may have a negative impact on the Canada lynx. Leaving piles of slash in an area may compensate for decreased structural diversity in even-aged monocultures and clearcut areas by providing cover. Slash piles may be most valuable when they are located within or near forested cover [2].

The following table provides fire-return intervals for plant communities and ecosystems where Canada lynx is important. For further information, see the FEIS review of the dominant plant species listed below.

Fire-return intervals for plant communities with Canada lynx

Community or Ecosystem Dominant Species Fire Return Interval Range (years)
grand fir Abies grandis 35-200 [4]
maple-beech Acer-Fagus spp. 684-1,385 [25,113]
maple-beech-birch Acer-Fagus-Betula spp. >1,000
sugar maple Acer saccharum >1,000 [113]
birch Betula spp. 80-230 [102]
tundra ecosystems Deschampsia caespitosa, Carex bigelowii, Carex macrochaeta, Chamerion latifolium, Festuca altaica, Potentilla nana, Sibbaldia procumbens, Saxifraga spp., Trifolium dasphyllum, Vaccinium vitis-idaea >100 to 500 [32,112,115]
beech-sugar maple Fagus spp.-Acer saccharum >1,000 [113]
tamarack Larix laricina 35-200 [81]
western larch Larix occidentalis 25-350 [5,13,27]
Great Lakes spruce-fir Picea-Abies spp. 35 to >200
northeastern spruce-fir Picea-Abies spp. 35-200 [32]
Engelmann spruce-subalpine fir Picea engelmannii-Abies lasiocarpa 35 to >200 [4]
black spruce Picea mariana 35-200
conifer bog* Picea mariana-Larix laricina 35-200
red spruce* Picea rubens 35-200 [32]
whitebark pine* Pinus albicaulis 50-200 [1,3]
jack pine Pinus banksiana <35 to 200 [25,32]
Rocky Mountain lodgepole pine* Pinus contorta var. latifolia 25-340 [12,13,103]
Pacific ponderosa pine* Pinus ponderosa var. ponderosa 1-47 [4]
interior ponderosa pine* Pinus ponderosa var. scopulorum 2-30 [4,9,64]
red pine (Great Lakes region) Pinus resinosa 3-18 (x=3-10) [39]
red-white pine* (Great Lakes region) Pinus resinosa-P. strobus 3-200 [25,49,66]
eastern white pine-eastern hemlock Pinus strobus-Tsuga canadensis 35-200
eastern white pine-northern red oak-red maple Pinus strobus-Quercus rubra-Acer rubrum 35-200 [113]
aspen-birch Populus tremuloides-Betula papyrifera 35-200 [32,113]
quaking aspen (west of the Great Plains) Populus tremuloides 7-120 [4,46,68]
Rocky Mountain Douglas-fir* Pseudotsuga menziesii var. glauca 25-100 [4,6,7]
coast Douglas-fir* Pseudotsuga menziesii var. menziesii 40-240 [4,69,89]
northern red oak Quercus rubra 10 to <35 [113]
western redcedar-western hemlock Thuja plicata-Tsuga heterophylla >200 [4]
eastern hemlock-yellow birch Tsuga canadensis-Betula alleghaniensis 100-240 [102,113]
eastern hemlock-white pine Tsuga canadensis-Pinus strobus x=47 [25]
western hemlock-Sitka spruce Tsuga heterophylla-Picea sitchensis >200
mountain hemlock* Tsuga mertensiana 35 to >200 [4]
*fire return interval varies widely; trends in variation are noted in the species review
  • 2. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 18. Brown, Timothy K. 2002. Creating and maintaining wildlife, insect, and fish habitat structures in dead wood. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 883-892. [44408]
  • 20. Bull, Evelyn L.; Aubry, Keith B.; Wales, Barbara C. 2001. Effects of disturbance on forest carnivores of conservation concern in eastern Oregon and Washington. Northwest Science. 75: 180-184. [43073]
  • 29. DeGraaf, Richard M; Shigo, Alex L. 1985. Managing cavity trees for wildlife in the Northeast. Gen. Tech. Rep. NE-101. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 21 p. [13481]
  • 36. Fisher, Jason T.; Wilkinson, Lisa. 2005. The response of mammals to forest fire and timber harvest in the North American boreal forest. Mammal Review. 35(1): 51-81. [55373]
  • 42. Gilbert, Brian A.; Pierce, Wade. 2005. Predicting the availability of understory structural features important for Canadian lynx denning habitat on managed lands in northeastern Washington lynx ranges. Western Journal of Applied Forestry. 20(4): 224-227. [66456]
  • 58. Koehler, Gary M. 1990. Population and habitat characteristics of lynx and snowshoe hares in north central Washington. Canadian Journal of Zoology. 68: 845-851. [18030]
  • 60. Koehler, Gary M.; Brittell, J. David. 1990. Managing spruce-fir habitat for lynx and snowshoe hares. Journal of Forestry. 88(10): 10-14. [13599]
  • 61. Koehler, Gary M.; Hornocker, Maurice G.; Hash, Howard S. 1979. Lynx movements and habitat use in Montana. The Canadian Field-Naturalist. 93(4): 441-442. [13706]
  • 80. Parker, G. R.; Maxwell, J. W.; Morton, L. D.; Smith, G. E. J. 1983. The ecology of the lynx (Lynx canadensis) on Cape Breton Island. Canadian Journal of Zoology. 61: 770-786. [66527]
  • 88. Quinn, Norman W. S.; Parker, Gerry. 1987. Lynx. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 683-694. [50683]
  • 96. Slough, Brian G. 1999. Characteristics of Canada lynx, Lynx canadensis, maternal dens and denning habitat. The Canadian Field-Naturalist. 113(4): 605-608. [65977]
  • 105. Thompson, I. D.; Davidson, I. J.; O'Donnell, S.; Brazeau, F. 1989. Use of track transects to measure the relative occurrence of some boreal mammals in uncut forest and regeneration stands. Canadian Journal of Zoology. 67: 1816-1823. [25256]
  • 119. Wisdom, Michael J.; Holthausen, Richard S.; Wales, Barbara C.; Hargis, Christina D.; Saab, Victoria A.; Lee, Danny C.; Hann, Wendel J.; Rich, Terrell D.; Rowland, Mary M.; Murphy, Wally J.; Eames, Michelle R. 2000. Source habitats for terrestrial vertebrates of focus in the interior Columbia basin: broad-scale trends and management implications. Volume 2--group level results. In: Quigley, Thomas M., ed. Interior Columbia Basin Ecosystem Management Project: scientific assessment. Gen. Tech. Rep. PNW-GTR-485. Vol. 2. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 157-434. [66653]
  • 122. Zebley, Dawn Marie. 1992. Lynx. Women in Natural Resources. 13(3): 24-25. [19297]
  • 4. Arno, Stephen F. 2000. Fire in western forest ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 97-120. [36984]
  • 6. Arno, Stephen F.; Gruell, George E. 1983. Fire history at the forest-grassland ecotone in southwestern Montana. Journal of Range Management. 36(3): 332-336. [342]
  • 9. Baisan, Christopher H.; Swetnam, Thomas W. 1990. Fire history on a desert mountain range: Rincon Mountain Wilderness, Arizona, U.S.A. Canadian Journal of Forest Research. 20: 1559-1569. [14986]
  • 112. Viereck, Leslie A.; Schandelmeier, Linda A. 1980. Effects of fire in Alaska and adjacent Canada--a literature review. BLM-Alaska Tech. Rep. 6; BLM/AK/TR-80/06. Anchorage, AK: U.S. Department of the Interior, Bureau of Land Management, Alaska State Office. 124 p. [28862]
  • 32. Duchesne, Luc C.; Hawkes, Brad C. 2000. Fire in northern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 35-51. [36982]
  • 49. Heinselman, Miron L. 1970. The natural role of fire in northern conifer forests. In: The role of fire in the Intermountain West: Symposium proceedings; 1970 October 27-29; Missoula, MT. Missoula, MT: Intermountain Fire Research Council: 30-41. In cooperation with: University of Montana, School of Forestry. [15735]
  • 113. Wade, Dale D.; Brock, Brent L.; Brose, Patrick H.; Grace, James B.; Hoch, Greg A.; Patterson, William A., III. 2000. Fire in eastern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 53-96. [36983]
  • 1. Agee, James K. 1994. Fire and weather disturbances in terrestrial ecosystems of the eastern Cascades. Gen. Tech. Rep. PNW-GTR-320. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 52 p. (Everett, Richard L., assessment team leader; Eastside forest ecosystem health assessment; Hessburg, Paul F., science team leader and tech. ed., Volume III: assessment). [23656]
  • 3. Arno, Stephen F. 1976. The historical role of fire on the Bitterroot National Forest. Res. Pap. INT-187. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 29 p. [15225]
  • 5. Arno, Stephen F.; Fischer, William C. 1995. Larix occidentalis--fire ecology and fire management. In: Schmidt, Wyman C.; McDonald, Kathy J., comps. Ecology and management of Larix forests: a look ahead: Proceedings of an international symposium; 1992 October 5-9; Whitefish, MT. Gen. Tech. Rep. GTR-INT-319. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 130-135. [25293]
  • 7. Arno, Stephen F.; Scott, Joe H.; Hartwell, Michael G. 1995. Age-class structure of old growth ponderosa pine/Douglas-fir stands and its relationship to fire history. Res. Pap. INT-RP-481. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 25 p. [25928]
  • 64. Laven, R. D.; Omi, P. N.; Wyant, J. G.; Pinkerton, A. S. 1980. Interpretation of fire scar data from a ponderosa pine ecosystem in the central Rocky Mountains, Colorado. In: Stokes, Marvin A.; Dieterich, John H., tech. coords. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 46-49. [7183]
  • 66. Loope, Walter L. 1991. Interrelationships of fire history, land use history, and landscape pattern within Pictured Rocks National Seashore, Michigan. The Canadian Field-Naturalist. 105(1): 18-28. [5950]
  • 21. Bull, Evelyn L.; Holthausen, Richard S. 1993. Habitat use and management of pileated woodpeckers in northeastern Oregon. Journal of Wildlife Management. 57(2): 335-345. [21302]
  • 27. Davis, Kathleen M. 1980. Fire history of a western larch/Douglas-fir forest type in northwestern Montana. In: Stokes, Marvin A.; Dieterich, John H., tech. coords. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 69-74. [12813]
  • 30. DellaSala, Dominick A.; Olson, David M.; Barth, Sara E.; Crane, Saundra L.; Primm, Steve A. 1995. Forest health: moving beyond rhetoric to restore healthy landscapes in the inland Northwest. Wildlife Society Bulletin. 23(3): 346-356. [26904]
  • 31. DeVos, Antoon; Matel, S. Eugene. 1952. The status of lynx in Canada, 1920-1952. Journal of Forestry. 50: 742-745. [13709]
  • 37. Foote, M. Joan. 1983. Classification, description, and dynamics of plant communities after fire in the taiga of interior Alaska. Res. Pap. PNW-307. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 108 p. [7080]
  • 38. Fox, John F. 1978. Forest fires and the snowshoe hare--Canada lynx cycle. Oecologia. 31: 349-374. [11099]
  • 39. Frissell, Sidney S., Jr. 1968. A fire chronology for Itasca State Park, Minnesota. Minnesota Forestry Research Notes No. 196. Minneapolis, MN: University of Minnesota. 2 p. [34527]
  • 44. Grange, Wallace. 1965. Fire and tree growth relationships to snowshoe rabbits. In: Proceedings, 4th Tall Timbers fire ecology conference; 1965 March 18-19; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 111-123. [13530]
  • 46. Gruell, G. E.; Loope, L. L. 1974. Relationships among aspen, fire, and ungulate browsing in Jackson Hole, Wyoming. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 33 p. In cooperation with: U.S. Department of the Interior, National Park Service, Rocky Mountain Region. [3862]
  • 50. Heinselman, Miron L. 1970. The natural role of fire in northern coniferous forests. The Naturalist. 21(4): 15-23. [34705]
  • 51. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 55. Keith, Lloyd B.; Surrendi, Dennis C. 1971. Effects of fire on a snowshoe hare population. Journal of Wildlife Management. 35(1): 16-26. [124]
  • 56. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Yukon Wildlife Branch: 1-36. [14071]
  • 68. Meinecke, E. P. 1929. Quaking aspen: A study in applied forest pathology. Tech. Bull. No. 155. Washington, DC: U.S. Department of Agriculture. 34 p. [26669]
  • 69. Morrison, Peter H.; Swanson, Frederick J. 1990. Fire history and pattern in a Cascade Range landscape. Gen. Tech. Rep. PNW-GTR-254. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 77 p. [13074]
  • 71. Mowat, Garth; Slough, Brian. 2003. Habitat preference of Canada lynx through a cycle in snowshoe hare abundance. Canadian Journal of Zoology. 81(10): 1736-1745. [65961]
  • 79. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1997. Selection of post-fire seres by lynx and snowshoe hares in the Alaskan taiga. Northwestern Naturalist. 78(3): 77-86. [66449]
  • 81. Paysen, Timothy E.; Ansley, R. James; Brown, James K.; Gottfried, Gerald J.; Haase, Sally M.; Harrington, Michael G.; Narog, Marcia G.; Sackett, Stephen S.; Wilson, Ruth C. 2000. Fire in western shrubland, woodland, and grassland ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 121-159. [36978]
  • 84. Pilliod, David S.; Bull, Evelyn L.; Hayes, Jane L.; Wales, Barbara C. 2006. Wildlife and invertebrate response to fuel reduction treatments in dry coniferous forests of the western United States: a synthesis. Gen. Tech. Rep. RMRS-GTR-173. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 34 p. [65071]
  • 86. Poole, Kim G.; Wakelyn, Leslie A.; Nicklen, Paul N. 1996. Habitat selection by lynx in the Northwest Territories. Canadian Journal of Zoology. 74(5): 845-850. [65982]
  • 89. Ripple, William J. 1994. Historic spatial patterns of old forests in western Oregon. Journal of Forestry. 92(11): 45-49. [33881]
  • 102. Swain, Albert M. 1978. Environmental changes during the past 2000 years in north-central Wisconsin: analysis of pollen, charcoal, and seeds from varved lake sediments. Quaternary Research. 10: 55-68. [6968]
  • 103. Tande, Gerald F. 1979. Fire history and vegetation pattern of coniferous forests in Jasper National Park, Alberta. Canadian Journal of Botany. 57: 1912-1931. [18676]
  • 104. Thomas, Jack Ward, technical editor. 1979. Wildlife habitats in managed forests in the Blue Mountains of Oregon and Washington. Agricultural Handbook No. 553. Washington, DC: U.S. Department of Agriculture, Forest Service. 512 p. [20293]
  • 115. Whelan, Robert J. 1995. Fire - the phenomenon. In: Whelan, Robert J., ed. The ecology of fire. Cambridge, UK: Cambridge University Press: 8-56. [52342]
  • 121. Wright, H. E., Jr.; Heinselman, M. L. 1973. Ecological role of fire. Quaternary Research. 3(3): 319-328. [36472]
  • 25. Cleland, David T.; Crow, Thomas R.; Saunders, Sari C.; Dickmann, Donald I.; Maclean, Ann L.; Jordan, James K.; Watson, Richard L.; Sloan, Alyssa M.; Brosofske, Kimberley D. 2004. Characterizing historical and modern FIRE REGIMES in Michigan (USA): a landscape ecosystem approach. Landscape Ecology. 19: 311-325. [54326]
  • 12. Barrett, Stephen W. 1993. FIRE REGIMES on the Clearwater and Nez Perce National Forests north-central Idaho. Final Report: Order No. 43-0276-3-0112. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 21 p. [41883]
  • 13. Barrett, Stephen W.; Arno, Stephen F.; Key, Carl H. 1991. FIRE REGIMES of western larch - lodgepole pine forests in Glacier National Park, Montana. Canadian Journal of Forest Research. 21: 1711-1720. [17290]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: litter, natural, parturition, phase

Mating: Canada lynxes mate in late March and early April [58,70,73,88,116]. It is unclear when females and males attain sexual maturity, but most research indicates that breeding does not occur until the second year of life [17,80,91]. On Cape Breton Island, Nova Scotia, most female Canada lynxes reached sexual maturity at 22 months. They were capable of conceiving as young as 9 months old; however, reproductive success depended on the abundance of snowshoe hares [80].

Reproductive success of Canada lynxes fluctuates in an approximate 10-year cyclical manner corresponding with the snowshoe hare cycle. During periods of snowshoe hare abundance, Canada lynx birth rates typically range from 73% to 93% for adults and 33% to 100% for yearlings [80,97]. One to two years following a snowshoe hare decline, the birth rate declines [97]. Adult females may continue to conceive but live births are few or none [80,97]. Of  3,130 adult female Canada lynx carcasses examined in the Yukon, Tanana, and Copper basins of Alaska, the number of Canada lynx placental scars/female decreased from 3.7 to 1.4 scars during a snowshoe hare decline phase [74].

Gestation period and litter size: Gestation is 60 to 65 days [59,73,91]. Typically, 1 or 2 kittens are born from May to July [58,73,91,96,116]. Yearling and adult lynxes may produce litters 6 weeks earlier than average during periods of snowshoe hare abundance [70]. In western Montana, litter size ranged from 1 to 5 kittens, with an average of 2.75 (n=20) [17]. During periods of snowshoe hare abundance, yearling Canada lynxes may experience increased reproductive rates, and all age classes of females produce larger litters [73,80] that average 4 to 5 kittens [97].

Development: Canada lynx kittens remain with their mother for 9 to 10 months following birth to nurse and learn how to hunt [23,58,80,97].

Social organization: Canada lynxes are generally solitary [11,28]; however, they may travel in groups consisting of a female with her kittens, 2 adult females with their kittens, or an adult female with an adult male during the breeding season [23,80]. An adult female may remain in contact with her offspring for the female's lifetime [23].

Habits: Canada lynxes are most active between dusk and dawn [28,91], and hide during the day [91]. They are active year-round [28].

Dispersal: Dispersal of Canada lynxes is characterized as juveniles dispersing from their natal area or as a response to snowshoe hare declines [85]. Kittens remain with their mother through their first winter, and natal dispersal occurs from late April to early May [97]. Maximum natal dispersal distance for females is 6.0 miles (9.7 km) [91]. Canada lynxes are capable of long-range exploratory movements of up to 600 miles (1,000 km) [97].

Mortality: Mortality of Canada lynxes is influenced primarily by the relative abundance of snowshoe hares and the amount of trapping by humans. During periods of snowshoe hare scarcity, starvation is the most significant cause of natural mortality for lynxes [58]. One year following a snowshoe hare decline near Whitehorse, Yukon, 90% (n=161) of the Canada lynx population was reduced due to starvation, dispersal, and a collapse in recruitment [97]. Female Canada lynxes may lose their litters shortly after parturition during food shortages [70]. The mean mortality rate of 8 Canada lynx kittens over 2 years in north-central Washington during a period of snowshoe hare scarcity was 88% [58]. Mortality for kittens may increase to 100% one to two years following a snowshoe hare decline [80,97]. During periods of snowshoe hare abundance, natural mortality of juvenile and adult Canada lynxes is low. Juvenile mortality may range from 17% to 50% [97].

Trapping may be a significant cause of mortality [23,97]. Mortality rates may range from 50% to 90% in areas where trapping of Canada lynxes is allowed [23,80] and 0% to 27% where Canada lynxes are protected [58]. Because yearling Canada lynxes are dependent on their mothers for survival, mortality may increase if their mothers are trapped [80] (see Trapping).

  • 11. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 17. Brainerd, Scott M. 1985. Reproductive ecology of bobcat and lynx in western Montana. Missoula, MT: University of Montana. 85 p. Thesis. [13704]
  • 23. Carbyn, L. N.; Patriquin, D. 1983. Observations on home range sizes, movements and social organization of lynx, Lynx canadensis, in Riding Mountain National Park, Manitoba. The Canadian Field-Naturalist. 97(3): 262-267. [65987]
  • 28. DeGraaf, Richard M.; Rudis, Deborah D. 2001. New England wildlife: habitat, natural history, and distribution. Hanover, NH: University Press of New England. 467 p. [21385]
  • 58. Koehler, Gary M. 1990. Population and habitat characteristics of lynx and snowshoe hares in north central Washington. Canadian Journal of Zoology. 68: 845-851. [18030]
  • 59. Koehler, Gary M.; Aubry, Keith B. 1994. Lynx. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 74-98. [29933]
  • 70. Mowat, Garth; Slough, Brian G. 1998. Some observations on the natural history and behaviour of the Canada lynx, Lynx canadensis. The Canadian Field-Naturalist. 112(1): 32-36. [65979]
  • 73. Nellis, Carl H.; Wetmore, Stephen P., Keith, Lloyd B. 1972. Lynx-prey interactions in central Alberta. Journal of Wildlife Management. 36(2): 320-328. [13711]
  • 74. O'Connor, Robin Mary. 1984. Population trends, age structure, and reproductive characteristics of female lynx in Alaska, 1961 through 1973. Fairbanks, AK: University of Alaska. 111 p. Thesis. [65986]
  • 80. Parker, G. R.; Maxwell, J. W.; Morton, L. D.; Smith, G. E. J. 1983. The ecology of the lynx (Lynx canadensis) on Cape Breton Island. Canadian Journal of Zoology. 61: 770-786. [66527]
  • 85. Poole, Kim G. 2003. A review of the Canada lynx, Lynx canadensis, in Canada. The Canadian Field-Naturalist. 117(3): 360-376. [65960]
  • 88. Quinn, Norman W. S.; Parker, Gerry. 1987. Lynx. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 683-694. [50683]
  • 91. Saunders, Jack K. 1963. Food habits of the lynx in Newfoundland. Journal of Wildlife Management. 27(3): 384-390. [13710]
  • 96. Slough, Brian G. 1999. Characteristics of Canada lynx, Lynx canadensis, maternal dens and denning habitat. The Canadian Field-Naturalist. 113(4): 605-608. [65977]
  • 97. Slough, Brian G.; Mowat, Garth. 1996. Lynx population dynamics in an untrapped refugium. Journal of Wildlife Management. 60(4): 946-961. [66461]
  • 116. Whitaker, John O., Jr. 1980. National Audubon Society field guide to North American mammals. New York: Alfred A. Knopf, Inc. 745 p. [25194]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Direct Effects of Fire

DIRECT FIRE EFFECTS ON ANIMALS:
There is no reported and probably no significant direct fire-related mortality for Canada lynxes.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Home range increases, and individuals may become nomadic, when prey is scarce (Ward and Krebs 1985, Saunders 1963, Mech 1980). Range of male (average often about 15-30 sq km, but up to hundreds of sq km in Alaska and Minnesota) is larger than that of female. Spatial organization observed prior to low hare densities in Northwest Territories may be described as a land-tenure system, based on prior residency, and may have served to regulate density during peak prey levels (Poole 1995). Long distance dispersal movements of up to several hundred kilometers have been recorded.

Population density usually is less than 10 (locally up to 20) per 100 sq km, depending on prey availability. Mean densities range between 2 and 9 per 100 sq km (McCord and Cardoza 1982).

Usually solitary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Lynx use their eyes, ears and noses in communicating. They also use their voices, and can make calls to one another. Touching may happen in mating and between a mother and her kittens.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Communication and perception are probably similar to that of other cats. In addition to having good vision to facilitate hunting, these animals have excellent hearing. Scents are probably used in marking territories. Tactile communication is likely to occur between mates, as well as between mothers and their offspring. Communication through vocalizations occurs as well.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Mainly nocturnal. Most active from 2 hours after sunset to one hour after sunrise (Banfield 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, lynx have lived as long as 14.5 years. In captivity, lifespans of 26.75 years have been recorded.

Range lifespan

Status: wild:
14.5 (high) years.

Range lifespan

Status: captivity:
26.75 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

In the wild, lynx have lived as long as 14.5 years. In captivity, lifespans of 26.75 years have been recorded.

Range lifespan

Status: wild:
14.5 (high) years.

Range lifespan

Status: captivity:
26.75 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.8 years (captivity) Observations: One wild born specimen was about 26.8 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

We are not exactly certain how these animals mate. Since males share their home ranges with one or more females, it seems likely that they are polygynous.

Females raise one litter per year. After mating in February and March, females are pregnant for 8 to 10 weeks. Litters typically have 2 or 3 kittens, though the number may range from 1 to 5. Newborn lynx kittens weigh about 200 g. They feed mainly on their mother's milk for 5 months, but kittens eat some meat as early as one month of age.

Males do not take care of the young. Kittens live with their mother until they are about 11 months old, and siblings may stay together for a while even after they leave their mother. Females can reproduce at 21 months and males at 33 months.

Breeding interval: Lynx can breed once per year.

Breeding season: Breeding occurs in January and February.

Range number of offspring: 1 to 6.

Average number of offspring: 2.

Range gestation period: 56 to 70 days.

Average weaning age: 150 days.

Average time to independence: 10 months.

Average age at sexual or reproductive maturity (female): 21 months.

Average age at sexual or reproductive maturity (male): 33 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 204 g.

Average number of offspring: 3.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
573 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
498 days.

Females have their babies in fallen logs, stumps, and clumps of timber. Dens in these places help to protect the newborn kittens from predators.

Mothers take care of kittens without help from males. Kittens are helpless at birth, but have a lot of fur to keep them warm. Mothers nurse their kittens for about 5 months. When they no longer drink milk, the kittens live on a diet of meat. Mothers may teach their young how to hunt for meat. Sometimes, two lynx may cooperate in catching a prey animal.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The mating system of these animals is not reported. However, female home ranges are usually encompassed by the home range of a male, and the home ranges of multiple females may overlap. This distribution, in conjuction with the slight sexual dimorphism, indicate that the species is probably polygynous.

Females enter estrus only once per year and raise one litter per year. Estrus lasts 1 to 2 days. Mating in February and March is folowed by a gestation period of from 8 to 10 weeks. Litters typically have 2 or 3 kittens, though the number may range from 1 to 5. Lynx weigh about 200 g at birth. Lactation lasts for 5 months, although kittens eat some meat as early as one month of age.

Males do not participate in parental care. Young remain with the mother until the following winter's mating season, and siblings may remain together for a while after separation from the mother. Females reach sexual maturity at 21 months and males at 33 months.

Breeding interval: Lynx can breed once per year.

Breeding season: Breeding occurs in January and February.

Range number of offspring: 1 to 6.

Average number of offspring: 2.

Range gestation period: 56 to 70 days.

Average weaning age: 150 days.

Average time to independence: 10 months.

Average age at sexual or reproductive maturity (female): 21 months.

Average age at sexual or reproductive maturity (male): 33 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 204 g.

Average number of offspring: 3.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
573 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
498 days.

Females give birth to their young in fallen logs, stumps, clumps of timber, or similar tangles of roots and branches. This, one assumes, helps to protect the young from potential predators.

All parental care is provided by females. Young are altricial at birth, but have well-developed pelage. Nursing lasts for about 5 months, after which the young eat prey. Mothers may help to educate their young in hunting techniques, and cooperative hunting has been observed.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in late winter-early spring in North America. Gestation lasts 62-74 days. Litter size averages 3-4; adult females produce one litter every 1-2 years. Young stay with mother until next mating season or longer. Some females give birth as yearlings, but their pregnancy rate is lower than that of older females (Brainerd 1985). Prey scarcity suppresses breeding and may result in mortality of nearly all young (Brand and Keith 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lynx canadensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACCGCTGATTATTTTCAACTAATCACAAAGATATTGGCACTCTCTACCTTTTATTTGGTGCCTGGGCCGGTATGGTAGGGACTGCTCTCAGCCTCCTGATCCGAGCCGAACTAGGTCAACCTGGTACATTATTAGGAGAC---GACCAGATTTACAATGTAATCGTCACCGCCCACGCTTTTGTAATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGGTTCGGGAACTGATTGGTCCCATTAATAATTGGAGCCCCTGACATAGCATTTCCCCGAATGAACAATATAAGCTTCTGACTTCTTCCTCCATCCTTTCTGCTTCTACTTGCTTCGTCCATAGTGGAGGCGGGAGCAGGAACTGGGTGAACGGTATATCCACCCCTAGCCGGTAACCTGGCTCATGCAGGAGCATCCGTGGATTTAACCATCTTCTCACTCCACCTGGCAGGTGTTTCTTCAATCTTGTGTGCTATTATCTTTATTACCACTATTATTAATATAAAACCCCCTGCTATGATCCGAATACAAACACCTCTATTGTTATGGTCAGTTCTAATTACTGCAGTTCTACTACTCCTATCACTCCCAGTTTTAGCAGCAGGAATTACCATGCTACTAACAGATCGAAATTTAAACACCACATTCTTTGATCCTGCTGGAGGAGGGGATCCCATTTTATACCAGCACTTATTCTGATTCTTTGGTCACCCAGAGGTCTACATCCTAATTCTACCTGGCTTTGGAATAATCTCACACATTGTTACCTATTATTCAGGTAAAAAAGAACCCTTTGGCTACATGGGAATAGTTTGAGCTATAATATCAATCGGCTTCCTGGGCTTTATCGTATGAGCCCATCACATGTTTACTGTGGGGATGGATGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lynx canadensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

U.S. Federal Legal Status

Threatened in Mountain-prairie region; Candidate species in New Mexico [107]
  • 107. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lynx are listed in CITES Appendix II, and they are listed as threatened by the U.S. Fish and Wildlife Service and endangered in the state of Michigan.

IUCN Red List of Threatened Species: least concern

US Federal List: threatened

CITES: appendix ii

State of Michigan List: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Nowell, K.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because the Canada lynx is widespread and abundant over most of its range, where it is legally harvested for the international fur trade for hundreds of years, and recent decades of managed harvests do not appear to have caused any significant decline or range loss (Mowat et al. 2000). In the southern part of its range, it is considered Endangered in New Brunswick, Canada, and of "Special Concern" in Nova Scotia (Parker 2001). In the contiguous US, it is listed as Threatened under the Endangered Species Act and critical habitat is being designated for conservation management (US FWS 2008).

History
  • 2002
    Least Concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lynx are listed in CITES Appendix II, and they are listed as threatened by the U.S. Fish and Wildlife Service and endangered in the state of Michigan.

US Federal List: threatened

CITES: appendix ii

State of Michigan List: endangered

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in northern North America; declines have occurred in some populations, but apparently still widespread and relatively abundant in most of historic range, though population data are lacking for many areas; habitat loss/fragmentation and susceptibility to overharvest are the major concerns.

In the contiguous U.S., overall numbers and range are substantially reduced from historical levels. At present, numbers have not recovered from overexploitation by both regulated and unregulated harvest that occurred in the 1970s and 1980s. Forest management practices that result in the loss of diverse age structure, fragmentation, roading, urbanization, agriculture, recreational developments, and unnatural fire frequencies have altered suitable habitat in many areas. As a result, many states may have insufficient habitat quality and/or quantity to sustain lynx or their prey. Human access into habitat has increased dramatically over the last few decades contributing to direct and indirect mortality and displacement from suitable habitat. Although legal take is highly restricted, existing regulatory mechanisms may be inadequate to protect small, remnant populations or to conserve habitat. Competition with bobcats and coyotes may be a concern in some areas.

Other Considerations: See EGR for coterminous United States population (Lynx canadensis POP 1).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 03/24/2000
Lead Region:   Mountain-Prairie Region (Region 6)   
Where Listed: (Contiguous U.S. DPS)

Status: Candidate
Date Listed:
Lead Region:   Mountain-Prairie Region (Region 6)   
Where Listed: NM population


For most current information and documents related to the conservation status and management of Lynx canadensis, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Canada lynx is primarily found in Canada, where it is managed and trapped for its fur. It is considered endangered only in New Brunswick, and has been extirpated from Prince Edward Island and maiinland Nova Scotia (Nowell and Jackson 1996, Parker 2001). In the US, the Canada lynx is abundant in Alaska, but in the "Lower 48" states populations are small and threatened. Lynx were reintroduced apparently unsuccessfully in northern New York state in the late 1980s, and more recently, apparently successfully, in Colorado (Sunquist and Sunquist 2002).

In the northern parts of their range, lynx populations undergo dramatic fluctuations roughly every ten years, following apparently regular cycles of increase and decline of their primary prey, the snowshoe hare Lepus americanus, a pattern evident in lynx fur trade records dating back to the early 1800s (Nowell and Jackson 1996). In the southern parts, lynx and hares appear to maintain a relatively stable but low density (Parker 2001).

Schwartz et al. (2003) documented reduced genetic variation in lynx populations from the peripheral areas of its distribution.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In most of Canada and the US state of Alaska, trapping of Canada lynx is managed for the fur trade. Trapping can reduce lynx populations and have the greatest impact when hare populations cyclically crash. In response to concerns about over-harvest during the cyclic low of the lynx-hare cycle in the 1980s, most Canadian provinces and Alaska implemented management measures which led to reduced harvests (Mowat et al. 2000). In the early 1980 (1980-1984), an average of 35,669 Canada lynx pelts were exported from the US and Canada. That fell to in the late 1980s (1986-1989) to an average annual export of 7,360. Exports have trended lower and fluctuated less severely since then, with annual exports from 2000-2006 averaging 15,387 (UNEP-WCMC 2008). Historical information suggests that, despite minimal harvest controls for much of the last century, lynx-hare cycles have been largely stable in the northern part of their range and no permanent range decrease has been detected (Mowat et al. 2000, Poole 2003).

In eastern Canada where lynx are rare and protected, the primary threat is considered to be interspecific competition from the eastern coyote, which expanded its range into eastern North America in the last few decades (Parker 2001).

In the contiguous US, the primary threat is habitat fragmentation. Logging practices and fire suppression can reduce hare and lynx abundance. Lynx are also threatened by interspecific competition from other predators whose populations have increased in recent decades, and may be killed accidentally in snares set for other species, or on roads. Maintenance of connectivity with the abundant northern population is considered essential for recovery (Ruediger et al. 2000, Nordstrom 2005). Hybridization with bobcats has been found by genetic analysis in Minnesota (Schwartz et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: In determining threatened status for the contiguous U.S. distinct population segment, USFWS (2000) cited the inadequacy of existing regulatory mechanisms. "Current U.S. Forest Service Land and Resource Management Plans include programs, practices, and activities within the authority and jurisdiction of federal land management agencies that may threaten lynx or lynx habitat. The lack of protection for lynx in these plans render[s] them inadequate to protect the species" (USFWS 2000). Past extensive logging that eliminated habitat for lynx and snowshoe hare was detrimental. Habitat has been lost due to suppression of forest fires and ecological succession to habitats that no longer support snowshoe hare and lynx. Fragmentation, due to forestry, agriculture, and roads, and the subsequent isolation of suitable habitat is a concern. Lack of immigration from Canadian lynx populations is an important factor in some regions. Past excessive trapping of lynx (as recently as the 1970s and 1980s) depressed populations and may have been detrimental to local lynx populations in Washington (see U.S. Forest Service et al. 1993) and elsewhere (U.S. Fish and Wildlife Service 1998). Road construction causes habitat fragmentation and allows increased human access into lynx habitat; this may increase lynx mortality by facilitating access to hunters and trappers (although there is no legal harvest except for two lynx per year in Montana); incidental harvest of lynx in the course of legal trapping/hunting for other species may be a problem in some areas. Increased winter recreation (snowmobiles, ski area development) may be causing displacement and/or incidental mortality of lynx. Habitat changes and increased access into lynx habitats has resulted in increased competition and displacement of lynx by bobcat and coyote in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the term: natural

Canada lynxes require large habitats containing a mosaic of successional stages [2,38,60,80,86,88,121,121]. Early and midsuccessional stages of habitat are necessary to maintain populations of snowshoe hares and Canada lynxes [31,51,58,60,71,86,88]. Burned areas that are approximately 30 years old with unburned inclusions of mature forest generally provide optimal habitat for the foraging and denning requirements of Canada lynxes [36,36,37,56,58,60,61,80,96,105]. To mimic a natural disturbance such as fire, frequent habitat alteration via small patches of clearcuts [45,65,80] or burning small patches may be beneficial [59].
  • 2. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 36. Fisher, Jason T.; Wilkinson, Lisa. 2005. The response of mammals to forest fire and timber harvest in the North American boreal forest. Mammal Review. 35(1): 51-81. [55373]
  • 45. Griffin, Paul C.; Mills, L. Scott. 2007. Precommercial thinning reduces snowshoe hare abundance in the short term. The Journal of Wildlife Management. 71(2): 559-564. [66706]
  • 58. Koehler, Gary M. 1990. Population and habitat characteristics of lynx and snowshoe hares in north central Washington. Canadian Journal of Zoology. 68: 845-851. [18030]
  • 59. Koehler, Gary M.; Aubry, Keith B. 1994. Lynx. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 74-98. [29933]
  • 60. Koehler, Gary M.; Brittell, J. David. 1990. Managing spruce-fir habitat for lynx and snowshoe hares. Journal of Forestry. 88(10): 10-14. [13599]
  • 61. Koehler, Gary M.; Hornocker, Maurice G.; Hash, Howard S. 1979. Lynx movements and habitat use in Montana. The Canadian Field-Naturalist. 93(4): 441-442. [13706]
  • 65. Litvaitis, John A.; Sherburne, James A.; Bissonette, John A. 1985. Influence of understory characteristics on snowshoe hare habitat use and density. Journal of Wildlife Management. 49(4): 866-873. [19878]
  • 80. Parker, G. R.; Maxwell, J. W.; Morton, L. D.; Smith, G. E. J. 1983. The ecology of the lynx (Lynx canadensis) on Cape Breton Island. Canadian Journal of Zoology. 61: 770-786. [66527]
  • 88. Quinn, Norman W. S.; Parker, Gerry. 1987. Lynx. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 683-694. [50683]
  • 96. Slough, Brian G. 1999. Characteristics of Canada lynx, Lynx canadensis, maternal dens and denning habitat. The Canadian Field-Naturalist. 113(4): 605-608. [65977]
  • 105. Thompson, I. D.; Davidson, I. J.; O'Donnell, S.; Brazeau, F. 1989. Use of track transects to measure the relative occurrence of some boreal mammals in uncut forest and regeneration stands. Canadian Journal of Zoology. 67: 1816-1823. [25256]
  • 31. DeVos, Antoon; Matel, S. Eugene. 1952. The status of lynx in Canada, 1920-1952. Journal of Forestry. 50: 742-745. [13709]
  • 37. Foote, M. Joan. 1983. Classification, description, and dynamics of plant communities after fire in the taiga of interior Alaska. Res. Pap. PNW-307. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 108 p. [7080]
  • 38. Fox, John F. 1978. Forest fires and the snowshoe hare--Canada lynx cycle. Oecologia. 31: 349-374. [11099]
  • 51. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 56. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Yukon Wildlife Branch: 1-36. [14071]
  • 71. Mowat, Garth; Slough, Brian. 2003. Habitat preference of Canada lynx through a cycle in snowshoe hare abundance. Canadian Journal of Zoology. 81(10): 1736-1745. [65961]
  • 86. Poole, Kim G.; Wakelyn, Leslie A.; Nicklen, Paul N. 1996. Habitat selection by lynx in the Northwest Territories. Canadian Journal of Zoology. 74(5): 845-850. [65982]
  • 121. Wright, H. E., Jr.; Heinselman, M. L. 1973. Ecological role of fire. Quaternary Research. 3(3): 319-328. [36472]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the term: cover

Due to their dependence on snowshoe hares, management practices that benefit snowshoe hares will benefit Canada lynxes [80]. This includes maintaining early to midsuccessional habitats [36,58,60,61,80,105,122]. These habitats should be adjacent to mature forests containing coarse woody debris for denning and raising kittens [2,18,20,29,42,58,60,80,119] (see Preferred Habitat). Trapping of Canada lynxes should be flexible, based on the approximate 10-year snowshoe hare-Canada lynx population cycle [80,97] (see Trapping). Management of Canada lynxes in southern latitudes may need to differ from management in northern latitudes, due to the lack of dramatic fluctuations in Canada lynx and snowshoe hare populations in southern populations [59].

There is high gene flow among Canada lynxes despite geographic separation of distances up to 1,926 miles (3,100 km), so management should focus on maintaining connectivity of habitat within the core of the Canada lynx's geographic range [74,92]. Slough and Mowat [97] recommend a minimum effective size of 500 km² of high-quality habitat for a Canada lynx refugium during years when home range sizes for males and females do not fluctuate widely. Coordinating management across multiple ownerships is needed to prevent fragmentation of Canada lynx habitat. For detailed information about providing appropriate habitat to maintain Canada lynx populations, see the website on Canada lynx conservation and assessment strategy.

Silviculture: In intensively managed forests, even-aged regenerating forest stands should be interspersed with mature forest to provide quality habitat for the Canada lynx [2,53,88]. To produce diverse habitat, stripcutting or blockcutting may benefit Canada lynxes in boreal forests [88]. If maximizing the preharvest mammalian community is a management goal, the rate of successional convergence to mature forest may be increased by doing the following: 1) leave "moderate" amounts of downed woody matter in the harvested area; 2) leave snags and dead wood in close proximity to live trees to form clumps; and 3) leave >30% of mature trees as clumped residuals in harvested areas [36].

A short-term result of clearcutting is reducing snowshoe hare and Canada lynx densities [36,80]. In the long term, snowshoe hare abundance generally increases in clearcut areas due to an increase in browse plants and cover [36,58,60,61,80,105,122]. Clearcuts ≤15 years old probably have minimal value to Canada lynxes and snowshoe hares [80] and may not be optimal habitat for either species for 30 years [59]. In Maine, snowshoe hares did not recolonize spruce-fir habitat until 6 to 7 years following clearcutting, and populations peaked 20 to 25 years following clearcutting [65]. Large clearcuts may potentially act as barriers to Canada lynx movement [59]. Parker and others [80] recommend keeping clearcuts relatively small and maintaining a mosaic of clearcuts with mature forest and uneven-aged forest stands.

Recent trends away from clearcutting to partial harvest in northern Maine may negatively affect densities of snowshoe hares and Canada lynxes due to their preference for even-aged forests that regenerate after clearcutting or fire. More research is needed to examine the effects of specific types of partial harvest on the Canada lynx [53].

In west-central Alberta, Canada lynxes would likely benefit from short-rotation harvesting of quaking aspen [83].

Precommercial thinning decreased snowshoe hare abundance in forests dominated by lodgepole pine, subalpine fir, Engelmann spruce, and western larch (Larix occidentalis) in western Montana. This silvicultural practice may lead to an ecologically significant loss of prey available to the Canada lynx. When managing forests for high snowshoe hare abundance, the authors suggest a precommercial thinning method in which 20% of the total stand is retained in uncut 0.62 acre (0.25 ha) patches [45].

Coarse woody debris: Logs and upturned stumps in mature forests are important denning sites for the Canada lynx [18,19,20,29,42,96,119] (see Preferred Habitat). A lack of suitable den sites may reduce Canada lynx recruitment [96]. Forest thinning and salvage logging reduce the availability of coarse woody debris for denning Canada lynxes. They may also reduce the abundance of some prey species, which could be "detrimental" to Canada lynxes [20]. Snowshoe hares also utilize coarse woody debris for denning [22].

Trapping: Trapping is a major cause of Canada lynx mortality in some parts of Canada. However, due to high fecundity, especially following periods of increasing snowshoe hare availability, populations of Canada lynxes may increase rapidly [97].

An important factor in the management of Canada lynx is the vulnerability of family groups to trapping (see Development) [23]. If adult females accompanied by kittens are trapped, orphaned kittens may die of starvation [23]. During periods of prey scarcity, in which kitten survival is low, Canada lynx populations may decrease substantially due to starvation and trapping [15,23,80]. Slough and Mowat [97] and Parker and others [80] suggest restricting trapping during early winter to avoid removing adult females from their kittens.

Parker and others [80] suggest flexible harvest regulations. Controlled trapping should be limited to years of high population recruitment to reduce overexploitation. This is crucial where habitat and immigration from unexploited populations is limited [80]. A closed season should be considered during periods of low snowshoe hare densities [80].
  • 2. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 15. Berrie, Peter M. 1973. Ecology and status of the lynx in interior Alaska. In: Eaton, Randall L., ed. The world's cats: Vol. 1--Ecology and conservation. Winston, OR: World Wildlife Safari: 4-41. [65989]
  • 18. Brown, Timothy K. 2002. Creating and maintaining wildlife, insect, and fish habitat structures in dead wood. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 883-892. [44408]
  • 19. Bull, Evelyn L. 2002. The value of coarse woody debris to vertebrates in the Pacific Northwest. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 171-178. [44352]
  • 20. Bull, Evelyn L.; Aubry, Keith B.; Wales, Barbara C. 2001. Effects of disturbance on forest carnivores of conservation concern in eastern Oregon and Washington. Northwest Science. 75: 180-184. [43073]
  • 22. Bunnell, Fred L.; Houde, Isabelle; Johnston, Barb; Wind, Elke. 2002. How dead trees sustain live organisms in western forests. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 291-318. [44365]
  • 23. Carbyn, L. N.; Patriquin, D. 1983. Observations on home range sizes, movements and social organization of lynx, Lynx canadensis, in Riding Mountain National Park, Manitoba. The Canadian Field-Naturalist. 97(3): 262-267. [65987]
  • 29. DeGraaf, Richard M; Shigo, Alex L. 1985. Managing cavity trees for wildlife in the Northeast. Gen. Tech. Rep. NE-101. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 21 p. [13481]
  • 36. Fisher, Jason T.; Wilkinson, Lisa. 2005. The response of mammals to forest fire and timber harvest in the North American boreal forest. Mammal Review. 35(1): 51-81. [55373]
  • 42. Gilbert, Brian A.; Pierce, Wade. 2005. Predicting the availability of understory structural features important for Canadian lynx denning habitat on managed lands in northeastern Washington lynx ranges. Western Journal of Applied Forestry. 20(4): 224-227. [66456]
  • 45. Griffin, Paul C.; Mills, L. Scott. 2007. Precommercial thinning reduces snowshoe hare abundance in the short term. The Journal of Wildlife Management. 71(2): 559-564. [66706]
  • 53. Hoving, Christopher L.; Harrison, Daniel J.; Krohn, William B.; Jakubas, Walter J.; McCollough, Mark A. 2004. Canada lynx (Lynx canadensis) habitat and forest succession in northern Maine, USA. Wildlife Biology. 10(4): 285-294. [65958]
  • 58. Koehler, Gary M. 1990. Population and habitat characteristics of lynx and snowshoe hares in north central Washington. Canadian Journal of Zoology. 68: 845-851. [18030]
  • 59. Koehler, Gary M.; Aubry, Keith B. 1994. Lynx. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 74-98. [29933]
  • 60. Koehler, Gary M.; Brittell, J. David. 1990. Managing spruce-fir habitat for lynx and snowshoe hares. Journal of Forestry. 88(10): 10-14. [13599]
  • 61. Koehler, Gary M.; Hornocker, Maurice G.; Hash, Howard S. 1979. Lynx movements and habitat use in Montana. The Canadian Field-Naturalist. 93(4): 441-442. [13706]
  • 65. Litvaitis, John A.; Sherburne, James A.; Bissonette, John A. 1985. Influence of understory characteristics on snowshoe hare habitat use and density. Journal of Wildlife Management. 49(4): 866-873. [19878]
  • 74. O'Connor, Robin Mary. 1984. Population trends, age structure, and reproductive characteristics of female lynx in Alaska, 1961 through 1973. Fairbanks, AK: University of Alaska. 111 p. Thesis. [65986]
  • 80. Parker, G. R.; Maxwell, J. W.; Morton, L. D.; Smith, G. E. J. 1983. The ecology of the lynx (Lynx canadensis) on Cape Breton Island. Canadian Journal of Zoology. 61: 770-786. [66527]
  • 83. Peterson, E. B.; Peterson, N. M. 1992. Ecology, management, and use of aspen and balsam poplar in the prairie provinces, Canada. Special Report 1. Edmonton, AB: Forestry Canada, Northwest Region, Northern Forestry Centre. 252 p. [22689]
  • 88. Quinn, Norman W. S.; Parker, Gerry. 1987. Lynx. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 683-694. [50683]
  • 92. Schwartz, Michael K.; Mills, L. Scott; McKelvey, Kevin S.; Ruggiero, Leonard F.; Allendorf, Fred W. 2002. DNA reveals high dispersal synchronizing the population dynamics of Canada lynx. Nature. 415(6871): 520-522. [66455]
  • 96. Slough, Brian G. 1999. Characteristics of Canada lynx, Lynx canadensis, maternal dens and denning habitat. The Canadian Field-Naturalist. 113(4): 605-608. [65977]
  • 97. Slough, Brian G.; Mowat, Garth. 1996. Lynx population dynamics in an untrapped refugium. Journal of Wildlife Management. 60(4): 946-961. [66461]
  • 105. Thompson, I. D.; Davidson, I. J.; O'Donnell, S.; Brazeau, F. 1989. Use of track transects to measure the relative occurrence of some boreal mammals in uncut forest and regeneration stands. Canadian Journal of Zoology. 67: 1816-1823. [25256]
  • 119. Wisdom, Michael J.; Holthausen, Richard S.; Wales, Barbara C.; Hargis, Christina D.; Saab, Victoria A.; Lee, Danny C.; Hann, Wendel J.; Rich, Terrell D.; Rowland, Mary M.; Murphy, Wally J.; Eames, Michelle R. 2000. Source habitats for terrestrial vertebrates of focus in the interior Columbia basin: broad-scale trends and management implications. Volume 2--group level results. In: Quigley, Thomas M., ed. Interior Columbia Basin Ecosystem Management Project: scientific assessment. Gen. Tech. Rep. PNW-GTR-485. Vol. 2. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 157-434. [66653]
  • 122. Zebley, Dawn Marie. 1992. Lynx. Women in Natural Resources. 13(3): 24-25. [19297]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Included on CITES Appendix II. In Canada, the national and provincial governments manage harvests by region (Govt of US 2007b), using closed seasons, quotas, limited entry and long-term trapping concessions (Nowell and Jackson 1996). In the US, trapping takes place only in Alaska, and harvest quotas are increased during periods of population increase and decreased during periods of cyclic decline (Govt of US 2007b).

The population of the contiguous US was listed as Threatened under the Endangered Species Act in 2000, requiring the US government to develop a recovery plan and identify critical habitat for lynx (Nordstrom 2005). Critical habitat designations only apply to federal lands or federally funded or permitted activities on private lands, but not to private activities on private lands. This designation gives the federal government the authority to manage activities that affect the designated habitat. In February 2008, the US Fish and Wildlife Service proposed a revised designation of critical habitat of 42,753 square miles of critical lynx habitat as follows:

Maine: Approximately 10,633 square miles in portions of Aroostook, Franklin, Penobscot, Piscataquis and Somerset Counties.

Minnesota: Approximately 8,226 square miles in portions of Cook, Koochiching, Lake, and St. Louis Counties, and Superior National Forest.

Northern Rocky Mountains: Approximately 11,304 square miles in portions of Boundary County in Idaho; and Flathead, Glacier, Granite, Lake, Lewis and Clark, Lincoln, Missoula, Pondera, Powell and Teton Counties in Montana. This area includes the Flathead Indian Reservation, National Forest lands and Bureau of Land Management (BLM) lands in the Garnet Resource Area.

North Cascades: Approximately 2,000 square miles in portions of Chelan and Okanogan Counties which includes BLM lands in the Spokane District.

Greater Yellowstone Area: Approximately 10,590 square miles in Gallatin, Park, Sweetgrass, Stillwater, and Carbon Counties in Montana; and Park, Teton, Fremont, Sublette, and Lincoln Counties in Wyoming.

The Kettle range of Washington state was not included due to lack of recent evidence of reproduction, and the reintroduced population of Colorado and Utah in the southern Rockies was also not included due to lack of evidence that it is self-sustaining. The designation is proposed but not final, and significantly increases a 2006 designation of 1,841 square miles of critical habitat for the lynx within the boundaries of Voyagers National Park in Minnesota, Glacier National Park in Montana, and North Cascades National Park in Washington (US FWS 2008).

To reduce accidental taking of lynx in traps set for other furbearers, the Fish and Wildlife Service has recommended various measures to trappers (e.g., avoid using hares or rabbits as bait) (Goldman and Krauze 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Trapping may be major source of mortality; such mortality is in addition to natural mortality during times of low hare abundance and low recruitment (Brittell et al. 1989). Refugia not subject to trapping may be important in maintaining populations during periods of low recruitment (Ward and Krebs 1985).

For the Pacific Northwest, U.S. Forest Service et al. (1993) recommended the following actions within known lynx range: (1) minimizing road construction, closing unused roads, and maintaining roads to the minimum standard possible, (2) using prescribed fire to maintain forage for snowshoe hare in juxtaposition with hunting cover for lynx, (3) designating areas to be closed to kill trapping of any furbearer to avoid incidental lynx mortality to maintain population refugia for lynx in key areas, (4) planning for kill-trapping closure on a wider basis if data indicate a declining lynx population as a result of incidental trapping mortality, and (5) developing and implementing a credible survey and monitoring stretegy to determine the distribution of lynx throughout its potential range.

Management Research Needs: Develop accurate and reliable population size and trend indices.

Initiate intensive long-term studies of populations with known sex and age structure, reproductive activities, home ranges, habitat use, food habits, trends in prey species and interactions with other predators; such areas should then be tested with closely regulated harvest programs to determine optimal management strategies (McCord and Cardoza 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Managed in some states and provinces as a furbearer species with no harvest allowed. In the U.S., only Montana currently allows a regulated harvest (quota of two lynx statewide as of 1997-1998 harvest season); fully protected in all other states; protected in national parks.

Needs: Protect from overharvest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Canadian lynx are not known to have a negative impact on human economies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Canadian lynx have been exploited for their fur since the seventeenth century. With restrictions on trade in furs of large cats in the late 1960's, and subsequent reduction of ocelot and margay populations by fur trappers, increased attention has been focused on the pelts of Canadian lynx. However, it seems that the greatest pressure on populations of lynx remains the size of hare populations, not trappers. Lynx help control populations of small mammals, such as snowshoe hares and voles, that are agricultural or silvicultural pests.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Canadian lynx are not known to have a negative impact on human economies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Canadian lynx have been exploited for their fur since the seventeenth century. With restrictions on trade in furs of large cats in the late 1960's, and subsequent reduction of ocelot and margay populations by fur trappers, increased attention has been focused on the pelts of Canadian lynx. However, it seems that the greatest pressure on populations of lynx remains the size of hare populations, not trappers. Lynx help control populations of small mammals, such as snowshoe hares and voles, that are agricultural or silvicultural pests.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Canada lynx

The Canada lynx (Lynx canadensis) or Canadian lynx is a North American mammal of the cat family, Felidae. It is a close relative of the Eurasian Lynx (Lynx lynx). However, in some characteristics the Canada lynx is more like the bobcat (Lynx rufus) than the Eurasian Lynx. With the recognised subspecies, it ranges across Canada and into Alaska as well as some parts of the northern United States.

With a dense silvery-brown coat, ruffed face and tufted ears, the Canada lynx resembles the other species of the mid-sized Lynx genus. It is larger than the bobcat, with which it shares parts of its range, and over twice the size of the domestic cat.

Contents

Taxonomy [edit]

There had been debates over whether to classify this species as Lynx canadensis or Felis canadensis, part of a wider issue regarding whether the four species of lynx should be given their own genus, or be placed as a subgenus of Felis,[4][5] but the Lynx genus is now accepted. Johnson et al. report that Lynx shared a clade with the Puma, leopard cat (Prionailurus bengalensis), and domestic cat (Felis) lineages, dated to 7.15 Ma; Lynx diverged first, approximately 3.24 Ma.[6]

Subspecies [edit]

Three subspecies of the Canada lynx are currently recognised:

Physical characteristics [edit]

Comparative illustration of bobcat (top) and Canada lynx (bottom) heads (1906)
Canada lynx

The appearance of the Canada lynx is similar to that of the Eurasian lynx: the dense fur is silvery brown and may bear blackish markings. In summer, its coat takes on a more reddish brown color. It has a furry ruff which resembles a double-pointed beard, a short tail with a black tip, and long furry tufts on its ears. Its long legs with broad furred feet aid in traveling through deep snow.

It is smaller than its Eurasian cousin, at an average weight of 8 to 11 kg (18 to 24 lb), 80 to 105 cm (31 to 41 in) in length, and a shoulder height of 48 to 56 cm (19 to 22 in). Males are larger than females. Although the species is larger on average than the bobcat, it is less variable in size and the largest bobcat outsize the lynx.[7]

Like all lynx, it has 28 teeth, with four long canines for puncturing and gripping. The lynx can feel where it is biting the prey with its canines because they are heavily laced with nerves. The lynx also has four carnassials that cut the meat into small pieces. In order for the lynx to use its carnassials, it must chew the meat with its head to its side. There are large spaces between the four canines and the rest of the teeth, and a reduced number of premolars, to ensure that the bite goes as deeply as possible into the prey.[8]

Adaptations that lynx have for manoeuvering through the deep snow are feet with a large gap between the first and second toes and their big toe set at a wide angle which gives them a better vicelike grip on the snow.

Behaviour [edit]

The Canada lynx is a secretive and mostly nocturnal animal, although it may be active at any time of day. They shelter in areas of particularly dense forest. In regions where their range overlaps with that of other predators, such as bobcats and coyotes, they tend to hunt in areas with deeper snow cover, or at higher altitudes. The cat tends to stay within 100 yards (91 m) of the treeline, but does not shy away from swimming. One account records a lynx swimming two miles across the Yukon River.[9]

Although normally solitary, at times small groups may be observed traveling together. The lynx roam about 1.5 to 3 mi (2.4 to 4.8 km) each day, and thus require a large territory. Typical home ranges are between 15 and 50 km2 (5.8 and 19 sq mi), but are highly variable, with extremes from 3 to 783 km2 (1.2 to 302 sq mi) having been reported. When food becomes scarce, the lynx territory will increase; most of the population will roam far, with a select few staying behind in their original territory.[10]

Like other cats, Canada lynx use scent marking to indicate their territory. Adults typically deposit faeces on top of the snow or on tree stumps and other prominent sites, and frequently spray urine to mark their range.[10]

Hunting and diet [edit]

Canada lynx near Whitehorse, Yukon.

Canada lynx feed predominantly on snowshoe hares, which typically comprise 60% to 97% of their diet; as a result, the size of the lynx population tends to run parallel to the 10 year long rise and decline of hare's numbers. However, especially in summer, they will also eat rodents and birds, and sometimes hunt larger prey such as deer. Like many cats, they will eat carrion when it is available.

Canada lynx use their large ears and eyes to seek out prey. They will hunt every one to two days and consume around 600 to 1,200 g (1.3 to 2.6 lb) of food per day. They hunt both by ambush and by actively seeking out prey, varying their tactics depending on the terrain and relative abundance of prey species.[10] Lynx do not have stamina; whilst they are fast over short distances, they lack the ability to maintain their speed for more than a few dozen feet. If the lynx does not catch its prey within the first few seconds, it will generally give up the chase to conserve energy.

If the lynx kills or scavenges a larger animal that it cannot consume all in one sitting, it will drag it to a hiding area such as a bush or under a rock and then will cover the dead animal with leaves and return to consume it later. Such behaviour is particularly common when prey is abundant. If food is scarce and the lynx comes upon a large number of prey, it may go on a spree, killing as many prey as possible, then storing the kills.

Although Canada lynx are typically solitary hunters, females and cubs have been seen to hunt together in coordinated attacks. One lynx will scare the prey out of the hiding place, while the others are ready to attack a short distance away.[10]

Other animals use the lynx to hunt as well. The Great Horned Owl will station itself above the lynx and wait for the lynx to flush the prey out of its hiding place. The owl will then attack and capture the prey before the lynx can get to it.[citation needed]

Reproduction and life cycle [edit]

Two Canada lynx kittens.

The breeding season in Canada lynx lasts only for a month, ranging from March to May, depending on the local climate. Females come into oestrus only once during this period, lasting for three to five days.[10] The female attracts a mate by leaving some of her urine where the male has marked his territory, and by repeated calling. Mating can occur six times in one hour. The female lynx will only mate with one male each season, but the male may mate with multiple females.

Gestation lasts around 64 days, so that the young are born in May or early June. Before birth, the female prepares a maternal den, usually in very thick brush, and typically inside thickets of shrubs or trees or woody debris. The dens are generally situated mid-slope and face south or southwest.[11]

Litters contain from one to eight cubs, and tend to be much larger when prey is abundant. This suggests a greater degree of reproductive flexibility than in other cats, and females often do not mate at all when prey is scarce. When cubs are born in lean years, however, infant mortality may be as high as 95%.

Canada lynx cubs weigh from 175 to 235 g (6.2 to 8.3 oz) at birth, and initially have greyish buff fur with black markings. They are blind and helpless for the first fourteen days, and weaned at twelve weeks.[10] When their eyes open, they are a bright blue color, but as they mature, the eyes become a brown-hazel color. The mother brings the food to her cubs and allows them to play with it before eating it, thus training their hunting skills.

Cubs leave the den after about five weeks, and begin hunting at between seven and nine months of age. They leave the mother at around ten months, as the next breeding season begins, but do not reach the full adult size until around two years old. Female reach sexual maturity at ten months, although they often delay breeding for another year, while males reach maturity at two or three years. Canada lynx have been reported to live for up to fourteen years in captivity, although the lifespan is likely much shorter in the wild.[10]

Distribution and habitat [edit]

The Canada lynx is found in northern forests across almost all of Canada and Alaska. It is, however, absent in the relatively treeless regions of the Great Plains and the northern coasts, which are outside the natural range of the snowshoe hare. Due to human activity, the Canada lynx is no longer found in Prince Edward Island or on the mainland of Nova Scotia,[10] although there are two known areas of Canada lynx populations in the Cape Breton Highlands.

In addition there are large populations of this lynx in Montana, Idaho, Washington, and Oregon and a resident population exists in Yellowstone National Park, Wyoming that extends into the Greater Yellowstone Ecosystem.[12] The Canada lynx is rare in Utah, Minnesota, and New England. The Canada lynx is a threatened species in the contiguous United States. It is also found in the Medicine Bow National Forest in Wyoming.

Starting in 1999, the Colorado Division of Wildlife began a program reintroducing a wild lynx population back to Colorado. While showing early signs of promise, biologists say it will take more than a decade to determine whether the program is a success. However, in 2006 the first case of a native-born Colorado lynx giving birth since 1999 was documented: it gave birth to two kittens, affirming the possibility of successful reintroduction. There were many successful kindles thereafter.

In 2007 several of these lynx were shot and killed by unknown persons. In some cases only the radio tracking collars were found, leading to suspicions of fur poaching, in other cases the animals were shot and the body left intact.[13]

By 2010, after an 11 year effort, it had been successfully reintroduced into Colorado where it had become extinct in the 1970s. The initial introduction was in the San Juan Mountains in southwestern Colorado but self-sustaining populations were established throughout the south-central Colorado Rockies as far north as Summit County by 2010. In Colorado the red squirrel is an important secondary food source when snowshoe hares are scarce.[14][15][16] Isolated individual lynx have wandered widely from the core area in the Southern Rockies where they were reintroduced resulting in observation of lynx introduced in Colorado as far away as Iowa, northern Idaho, and eastern Nevada. It was found helpful to rest and feed the animals well before releasing them in prime condition during the spring thaw.[17]

Cycle of lynx abundance [edit]

In the northern parts of Canada, its population can be estimated from the records kept from the number caught each year for its fur. Records have been kept by the Hudson's Bay Company and Canadian government since the 1730s.[18] A graph of its abundance is characterised by huge rises and falls with the peaks occurring at a level typically ten times higher than the troughs and about 5 years after them, and the process then reversing itself.

This lynx is a specialist predator, eating snowshoe hare almost exclusively when they are available. The population variation of the lynx and the hare is an example of a predator-prey cycle. Environmental factors such as weather and forest plant growth that may affect this population variation have been studied.

Conservation [edit]

The Canada lynx is trapped for its fur and has declined in many areas due to habitat loss, and the IUCN lists them as Least Concern.[2] On March 24, 2000, the U.S. Fish and Wildlife Service issued its Final Rule, which designated the Canada lynx a Threatened Species in the lower 48 states.[19][20] Canada lynx-bobcat hybrids have also been detected at the southern periphery of the current population range for lynx (Maine, Minnesota and New Brunswick)[21][22] which may limit their recovery in the south.

References [edit]

  1. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 541. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b Nowell, K. (2008). Lynx canadensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved March 22, 2009. Database entry includes justification for why this species is of least concern
  3. ^ "Polarluchs (Lynx canadensis)". Naturwissenschaften. zeno.org. Retrieved May 6, 2013. 
  4. ^ Zielinski, William J; Kuceradate, Thomas E (1998). American Marten, Fisher, Lynx, and Wolverine: Survey Methods for Their Detection. DIANE Publishing. pp. 77–8. ISBN 0-7881-3628-3. 
  5. ^ Carron Meaney; Gary P. Beauvais (September 2004). "Species Assessment for Canada Lynx (Lynx canadensis) in Wyoming" (PDF). United States Department of the Interior, Bureau of Land Management. Archived from the original on September 26, 2007. Retrieved June 25, 2007. 
  6. ^ Johnson, W.E., Eizirik, E., Pecon-Slattery, J., Murphy, W.J., Antunes, A., Teeling, E. & O'Brien, S.J. (2006). "The Late Miocene radiation of modern Felidae: A genetic assessment". Science 311 (5757): 73–77. doi:10.1126/science.1122277. PMID 16400146. 
  7. ^ Web Page Redirect – Wisconsin Department of Natural Resources. Dnr.state.wi.us (February 2, 2009). Retrieved on September 16, 2011.
  8. ^ Macdonald, David W. (1993). Velvet claw a natural history of the carnivores. New York: Parkwest: BBC Books. pp. 47–50. ISBN 0-563-20844-9. 
  9. ^ Kobalenko, Jerry (1997). Forest cats of North America cougars, bobcats, lynx. Willowdale, Ont: Firefly Books. ISBN 1-55209-172-4. 
  10. ^ a b c d e f g h Sunquist, Mel; Sunquist, Fiona (2002). Wild cats of the World. Chicago: University of Chicago Press. pp. 154–165. ISBN 0-226-77999-8. 
  11. ^ Slough, BG (1999). "Characteristics of Canada Lynx, Lynx canadensis, Maternal Dens and Denning Habitat". Canadian Field-Naturalist 113 (4): 605–608. Retrieved July 23, 2007. 
  12. ^ Potter, Tiffany (April 13, 2004). "Reproduction of Canada Lynx Discovered in Yellowstone". Nature: Year in Review. National Park Service. Retrieved March 19, 2007. 
  13. ^ Bronski, P (June 2007). "Environment – Missing Lynx". 5280 Magazine. Retrieved June 16, 2007. 
  14. ^ Banda, Solomon (September 18, 2010) Associated Press story printed as Lynx reintroduction ruled a success in Colorado by The Denver Post and Colorado: Lynx No Longer Missing by The NY Times
  15. ^ "DOW Declares Colorado Lynx Reintroduction Program a Success" press release Colorado Division of Wildlife September 17, 2010, accessed September 18, 2010
  16. ^ "Success of the Lynx Reintroduction Program" Colorado Division of Wildlife Sep 7, 2010, accessed September 18, 2010
  17. ^ "Success of the Colorado Division of Wildlife’s lynx reintroduction program" report by the Colorado Division of Wildlife, accessed September 18, 2010
  18. ^ Weinstein, MS (1977). "Hares, Lynx, and Trappers". The American Naturalist 111 (980): 806–808. doi:10.1086/283212. JSTOR 2460337. 
  19. ^ Fish and Wildlife Service (March 24, 2000). "Endangered and Threatened Wildlife and Plants; Determination of Threatened Status for the Contiguous U.S. Distinct Population Segment of the Canada Lynx and Related Rule". Federal Register 65 (58): 16052. 
  20. ^ Canada Lynx. U.S. FWS.
  21. ^ Homyack, J.A., et al. (2008). "Canada Lynx-Bobcat (Lynx canadensis x L.rufus) hybrids at the southern periphery of lynx range in Maine, Minnesota and New Brunswick". American Midland Naturalist 159 (2): 504–508. doi:10.1674/0003-0031(2008)159[504:CLLCLR]2.0.CO;2. 
  22. ^ Schwartz M.K. et al. (2004). "Hybridization between Canada Lynx and Bobcats: Genetic results and management implications". Conservation Genetics 5 (3): 349–355. doi:10.1023/B:COGE.0000031141.47148.8b. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Placed in the genus Felis by some authors. Some authors regard L. lynx, L. canadensis, and L. pardinus as conspecific (see Tumlison 1987). Jones et al. (1992) treated L. canadensis and L. lynx as conspecific. Baker et al. (2003) amd Wozencraft (in Wilson and Reeder 1993, 2005) recognized L. canadensis (North America), L. lynx (Eurasia), and L. pardinus (Portugal, Spain) as separate species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!