Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

Nasua nasua is broadly distributed in South America, ranging from Colombia and Venezuela in the north to Uruguay and northern Argentina in the south (Gompper and Decker, 1998). The species is absent from the Llano grasslands of Venezuela (Eisenberg, 1989) and has also been introduced to Robinson Crusoe, one of the Juan Fernández Islands of Chile (Colwell, 1989; Miller and Rottmann, 1976; Pine et al., 1979).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Nasua nasua is found in tropical regions of South America, from Columbia and Venezuela to Uruguay, northern parts of Argentina, and into Ecuador. On the eastern and western slopes of the Andes Mountains they are found up to 2500 meters.

(Marwell Zoological Park, 1996; Gompper, 1998; Animals 1999)

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Coati upper parts are dark brown, gray, or dark or brightly rust colored. The underparts are white. The head is narrow with the nose slightly turned upward and elongated, and is very flexible, allowing coaties to search out food under leaf litter and overturned debris. The muzzle is brown with pale spots above, below, and behind the eye. The ears are small and fringed with white on the inside rims. The long tails of coatis are used for balance, and are black to brown with yellow rings. Coatis have thick, dull fur. The young are not as darkly colored as adults. Adults measure 41 to 67 cm from head to the base of the tail, with the tail adding an additional 32 to 69 cm to their length. These animals are about 30 cm tall at the shoulder, and weigh between 3 and 6 kg. Coatis have strong claws and forelimbs to climb and dig out food from under rotted logs. They can reverse the joints of the anklebone to descend trees headfirst. (Marwell Zoological Park, 1996; Emmons, 1997; Kalasinkas, 1999)

Range mass: 3 to 6 kg.

Range length: 73 to 136 cm.

Average basal metabolic rate: 5.591 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is an occupant of forested habitat. It has been reported from multistratal deciduous and evergreen rainforest, riverine gallery forest, xeric chaco, cerrado and dry scrub forest (Brooks, 1993; Emmons, 1990; Handley, 1976; Mondolfi, 1976; Schaller, 1983). It is found over a wide altitudinal range, with Andean individuals found at elevations up to 2,500 m (Lönnberg, 1921). Nasua nasua is omnivorous, eating predominantly invertebrates and fruit (Gompper and Decker, 1998). The consumption of vertebrates has been noted, but is never common (Beisiegel, 2001; Bisbal, 1986; Gompper, 1996; Kaufmann, 1962; Russell, 1982; Schaller, 1983). It is essentially diurnal in its activities. Adult males are solitary, while females and immature males travel in groups up to 30 individuals (Crespo, 1982; Emmons, 1990; Schaller, 1983).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ring-tailed coatis primarily live in forested areas; deciduous, evergreen, cloud forest, riverine gallery forest, xeric, Chaco, cerrado, and dry scrub forest habitats. Due to human influence, coatis prefer secondary forests and forest edges. They are found up to 2500 meters in elevation (Emmons, 1997; Gompper, 1998)

Range elevation: 2500 (high) m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Primarily omnivorous, coatis usually seek out fruits and invertebrates. Coatis eat palms, eggs, larval beetles, scorpions, centipedes, spiders, ants, termites, lizards, small mammals, rodents, and carrion when it is available. They infrequently take chickens (Gompper, 1998; Kasalinkas, 1999; Nowak, 1991).

Animal Foods: birds; mammals; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: leaves; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Coatis help to control pest populations through their foraging behavior. They provide food to predators, and are likely important in dispersing some seeds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Coatis seem to prefer edges and secondary forest habitats, possibly due to human interactions (Gompper, 1998; Kasalinkas, 1999). They have a wide variety of predators, most notably large cats.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Nasua nasua is prey of:
Boidae
Panthera onca
Leopardus pardalis
Herpailurus yaguarondi
Puma concolor
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Nasua nasua preys on:
Arthropoda
Insecta
Reptilia
Aves
Mammalia
Paleosuchus trigonatus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

See Reproduction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

One captive coati was reported to be still alive after 17 years and 8 months. In the wild, coatis only live for about 7 to 8 years (Nowak, 1991; Kasalinkas,1999).

Range lifespan

Status: wild:
7 to 8 years.

Range lifespan

Status: captivity:
17.5 (high) years.

Average lifespan

Status: captivity:
17.7 years.

Average lifespan

Status: wild:
14.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.7 years (captivity) Observations: One wild born specimen was about 23.7 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Typically, one male is accepted into a band of females and juveniles near the beginning of the breeding season. The mating system is polygynous, with that male mating the females in the band. (Nowak, 1991)

Mating System: polygynous

Breeding season for coatis varies with location, and corresponds with the maximum availability of fruit. Occurs between January and March in some locations, and between October and February in others. Males will join the losely organized bands of females to mate. After mating, males leave the bands for a mainly solitary existence, and the females disperse and build tree nests for the remainder of gestation and parturation. Females give birth to litters of 3 to 7 young 74 to 77 days after mating. Most births occur between April and June Five to six weeks after birth, the females and their young will rejoin the band. (Marwell Zoological Park 1996, Emmons, 1997; Gompper, 1998; Kasalinkas, 1999; Nowak, 1991)

Young are altricial. Neonates weigh 78 g at 5 days. Eyes open at 10 days. Young coatis are able to stand at 19 days. By 24 days of age, coatis are able to walk and to focus their eyes. Young can climb at 26 days, and eat solid food at 4 months. Females become sexually mature at 2 years of age, and male mature sexually around three years of age. (Marwell Zoological Park, 1996; Gompper, 1998; Kalasinkas, 1999)

Breeding season: Mating occurs from October through March, with exact timing varying by location, and young are born between April and June.

Range number of offspring: 3 to 7.

Range gestation period: 74 to 77 days.

Average weaning age: 4 months.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 140 g.

Average number of offspring: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Females care for the altricial young in isolated tree nests until they are able to walk and climb, at which time they rejoin the social group. Mothers continue to nurse the young until they are weaned around 4 months of age. (Nowak, 1991)

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nasua nasua

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCGTAGACCGATGATTGTTTTCCACAAATCATAAGGACATTGGCACCCTCTATCTTCTATTCGGGGCCTGAGCTGGGATGGCAGGAACTGCCCTTAGTCTATTAATTCGCGCCGAGCTGGGCCAACCGGGCACTTTACTAGGTGATGATCAGGTCTATAATGTAGTAGTAACCGCTCATGCATTCGTAATGATCTTCTTCATAGTGATACCAATTATGATTGGGGGTTTCGGAAATTGATTAGTACCCCTTATAATTGGTGCGCCTGACATAGCATTCCCACGAATAAACAATATAAGTTTCTGACTCCTACCTCCATCATTCCTCCTGCTGCTAGCCTCTTCAATAGTAGAGGCGGGGGCAGGAACAGGATGGACCGTGTATCCCCCTCTAGCAGGTAATTTAGCACATGCTGGGGCGTCCGTCGACCTAACAATCTTCTCCCTGCATTTAGCAGGGGTTTCGTCCATCTTAGGTGCTATCAACTTTATTACTACTATTATCAATATAAAACCTCCGGCTATGACACAATACCAGACTCCTCTATTCGTGTGATCAGTACTAATTACGGCAGTGCTTCTACTGCTATCCCTACCAGTATTAGCAGCTGGTATTACAATACTACTCACAGATCGAAATCTAAACACTACCTTCTTCGATCCGGCCGGAGGAGGGGATCCAATCTTATATCAACACCTATTCTGATTTTTCGGACATCCCGAAGTATATATTTTAATCCTGCCAGGTTTCGGAATAATCTCACACATTGTCACATACTACTCAGGGAAGAAAGAGCCTTTCGGTTATATAGGCATGGTTTGGGCGATGATATCAATTGGGTTCTTAGGCTTCATCGTATGAGCACATCATATATTTACAGTAGGGATGGATGTTGATACACGAGCATACTTTACCTCAGCTACTATAATTATTGCCATCCCTACGGGAGTAAAGGTATTTAGCTGGCTAGCTACCCTACACGGAGGCAACATTAAATGATCACCGGCCATGCTATGGGCCTTAGGGTTCATTTTTTTATTCACGGTAGGCGGCCTAACAGGAATTGTACTGTCAAACTCATCACTAGATATTATTCTTCACGATACGTACTACGTAGTGGCACACTTTCACTATGTACTGTCAATGGGGGCAGTATTCGCTATCATAGGGGGGTTCGCCCACTGGTTCCCGTTATTTTCGGGTTACACACTTAACGACGTTTGAGCTAAAGTTCACTTCACAATCATATTTGTTGGAGTTAACATGACATTCTTCCCACAACATTTCCTAGGCTTATCCGGCATGCCTCGACGATACTCGGACTATCCAGATGCATATACAACATGAAACACAGTATCTTCTATAGGCTCATTCATCTCCCTAGCAGCTGTTATACTAATAACTTTCATAATTTGAGAGGCTTTCGCCTCAAAACGAGAAGTGATAATAGTGGAACTAACCTCAACAAACGTTGAGTGGCTACACGGGTGTCCTCCTTCATATCATACATTTGAAGAACCTGCCTATGTGCTAATAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nasua nasua

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Emmons, L. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern as the species is widespread and apparently common in an area of relatively intact habitat, population density varies greatly from region to region and there are no major threats (although the species is probably declining due to hunting and habitat loss).

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

They are protected under CITES Appendix III in Uruguay, but are not classified as threatened in the wild (Emmons, 1997; Marwell Zoological Park, 1996).

Humans cause detrimental effects from hunting and deforestation for mining, road building, petroleum, and timber extraction.

CITES: appendix iii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population density of Nasua nasua varies greatly from region to region. Densities reported ranges from 6.2 individuals/km2 in a region of low-lying deciduous forest, to 13 individuals/km2 in taller gallery forests (Gompper and Decker, 1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Habitat loss due to deforestation and hunting for their meat by natives are major threats for the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected under CITES Appendix III as N. n. solitaria in Uruguay. The species occurs in numerous protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

They cause damage to crops, and household damage in villages. They have also been known to take poultry. (Marwell Zoological Park, 1996; Kasalinkas, 1999; Nowak, 1991).

Negative Impacts: crop pest; household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hunted by local populations for food, coatis are also vital in helping control populations of insects. There is a small demand for these animals in the live pet trade. (Marwell Zoological Park, 1996; Emmons, 1997; Gompper, 1998)

Positive Impacts: pet trade ; food ; ecotourism ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

South American coati

The South American coati, or ring-tailed coati (Nasua nasua), is a species of coati from tropical and subtropical South America. In Brazilian Portuguese it is known as quati. Weight in this species is 2–7.2 kg (4.4–16 lb) and total length is 85–113 cm (33–44 in), half of that being its tail.[3] Its color is highly variable and the rings on the tail may be quite weak, but it lacks the largely white muzzle ("nose") of its northern cousin, the white-nosed coati.[3]

Contents

Distribution[edit]

The South American coati is widespread in tropical and substropical South America. Most of its distribution is in the lowlands east of the Andes (locally, it occurs as high as 2,500 m or 8,200 ft), from Colombia and The Guianas south to Uruguay and northern Argentina (Chile is the only South American country where the species is not found).[2][3]

The status of coatis west of the Andes has caused some confusion,[4] but specimen records from west Ecuador, and north and west Colombia are South American coatis.[5][6] The only documented records of white-nosed coatis in South America are from far northwestern Colombia (Gulf of Urabá region, near Colombian border with Panama).[5][6] The smaller mountain coatis are mainly found at altitudes above the South American coati, but there is considerable overlap.[7]

Behavior[edit]

South American coatis are variable in color and can be quite orange-red.[3]

South American coatis are diurnal animals, and they live both on the ground and in trees.[8] They typically live in the forest.[9] They are omnivorous and primarily eat fruit, invertebrates, other small animals and bird's eggs.[8] Coatis search for fruit in trees high in the canopy, and use their snouts to poke through crevices to find animal prey on the ground.[8] They also search for animal prey by turning over rocks on the ground or ripping open logs with their claws.[8]

Females generally live in large groups, called bands, consisting of 15 to 30 animals.[8][9] Males, on the other hand, are usually solitary.[9] Solitary males were originally considered a separate species due to the different social habits and were called "coatimundis",[9] a term still sometimes used today. Neither bands of females nor solitary males defend a unique territory, and territories therefore overlap.[9]

Group members produce soft whining sounds, but alarm calls are different, consisting of loud woofs and clicks.[8] When an alarm call is sounded, the coatis typically climb trees, and then drop down to the ground and disperse.[8] Coatis typically sleep in the trees.[8] Predators of the South American coati include foxes, jaguars, jaguarundis, domestic dogs, and people.[10]

Reproduction[edit]

All females in a group come into heat simultaneously when fruit is in season.[9] Females mate with multiple males.[9] Gestation period is 77 days.[9] Females give birth to 2-4 young at a time, which are raised in a nest in the trees for 4–6 weeks.[8][9] Females leave the group during this time.[8][9] Females tend to remain with the group they were born in but males generally disperse from their mothers' group after 3 years.[9]

Other[edit]

South American coatis generally live for up to 7 years in the wild, but can live up to 14 years in captivity.[9]

Subspecies[edit]

The South American coati has 13 recognized subspecies:[1]

References[edit]

  1. ^ a b Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b Duckworth, J.W. & Schipper, J. (2008). Nasua nasua. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 9 October 2008.
  3. ^ a b c d Kays, R. (2009). South American Coati (Nasua nasua), pp. 526-528 in: Wilson, D. E., and R. A. Mittermeier, eds. (2009). Handbook of the Mammals of the World. Vol. 1, Carnivores. ISBN978-84-96553-49-1
  4. ^ Eisenberg, J., and K. H. Redford (1999). Mammals of the Neotropcs: The Central Neotropics. Vol. 3, p. 288. ISBN 0-226-19541-4
  5. ^ a b Decker, D. M. (1991). Systematics Of The Coatis, Genus Nasua (Mammalia, Procyonidae). Proceedings of The Biological Society of Washington 104: 370-386
  6. ^ a b Guzman-Lenis, A. R. (2004). Preliminary Review of the Procyonidae in Colombia. Acta Biológica Colombiana 9(1): 69-76
  7. ^ Helgen, K. M., R. Kays, L. E. Helgen, M. T. N. Tsuchiya-Jerep, C. M. Pinto, K. P. Koepfli, E. Eizirik, and J. E. Maldonado (2009). Taxonomic boundaries and geographic distributions revealed by an integrative systematic overview of the mountain coatis, Nasuella (Carnivora: Procyonidae). Small Carnivore Conservation. 41: 65–74.
  8. ^ a b c d e f g h i j Emmons, Louise (1997). Neotropical Rainforest Mammals, A Field Guide, 2nd Edition. pp. 153–154. ISBN 0-226-20721-8. 
  9. ^ a b c d e f g h i j k l "BBC Ring-tailed Coati". Retrieved 2007-07-13. 
  10. ^ "Southern Coati". Retrieved 2007-07-13. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!