Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Ringtails are nocturnal, cat-sized carnivores. They are good climbers and are found in habitats that range from dry canyons to wet woodlands, in highland and lowland terrain. They prey on small mammals, but their varied diet also includes other vertebrates, insects, nuts, and fruit. These animals are solitary and territorial, marking their home ranges by depositing urine and feces.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Lichtenstein, H., 1830.  Erlauterungen der Nachrichten des Fran. Hernandez von den vierfussigen Thieren Neuspaniens, p. 119.  Abhandlungen der Koniglichen Akademie der Wissenschaften in Berlin, 89-128.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species is widely distributed in Mexico and across southern North America In the United States it ranges from southern Oregon and California through the southwestern states to Texas (Hall, 1981; Poglayen-Neuwall and Toweill, 1988). In Mexico, its distribution is from the desert region of the Baja California peninsula to Oaxaca. Three islands in the Gulf of California are included in its distribution: Tiburón, Espíritu Santo, and San José (Lawlor, 1983). The species is usually distributed from sea level to 1400 m with records at 2000 and 2900 m (Poglayen-Neuwall and Toweill, 1988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bassariscus astutus can be found from southwestern Oregon and eastern Kansas south through California, southern Nevada, Utah, Colorado, Arizona, New Mexico, Oaklahoma, Texas, Baja California and northern Mexico. Outlying records in Arkansas, Louisiana, Alabama, and Ohio are likely the result of a ringtail habit of boarding railroad cars and being transplanted as a result (Nowak, 1999).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Western North America, as far north as southern Oregon, northern Nevada, northern Utah, southern Wyoming, and Colorado, south through California, Arizona, New Mexico, Texas, and Mexico to southern Baja California and the Isthmus of Tehuantepec, including some islands in the Gulf of California. Old records exist for the central U.S. north to Kansas. Generally sea level to about 1400 m, but reported from up to 2900 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Body mass of both sexes from throughout the geographic range of Bassariscus astutus ranges from 824 to 1,338 g. Head and body length is 305 to 420 mm and tail length is 310 to 441 mm. Shoulder height is about 160 mm. The upper body is buffy in color with a dark brown wash, and the underparts are a pale buff. The tail is bushy and has black and white rings (hence the common name of the species), much like a raccoon. The eyes are ringed by black or dark brown and set within buffy patches. The body is cat-like with a fox-like face and large oval ears. The claws of these animals are semi-retractable. The dental formula is: i 3/4, c 1/1, p 3/4, m 3/2 for a total of 40 teeth. The canines are well developed (Nowak, 1999; Poglayen-Neuwal, 1988).

Range mass: 824 to 1,338 g.

Range length: 305 to 420 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 81 cm

Weight: 1100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 793 mm males; 756 mm females
Range: 616-811 mm

Weight:
Range: 0.9-1.3 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species occurs in a variety of habitats as semi-arid oak forests (Quercus), pinyon pine (Pinus edulis), or juniper (Juniperus) woodland, and also inhabit montane conifer forests, chaparral, desert, dry tropical habitats and rocky or cliff areas (Poglayen-Neuwall and Toweill, 1988). The species adapts well to disturbed areas and is frequently found in human habitation (Barja and List, 2006). Reports on home range include 5.0 to 13.8 ha for four individuals (Lacy, 1983), 43.4 ha (35 and 51.7 ha) for two males and 20.3 ha (15.7 to 27.7 ha) for three females (Toweill and Teer, 1980) and 136 ha (49 to 233) for nine individuals. Ringtails are nocturnal carnivores with some crepuscular activity and are solitary, except for the breeding season (Toweill and Toweill, 1978; Poglayen-Neuwall and Toweill, 1988). They breed at the end of February and give birth in May (Poglayen-Neuwall and Poglayen-Neuwall, 1980). They eat rodents, insects, birds and a good amount of fruit (Trapp, 1978; Aranda, 2000).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Ringtails can be found at elevations of up to 2900 m but are most common at elevations ranging from sea level to 1400 m. Ringtails utilize a variety of habitats. They prefer habitats with rocky outcroppings, canyons, or talus slopes and can be found in semi-arid country, deserts, chaparral, oak woodlands, pinyon pine woodlands, juniper woodlands and montane conifer forests. They also inhabit riparian habitats due to the increased food availability (Poglayen-Neuwall, 1988; 1990).

Range elevation: 0 to 2900 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Typically in rocky areas with cliffs or crevices for daytime shelter; desert scrub, chaparral, pine-oak and conifer woodland. Usually within 0.5 miles of water. Dens usually in rock shelter; also in tree hollow, under tree roots, in burrow dug by other animal, in remote building, under brush pile. Changes den often.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Ringtails are omnivorous, but show a dietary preference for animal matter. Specific dietary items are largely selected as a function of their seasonal abundance. Principal animal matter food items include rodents, rabbits, squirrels, and insects, however, birds, lizards, snakes, frogs, and carrion are also eaten. Plant matter eaten includes acorns, mistletoe, juniper berries, persimmons, wild figs and other fruits. When available, B. astutus will also feed on nectar (Poglayen-Neuwall 1988,1990; Kuban and Schwartz, 1985).

Animal Foods: birds; mammals; amphibians; reptiles; carrion ; insects

Plant Foods: seeds, grains, and nuts; fruit; flowers

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Omnivorous, but prefers animal matter. Principal foods are arthropods, small mammals, and fruits; proportions vary seasonally. Also eats various birds, reptiles, amphibians; nectar feeding from AGAVE also reported (Poglayen-Neuwall and Towell 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

An important mid-size carnivore, the ringtail can help keep rodent populations under control.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

When threatened, a ringtail will bristle the hair on its tail, arching the tail over its back towards its head, and thereby making itself appear larger. If captured, it screams a high pitched, penetrating sound and discharges a pungent, foul smelling secretion from the anal glands (Poglayen-Neuwall 1988,1990).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Bassariscus astutus is prey of:
Bubo virginianus
Lynx rufus
Canis latrans

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Bassariscus astutus preys on:
Insecta
Amphibia
Reptilia
Aves
Mammalia
Zenaida asiatica
Columbina inca
Otus asio
Micrathene whitneyi

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Secretive, may be common in areas where seldom observed. In different areas, population density ranges from a few to about 20 per sq km. Home range may shift seasonally. Occurs singly or as pairs in local concentrations (Poglayen-Neuwall and Towell 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Ringtails have a variety of vocalizations. Adults can emit an explosive bark, a piercing scream, and a long, high-pitched call. Infants vocalize with metallic chirps, squeaks, and wimpers. Scent seems to be as important as vocalizations for communication within the species. B. astutus scent marks its home range territory by rubbing urine on the ground and on raised objects. During the mating season, ringtails increase their marking activity to attract a mate and deter competitors of the same sex (Nowak, 1999; Poglayen-Neuwall, 1988). It is likely that there is tactile communication between a mother and her offspring, as well as between mates.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Activity mainly nocturnal, though sometimes also active at dusk and dawn. Active throughout the year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The life expectancy of ringtails is about 7 years in the wild. A female kept in captivity reached the age of 16 (Poglayen-Neuwall 1988).

Range lifespan

Status: captivity:
16 (high) years.

Average lifespan

Status: wild:
7 years.

Average lifespan

Status: captivity:
14.3 years.

Average lifespan

Status: wild:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19 years (captivity) Observations: In the wild, these animals probably live about 7 years. One wild born specimen was about 19 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system of these procyonids has not been reported.

Female ringtails are undergo a single estrous cycle in a season, usually mating from February to May. Heat usually lasts from 24 to 36 hours. The gestation period is short among the Procyonidae, and ranges from 51 to 54 days. Birth usually occurs in May or June with a litter size ranging from one to four.

Females choose a den in a rock crevice, boulder pile, or tree hollow in which they bear their young. Newborns are altricial with a mass of 25 g. Neonates open their eyes around one month of age. The young can take solid food at 30 to 40 days of age and are weaned at about 10 weeks. The female is mainly responsible for care, and forages with her young beginning when they are about 2 months old. The father is sometimes tolerated and may play with the young as they grow older. Ringtails reach sexual maturity in both sexes near 10 months of age (Poglayen-Neuwall, 1990).

Breeding season: Breeding season occurs from February to May.

Range number of offspring: 1 to 5.

Range gestation period: 51 to 54 days.

Average weaning age: 10 weeks.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 30 g.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
300 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
300 days.

Females are known to care for the young. They nurse the young for 10-12 weeks, and allow the young to accompany them when they forage. Males have been known to play with older offspring, and so may play some role in parental care, although no more than this has been documented.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds February-May, mainly March-April. Gestation lasts 51-54 days. Parturition usually occurs in May or June. Litter size usually is 1-4. Young forage with mother at 60-100 days, stay with mother until late summer, when weaning occurs and they leave home den. Sexually mature usually at end of second year, though young-of-year may mate successfully.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bassariscus astutus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA844-07|DQ533935|Bassariscus astutus| ACCCGATGATTGTTTTCTACAAATCACAAGGACATTGGCACCCTTTACCTCCTGTTCGGGGCTTGGGCTGGAATAGTGGGCACTGCTCTC---AGCCTACTAATTCGTGCTGAACTGGGTCAACCAGGTACTCTGTTGGGGGAT---GATCAAATTTATAATGTGATTGTAACTGCCCACGCTTTCGTAATAATCTTCTTCATAGTTATGCCTATTATGATTGGAGGATTTGGAAACTGGCTAGTACCTCTTATG---ATTGGGGCACCTGACATAGCCTTTCCGCGAATAAATAATATAAGCTTCTGACTCTTGCCACCATCATTTCTACTATTGCTGGCATCCTCAATAGTAGAAGCAGGTGCGGGAACTGGATGAACTGTGTATCCACCTCTGGCTGGTAACTTGGCACATGCAGGAGCATCTGTGGACCTC---ACAATCTTCTCCCTTCACCTAGCAGGTGTTTCATCTATCTTAGGTGCCATCAACTTTATTACTACTATTATTAATATGAAACCTCCTGCCATATCACAATACCAAATCCCACTGTTTGTGTGGTCCGTACTTATCACAGCAGTACTTCTTCTTCTATCGCTACCAGTTCTAGCAGCC---GGTATTACCATATTACTCACTGACCGAAACCTTAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGATCCTATCTTATATCAACACCTGTTCTGATTCTTCGGTCACCCTGAGGTTTATATCCTAATTCTACCCGGCTTTGGGATAATCTCTCATATCGTAACATACTACTCAGGAAAAAAA---GAACCATTTGGTTATATAGGAATAGTATGGGCTATGATGTCTATCGGTTTCCTAGGGTTTATTGTGTGGGCCCACCACATATTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bassariscus astutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Timm, R., Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern as the species is common and widely distributed from central to northern Mexico, and adapts well to disturbed areas (Barja and List 2006).

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

This species has no special conservation status.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Found always in low densities and considered not abundant. Densities reported for ringtails vary from 10.5 to 20.5 individuals/km2 (Belluomini, 1983; Belluomini and Trapp, 1984), 7 to 20 individuals/km2 (Lacy 1983) and 2.2 to 4.2/km2 (Toweill and Teer, 1980) to 0.08 to 2.3 individuals/km2 (Grinnell et al., 1937) and 1.5 to 2.9 individuals/km2 (Trapp, 1973; Trapp, 1978).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The ringtail is legally trapped for fur in Arizona, New Mexico, Colorado, and Texas, where it is also caught incidentally in traps set for valuable fur-bearers such as foxes and raccoons. In recent years about 4,000 have been taken annually in Arizona, and about 1,000 in New Mexico. In Texas 45,000~50,000 ringtails were trapped each year from 1979-1985. As in the case with raccoons, the number of ringtails trapped for fur has declined since a peak in 1979, when approximately 135,000 pelts were sold. Ringtail fur is of poor quality (thin, non-durable, and subject to fading), and pelts have usually sold for less than $5 each although they have brought as much as $12. The justification for trapping ringtails for fur is weak, especially since in none of the states where trapping is legal is there sufficient knowledge of population levels and trends on which to base valid harvest regulations (Glatston, 1994). Threats to the ringtail include also automobiles (Glatston, 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Benefits from protection of habitat by regulation of grazing and wood cutting (B82CHA01NA).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Ringtails cause little economic damage. Occasional domestic poultry are taken and an occasional orchard tree is plundered (Nowak, 1999; Poglayen-Neuwall, 1988).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Ringtails are sometimes harvested for their fur, however, the coat is not of a very high quality and is generally used as trim only. In the 1976-77 trapping season, the United States produced 88,329 pelts, which sold for an average price of $5.50. The harvest of these animals peaked at about 135,000 in 1978-79 and has since declined. In the 1991-92 season only 5,638 skins were taken, and their average price was$3.62. Although ringtails now have protection in many states, many fall victim to traps set for other furbearing animals (Nowak, 1999; Poglayen-Neuwall, 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Harvested for fur; annual harvest in Texas estimated in early 1980s at 75,000-100,000 (see Poglayen-Neuwall and Towell 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ring-tailed cat

The ringtail (Bassariscus astutus) is a mammal of the raccoon family (thus not actually a cat), native to arid regions of North America. It is also known as the ringtail cat, ring-tailed cat or miner's cat, and is also sometimes mistakenly called a "civet cat" (after similar, though unrelated, cat-like omnivores of Asia and Africa). The ringtail is sometimes called a cacomistle, though this term seems to be more often used to refer to Bassariscus sumichrasti.

Contents

Physical description

The ringtail is buff to dark brown in color with white underparts and a flashy black and white striped tail that has 14-16 white and black stripes,[2] which is longer than the rest of its body. The claws are short, straight, and semi-retractable.[3] The eyes are large and purple, each surrounded by a patch of light fur. It is smaller than a housecat, measuring 30–42 cm long with a tail of 31–44 cm and weighing 0.8–1.5 kg. Ringtails have occasionally been hunted for their pelts, but the fur is not especially valuable.

Range and habitat

The ringtail is found in California, Colorado, eastern Kansas, Oklahoma, Oregon, Arizona, New Mexico, southern Nevada, Texas, Utah and throughout northern and central Mexico. Its distribution overlaps that of B. sumichrasti in the Mexican states of Guerrero, Oaxaca and Veracruz.[3] It is found in rocky, desert as its habitat, where it nests in the hollows of trees or abandoned wooden structures. The ringtail is the state mammal of Arizona. It is also found in the Great Basin Desert. The Great Basin desert covers most of Nevada and over half of Utah, as well as parts of California, Idaho, and Oregon. The ringtail prefers to live in rocky habitats associated with water. These areas can include riparian canyons, caves, and mine shafts. It can also be found in the Sonoran Desert in Arizona,US.

Agility

The ankle joint is flexible and able to rotate over 180 degrees, a trait helping make it an agile climber. Their considerable tail provides balance for negotiating narrow ledges and limbs, even allowing them to reverse directions by performing a cartwheel. Ringtails also can ascend narrow passages by stemming (pressing all feet on one wall and their back against the other or pressing both right feet on one wall and both left feet on the other), and wider cracks or openings by ricocheting between the walls.[4]

Habits

Ringtail in Phoenix, Arizona

Much like the common raccoon, the ringtail is nocturnal and solitary. But it is timid and seen much more rarely than raccoons. It is omnivorous, eating fruits, berries, insects, lizards, small rodents, and birds. Foxes, coyotes, raccoons and bobcats will prey upon ringtails. Hawks and owls may attack the young. They produce a variety of sounds, including clicks and chatters reminiscent of raccoons. A typical call is a very loud, plaintive bark. As adults, these mammals lead solitary lives, generally coming together only to mate.

Reproduction

Ringtails mate in the spring. The gestation period is 45–50 days, during which the male will procure food for the female. There will be 2-4 cubs in a litter. The cubs open their eyes after a month, and will hunt for themselves after four months. They reach sexual maturity at ten months. The ringtail's lifespan in the wild is about seven years.[5][dead link]

Domestication

Ringtail in Phoenix, Arizona

The ringtail is said to be easily tamed, and can make an affectionate pet and effective mouser. Miners and settlers once kept pet ringtails to keep their cabins free of vermin; hence, the common name of "miner's cat" (though in fact the ringtail is no more cat than it is civet). The ringtails would move into the miners' and settlers' encampments and become accepted by humans in much the same way that some early domestic cats were theorized to have done. At least one biologist in Oregon has joked that the ringtail is one of two species— the domestic cat and the ringtail— that thus "domesticated humans" due of that pattern of behavior.

Often a hole was cut in a small box and placed near a heat source (perhaps a stove) as a dark, warm place for the animal to sleep during the day, coming out after dark to rid the cabin of mice.

References

  1. ^ Timm, R., Reid, F. & Helgen, K. (2008). Bassariscus astutus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 26 January 2009.
  2. ^ Lu, Julie. "The Biogeography of Ringtailed Cats". San Fransisco University. http://bss.sfsu.edu/holzman/courses/Fall02%20projects/Ringtail.htm. Retrieved December 2010. 
  3. ^ a b Poglayen-Neuwall, Ivo; Toweill, Dale E. (1988). "Bassariscus astutus". Mammalian Species (327). http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-327-01-0001.pdf. 
  4. ^ Williams, David B. "Ringtail Cat (Bassariscus astutus)". DesertUSA.com. http://www.desertusa.com/mag01/mar/papr/ringt.html. Retrieved December 2010. 
  5. ^ Postanowicz, Rebecca. "Ringtailed Cat". lioncrusher.com. http://www.lioncrusher.com/animal.asp?animal=84. Retrieved 3/6/07. 
  • Nowak, Ronald M. (2005). Walker's Carnivores of the World. Baltimore: Johns Hopkins University Press. ISBN 0-8018-8032-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Decker and Wozencraft (1991) for a phylogenetic analysis on procyonid genera (analysis based on skeletal and soft morphological characters).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!