Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Lynx have dense winter coats, and their large feet, padded with thick fur, let them run atop deep snow. A large portion of their diet consists of snowshoe hares, which are similarly equipped to run on snow. Lynx hunt mostly at dawn and dusk. They are solitary, and maintain nonexclusive territories. The ranges of females overlap more than the ranges of males. Adults scent-mark their territories by urinating and defecating on logs, stumps, and bushes along their travel routes. The chemistry of their urine changes seasonally and this generates different signals, attracting mates during breeding season and repelling other Lynx at other times.

Links:
Mammal Species of the World
  • Original description: In Linnaeus, C. (translated and revised by R. Kerr), 1792. The animal kingdom; or, zoological system of the celebrated Sir Charles Linnaeus. Class I. Mammalia and Class II. Birds.  Being a translation of that part of the Systema Naturae, as lately published with great improvements by Professor Gmelin, together with numerous additions from more recent zoological writers and illustrated with copperplates, 1:157.  J. Murray, London, 644 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Throughout North America, Canada lynx are generally considered to be distributed in two broad spatial and demographic patterns. The contiguous Northern Taiga population covers most of Canada east from Newfoundland and Labrador to Alaska. The southern Boreal population consists of small, widely isolated populations south of the 49 degree parallel in the "Lower 48" states of the US, and in Canada including northwestern New Brunswick and Cape Breton island in Nova Scotia (Parker 2001). Its range is coincident with that of their main prey, the snowshoe hare Lepus americanus (Nowell and Jackson 1996, Sunquist and Sunquist 2002). While still occurring in 95% of their historic range in Canada (with the exception of far eastern Canada) (Poole 2003), in the contiguous United States, lynx historically occurred in 24 states (McKelvey et al. 2000), possibly ranging as far down the Rocky mountain chain to include a 25th, New Mexico (Frey 2006). Widely extirpated, the US Fish and Wildlife Service has identified six "core" areas for recovery where there is evidence of lynx reproduction within the last 20 years: northern Maine and New Hampshire; northeastern Minnesota; northwestern Montana and northeastern Idaho; the Kettle and Wedge mountain ranges of Washington state; the northern Cascade range of Washington state; and the Greater Yellowstone area of Wyoming, Montana and Idaho. A reintroduced population in the southern Rocky mountains of Colorado state is another core area; 204 lynx from Canada and Alaska have been released since 1999, and there is evidence of reproduction (Nordstrom et al. 2005) and lynx have ranged up to 4,310 m, with an average elevation of 3,170 m (Wild et al. 2006). A reintroduction in northern New York state was not successful (Sunquist and Sunquist 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Major populations of Canadian lynx, Lynx canadensis, are found throughout Canada, in western Montana, and in nearby parts of Idaho and Washington. There are small populations in New England and Utah and possibly in Oregon, Wyoming and Colorado as well.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout Alaska and Canada (except arctic islands) south through the Rocky Mountains, northern Great Lakes region, and northern New England. Also northern Eurasia if regarded as conspecific with Lynx lynx (=Felis lynx). See U.S. Fish and Wildlife Service (1998) for information on distribution and relative abundance in the contiguous U.S. Considered historically resident in 16 states represented by five ecologically distinct regions: Cascade Range (Washington, Oregon), northern Rocky Mountains (northeastern Washington, southeastern Oregon, Idaho, Montana, western Wyoming, northern Utah), southern Rocky Mountains (southeastern Wyoming, Colorado), northern Great Lakes (Minnesota, Wisconsin, Michigan ), and northern New England (Maine, New Hampshire, Vermont, New York, Pennsylvania, Massachusetts). Resident populations currently exist only in Maine, Montana, Washington, and possibly Minnesota; considered extant but no longer sustaining self-support populations in Wisconsin, Michigan, Oregon, Idaho, Wyoming, Utah, and Colorado; may be extirpated from New Hampshire, Vermont, New York, Pennsylvania, and Massachusetts (U.S. Fish and Wildlife Service 1998). See Stardom (1988 COSEWIC report) for information on distribution and relative abundance in Canada, where still widespread and relatively abundant in most of historic range. See USFWS (2000) for a state-by-state review of historical and current distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The coloration of lynx varies, but is normally yellowish-brown. The upper parts may have a frosted, gray look and the underside may be more buff. Many individuals have dark spots. The tail is quite short and is often ringed and tipped with black. The fur on the body is long and thick. The hair is particularly long on the neck in winter. The triangular ears are tipped with tufts of long black hairs. The paws are quite large and furry, helping to distribute the weight of the animal when moving on snow.

Head-body length is between 670 and 1,067 mm and tail length ranges from 50 to 130 mm. Amimals typically weigh between 4.5 and 17.3 kg. On average, males weigh slightly more than females.

Range mass: 4.5 to 17.3 kg.

Range length: 670 to 1,067 mm.

Sexual Dimorphism: male larger

  • Tumlison, R. 1999. Canada lynx| Lynx canadensis . Pp. 233-234 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington D.C.: The Smithsonian Institution Press in Association with the American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 107 cm

Weight: 18100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly larger than females.

Length:
Range: 670-1,067 mm

Weight:
Range: 4.5-17.3 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Canada lynx are found only in boreal forest, and their main prey species, the snowshoe hare Lepus americanus, depends largely on patches of sucessional growth (Buskirk et al. 2000). Hares make up 60-97% of their diet, at an average rate of one every 1-2 days (Sunquist and Sunquist 2002). The lynx-hare cycle was first discovered from harvest records of the Hudson’s Bay Company dating back to the early 1800's. Numbers of snowshoe hares peak approximately every ten years in the northern part of their range, and lynx numbers follow the same pattern with a short lag, typically 1-2 years. The fluctuations can be drastic, with hare abundance reaching 2,300/km² during the peaks, and crashing to 12/km² during the lows. While the populations of many prey and predator species are cyclic and roughly synchronous in the northern latitudes, the hare-lynx correlation is particularly close (Nowell and Jackson 1996, Sunquist and Sunquist 2002). Three primary variables drive the cycle: vegetation quality, and both hare and lynx numbers. Historically, lynx trapping pressure also influenced the amplitude of the cycle (Gamarra and Sole 2000).

In the southern parts of their range, predator and prey communities are more diverse, and snowshoe hares are less important as prey species (Buskirk et al. 2000). Ungulates to not figure prominently in the lynx's diet other than as carrion, although they preyed on caribou calves in Newfoundland after the hare population crashed (Bergerud 1983).

Lynx home ranges average 15-50 km², although they can be much larger, and tend to be larger on the southern periphery of their geographic distribution, suggesting that these areas are marginal habitat. Average lynx densities range from 1-45 animals (including young) per 100 km², and fluctuate with hare abundance (Sunquist and Sunquist 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Lynx usually live in mature forests with dense undergrowth but can also be found in more open forests, rocky areas or tundra.

Terrestrial Biomes: tundra ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Generally occurs in boreal and montane regions dominated by coniferous or mixed forest with thick undergrowth, but also sometimes enters open forest, rocky areas, and tundra to forage for abundant prey. When inactive or birthing, occupies den typically in hollow tree, under stump, or in thick brush. Den sites tend to be in mature or old growth stands with a high density of logs (Koehler 1990, Koehler and Brittell 1990).

U.S. Forest Service et al. (1993) listed three primary habitat components for lynx in the Pacific Northwest: (1) foraging habitat (15-35-year-old lodgepole pine) to support snowshoe hare and provide hunting cover, (2) denning sites (patches of >200-year-old spruce and fir, generally less than 5 acres, and (3) dispersal/travel cover (variable in vegetation composition and structure).

Major limiting factor is abundance of snowshoe hare, which in turn is limited by availability of winter habitat (in the Pacific Northwest, primarily early successional lodgepole pine with trees at least 6 feet tall) (U.S. Forest Service et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Canadian lynx are strictly carnivores. Snowshoe hares are of particular importance in the diet of these cats, and populations of the two are known to fluctuate in linked cycles with periods of about 9.6 years. In these cycles, there is a slight lag between hare and lynx populations. Although in some areas, such as Cape Breton Island, lynx prey exclusively on hares, in other areas they also take rodents, birds and fish.

In the fall and winter, lynx will kill and eat deer and other large ungulates that are weakened by the rutting season. They also utilize carcasses left by human hunters.

Canadian lynx only eat meat. Snowshoe hares are a very important food for these cats, and when there are fewer hares to eat, the number of lynx decreases. In some areas, such as Cape Breton Island, lynx eat only hares, but in other areas they also feast on rodents, birds and fish. If they can find a deer that is very weak or sick, lynx will kill and eat it. They also feed off carcasses left by human hunters.

Animal Foods: birds; mammals; fish; carrion

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats primarily small mammals and birds, particularly Lepus americanus. Occasionally feeds on squirrels, small mammals, beaver, deer, moose, muskrat, and birds; some taken as carrion. May cache food for later use.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As predators, Canadian lynx are important in regulating the populations of their prey. This is particularly noticeable in the cycle of populations of lynx and snowshoe hares.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of these cats have not been reported. However, one can assume that young kittens are vulnerable to other large carnivores, such as wolves and bears.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Lynx canadensis preys on:
Amphispiza bilineata
Sciurus carolinensis
Castor canadensis
Falcipennis canadensis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Unknown, but numerous--Nearctic (or Holarctic) distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is unknown, but it varies cyclically with availability of food; total probably is at least in the hundreds of thousands during population peaks, based on annual harvests in Canada that periodically exceed 50,000 (Nowak 1991). British Columbia population was estimated to vary between 200,000 and 250,000 (Goodchild and Munro 1980). See Stardom (1988 COSEWIC report) for information on status in Canada. In the contiguous U.S., total population size is unknown, but probably less than 2,000. Colorado: only 18 positive recordrds; none since 1973; proposing to reintroduce lynx (Colorado Division of Wildlife 1997). Idaho: less than 100 individuals (C. Harris, pers. comm., 1997). Maine: less than 200 individuals (C. McLaughlin, pers. comm., 1997). Oregon: perhaps fewer than 75 individuals (E. Gaines, pers. comm., 1997). Utah: very rare, few if any extant occurrences (G. Oliver, pers. comm., 1997). Montana: 740-1040 individuals (B. Giddings, pers. comm., 1998). Washington: 72-191 individuals (Washington Department of Wildlife 1993, Washington Department of Natural Resources 1996). Wyoming: less than 100 individuals (B. Oakleaf, pers. comm., 1998). Periodic increases in lynx numbers may be accentuated by dispersal of transient animals from Canadian populations (U.S. Fish and Wildlife Service 1998). It has been suggested that, because lynx occurrence throughout much of the continguous U.S. is on the southern periphery of the species' range, the presence of lynx is solely a consequence of dispersal from Canada and that most of the U.S. may never have supported self-sustaining, resident populations over time (U.S. Fish and Wildlife Service 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range increases, and individuals may become nomadic, when prey is scarce (Ward and Krebs 1985, Saunders 1963, Mech 1980). Range of male (average often about 15-30 sq km, but up to hundreds of sq km in Alaska and Minnesota) is larger than that of female. Spatial organization observed prior to low hare densities in Northwest Territories may be described as a land-tenure system, based on prior residency, and may have served to regulate density during peak prey levels (Poole 1995). Long distance dispersal movements of up to several hundred kilometers have been recorded.

Population density usually is less than 10 (locally up to 20) per 100 sq km, depending on prey availability. Mean densities range between 2 and 9 per 100 sq km (McCord and Cardoza 1982).

Usually solitary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication and perception are probably similar to that of other cats. In addition to having good vision to facilitate hunting, these animals have excellent hearing. Scents are probably used in marking territories. Tactile communication is likely to occur between mates, as well as between mothers and their offspring. Communication through vocalizations occurs as well.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Mainly nocturnal. Most active from 2 hours after sunset to one hour after sunrise (Banfield 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, lynx have lived as long as 14.5 years. In captivity, lifespans of 26.75 years have been recorded.

Range lifespan

Status: wild:
14.5 (high) years.

Range lifespan

Status: captivity:
26.75 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.8 years (captivity) Observations: One wild born specimen was about 26.8 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system of these animals is not reported. However, female home ranges are usually encompassed by the home range of a male, and the home ranges of multiple females may overlap. This distribution, in conjuction with the slight sexual dimorphism, indicate that the species is probably polygynous.

Females enter estrus only once per year and raise one litter per year. Estrus lasts 1 to 2 days. Mating in February and March is folowed by a gestation period of from 8 to 10 weeks. Litters typically have 2 or 3 kittens, though the number may range from 1 to 5. Lynx weigh about 200 g at birth. Lactation lasts for 5 months, although kittens eat some meat as early as one month of age.

Males do not participate in parental care. Young remain with the mother until the following winter's mating season, and siblings may remain together for a while after separation from the mother. Females reach sexual maturity at 21 months and males at 33 months.

Breeding interval: Lynx can breed once per year.

Breeding season: Breeding occurs in January and February.

Range number of offspring: 1 to 6.

Average number of offspring: 2.

Range gestation period: 56 to 70 days.

Average weaning age: 150 days.

Average time to independence: 10 months.

Average age at sexual or reproductive maturity (female): 21 months.

Average age at sexual or reproductive maturity (male): 33 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 204 g.

Average number of offspring: 3.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
573 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
498 days.

Females give birth to their young in fallen logs, stumps, clumps of timber, or similar tangles of roots and branches. This, one assumes, helps to protect the young from potential predators.

All parental care is provided by females. Young are altricial at birth, but have well-developed pelage. Nursing lasts for about 5 months, after which the young eat prey. Mothers may help to educate their young in hunting techniques, and cooperative hunting has been observed.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in late winter-early spring in North America. Gestation lasts 62-74 days. Litter size averages 3-4; adult females produce one litter every 1-2 years. Young stay with mother until next mating season or longer. Some females give birth as yearlings, but their pregnancy rate is lower than that of older females (Brainerd 1985). Prey scarcity suppresses breeding and may result in mortality of nearly all young (Brand and Keith 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lynx canadensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0286-06|AY598472|Lynx canadensis| AACCGCTGATTATTTTCAACTAATCACAAAGATATTGGCACTCTCTACCTTTTATTTGGTGCCTGGGCCGGTATGGTAGGGACTGCTCTC---AGCCTCCTGATCCGAGCCGAACTAGGTCAACCTGGTACATTATTAGGAGAC---GACCAGATTTACAATGTAATCGTCACCGCCCACGCTTTTGTAATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGGTTCGGGAACTGATTGGTCCCATTAATA---ATTGGAGCCCCTGACATAGCATTTCCCCGAATGAACAATATAAGCTTCTGACTTCTTCCTCCATCCTTTCTGCTTCTACTTGCTTCGTCCATAGTGGAGGCGGGAGCAGGAACTGGGTGAACGGTATATCCACCCCTAGCCGGTAACCTGGCTCATGCAGGAGCATCCGTGGATTTA---ACCATCTTCTCACTCCACCTGGCAGGTGTTTCTTCAATCTTGTGTGCTATTATCTTTATTACCACTATTATTAATATAAAACCCCCTGCTATGATCCGAATACAAACACCTCTATTGTTATGGTCAGTTCTAATTACTGCAGTTCTACTACTCCTATCACTCCCAGTTTTAGCAGCA---GGAATTACCATGCTACTAACAGATCGAAATTTAAACACCACATTCTTTGATCCTGCTGGAGGAGGGGATCCCATTTTATACCAGCACTTATTCTGATTCTTTGGTCACCCAGAGGTCTACATCCTAATTCTACCTGGCTTTGGAATAATCTCACACATTGTTACCTATTATTCAGGTAAAAAA---GAACCCTTTGGCTACATGGGAATAGTTTGAGCTATAATATCAATCGGCTTCCTGGGCTTTATCGTATGAGCCCATCACATGTTTACTGTGGGGATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lynx canadensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Nowell, K.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because the Canada lynx is widespread and abundant over most of its range, where it is legally harvested for the international fur trade for hundreds of years, and recent decades of managed harvests do not appear to have caused any significant decline or range loss (Mowat et al. 2000). In the southern part of its range, it is considered Endangered in New Brunswick, Canada, and of "Special Concern" in Nova Scotia (Parker 2001). In the contiguous US, it is listed as Threatened under the Endangered Species Act and critical habitat is being designated for conservation management (US FWS 2008).

History
  • 2002
    Least Concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Lynx are listed in CITES Appendix II, and they are listed as threatened by the U.S. Fish and Wildlife Service and endangered in the state of Michigan.

US Federal List: threatened

CITES: appendix ii

State of Michigan List: endangered

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in northern North America; declines have occurred in some populations, but apparently still widespread and relatively abundant in most of historic range, though population data are lacking for many areas; habitat loss/fragmentation and susceptibility to overharvest are the major concerns.

In the contiguous U.S., overall numbers and range are substantially reduced from historical levels. At present, numbers have not recovered from overexploitation by both regulated and unregulated harvest that occurred in the 1970s and 1980s. Forest management practices that result in the loss of diverse age structure, fragmentation, roading, urbanization, agriculture, recreational developments, and unnatural fire frequencies have altered suitable habitat in many areas. As a result, many states may have insufficient habitat quality and/or quantity to sustain lynx or their prey. Human access into habitat has increased dramatically over the last few decades contributing to direct and indirect mortality and displacement from suitable habitat. Although legal take is highly restricted, existing regulatory mechanisms may be inadequate to protect small, remnant populations or to conserve habitat. Competition with bobcats and coyotes may be a concern in some areas.

Other Considerations: See EGR for coterminous United States population (Lynx canadensis POP 1).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 03/24/2000
Lead Region:   Mountain-Prairie Region (Region 6)   
Where Listed: (Contiguous U.S. DPS)

Status: Candidate
Date Listed:
Lead Region:   Mountain-Prairie Region (Region 6)   
Where Listed: NM population


For most current information and documents related to the conservation status and management of Lynx canadensis, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Canada lynx is primarily found in Canada, where it is managed and trapped for its fur. It is considered endangered only in New Brunswick, and has been extirpated from Prince Edward Island and maiinland Nova Scotia (Nowell and Jackson 1996, Parker 2001). In the US, the Canada lynx is abundant in Alaska, but in the "Lower 48" states populations are small and threatened. Lynx were reintroduced apparently unsuccessfully in northern New York state in the late 1980s, and more recently, apparently successfully, in Colorado (Sunquist and Sunquist 2002).

In the northern parts of their range, lynx populations undergo dramatic fluctuations roughly every ten years, following apparently regular cycles of increase and decline of their primary prey, the snowshoe hare Lepus americanus, a pattern evident in lynx fur trade records dating back to the early 1800s (Nowell and Jackson 1996). In the southern parts, lynx and hares appear to maintain a relatively stable but low density (Parker 2001).

Schwartz et al. (2003) documented reduced genetic variation in lynx populations from the peripheral areas of its distribution.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In most of Canada and the US state of Alaska, trapping of Canada lynx is managed for the fur trade. Trapping can reduce lynx populations and have the greatest impact when hare populations cyclically crash. In response to concerns about over-harvest during the cyclic low of the lynx-hare cycle in the 1980s, most Canadian provinces and Alaska implemented management measures which led to reduced harvests (Mowat et al. 2000). In the early 1980 (1980-1984), an average of 35,669 Canada lynx pelts were exported from the US and Canada. That fell to in the late 1980s (1986-1989) to an average annual export of 7,360. Exports have trended lower and fluctuated less severely since then, with annual exports from 2000-2006 averaging 15,387 (UNEP-WCMC 2008). Historical information suggests that, despite minimal harvest controls for much of the last century, lynx-hare cycles have been largely stable in the northern part of their range and no permanent range decrease has been detected (Mowat et al. 2000, Poole 2003).

In eastern Canada where lynx are rare and protected, the primary threat is considered to be interspecific competition from the eastern coyote, which expanded its range into eastern North America in the last few decades (Parker 2001).

In the contiguous US, the primary threat is habitat fragmentation. Logging practices and fire suppression can reduce hare and lynx abundance. Lynx are also threatened by interspecific competition from other predators whose populations have increased in recent decades, and may be killed accidentally in snares set for other species, or on roads. Maintenance of connectivity with the abundant northern population is considered essential for recovery (Ruediger et al. 2000, Nordstrom 2005). Hybridization with bobcats has been found by genetic analysis in Minnesota (Schwartz et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: In determining threatened status for the contiguous U.S. distinct population segment, USFWS (2000) cited the inadequacy of existing regulatory mechanisms. "Current U.S. Forest Service Land and Resource Management Plans include programs, practices, and activities within the authority and jurisdiction of federal land management agencies that may threaten lynx or lynx habitat. The lack of protection for lynx in these plans render[s] them inadequate to protect the species" (USFWS 2000). Past extensive logging that eliminated habitat for lynx and snowshoe hare was detrimental. Habitat has been lost due to suppression of forest fires and ecological succession to habitats that no longer support snowshoe hare and lynx. Fragmentation, due to forestry, agriculture, and roads, and the subsequent isolation of suitable habitat is a concern. Lack of immigration from Canadian lynx populations is an important factor in some regions. Past excessive trapping of lynx (as recently as the 1970s and 1980s) depressed populations and may have been detrimental to local lynx populations in Washington (see U.S. Forest Service et al. 1993) and elsewhere (U.S. Fish and Wildlife Service 1998). Road construction causes habitat fragmentation and allows increased human access into lynx habitat; this may increase lynx mortality by facilitating access to hunters and trappers (although there is no legal harvest except for two lynx per year in Montana); incidental harvest of lynx in the course of legal trapping/hunting for other species may be a problem in some areas. Increased winter recreation (snowmobiles, ski area development) may be causing displacement and/or incidental mortality of lynx. Habitat changes and increased access into lynx habitats has resulted in increased competition and displacement of lynx by bobcat and coyote in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Included on CITES Appendix II. In Canada, the national and provincial governments manage harvests by region (Govt of US 2007b), using closed seasons, quotas, limited entry and long-term trapping concessions (Nowell and Jackson 1996). In the US, trapping takes place only in Alaska, and harvest quotas are increased during periods of population increase and decreased during periods of cyclic decline (Govt of US 2007b).

The population of the contiguous US was listed as Threatened under the Endangered Species Act in 2000, requiring the US government to develop a recovery plan and identify critical habitat for lynx (Nordstrom 2005). Critical habitat designations only apply to federal lands or federally funded or permitted activities on private lands, but not to private activities on private lands. This designation gives the federal government the authority to manage activities that affect the designated habitat. In February 2008, the US Fish and Wildlife Service proposed a revised designation of critical habitat of 42,753 square miles of critical lynx habitat as follows:

Maine: Approximately 10,633 square miles in portions of Aroostook, Franklin, Penobscot, Piscataquis and Somerset Counties.

Minnesota: Approximately 8,226 square miles in portions of Cook, Koochiching, Lake, and St. Louis Counties, and Superior National Forest.

Northern Rocky Mountains: Approximately 11,304 square miles in portions of Boundary County in Idaho; and Flathead, Glacier, Granite, Lake, Lewis and Clark, Lincoln, Missoula, Pondera, Powell and Teton Counties in Montana. This area includes the Flathead Indian Reservation, National Forest lands and Bureau of Land Management (BLM) lands in the Garnet Resource Area.

North Cascades: Approximately 2,000 square miles in portions of Chelan and Okanogan Counties which includes BLM lands in the Spokane District.

Greater Yellowstone Area: Approximately 10,590 square miles in Gallatin, Park, Sweetgrass, Stillwater, and Carbon Counties in Montana; and Park, Teton, Fremont, Sublette, and Lincoln Counties in Wyoming.

The Kettle range of Washington state was not included due to lack of recent evidence of reproduction, and the reintroduced population of Colorado and Utah in the southern Rockies was also not included due to lack of evidence that it is self-sustaining. The designation is proposed but not final, and significantly increases a 2006 designation of 1,841 square miles of critical habitat for the lynx within the boundaries of Voyagers National Park in Minnesota, Glacier National Park in Montana, and North Cascades National Park in Washington (US FWS 2008).

To reduce accidental taking of lynx in traps set for other furbearers, the Fish and Wildlife Service has recommended various measures to trappers (e.g., avoid using hares or rabbits as bait) (Goldman and Krauze 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Trapping may be major source of mortality; such mortality is in addition to natural mortality during times of low hare abundance and low recruitment (Brittell et al. 1989). Refugia not subject to trapping may be important in maintaining populations during periods of low recruitment (Ward and Krebs 1985).

For the Pacific Northwest, U.S. Forest Service et al. (1993) recommended the following actions within known lynx range: (1) minimizing road construction, closing unused roads, and maintaining roads to the minimum standard possible, (2) using prescribed fire to maintain forage for snowshoe hare in juxtaposition with hunting cover for lynx, (3) designating areas to be closed to kill trapping of any furbearer to avoid incidental lynx mortality to maintain population refugia for lynx in key areas, (4) planning for kill-trapping closure on a wider basis if data indicate a declining lynx population as a result of incidental trapping mortality, and (5) developing and implementing a credible survey and monitoring stretegy to determine the distribution of lynx throughout its potential range.

Management Research Needs: Develop accurate and reliable population size and trend indices.

Initiate intensive long-term studies of populations with known sex and age structure, reproductive activities, home ranges, habitat use, food habits, trends in prey species and interactions with other predators; such areas should then be tested with closely regulated harvest programs to determine optimal management strategies (McCord and Cardoza 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Managed in some states and provinces as a furbearer species with no harvest allowed. In the U.S., only Montana currently allows a regulated harvest (quota of two lynx statewide as of 1997-1998 harvest season); fully protected in all other states; protected in national parks.

Needs: Protect from overharvest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Canadian lynx are not known to have a negative impact on human economies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Canadian lynx have been exploited for their fur since the seventeenth century. With restrictions on trade in furs of large cats in the late 1960's, and subsequent reduction of ocelot and margay populations by fur trappers, increased attention has been focused on the pelts of Canadian lynx. However, it seems that the greatest pressure on populations of lynx remains the size of hare populations, not trappers. Lynx help control populations of small mammals, such as snowshoe hares and voles, that are agricultural or silvicultural pests.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Canada lynx

The Canada lynx (Lynx canadensis) or Canadian lynx is a North American mammal of the cat family, Felidae. It is a close relative of the Eurasian Lynx (Lynx lynx). However, in some characteristics the Canada lynx is more like the bobcat (Lynx rufus) than the Eurasian Lynx. With the recognized subspecies, it ranges across Canada and into Alaska as well as some parts of the northern United States.

With a dense silvery-brown coat, ruffed face and tufted ears, the Canada lynx resembles the other species of the mid-sized Lynx genus. It is larger than the bobcat, with which it shares parts of its range, and over twice the size of the domestic cat.

Contents

Taxonomy

There had been debates over whether to classify this species as Lynx canadensis or Felis canadensis, part of a wider issue regarding whether the four species of Lynx should be given their own genus, or be placed as a subgenus of Felis,[3][4] but the Lynx genus is now accepted. Johnson et al. report that Lynx shared a clade with the Puma, leopard cat (Prionailurus bengalensis), and domestic cat (Felis) lineages, dated to 7.15 Ma; Lynx diverged first, approximately 3.24 Ma.[5]

Subspecies

Three subspecies of the Canada lynx are currently recognized:

Physical characteristics

Canada lynx
Canada lynx

The appearance of the Canada lynx is similar to that of the Eurasian lynx: the dense fur is silvery brown and may bear blackish markings. In summer, its coat takes on a more reddish brown color. It has a furry ruff which resembles a double-pointed beard, a short tail with a black tip, and long furry tufts on its ears. Its long legs with broad furred feet aid in traveling through deep snow.

It is smaller than its Eurasian cousin, at an average weight of 8 to 11 kg (18 to 24 lb), 80 to 105 cm (31 to 41 in) in length, and a shoulder height of 48 to 56 cm (19 to 22 in). Males are larger than females. Although the species is larger on average than the bobcat, it is less variable in size and the largest bobcats outsize the lynx.[6]

Like all lynx, it has 28 teeth, with four long canines for puncturing and gripping. The lynx can feel where it is biting the prey with its canines because they are heavily laced with nerves. The lynx also has four carnassials that cut the meat into small pieces. In order for the lynx to use its carnassials, it must chew the meat with its head to its side. There are large spaces between the four canines and the rest of the teeth, and a reduced number of premolars, to ensure that the bite goes as deeply as possible into the prey.[7] Adaptations that lynxs have for maneuvering through the deep snow are feet with a large gap between the first and second toes and their big toe set at a wide angle which gives them a better vicelike grip on the snow.

Behavior

The Canada lynx is a secretive and mostly nocturnal animal, although it may be active at any time of day. They shelter in areas of particularly dense forest. In regions where their range overlaps with that of other predators, such as bobcats and coyotes, they tend to hunt in areas with deeper snow cover, or at higher altitudes. The cat tends to stay within a hundred yards of the treeline, but does not shy away from swimming. One account records a lynx swimming two miles across the Yukon River.[8]

Although normally solitary, at times small groups may be observed traveling together. The lynx roam about one and a half to three miles each day, and thus require a large territory. Typical home ranges are between 15 and 50 km2 (5.8 and 19 sq mi), but are highly variable, with extremes from 3 to 783 km2 (1.2 to 302 sq mi) having been reported. When food becomes scarce, the lynx territory will increase; most of the population will roam far, with a select few staying behind in their original territory.[9]

Like other cats, Canada lynx use scent marking to indicate their territory. Adults typically deposit faeces on top of the snow or on tree stumps and other prominent sites, and frequently spray urine to mark their range.[9]

Hunting and diet

Canada lynx near Whitehorse, Yukon.

Canada lynx feed predominantly on snowshoe hares, which typically comprise 60% to 97% of their diet; as a result, the size of the lynx population tends to run parallel to the 10 year long rise and decline of hare's numbers. However, especially in summer, they will also eat rodents and birds, and sometimes hunt larger prey such as deer. Like many cats, they will eat carrion when it is available.

Canada lynx use their large ears and eyes to seek out prey. They will hunt every one to two days and consume around 600 to 1,200 g (1.3 to 2.6 lb) of food per day. They hunt both by ambush and by actively seeking out prey, varying their tactics depending on the terrain and relative abundance of prey species.[9] Lynx do not have stamina; whilst they are fast over short distances, they lack the ability to maintain their speed for more than a few dozen feet. If the lynx does not catch its prey within the first few seconds, it will generally give up the chase to conserve energy.

If the lynx kills or scavenges a larger animal that it cannot consume all in one sitting, it will drag it to a hiding area such as a bush or under a rock and then will cover the dead animal with leaves and return to consume it later. Such behavior is particularly common when prey is abundant. If food is scarce and the lynx comes upon a large number of prey, it may go on a spree, killing as many prey as possible, then storing the kills.

Although Canada lynx are typically solitary hunters, females and cubs have been seen to hunt together in coordinated attacks. One lynx will scare the prey out of the hiding place, while the others are ready to attack a short distance away.[9]

Other animals use the lynx to hunt as well. The Great Horned Owl will station itself above the lynx and wait for the lynx to flush the prey out of its hiding place. The owl will then attack and capture the prey before the lynx can get to it.[citation needed]

Reproduction and life cycle

Two Canada lynx kittens.

The breeding season in Canada lynx lasts only for a month, ranging from March to May, depending on the local climate. Females come into oestrus only once during this period, lasting for three to five days.[9] The female attracts a mate by leaving some of her urine where the male has marked his territory, and by repeated calling. Mating can occur six times in one hour. The female lynx will only mate with one male each season, but the male may mate with multiple females.

Gestation lasts around 64 days, so that the young are born in May or early June. Before birth, the female prepares a maternal den, usually in very thick brush, and typically inside thickets of shrubs or trees or woody debris. The dens are generally situated mid-slope and face south or southwest.[10]

Litters contain from one to eight cubs, and tend to be much larger when prey is abundant. This suggests a greater degree of reproductive flexibility than in other cats, and females often do not mate at all when prey is scarce. When cubs are born in lean years, however, infant mortality may be as high as 95%.

Canada lynx cubs weigh from 175 to 235 g (6.2 to 8.3 oz) at birth, and initially have greyish buff fur with black markings. They are blind and helpless for the first fourteen days, and weaned at twelve weeks.[9] When their eyes open, they are a bright blue color, but as they mature, the eyes become a brown-hazel color. The mother brings the food to her cubs and allows them to play with it before eating it, thus training their hunting skills.

Cubs leave the den after about five weeks, and begin hunting at between seven and nine months of age. They leave the mother at around ten months, as the next breeding season begins, but do not reach the full adult size until around two years old. Female reach sexual maturity at ten months, although they often delay breeding for another year, while males reach maturity at two or three years. Canada lynx have been reported to live for up to fourteen years in captivity, although the lifespan is likely much shorter in the wild.[9]

Distribution and habitat

The Canada lynx is found in northern forests across almost all of Canada and Alaska. It is, however, absent in the relatively treeless regions of the Great Plains and the northern coasts, which are outside the natural range of the snowshoe hare. Due to human activity, the Canada lynx is no longer found in Prince Edward Island or on the mainland Nova Scotia,[9] although there are two known areas of Canada lynx populations in the Cape Breton Highlands.

In addition there are large populations of this lynx in Montana, Idaho, Washington, and Oregon and a resident population exists in Yellowstone National Park, Wyoming that extends into the Greater Yellowstone Ecosystem.[11] The Canada lynx is rare in Utah, Minnesota, and New England. The Canada lynx is a threatened species in the contiguous United States. It is also found in the Medicine Bow National Forest in Wyoming.

Starting in 1999, the Colorado Division of Wildlife began a program reintroducing a wild lynx population back to Colorado. While showing early signs of promise, biologists say it will take more than a decade to determine whether the program is a success. However, in 2006 the first case of a native-born Colorado lynx giving birth since 1999 was documented: it gave birth to two kittens, affirming the possibility of successful reintroduction. There were many successful kindles thereafter.

In 2007 several of these lynx were shot and killed by unknown persons. In some cases only the radio tracking collars were found, leading to suspicions of fur poaching, in other cases the animals were shot and the body left intact.[12]

By 2010, after an 11 year effort, it had been successfully reintroduced into Colorado where it had become extinct in the 1970s. The initial introduction was in the San Juan Mountains in southwestern Colorado but self-sustaining populations were established throughout the south-central Colorado Rockies as far north as Summit County by 2010. In Colorado the red squirrel is an important secondary food source when snowshoe hares are scarce.[13][14][15] Isolated individual lynx have wandered widely from the core area in the Southern Rockies where they were reintroduced resulting in observation of lynx introduced in Colorado as far away as Iowa, northern Idaho, and eastern Nevada. It was found helpful to rest and feed the animals well before releasing them in prime condition during the spring thaw.[16]

Cycle of lynx abundance

In the northern parts of Canada, its population can be estimated from the records kept from the number caught each year for its fur. Records have been kept by the Hudson's Bay Company and Canadian government since the 1730s.[17] A graph of its abundance is characterized by huge rises and falls with the peaks occurring at a level typically ten times higher than the troughs and about 5 years after them, and the process then reversing itself.

This lynx is a specialist predator, eating snowshoe hare almost exclusively when they are available. The population variation of the lynx and the hare is an example of a predator-prey cycle. Environmental factors such as weather and forest plant growth that may affect this population variation have been studied.

Conservation

The Canada lynx is trapped for its fur and has declined in many areas due to habitat loss, and the IUCN lists them as Least Concern.[2] On 24 March 2000, the U.S. Fish and Wildlife Service issued its Final Rule, which designated the Canada lynx a Threatened Species in the lower 48 states.[18] Canada lynx-bobcat hybrids have also been detected at the southern periphery of the current population range for lynx (Maine, Minnesota and New Brunswick)[19][20] which may limit their recovery in the south.

References

  1. ^ a b Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 541. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ a b Nowell, K. (2008). Lynx canadensis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 22 March 2009. Database entry includes justification for why this species is of least concern
  3. ^ Zielinski, William J; Kuceradate, Thomas E (1998). American Marten, Fisher, Lynx, and Wolverine: Survey Methods for Their Detection. DIANE Publishing. pp. 77–8. ISBN 0-7881-3628-3. 
  4. ^ Carron Meaney; Gary P. Beauvais (September 2004). "Species Assessment for Canada Lynx canadensis) in Wyoming" (PDF). United States Department of the Interior, Bureau of Land Management. Archived from the original on 2007-09-26. http://web.archive.org/web/20070926024618/http://uwadmnweb.uwyo.edu/wyndd/Species+Assessments/Canada+Lynx+-+Final+(Sep+2004).pdf. Retrieved 2007-06-25. 
  5. ^ Johnson, W.E., Eizirik, E., Pecon-Slattery, J., Murphy, W.J., Antunes, A., Teeling, E. & O'Brien, S.J. (2006). "The Late Miocene radiation of modern Felidae: A genetic assessment". Science 311 (5757): 73–77. doi:10.1126/science.1122277. PMID 16400146. 
  6. ^ Web Page Redirect - Wisconsin Department of Natural Resources. Dnr.state.wi.us (2009-02-02). Retrieved on 2011-09-16.
  7. ^ Macdonald, David W. (1993). Velvet claw a natural history of the carnivores. New York: Parkwest: BBC Books. pp. 47–50. ISBN 0-563-20844-9. 
  8. ^ Kobalenko, Jerry (1997). Forest cats of North America cougars, bobcats, lynx. Willowdale, Ont: Firefly Books. ISBN 1-55209-172-4. 
  9. ^ a b c d e f g h Sunquist, Mel; Sunquist, Fiona (2002). Wild cats of the World. Chicago: University of Chicago Press. pp. 154–165. ISBN 0-226-77999-8. 
  10. ^ Slough, BG (1999). "Characteristics of Canada Lynx, Lynx canadensis, Maternal Dens and Denning Habitat". Canadian Field-Naturalist 113 (4): 605=608. http://md1.csa.com/partners/viewrecord.php?requester=gs&collection=ENV&recid=4698199&q=&uid=791057556&setcookie=yes. Retrieved 2007-07-23. 
  11. ^ Potter, Tiffany (2004-04-13). "Reproduction of Canada Lynx Discovered in Yellowstone". Nature: Year in Review. National Park Service. http://www2.nature.nps.gov/YearinReview/yir2003/07_E.html. Retrieved 2007-03-19. 
  12. ^ Bronski, P (June 2007). "Environment - Missing Lynx". 5280 Magazine. http://www.5280.com/issues/2007/0706/index.php. Retrieved 2007-06-16. 
  13. ^ "Lynx reintroduction ruled a success in Colorado" Associated Press story by P. Solomon Banda printed by The Denver Post, September 18, 2010, accessed September 18, 2010 NY Times
  14. ^ "DOW Declares Colorado Lynx Reintroduction Program a Success" press release Colorado Division of Wildlife September 17, 2010, accessed September 18, 2010
  15. ^ "Success of the Lynx Reintroduction Program" Colorado Division of Wildlife Sept. 7, 2010, accessed September 18, 2010
  16. ^ "Success of the Colorado Division of Wildlife’s lynx reintroduction program" report by the Colorado Division of Wildlife, accessed September 18, 2010
  17. ^ Weinstein, MS (1977). "Hares, Lynx, and Trappers". The American Naturalist 111 (980): 806–808. doi:10.1086/283212. JSTOR 2460337. 
  18. ^ 65 Federal Register 16051 16086[http://mountain-prairie.fws.gov/species/mammals/lynx/ Canada Lynx - U.S. FWS. (PDF) . Retrieved on 2011-09-16.
  19. ^ Homyack, J.A., et al. (2008). "Canada Lynx-Bobcat (Lynx canadensis x L. rufus) hybrids at the southern periphery of lynx range in Maine, Minnesota and New Brunswick". Am. Midl. Nat. 159: 504–508. doi:10.1674/0003-0031(2008)159[504:CLLCLR]2.0.CO;2. 
  20. ^ Schwartz M.K. et al. (2004). "Hybridization between Canada Lynx and Bobcats: Genetic results and management implications". Conserv. Genet. 5: 349–355. doi:10.1023/B:COGE.0000031141.47148.8b. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Placed in the genus Felis by some authors. Some authors regard L. lynx, L. canadensis, and L. pardinus as conspecific (see Tumlison 1987). Jones et al. (1992) treated L. canadensis and L. lynx as conspecific. Baker et al. (2003) amd Wozencraft (in Wilson and Reeder 1993, 2005) recognized L. canadensis (North America), L. lynx (Eurasia), and L. pardinus (Portugal, Spain) as separate species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!