Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Description

Spotted skunks are smaller than Striped skunks and more weasel-like in appearance. Like all skunks, they have anal scent glands and can emit a foul-smelling spray to protect themselves. The Spotted Skunk usually sprays as a last resort, if stomping with its front paws or doing a handstand is not sufficient to warn off an intruder. Spotted Skunks are good climbers, able to scurry up and down trees like squirrels, and prefer forested areas to open countryside. They sometimes dig burrows to use for denning, and sometimes choose such places as barns, haystacks, dens abandoned by other mammals, or crevices in trees. Usually they live alone, although in cold weather, several skunks may den together.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:44, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The eastern spotted skunk (Spilogale putorius) from eastern Canada to northeast Mexico. It occurs throughout south-central Pennsylvania down the Appalachian Mountain chain to Florida, west to the Continental Divide and south to Tamaulipas, Mexico (Hall, 1981; Kinlaw, 1995).

Increases in geographic range of eastern spotted skunks in the Great Plains may be correlated with increases in the amount of land devoted to agriculture, because agricultural practices provide outbuildings as shelter and encourage commensal house-mice (Mus musculus) that serve as a prey base (Choate et al., 1974). By the 1940s eastern spotted skunks were reported in North Dakota, Wisconsin, and Minnesota, areas in which they had not previously occurred (Van Gelder, 1959).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Eastern Spotted Skunks (Spilogale putorius) are found throughout much of the eastern United States. They are found as far north as Minnesota and south through Central America to El Salvador. They occur as far west as eastern Wyoming and Colorado. They occur throughout the midwestern states, in the Appalachian mountains as far north as Pennsylvania, throughout Florida, and to eastern Texas.

Biogeographic Regions: nearctic (Native )

  • Wilson, D., S. Ruff. 1999. The Smithsonian Book of North American Mammals. Washington and London: Smithsonian Institution Press.
  • Burt, W., R. Stirton. 1961. The Mammals of El Salvador. Miscellaneous Publications of the University of Michigan Museum of Zoology, 117: 1-10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) North Dakota, Minnesota, western and southern Wisconsin, southern Indiana (formerly), and southern Pennsylvania (formerly) south to the Gulf Coast and northeastern Mexico, east to West Virginia, Maryland, western Virginia, western Tennessee, western North Carolina, western South Carolina, and southern Florida, west to eastern Wyoming, eastern Colorado, and Texas; very localized within this range; range evidently expanded westward in the Great Plains region with agricultural expansion (Kinlaw 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These skunks have large bodies that are low to the ground with a small tapered head. The nose is short and rounded. The head and body length is typically 115-345 mm and the tail length 70-220 mm. Males are slightly larger than females. Females have three pairs of teats for feeding young. The hair is longest on the tail and shortest on the head. As in all skunk species S. putorius has a well-developed pair of anal glands used in self-defense. They have 34 teeth. There is a small white spot on the forehead and one in front of each ear. There are six distinct white stripes on the anterior part of the body. The posterior part of the body has two interrupted white bands, and one spot on each side of the rump and two more at the base of the tail. There are five toes on each foot. The front claws are sharp and recurved, and are more than twice as long as the hind claws (Grzmek 1972, Nowk 1964, Davis and Schmidley 1994).

Range mass: 200 to 1000 g.

Average basal metabolic rate: 1.674 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 56 cm

Weight: 999 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Average: 459 mm males; 422 mm females
Range: 310-610 mm males; 270-544 mm females

Weight:
Range: 276-885 g males; 207-475 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Prefer forested areas or habitats with significant cover (Dragoo and Honeycutt, 1999). Also open and brushy areas, rocky canyons and outcrops in woodlands and prairies. When inactive or bearing young, occupies den in burrow abandoned by other mammal, under brushpile, in hollow log or tree, in rock crevice, under building, or in similar protected site.

Eastern spotted skunks are primarily insectivivorous. When insects are unavailable, this species preys on small mammals, mainly rodents and young rabbits (Boppel and Long, 1994).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Spilogale putorius occupies mostly wooded areas and tall-grass prairies and many times prefers rocky habitats. It lives in holes either self-dug or abandoned burrows from other animals. Except during mating season, these skunks prefer to live with several skunks in one burrow.(Davis and Schmidley 1994, Grzmek 1972)

Terrestrial Biomes: savanna or grassland ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefer forested areas or habitats with significant cover (Dragoo and Honeycutt, in Wilson and Ruff 1999). Also open and brushy areas, rocky canyons and outcrops in woodlands and prairies. When inactive or bearing young, occupies den in burrow abandoned by other mammal, under brushpile, in hollow log or tree, in rock crevice, under building, or in similar protected site.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

These skunks are omnivorous. Their natural food sources depend on the seasons: In winter, they eat cottontails and corn; in spring, native field mice and insects; in summer, insects with small amounts of fruits, birds, and birds' eggs, and in fall, predominately insects. They are excellent rodent catchers. -S.putorius- has also been known to knock down beehives for the honeycomb, despite the many bee stings the animal receives. (Davis and Schmidley 1994, Grzmek 1972)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic omnivore; eats small mammals, grubs and other insects, corn, grapes, berries, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Average home range is around 1/4 sq mi (Schwartz and Schwartz 1981). Not as abundant as striped skunk (Mephitis mephitis) in most of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Mostly nocturnal. Mostly inactive in winter (Caire et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.5 years (captivity) Observations: There is a delay in the implantation, so the total gestation time can take from 50 to 234 days. One wild born specimen of the *gracilis* subspecies was about 10-11 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating occurs in March and April, although in southern states some females may mate in July and August if they have not mated or lost their first litter. In some cases there have been females with two litters in one year. Males tend to wander and become more active during the mating season, and are know for a condition called "mating madness" in which they will spray any large animals that they encounter. In males, testes enlarge and testosterone levels increase throughout mating season, peaking in April, but maintaining these characteristics thoughout July if females are capable of a second litter. Courtship behaviors include a short chase ending with the male grabbing the female by the nape of her neck and with both sinking to their sides. Copulation usually lasts one minute and can be repeated 10-20 times. The gestation period is approximately 50-65 days with the litter size usually about 5-6. The young are born blind and helpless and their bodies are covered with a fine hair that already has distinct black and white markings. Their eyes open at 30-32 days and they begin to walk and play when 36 days old. Sexual maturity is reached at 11 months in both sexes. (Davis and Schmidley 1994, Grzmek 1972, Kaplan 1994)

Average birth mass: 9.5 g.

Average gestation period: 31 days.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
152 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
152 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mates in winter (or early spring?). Gestation lasts 50-65 days. Litter size is 2-9 (average 5); 1 litter per year. Young are born in April-July (mainly May-June), weaned in about 8 weeks, sexually mature in 9-10 months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spilogale putorius

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1650-08|NC_010497|Spilogale putorius| AACCGATGATTATTTTCTACAAACCATAAAGACATCGGCACCCTTTATCTTTTATTTGGTGCATGAGCCGGAATAGCTGGGACCGCTCTT---AGCCTATTAATCCGAGCTGAGCTAGGACAGCCCGGGGCTCTACTAGGGGAT---GATCAAATCTACAACGTAATTGTAACAGCCCATGCATTTGTTATAATCTTTTTTATAGTAATACCGATCATAATCGGAGGATTCGGTAACTGATTAGTTCCCTTAATA---ATTGGGGCTCCAGACATGGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTACCCCCATCCTTTCTTTTACTCTTAGCCTCTTCCATAGTAGAAGCAGGGGCAGGAACAGGATGAACAGTGTATCCCCCATTAGCAGGTAACTTAGCCCATGCAGGGGCATCCGTAGATTTA---ACAATTTTCTCCCTTCACCTAGCAGGCGTATCATCAATCTTAGGAGCTATTAACTTTATTACCACAATTATTAATATGAAACCTCCTGCAATATCACAATATCAAACTCCATTATTTGTATGATCCGTACTAATTACAGCAGTTCTACTTCTCTTATCACTACCAGTATTAGCAGCT---GGCATTACTATATTACTTACAGATCGAAACTTAAATACAACCTTTTTCGACCCGGCTGGAGGAGGAGATCCTATTTTATATCAACACTTATTTTGATTCTTTGGACATCCTGAAGTCTATATTTTGATCCTACCAGGATTTGGAATAATCTCACATATTGTGACCTACTATTCAGGCAAAAAA---GAACCTTTTGGGTATATAGGGATAGTGTGGGCAATAATATCCATTGGTTTCCTGGGCTTTATCGTATGAGCTCACCATATGTTTACTGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Spilogale putorius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Cuarón, A.D., Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern as it occurs in numerous protected areas and is suspected to have large populations, although the populations status of this species is unclear throughout its range (Kaplan and Mead 1991, Reed and Kennedy 2000). In addition this species has a wide distribution range and occurs in a variety of habitats. Although the species is declining in portions of its range, this is not at a rate fast enough to be threatened.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species has been known in several areas of the Appalachian Mountains of the eastern United States since the early 1900s (Howell, 1906). However, the abundance of Spilogale putorius in the southern Appalachians is unclear and Reed and Kennedy (2000) showed that the species occurs in the Appalachian Mountains of Tennessee at low density. Lee et al. (1982) suggested that Spilogale putorius was abundant in North Carolina in the Appalachian Mountains and Howell (1921) reported the species as common in Alabama.

Few reports of population density for Spilogale putorius are available. Crabb (1948) pointed out that estimates in an agricultural area of Iowa could range between one eastern spotted skunk per 11.4 ha to one per 5.0 ha, depending on the method of calculation. Additionally, data collected in 1973–1974 (Ehrhart, 1974) at Canaveral National Seashore, Florida, revealed a density estimate of one S. putorius per 2.5 ha.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species. The main cause of current mortality of this species is represented by automobile roadkills (Rosatte, 1987). The pelts of both eastern and western spotted skunks represent an insignificant fraction of the modern fur trade. In the 1983-1984 trapping season, 5,588 pelts described as spotted skunk were harvested in the United States (Novak et al., 1987). The species is declining in the midwest and portions of the east, but common in southern Florida (Reid 2006). Pesticides present a threat to the species in areas with intensive agriculture.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The populations status of this species is in question throughout its range (Kaplan and Mead, 1991). It is listed as endangered in Missouri, and threatened in Iowa and Kansas. It has been listed as "special concern" in Minnesota (since 1984) and also similarly listed in Nebraska (Boppel and Long, 1994). It is corsidered "rare" in North Dakota and Oklahoma (Wires and Baker, 1994).

Reed and Kennedy (2000) in a study conducted in eastern Tennessee argued that it is still not clear that conservation measures are necessary to insure long-term perpetuation of the species, because there is no evidence of a decline in eastern spotted skunks over time in that region. Programs to monitor this species in eastern Tennessee would contribute significantly to the long-term perpetuation of the species in the southern Appalachians.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Eastern Spotted Skunks are deliberately killed by humans for their pelts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Trapped for pelt in some areas (dealers paid average of about $5 per pelt in early 1980s in Oklahoma, Caire et al. 1989). May be locally destructive to poultry.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eastern spotted skunk

The eastern spotted skunk (Spilogale putorius) is a small, relatively slender skunk found throughout the eastern United States and in small areas of Canada and Mexico.

Skull

This small skunk is more weasel-like in body shape than the more familiar striped skunk. The eastern spotted skunk has four stripes on its back[2] which are broken in pattern, giving it a "spotted" appearance. They have a white spot on their forehead. They are found in Canada (southeast Manitoba and northwestern Ontario), the United States and northeastern Mexico.[1] Males, at 46.3–68.8 cm (18.2–27.1 in) in total length, are large than females, at 35–54.4 cm (14–21.4 in).[2] Roughly a third of their total length is comprised by the tail. Body mass can range from 0.2 to 1.8 kg (0.44 to 4.0 lb), with males averaging around 700 g (1.5 lb) against the female's average of 450 g (0.99 lb).[3] Skull length is 43–55 mm (1.7–2.2 in).[4] The Eastern spotted skunk is a very small skunk, which (for comparison sake) is no larger than a good-sized tree squirrel.[2][5]

They are much more active than any other type of skunk. They have mostly the same predators as any other skunk (big cats, bobcats, owls, humans, etc.). Up to eight skunks may share an underground den in the winter. They can also climb and take shelter in trees.[citation needed]

Eastern spotted skunks seem to prefer forest edges and upland prairie grasslands, especially where rock outcrops and shrub clumps are present. In western counties, it relies heavily on riparian corridors where woody shrubs and woodland edges are present. Woody fencerows, odd areas, and abandoned farm buildings are also important habitat for Eastern Spotted Skunks.

Fur skin of Spilogale putorius

Contents

Characteristics

Spilogale putorius possess a small weasel-like body with fine, dense black fur that has 4 to 6 broken, white stripes.[6] Two of the stripes are located at the median of the body and four stripes are placed on the side running from the back of the head to the rear. White markings are present on both cheeks, as well as on the tip of the tail. This is known as an aposematic fur pattern and is thought to act as a warning to predators.

The typical body length of eastern spotted skunks is 24 to 26 centimetres (9.4 to 10 in) with a tail length from 11 to 19 centimetres (4.3 to 7.5 in), resulting in a total length of 35 to 45 centimetres (14 to 18 in). The feet are 40 to 53 millimetres (1.6 to 2.1 in) long, and the forefeet have claws approximately 7 millimetres (0.28 in) long, while the hind feet have claws that are around 3.5 centimetres (1.4 in). The feet are equipped with pads on the soles that aid in climbing. The large claws of the forefeet help the skunk dig and grasp prey. The total body weight of adults ranges from 400 to 965 grams (14 to 34.0 oz).

Behavior

Eastern spotted skunks are quite secretive and crafty creatures, and it is a rarity for humans to see them. They are also nocturnal and tend to be more active during dry cool nights rather than warm wet nights. Although these skunks do not hibernate, they do tend to greatly reduce their activity when enduring intensely warm summers or very cold winters.[6] Generally speaking, out of the four species, S. putorius is the most active. They are also more agile and vigilant than the other skunks dwelling in North America.

In addition to performing a handstand before spraying a potential predator, the skunk also performs what foot stamping, which involves the skunk stamping its feet on the ground in order to warn an approaching predator. The stamping can be heard for several meters away and is usually followed by the skunk spraying its odorous solution. When these skunks encounter an egg that they want to eat they will straddle the egg with their front legs and bite the egg open. If this fails they will then proceed to use their front legs to push the egg back and kick it with one of their hind legs.[6]

Breeding

Eastern spotted skunks breed mostly in the later winter months and give birth in late Spring to early Summer. On average the female skunk will give birth to 4–5 baby skunks (kits) at a time. It takes twelve weeks before newborn skunks will become fully developed into adult skunks and two months before they develop skunk musk to use as self-defense.

References

  1. ^ a b Cuarón, A.D., Reid, F. & Helgen, K. (2008). Spilogale putorius. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 27 January 2009.
  2. ^ a b c John O. Whitaker, Jr. (30 July 2010). Mammals of Indiana: A Field Guide. Indiana University Press. p. 1. ISBN 978-0-253-22213-8. http://books.google.com/books?id=O3appfc3S7cC. Retrieved 23 November 2011. 
  3. ^ [1]
  4. ^ Hunter, Luke (2011). Carnivores of the World. Princeton University Press. ISBN 978-0-691-15228-8. 
  5. ^ [2]
  6. ^ a b c Bullock, Lindsay (December 2008). "Mammals of Mississippi". Department of Wildlife and Fisheries. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Spilogale gracilis is included in S. putorius by some authors (e.g., Wozencraft, in Wilson and Reeder 1993). Mead (1968) argued that Spilogale gracilis and possibly leucoparia, both of which were included in S. putorius by Van Gelder (1959) and Hall (1981), are reproductively isolated from eastern populations and therefore should be considered distinct species. Jones et al. (1992) and Wozencraft (in Wilson and Reeder 2005) regarded Spilogale gracilis and S. putorius as separate species.

Based on patterns of mtDNA variation in Mustelidae, Dragoo and Honeycut (1997) recommended that skunks (Mephitis, Conepatus, Spilogale) and the Oriental stink badger (Mydaus) be separated as a distinct family (Mephitidae). Wozencraft (in Wilson and Reeder 2005) recognized Mephitidae as valid family.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!