Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Description

"Badgers look like short, shaggy, medium-sized dogs. They are powerful diggers. One, taken to a football game as a mascot, escaped and dug its way under the field. They dig after and feed on ground squirrels and pocket gophers, and also eat toads, frogs, birds, snakes, insects and insect grubs, wasps, bees, and worms. They sleep through most of the winter in a den, spending about 29 hours at a time in a state of torpor, rousing briefly, and then sleeping again. In torpor, which is not true hibernation, the Badger's heartbeat slows to about half the normal rate and its temperature drops. Humans are the Badgers' worst enemy, trapping and poisoning them, but they are now protected in some states and provinces."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: "Schreber, J.C.D., 1777.  in Schreber's Die Säugthiere in Abbildungen nach der Natur mit Beschreibungen, Wolfgang Walther, Erlangen, 7 volumes, 1774-1846; 3(26):pl. 142[1778], text, 3(26):520[1777]."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Southern Canada (British Columbia, Alberta, Saskatchewan, Manitoba, and southern Ontario), south and west to Texas, and Puebla and Baja California, Mexico (Wozencraft, in Wilson and Reeder 1993; Long, in Wilson and Ruff 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The species is distributed from southern Canada (British Columbia, Alberta, Saskatchewan, Manitoba, and southern Ontario), over a majority of the northern, western and central United States, and south to Puebla and Baja California, Mexico (Wozencraft, in Wilson and Reeder 1993; Long, in Wilson and Ruff 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Badgers are found mainly in the Great Plains region of North America. Badgers occur north through the central western Canadian provinces, in appropriate habitat throughout the western United States, and south throughout the mountainous areas of Mexico. They have expanded their range since the turn of the 20th century and are now found as far east as Ontario, Canada.

Biogeographic Regions: nearctic (Native )

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor: University of Michigan Press.
  • Long, C. 1999. American badger: Taxidea taxus. Pp. 177-179 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American badgers are widely distributed in North America from central Alberta
south to central Mexico, and from the Pacific coast east to the Great
Lakes States [19]. Subspecies distributions are as follows.

T. t. berlandieri occurs from Oklahoma and Texas to the northern Sierra
Nevada and south to Mexico.

T. t. jacksoni occurs from Ohio and extreme southeastern Ontario to
Michigan, northern Indiana, northern Illinois, Wisconsin, Minnesota,
Quebec, and southeastern Saskatchewan.

T. t. jeffersonii occurs in the western Great Plains from Colorado,
Wyoming, and eastern Montana to southern British Columbia, Washington,
Oregon, western California, and northern Baja California.

T. t. taxus occurs from western Ohio, Indiana, and northern and western
Missouri to eastern Colorado, eastern Wyoming, and eastern Montana;
north to Alberta, Manitoba, and southwestern Saskatchewan.

There is considerable overlap in the ranges of subspecies, with
intermediate forms occurring in the areas of overlap. American badgers are
undergoing range extensions eastward through escape or release of
captive animals, and because of changes in agricultural patterns [19].
  • 19. Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing. 404 p. [25718]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AZ AR CA CO ID IL IN IA MI MN MO MT NE
NV NM ND OH OK OR SD TN TX UT WA WI WY


AB BC MB ON PQ SK



MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Badgers are found primarily in the Great Plains region of North America. Badgers occur north through the central western Canadian provinces, in appropriate habitat throughout the western United States, and south throughout the mountainous areas of Mexico. They have expanded their range since the turn of the 20th century and are now found as far east as Ontario, Canada.

Biogeographic Regions: nearctic (Native )

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor: University of Michigan Press.
  • Long, C. 1999. American badger: Taxidea taxus. Pp. 177-179 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Badgers measure 520 to 875 mm from head to tail, with the tail making up only 100 to 155 mm of this length. Badgers weigh 4 to 12 kg. The body is flattened, and the legs are short and stocky. The fur on the back and sides of the animal ranges from grayish to reddish. The belly is a buffy color. The face of the badger is distinct. The throat and chin are whitish, and the face has black patches. A white stripe extends back over the head from the nose. In northern populations, this stripe ends near the shoulders. In southern populations, however, it continues over the back to the rump. Males are significantly larger than females and animals from northern populations are larger than those from southern populations.

Range mass: 4 to 12 kg.

Range length: 520 to 875 mm.

Other Physical Features: endothermic ; heterothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 15.062 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Badgers measure 520 to 875 mm from head to tail, with the tail making up only 100 to 155 mm of this length. Badgers weigh 4 to 12 kg. The body is flattened, and the legs are short and stocky. The fur on the back and flanks of the animal ranges from grayish to reddish. The ventrum is a buffy color. The face of the badger is distinct. The throat and chin are whitish, and the face has black patches. A white dorsal stripe extends back over the head from the nose. In northern populations, this stripe ends near the shoulders. In southern populations, however, it continues over the back to the rump. Males are significantly larger than females and animals from northern populations are larger than those from southern populations.

Range mass: 4 to 12 kg.

Range length: 520 to 875 mm.

Other Physical Features: endothermic ; heterothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 15.062 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 87 cm

Weight: 11400 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: "600-790 mm "

Weight:
Range: up to 12 kg in the wild, 18 kg in captivity
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Other North American mammals of similar size and shape (low flat profile) include skunks and wolverine; differs from skunks in lacking extensive black pelage, differs from wolverine in having a white middorsal head stripe.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Prefers open areas and may also frequent brushlands with little groundcover. When inactive, occupies underground burrow.

Young are born in underground burrows. In Idaho, activites of females with young (March-May) centered on a sequence of maternal dens (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Prefers open areas and may also frequent brushlands with little groundcover. When inactive, occupies underground burrow. Badgers are known to inhabit regions ranging from below sea level to elevations 3,600 m (Kyle et al., 2004). They are usually found in relative dry, grasslands and open forests (Rahme et al. 1995). Taxidea may be active at any hour but is mainly nocturnal.

Feeds primarily on small rodents usually captured by digging out burrow. Ground squirrels often major item in diet, as are pocket gophers, kangaroo rats, priairie dogs, and mice; also eats scorpions, insects, snakes, lizards, and birds, especially when ground squirrel population is low (Messick and Hornocker 1981).

Its movements are restricted, especially in winter, and it shows a strong attachment to a home area. Estimated home ranges vary from 2 to 725 ha changing seasonally (Sargeant and Warne, 1972). The badger is active all year, but it may sleep in its den for several days or weeks during severe winter weather (Nowak, 2005). Most food is obtained by excavating the burrows of fossorial rodents. Also eaten are other small mammals, birds, reptiles and arthropods.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Badgers prefer to live in dry, open grasslands, fields, and pastures. They are found from high alpine meadows to sea level (or below in Death Valley, California).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; mountains

Wetlands: marsh

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: density

American badgers occur primarily in grasslands, parklands, farms, and other
treeless areas with friable soil and a supply of rodent prey [1,6].
They are also found in forest glades and meadows, marshes, brushy areas,
hot deserts, and mountain meadows. American badgers are sometimes found at
elevations up to 12,000 feet (3,600 m) but are usually found in the
Sonoran and Transition life zones (which are at elevations lower and
warmer than those characterized by coniferous forests) [19]. In Arizona
American badgers occur in desert scrub and semidesert grasslands [5]. In
California American badgers are occasionally found in open chaparral (with less
than 50% plant cover) and riparian zones. They are not usually found in
mature chaparral [25]. In Manitoba aspen parklands American badger abundance was
positively associated with the abundance of Richardson's ground
squirrels (Spermophilus richardsonii) [3].

Home Range: American badger use of home range varies with season and sex of the
American badger. Different areas of the home range are used more frequently at
different seasons and usually are related to prey availability. Males
generally have larger home ranges than females. Radio-transmitter
tagged American badgers had an average annual home range of 2,100 acres (850 ha).
The home range of one female was 1,790 acres (725 ha) in summer, 131
acres (53 ha) in fall, and 5 acres (2 ha) in winter [26]. Lindzey [15]
reported average home ranges of 667 to 1,550 acres (270-627 ha).

Population Density: Estimated density of American badgers in Utah scrub-steppe
was 1 American badger per square mile (2.6 sq km), or 10 dens per square mile
(assuming a single American badger has 10 dens in current or recent use) [18].
  • 1. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 3. Bird, Ralph D. 1930. Biotic communities of the aspen parkland of central Canada. Ecology. 11(2): 356-442. [15277]
  • 5. Davis, Russell; Sidner, Ronnie. 1992. Mammals of woodland and forest habitats in the Rincon Mountains of Saguaro National Monument, Arizona. Technical Report NPS/WRUA/NRTR-92/06. Tucson, AZ: The University of Arizona, School of Renewable Natural Resources, Cooperative National Park Resources Study Unit. 62 p. [20966]
  • 6. de Vos, A. 1969. Ecological conditions affecting the production of wild herbivorous mammals on grasslands. In: Advances in ecological research. [Place of publication unknown]
  • 15. Lindzey, Frederick G. 1978. Movement patterns of badgers in northwestern Utah. Journal of Wildlife Management. 42(2): 418-422. [25833]
  • 18. Long, Charles A. 1973. Taxidea taxus. Mammalian Species. 26: 1-4. [25832]
  • 19. Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing. 404 p. [25718]
  • 25. Quinn, Ronald D. 1990. Habitat preferences and distribution of mammals in California chaparral. Res. Pap. PSW-202. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station. 11 p. [15761]
  • 26. Sargeant, Alan B.; Warner, Dwain W. 1972. Movements and denning habits of a badger. Journal of Mammalogy. 53(1): 207-210. [25830]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

American badgers are most commonly found in treeless areas including tallgrass
and shortgrass prairies, grass-dominated meadows and fields within
forested habitats, and shrub-steppe communities. In the Southwest plant
indicators of the Sonoran and Transition life zones (relatively low, dry
elevations) commonly associated with American badgers include creosotebush
(Larrea tridentata), junipers (Juniperus spp.), Gambel oak (Quercus
gambelii), willows (Salix spp.), cottonwoods (Populus spp.), ponderosa
pine (Pinus ponderosa), grasses, and sagebrushes (Artemisia spp.) [19].
In Colorado American badgers are common in grass-forb and ponderosa pine habitats
[22]. In Kansas American badgers are common in tallgrass prairie dominated by
big bluestem (Andropogon gerardii), little bluestem (Schizachyrium
scoparium), and Indian grass (Sorghastrum nutans) [9]. In Montana
American badgers are present in Glacier National Park in fescue (Festuca spp.)
grasslands [30]. In Manitoba American badgers occur in grassland extensions
within aspen (Populus spp.) parklands [3].

REFERENCES :
NO-ENTRY
  • 3. Bird, Ralph D. 1930. Biotic communities of the aspen parkland of central Canada. Ecology. 11(2): 356-442. [15277]
  • 9. Gibson, David J. 1989. Effects of animal disturbance on tallgrass prairie vegetation. American Midland Naturalist. 121: 144-154. [6641]
  • 19. Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing. 404 p. [25718]
  • 22. Morris, Meredith J.; Reid, Vincent H.; Pillmore, Richard E.; Hammer, Mary C. 1977. Birds and mammals of Manitou Experimental Forest, Colorado. Gen. Tech. Rep. RM-38. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment. 17 p. [13483]
  • 30. Tyser, Robin W. 1990. Ecology of fescue grasslands in Glacier National Park. In: Boyce, Mark S.; Plumb, Glenn E., eds. National Park Service Research Center, 14th annual report. Laramie, WY: University of Wyoming, National Park Service Research Center: 59-60. [14766]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: association, marsh, shrub

101 Bluebunch wheatgrass
102 Idaho fescue
103 Green fescue
104 Antelope bitterbrush-bluebunch wheatgrass
105 Antelope bitterbrush-Idaho fescue
106 Bluegrass scabland
107 Western juniper/big sagebrush/bluebunch wheatgrass
204 North coastal shrub
205 Coastal sage shrub
206 Chamise chaparral
207 Scrub oak mixed chaparral
208 Ceanothus mixed chaparral
209 Montane shrubland
210 Bitterbrush
211 Creosotebush scrub
212 Blackbush
215 Valley grassland
301 Bluebunch wheatgrass-blue grama
302 Bluebunch wheatgrass-Sandberg bluegrass
303 Bluebunch wheatgrass-western wheatgrass
304 Idaho fescue-bluebunch wheatgrass
305 Idaho fescue-Richardson needlegrass
306 Idaho fescue-slender wheatgrass
307 Idaho fescue-threadleaf sedge
308 Idaho fescue-tufted hairgrass
309 Idaho fescue-western wheatgrass
311 Rough fescue-bluebunch wheatgrass
312 Rough fescue-Idaho fescue
313 Tufted hairgrass-sedge
322 Curlleaf mountain-mahogany-bluebunch wheatgrass
323 Shrubby cinquefoil-rough fescue
413 Gambel oak
414 Salt desert shrub
415 Curlleaf mountain-mahogany
416 True mountain-mahogany
501 Saltbush-greasewood
502 Grama-galleta
503 Arizona chaparral
505 Grama-tobosa shrub
506 Creosotebush-bursage
507 Palo verde-cactus
508 Creosotebush-tarbush
509 Transition between oak-juniper woodland and mahogany-oak association
601 Bluestem prairie
602 Bluestem-prairie sandreed
603 Prairie sandreed-needlegrass
604 Bluestem-grama prairie
605 Sandsage prairie
606 Wheatgrass-bluestem-needlegrass
607 Wheatgrass-needlegrass
608 Wheatgrass-grama-needlegrass
609 Wheatgrass-grama
610 Wheatgrass
611 Blue grama-buffalograss
612 Sagebrush-grass
614 Crested wheatgrass
615 Wheatgrass-saltgrass-grama
701 Alkali sacaton-tobosagrass
702 Black grama-alkali sacaton
703 Black grama-sideoats grama
704 Blue grama-western wheatgrass
705 Blue grama-galleta
706 Blue grama-sideoats grama
707 Blue grama-sideoats grama-black grama
708 Bluestem-dropseed
709 Bluestem-grama
710 Bluestem prairie
711 Bluestem-sacahuista prairie
712 Galleta-alkali sacaton
713 Grama-muhly-threeawn
714 Grama-bluestem
715 Grama-buffalograss
716 Grama-feathergrass
717 Little bluestem-Indiangrass-Texas wintergrass
718 Mesquite-grama
720 Sand bluestem-little bluestem (dunes)
721 Sand bluestem-little bluestem (plains)
722 Sand sagebrush-mixed prairie
724 Sideoats grama-New Mexico feathergrass-winterfat
801 Savanna
802 Missouri prairie
803 Missouri glades
804 Tall fescue
805 Riparian
819 Freshwater marsh and ponds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: shrub

K011 Western ponderosa forest
K016 Eastern ponderosa forest
K017 Black Hills pine forest
K018 Pine-Douglas-fir forest
K019 Arizona pine forest
K022 Great Basin pine forest
K024 Juniper steppe woodland
K033 Chaparral
K034 Montane chaparral
K037 Mountain-mahogany-oak scrub
K038 Great Basin sagebrush
K040 Saltbush-greasewood
K041 Creosotebush
K047 Fescue-oatgrass
K050 Fescue-wheatgrass
K051 Wheatgrass-bluegrass
K053 Grama-galleta steppe
K054 Grama-tobosa prairie
K055 Sagebrush steppe
K056 Wheatgrass-needlegrass shrubsteppe
K057 Galleta-three-awn shrubsteppe
K058 Grama-tobosa shrubsteppe
K059 Trans-Pecos shrub savanna
K063 Foothills prairie
K064 Grama-needlegrass-wheatgrass
K065 Grama-buffalograss
K066 Wheatgrass-needlegrass
K067 Wheatgrass-bluestem-needlegrass
K068 Wheatgrass-grama-buffalograss
K069 Bluestem-grama prairie
K070 Sandsage-bluestem prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem-sacahuista prairie
K085 Mesquite-buffalograss
K088 Fayette prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES14 Oak-pine
FRES15 Oak-hickory
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

American badgers enlarge hunting burrows for concealment, protection from
weather, and as natal dens; burrows are up to 30 feet (10 m) long and 10
feet (3 m) deep. Large mounds of soil are built up at burrow entrances [1].

During the summer American badgers usually use a new den each day; holes are
usually excavated at least a few days prior to their being used as a
den. There was an average of 0.64 dens (in use, signified by an open
hole) per acre (1.6/ha) in northern Utah scrub steppe [15]. Where prey
is particularly plentiful, American badgers will reuse dens [19]. In the fall
American badgers tend to reuse dens, sometimes for a few days at a time. In
winter a single den may be used for the majority of the season [18].
Natal dens are dug by the female and are used for extended periods, but
litters are often moved several times, probably to allow the mother to
forage in new areas close to the nursery. Natal dens are usually larger
and more complex than diurnal dens [16].
  • 1. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 15. Lindzey, Frederick G. 1978. Movement patterns of badgers in northwestern Utah. Journal of Wildlife Management. 42(2): 418-422. [25833]
  • 16. Lindzey, Frederick G. 1982. Badger: Taxidea taxus. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 653-663. [25233]
  • 18. Long, Charles A. 1973. Taxidea taxus. Mammalian Species. 26: 1-4. [25832]
  • 19. Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing. 404 p. [25718]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

217 Aspen
237 Interior ponderosa pine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Badgers prefer to live in dry, open grasslands, fields, and pastures. They are found from high alpine meadows to sea level (or below in Death Valley, California).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; mountains

Wetlands: marsh

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In Idaho, home ranges of adult males averaged 2.4 square kilometers, whereas those of females averaged 1.6 square kilometers; most young-of-the-year dispersed during their first summer, up to 110 km in males, up to 52 km in females (Messick and Hornocker 1981).

In southeastern Wyoming, home ranges averaged 12.3 square kilometers in males, 3.4 square kilometers in females (Goodrich and Buskirk 1998).

A female in Minnesota had a summer home range of 7.5 square kilometers and moved to an adjacent, but much smaller area in the winter (Sargeant and Warner 1972).

Where favorable habitat is patchier, home ranges can be significantly larger. In southeastern British Columbia, male home ranges averaged 69 square kilometers (fixed kernel method) and those of females averaged 38 square kilometers (Newhouse and Kinley 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on small rodents usually captured by digging out burrow. Ground squirrels often major item in diet, as are pocket gophers, kangaroo rats, priairie dogs, and mice; also eats scorpions, insects, snakes, lizards, and birds, especially when ground squirrel population is low (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Badgers are carnivorous. Their dominant prey are Geomyidae, Spermophilus, Talpidae, Marmota, Cynomys, Neotoma, Dipodomys, Peromyscus, and Microtus. They also prey on ground nesting birds, such as Riparia riparia and Athene cunicularia, Squamata, Amphibia, carrion, Actinopterygii, hibernating Mephitis, Insecta, including Apidae and honeycomb, and some plant foods, such as Zea and Helianthus. Unlike many Carnivora that stalk their prey in open country, badgers catch most of their food by digging. They can tunnel after ground dwelling rodentia with amazing speed. They sometimes store food for later.

Animal Foods: birds; mammals; amphibians; reptiles; insects; terrestrial non-insect arthropods

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: association

The American badger is largely carnivorous although some plant foods (e.g.,
sunflower [Helianthus spp.] seeds, corn [Zea mays], and small grains)
are consumed. American badgers prey mainly on small vertebrates, especially
fossorial rodents. Commonly taken rodents include moles (Talpidae),
marmots (Marmota spp.), mice (Muridae), woodrats (Neotoma spp.),
kangaroo rats (Dipodomys spp.), ground squirrels (Spermophilus spp.),
pocket gophers (Thomomys spp.), and prairie dogs (Cynomys spp.).
Occasionally lagomorphs are taken, usually only if suprised or trapped
in burrows. Other food items include fish, snakes, lizards, carrion,
hibernating skunks (Mephitis and Spilogale spp.), insects, honeycombs,
bees, larvae, and eggs and nestlings of ground-nesting birds such as
bank swallows (Riparia riparia) [18,19,28] and burrowing owls (Athene
cunicularia) [23]. American badger predation on coyote pups (Canis latrans) has
also been reported [19]. American badgers may be nest predators of the
ground-nesting short-eared owl (Asio flammeus) [31]. Long [17] reported
a American badger with five western toads (Bufo boreas) in its stomach, in
addition to a salamander (Ambystoma spp.) and five meadow voles
(Microtus pennsylvanicus). Caching of food has been reported [19].

Hunting: American badgers enlarge and dig out the burrows of fossorial rodents
in pursuit of prey. They have been observed to plug accessory entrances
to burrow systems, presumably to trap prey within the burrow. They also
dig into a burrow from the "back entrance" and then lurk in the main
entrance, capturing prey as it enters the burrow [19].

Coyotes have been observed following American badgers while American badgers were
foraging, capturing rodents flushed from burrows by the American badger [21,28].
In a big sagebrush (Artemisia tridentata)-rabbitbrush (Chrysothamnos
spp.) community in Wyoming, Uinta ground squirrels (Spermophilus
armatus) comprised the majority of American badger prey. Coyotes that followed
American badgers greatly benefited from the hunting association. It was
difficult to assess whether the American badger benefited from the hunting
association. It was suggested that coyotes could increase American badger
hunting efficiency by remaining at burrow exits, thus keeping ground
squirrels from using them. Coyotes also help find new burrow areas, and
appear to encourage American badgers to move to new hunting areas by chasing-play
behaviors. Since American badger hunting efficiency could not be assessed
directly, time spent below ground was presumed to indicate hunting
success. American badgers with coyote "partners" spent more time below ground
and presumably caught more ground squirrels than solitary hunting
American badgers. American badger behavior in the company of coyotes indicated that the
coyote association was either neutral or positive, since American badgers often
tolerated coyotes in close proximity and engaged in play behaviors with
them [21].
  • 17. Long, Charles A. 1964. The badger as a natural enemy of Ambystoma tigrinum and Bufo boreas. Herpetologica. 20(2): 144. [24384]
  • 18. Long, Charles A. 1973. Taxidea taxus. Mammalian Species. 26: 1-4. [25832]
  • 19. Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing. 404 p. [25718]
  • 21. Minta, Steven C.; Minta, Kathryn A.; Lott, Dale F. 1992. Hunting associations between badgers (Taxidea taxus) and coyotes (Canis latrans). Journal of Mammalogy. 73(4): 814-820. [20972]
  • 23. Olendorff, Richard R.; Stoddart, John W., Jr. 1974. The potential for management of raptor populations in western grasslands. In: Hamerstrom, B. E., Jr.; Harrell, W.; Olendorff, R. R., eds. Raptor Research: Report 2: 47-88. [22982]
  • 28. Skinner, Scott. 1990. Earthmover. Wyoming Wildlife. 54(2): 4-9. [25829]
  • 31. Walley, W. J. 1972. Summer observations of the short-eared owl in the Red River Valley. Prairie Naturalist. 4(2): 39-41. [22261]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Badgers are carnivorous. Their dominant prey are pocket gophers (Geomyidae), ground squirrels (Spermophilus), moles (Talpidae), marmots (Marmota), prairie dogs (Cynomys), woodrats (Neotoma), kangaroo rats (Dipodomys), deer mice (Peromyscus), and voles (Microtus). They also prey on ground nesting birds, such as bank swallows (Riparia riparia and burrowing owls Athene cunicularia), lizards, amphibians, carrion, fish, hibernating skunks (Mephitis and Spilogale), insects, including bees and honeycomb, and some plant foods, such as corn (Zea) and sunflower seeds (Helianthus). Unlike many carnivores that stalk their prey in open country, badgers catch most of their food by digging. They can tunnel after ground dwelling rodents with amazing speed. They have been known to cache food.

Animal Foods: birds; mammals; amphibians; reptiles; insects; terrestrial non-insect arthropods

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Badgers are important consumers of many small prey items in their ecosystem. They help to control rodent populations, kill venomous snakes, and eat insects and carrion. Their burrows provide shelter for other species and their digging activity helps in soil development.

Badgers and coyotes are sometimes seen hunting at the same time in an apparently cooperative manner. Badgers can readily dig rodents out of burrows but cannot run them down readily. Coyotes, on the other hand, can readily run rodents down while above ground, but cannot effectively dig them out of burrows. When badgers and coyotes hunt in the same area at the same time, they may increase the number of rodents available to the other. Coyotes take advantage of rodents attempting to escape from badgers attacking their burrows and it has been demonstrated that coyotes benefit from the association. Badgers may be able to take advantage of rodents that are escaping coyotes by fleeing into burrows, but it is more difficult to assess whether badgers actually do benefit from this association. Badgers and coyotes tolerate each other's presence and may even engage in play behavior.

Ecosystem Impact: creates habitat; soil aeration

Mutualist Species:

  • coyotes (Canis_latrans)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Natural predation on badgers is rare, with young animals being most vulnerable. The primary predators of badgers are humans who are responsible for habitat destruction, trapping, hunting, automobile fatalities, and poisoning. Other reported predators of American badgers include golden eagles (Aquila_chrysaetos), bobcats (Lynx_rufus), cougars (Puma_concolor), and coyotes (Canis_latrans). Bears (Ursus) and gray wolves (Canis_lupus) may also sometimes take badgers.

Known Predators:

  • humans (Homo_sapiens)
  • golden eagles (Aquila_chrysaetos)
  • bobcats (Lynx_rufus)
  • cougars (Puma_concolor)
  • coyotes (Canis_latrans)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

More info for the term: natural

The American badger is an aggressive animal and has few natural enemies. There
are reports of predation on American badgers by golden eagle (Aquila chrysaetos),
coyote [18], cougar (Felis concolor), and bobcat (Lynx rufus) [28].
Bears (Ursus spp.) and gray wolf (Canis lupus) occasionally kill American badger [16].
  • 16. Lindzey, Frederick G. 1982. Badger: Taxidea taxus. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 653-663. [25233]
  • 18. Long, Charles A. 1973. Taxidea taxus. Mammalian Species. 26: 1-4. [25832]
  • 28. Skinner, Scott. 1990. Earthmover. Wyoming Wildlife. 54(2): 4-9. [25829]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Badgers are important consumers of many small prey items in their ecosystem. They help to control rodent populations, kill venomous snakes, and eat insects and carrion. Their burrows provide shelter for other species and their digging activity helps in soil development.

Badgers and coyotes are sometimes seen hunting at the same time in an apparently cooperative manner. Badgers can readily dig rodents out of burrows but cannot run them down readily. Coyotes, on the other hand, can readily run rodents down while above ground, but cannot effectively dig them out of burrows. When badgers and coyotes hunt in the same area at the same time, they may increase the number of rodents available to the other. Coyotes take advantage of rodents attempting to escape from badgers attacking their burrows and it has been demonstrated that coyotes benefit from the association. Badgers may be able to take advantage of rodents that are escaping coyotes by fleeing into burrows, but it is more difficult to assess whether badgers actually do benefit from this association. Badgers and coyotes tolerate each other's presence and may even engage in play behavior.

Ecosystem Impact: creates habitat; soil aeration

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Natural predation on badgers is rare, with young animals being most vulnerable. The primary predators of badgers are humans who are responsible for habitat destruction, trapping, hunting, automobile fatalities, and poisoning. Other reported predators of American badgers include golden eagles (Aquila chrysaetos), bobcats (Lynx rufus), cougars (Puma concolor), and coyotes (Canis latrans). Bears (Ursus) and gray wolves (Canis lupus) may also sometimes take badgers.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 383 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: U.S. population roughly estimated to be on the order of several hundred thousand; Canadian population less than 50,000 (Newhouse and Kinley 1999). No estimates for Mexican population. In areas of abundance, can reach densities of 3-5/square kilometer (Long, in Wilson and Ruff 1999).

In Canada, both T. t. jacksoni in Ontario and T. t. jeffersonii in British Columbia are recognized as endangered, with as few as 200 and 600 animals remaining, respectively (Kyle et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Basicaly solitary, though home ranges may overlap (Messick and Hornocker 1981).

Density averages 1 per sq mile in prime open country (Long 1973). In southeastern Wyoming, density was 0.8-1.1 per sq km (Goodrich and Buskirk 1998).

In Idaho, half of the population was young-of-the-year (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the term: wildfire

The most important effect of fire on American badger habitat is its effect on
prey populations. American badgers probably leave a burned area if rodent
populations decline; however, some rodents increase on fire-disturbed
areas, making it likely that American badger activity would also increase in
those areas. In a southwestern Idaho shadscale (Atriplex
confertifolia)-winterfat (Krascheninnikovia lanata) community, wildfire
reduced the abundance of small mammals in the first postfire year. In
the same year, American badger numbers were lower (by hole counts) on burned
sites than on adjacent unburned sites [11]. Also in southwestern Idaho,
desert shrublands were converted to annual grasslands due to wildfire.
The major prey of American badgers in this area, Townsend's ground squirrels
(Spermophilus townsendii), experienced more widely fluctuating
populations on burned areas than on unburned areas. It was concluded
that wildfire in this community destablized the prey base, and would
adversely affect American badgers [33]. In Kansas tallgrass prairie there were
slightly fewer American badgers on burned areas sampled in the first postfire
growing season than on unburned areas (three versus six American badgers) [9].

Pocket gophers, which are a major prey item for American badgers in western North
America, often increase on lands disturbed by fire (also road building,
logging, silvicultural site preparation, and other activities that open
tree canopies and/or disturb the soil) [29]. Early postfire succession
in California chaparral communities is often accompanied by large
populations of fossorial rodents such as California ground squirrel (S.
beecheyi) and kangaroo rats [10] and would thus attract American badgers [25].
  • 9. Gibson, David J. 1989. Effects of animal disturbance on tallgrass prairie vegetation. American Midland Naturalist. 121: 144-154. [6641]
  • 10. Grinnell, Joseph; Dixon, Joseph S.; Linsdale, Jean M. 1937. Fur-bearing mammals of California: Their natural history, systematic status, and relations to man. Berkeley, CA: University of California Press. 2 vol. 777 p. [25979]
  • 11. Groves, Craig R.; Steenhof, Karen. 1988. Responses of small mammals and vegetation to wildfire in shadscale communities of southwestern Idaho. Northwest Science. 62(5): 205-210. [6584]
  • 25. Quinn, Ronald D. 1990. Habitat preferences and distribution of mammals in California chaparral. Res. Pap. PSW-202. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station. 11 p. [15761]
  • 29. Teipner, Cynthia Lea; Garton, Edward O.; Nelson, Lewis, Jr. 1983. Pocket gophers in forest ecosystems. Gen. Tech. Rep. INT-154. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 53 p. [20012]
  • 33. Yensen, Eric; Quinney, Dana L.; Johnson, Kathrine; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Seasonal Activity Patterns: At high elevations and latitudes American badgers
are inactive, perhaps even torpid, for extended periods in winter. They
are not true hibernators and emerge from their dens on winter days when
the temperatures are above freezing [18].

Diurnal Activity: American badgers are largely nocturnal but have been reported
active during the day as well [18].

Breeding Season: Mating occurs in late summer and early fall [18].

Gestation and Parturition: American badgers experience delayed implantation.
Pregnancies are suspended until December or as late as February. Young
are born from late March to early April [18]. Litters range from one to
five young [16], averaging about three [19].

Development of Young: American badgers are born blind, furred, and helpless
[18]. Eyes open at 4 to 6 weeks. The female feeds her young solid
foods prior to complete weaning, and for a few weeks thereafter [19].
Young American badgers first emerge from the den on their own at 5 to 6 weeks
[16,20]. Families usually break up and juveniles disperse from the end
of June to August; Messick and Hornocker [20] reported that young
American badgers left their mother as early as late May or June. Juvenile
dispersal movements are erratic [16].

Sexual Maturity: Most female American badgers become pregnant for the first time
after thay are 1 year old. A minority of females 4 to 5 months old
ovulate and a few become pregnant. Males usually do not breed until
their second year [18].

Mortality and Longevity: Major causes of adult American badger mortality
include, in order, automobiles, farmers (by various methods), sport
shooting, and fur trapping. Large predators occasionally kill American badgers
[16]. Yearly mortality has been estimated at 35 percent for populations
in equilibrium [14]. Lindzey [14] reported that average longevity was 9
to 10 years in the wild. The longevity record for wild American badgers is 14
years; a captive American badger lived at least 15 years 5 months [16].
  • 14. Lindsey, Frederick G.. 1971. Ecology of badgers in Curlew Valley, Utah and Idaho with emphasis on movement and activity patterns. Logan, UT: Utah State Univeristy. 50 p. Thesis. [26018]
  • 16. Lindzey, Frederick G. 1982. Badger: Taxidea taxus. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 653-663. [25233]
  • 18. Long, Charles A. 1973. Taxidea taxus. Mammalian Species. 26: 1-4. [25832]
  • 19. Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing. 404 p. [25718]
  • 20. Messick, John P.; Hornocker, Maurice G. 1981. Ecology of the badger in southwestern Idaho. Wildlife Monographs. 76: 1-53. [25831]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Badgers have keen vision, scent, and hearing. They have nerve endings in the foreclaws that may make them especially sensitive to touch in their forepaws, but this has not been investigated. Not much is known about communication in these normally solitary animals, but it is likely that they use scent to communicate to potential mates.

Communication Channels: chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Badgers have keen vision, scent, and hearing. They have nerve endings in the foreclaws that may make them especially sensitive to touch in their forepaws, but this has not been investigated. Not much is known about communication in these normally solitary animals, but it is likely that home ranges are marked with scents that are used by conspecifics to determine reproductive readiness.

Communication Channels: chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Usually active day/night; reported as chiefly nocturnal in Caire et al. 1989. In Idaho, rarely stayed underground for more than 24 hours except in winter; one female emerged from winter den only once during 72-day period (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Badgers have lived to be 26 years old in captivity. The average lifespan in the wild is between 4 and 10 years, but some badgers may live up to 14 years.

Range lifespan

Status: wild:
14 (high) years.

Range lifespan

Status: captivity:
26 (high) years.

Typical lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: captivity:
26.0 years.

Average lifespan

Status: captivity:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Badgers have lived to be 26 years old in captivity. The average lifespan in the wild has been estimated by different researchers at 4 to 5 years and at 9 to 10 years. The oldest wild badger lived to 14 years. Yearly mortality was estimated at 35% by one study. Some populations are estimated to be up to 80% yearlings or young of the year, suggesting high mortality rates.

Range lifespan

Status: wild:
14 (high) years.

Range lifespan

Status: captivity:
26 (high) years.

Typical lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: captivity:
26.0 years.

Average lifespan

Status: captivity:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity) Observations: The implantation can be delayed up to 10 months. One captive specimen was at least 25 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mates mid- to late summer. Implantation is delayed until December-February. One litter averaging 3 (2-5) is born March-early April (probably late May or early June in Kansas). Young leave family group in fall. In Idaho, 30% of young-of-the-year females bred; males were sexually mature as yearlings (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The home ranges of both male and female badgers expands during the breeding season, indicating that males and females travel more extensively to find mates. Males have larger home ranges that are likely to overlap with the home ranges of several females.

Mating System: polygynandrous (promiscuous)

Mating occurs in late summer or early autumn but the development of the embryos is delayed until December or as late as February. After this period the embryos implant into their mother's uterine wall and resume development. So, although a female is technically pregnant for 7 months, embryonic development is done in a mere 6 weeks. Females give birth to 1 to 5 young, usually 3, in early spring. Females are able to mate when they are 4 months old, but males do not mate until the autumn of their second year. Most females mate after their first year.

Breeding interval: Badgers breed once per year.

Breeding season: Badgers mate in late summer or early autumn.

Range number of offspring: 1 to 5.

Average gestation period: 6 weeks.

Range weaning age: 2 to 3 months.

Range time to independence: 5 to 6 months.

Range age at sexual or reproductive maturity (female): 4 (low) months.

Average age at sexual or reproductive maturity (female): 12 months.

Average age at sexual or reproductive maturity (male): 16 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 93.5 g.

Average gestation period: 41 days.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
441 days.

Female badgers prepare a grass-lined den in which to give birth. Badgers are born blind and helpless with a thin coat of fur. The eyes of the youngsters open at 4 to 6 weeks, and the young are nursed by their mother until they are 2 to 3 months old. Females give their young solid food before they are weaned and for a few weeks after they are weaned. Young may emerge from the den as early as 5 to 6 weeks old. The young badgers leave their mother when they are 5 to 6 months old.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor: University of Michigan Press.
  • Long, C. 1999. American badger: Taxidea taxus. Pp. 177-179 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: Smithsonian Institution Press.
  • Sullivan, J. 1996. "Taxidea taxus" (On-line). USDA Forest Service, Wildlife Species. Accessed September 08, 2006 at http://www.fs.fed.us/database/feis/wildlife/mammal/tata/all.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The home ranges of both male and female badgers expands during the breeding season, indicating that males and females travel more extensively to find mates. Males have larger home ranges that are likely to overlap with the home ranges of several females.

Mating System: polygynandrous (promiscuous)

Mating occurs in late summer or early autumn but embryos are arrested early in development. Implantation is delayed until December or as late as February. After this period embryos implant into the uterine wall and resume development. So, although a female is technically pregnant for 7 months, gestation is a mere 6 weeks. Litters of 1 to 5 offspring, with an average of 3, are born in early spring. Females are able to mate when they are 4 months old, but males do not mate until the autumn of their second year. Most females mate after their first year.

Breeding interval: Badgers breed once per year.

Breeding season: Badgers mate in late summer or early autumn.

Range number of offspring: 1 to 5.

Average gestation period: 6 weeks.

Range weaning age: 2 to 3 months.

Range time to independence: 5 to 6 months.

Range age at sexual or reproductive maturity (female): 4 (low) months.

Average age at sexual or reproductive maturity (female): 12 months.

Average age at sexual or reproductive maturity (male): 16 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 93.5 g.

Average gestation period: 41 days.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
441 days.

Female badgers prepare a grass-lined den in which to give birth. Badgers are born blind and helpless with a thin coat of fur. The eyes of the youngsters open at 4 to 6 weeks old, and the young are nursed by their mother until they are 2 to 3 months old. Females give their young solid food before they are weaned and for a few weeks after they are weaned. Young may emerge from the den as early as 5 to 6 weeks old. Juveniles disperse at 5 to 6 months.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor: University of Michigan Press.
  • Long, C. 1999. American badger: Taxidea taxus. Pp. 177-179 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: Smithsonian Institution Press.
  • Sullivan, J. 1996. "Taxidea taxus" (On-line). USDA Forest Service, Wildlife Species. Accessed September 08, 2006 at http://www.fs.fed.us/database/feis/wildlife/mammal/tata/all.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taxidea taxus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGGTGACTATTCTCCACAAATCATAAGGATATCGGCACTCTCTACCTCCTATTCGGTGCATGAGCTGGAATAGTAGGCACCGCTCTCAGCCTATTAATCCGCGCAGAACTAGGCCAACCAGGCACCCTACTGGGAGATGACCAGATCTACAATGTCATTGTAACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATTATAATCGGGGGCTTCGGAAACTGATTAGTCCCCTTAATAATTGGCGCACCCGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTGCCTCCTTCCCTTCTTCTCCTACTAGCCTCCTCCATAGTGGAAGCAGGAGCAGGAACAGGATGAACCGTATACCCTCCTCTAGCAGGTAATCTAGCACATGCAGGAGCGTCCGTAGACTTAACAATTTTCTCCCTACATTTAGCAGGTGTCTCGTCCATCCTAGGGGCTATCAACTTTATCACCACTATTATTAATATAAAACCCCCCGCAATATCACAATACCAAACTCCTCTATTCGTGTGATCCGTCCTAATCACAGCCGTACTTCTGCTCTTATCCTTACCAGTACTAGCTGCCGGAATTACAATACTACTCACAGACCGAAACCTAAACACTACTTTCTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATATCAACACTTATTTTGATTCTTTGGCCACCCTGAAGTATATATTCTAATTTTACCAGGCTTTGGAATAATCTCGCACATTGTTACCTATTACTCAGGAAAGAAAGAACCTTTCGGGTACATAGGAATAGTCTGAGCCATAATATCAATCGGCTTCCTGGGATTTATCGTGTGAGCCCACCATATATTTACTGTAGGAATAGACGTCGACACACGAGCATACTTCACTTCTGCTACCATAATCATCGCAATTCCAACAGGCGTGAAAGTATTTAGCTGACTCGCTACCTTACATGGAGGAAATATTAAATGATCACCAGCCATACTATGAGCCCTAGGGTTCATCTTTCTATTTACAGTAGGTGGCTTAACAGGAATTGTATTATCAAACTCATCACTAGACATCGTTCTTCACGACACATACTATGTAGTAGCACACTTCCACTACGTCCTCTCAATAGGGGCAGTATTTGCAATCATGGGCGGATTTGCCCACTGATTCCCACTATTTACAGGCTATACTCTAAATGATGTTTGGGCAAAAGCTCACTTCACAATTATATTTGTAGGAGTCAACATAACATTTTTTCCTCAACATTTCCTAGGACTATCCGGCATACCACGACGATACTCCGACTACCCAGACGCTTATACAACATGAAATACAGTGTCTTCCATAGGTTCATTCATTTCACTAACAGCAGTAATACTAATAATCTTCATAATCTGAGAGGCCTTTGCATCTAAACGAGAAGTATTAATGGTAGAACTCACCTCAACAAACATTGAATGACTGCACGGATGCCCTCCCCCATACCACACATTTGAAGAGCCAACTTACGTTCTATCAAAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Taxidea taxus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in the western and central U.S., southern Canada, and northern and central Mexico; relatively common over much of range, but probably has declined substantially in areas converted from grassland to intensive agriculture and where colonial rodents such as prairie dogs and groundsquirrels have been reduced or eliminated. Also threatened by collisions with vehicles and by direct persecution.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as the species has large range and is relatively common over much of range, but probably has declined substantially in areas converted from grassland to intensive agriculture and where colonial rodents such as prairie dogs and ground squirrels have been reduced or eliminated. Also threatened by collisions with vehicles and by direct persecution but not at a rate sufficient to qualify for a threat category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American badgers are fairly common in appropriate habitats and are not generally considered threatened. In some areas they are uncommon or rare. In Michigan, Wisconsin, Illinois, and British Columbia they are protected from hunting by law.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The American badger is listed by the state of Indiana as endangered or threatened
[34]; however, populations are thought to be stable in Indiana, and are
perhaps expanding southward because of increases in open land and
cultivated areas [32].
  • 32. Whitaker, John O., Jr. 1988. Mammals. Indiana Academy of Science. Monograph No. 5: 7-24. [25828]
  • 34. Meridith, Denise P. 1979. Eastern States endangered wildlife. Alexandria, VA: U.S. Department of the Interior, Bureau of Land Management, Eastern States Office. 153 p. [24550]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American badgers are fairly common in appropriate habitats and are not generally considered threatened. In some areas they are uncommon or rare. In Michigan, Wisconsin, Illinois, and British Columbia they are protected from hunting by law.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Secretive nature makes it difficult to determine trends. Long and Killingley (1983) presented evidence that badgers were declining in several western states. Messick (1987) indicated that declines were evident in Idaho, California, New Mexico, and parts of South Dakota; whereas populations appeared to be increasing in Kansas, Missouri, Wisconsin and Michigan. Trends are unknown in much of U.S. range (Newhouse and Kinley 1999). Definitely has declined and is declining in British Columbia (Newhouse and Kinley 1999, 2000). Probably have declined where prairie dogs have been eliminated or reduced a great deal in numbers.

Global Long Term Trend: Relatively stable to decline of 70%

Comments: Has undoubtedly declined substantially in parts of the west, where grassland habitat has been replaced by intensive agriculture, and where prey such as prairie dogs and ground squirrels have been reduced or eliminated. Numbers have "declined dramatically" in Alberta over the past 70 years-- 18,000 were harvested there in 1928 alone; now only 1000-10,000 remain in the provincial population (Scobie 2002). However, forest clearing has apparently resulted in some range expansion to the north and east in North America (Messick 1987, Scobie 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Large range in the western and central U.S., southern Canada, and northern and central Mexico; relatively common over much of range, but probably has declined substantially in areas converted from grassland to intensive agriculture and where colonial rodents such as prairie dogs and groundsquirrels have been reduced or eliminated. Also threatened by collisions with vehicles and by direct persecution.

U.S. population roughly estimated to be on the order of several hundred thousand; Canadian population less than 50,000 (Newhouse and Kinley 1999). No estimates for Mexican population. In areas of abundance, can reach densities of 3-5/square kilometer (Long, in Wilson and Ruff 1999). In Canada, both T. t. jacksoni in Ontario and T. t. jeffersonii in British Columbia are recognized as endangered, with as few as 200 and 600 animals remaining, respectively (Kyle et al. 2004).

Badgers have experienced negative demographic trends throughout their northern range as a result in declining habitat suitability (Newhouse and Kinley, 2000). Population sizes for the United States are not well known, but the total American population is probably several hundred thousand animals (Newhouse and Kinley, 2000). Badgers can occur at densities up to 6 individuals/km2 (Messick and Hornocker, 1981). In Canada, the T. taxus population, according to a 1998 questionnaire, is estimated to be between 13,700 and 28,900 in Saskatchewan province and 3,000 and 5,000 in Manitoba province, providing an estimated Prairie population to between 17,700 and 43,900 animals (Scobie, 2002).

Density averages 1 per sq mile in prime open country (Long 1973). In southeastern Wyoming, density was 0.8-1.1 per sq km (Goodrich and Buskirk 1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: Although clearing of forests for agricultural land has probably resulted in some range expansion, cultivation of grassland has undoubtedly caused declines (Soper 1964, Stardom 1979, Lindzey 1982, Messick 1987, Smith 1992, Newhouse and Kinley 1999). Likewise, intensification of agriculture is likely to cause declines in the future.

In the west, infill of formerly open woodlands and encroachment of forests into grassland as a result of effective fire suppression has eliminated or degraded much badger habitat (Newhouse and Kinley 1999).

Most mortality is caused by vehicles or deliberate killing by humans (Stardom 1979, Messick et al. 1981, Fitzgerald et al. 1994, Newhouse and Kinley 2000, Apps et al. 2002). Badgers may actually be attracted to roads, both because ground squirrels often burrow alongside them (Ketcheson and Bauer 1995), and because they are good travel routes (Warner and Ver Steeg 1995).

Badgers are trapped, shot and poisoned because their diggings are thought to cause broken legs in livestock, lead to water loss from irrigation canals, and cause damage to vehicles encountering their burrows (Scobie 2002). Declines may also be related to the persecution of their primary prey, prairie dogs and ground squirrels (Apps et al. 2002). Finley et al. (1976) speculated that some Colorado populations may have declined because of the elimination of prairie dogs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Changing land uses, resulting from agriculture, urban development, and forest ingrowth and loss of prey appears to be the major factors negatively affecting badgers. The loss of prey is considered to be one of the primary factors limiting badger populations in British Columbia (Newhouse and Kinley, 2000). Trapping for pelts has affected badger populations, mainly in response to rising fur prices, but has not had a significant influence on badger populations in recent years. Badgers are also trapped, shot and poisoned because their diggings are thought to cause broken legs in livestock, lead to water loss from irrigation canals, and cause damage to vehicles encountering their burrows (Scobie, 2002).

Although clearing of forests for agricultural land has probably resulted in some range expansion, cultivation of grassland has undoubtedly caused declines (Soper 1964, Stardom 1979, Lindzey 1982, Messick 1987, Smith 1992, Newhouse and Kinley 1999). Likewise, intensification of agriculture is likely to cause declines in the future.

In the west, infill of formerly open woodlands and encroachment of forests into grassland as a result of effective fire suppression has eliminated or degraded much badger habitat (Newhouse and Kinley 1999).

Most mortality is caused by vehicles or deliberate killing by humans (Stardom 1979, Messick et al. 1981, Fitzgerald et al. 1994, Newhouse and Kinley 2000, Apps et al. 2002). Badgers may actually be attracted to roads, both because ground squirrels often burrow alongside them (Ketcheson and Bauer 1995), and because they are good travel routes (Warner and Ver Steeg 1995).

Badgers are trapped, shot and poisoned because their diggings are thought to cause broken legs in livestock, lead to water loss from irrigation canals, and cause damage to vehicles encountering their burrows (Scobie 2002). Declines may also be related to the persecution of their primary prey, prairie dogs and ground squirrels (Apps et al. 2002). Finley et al. (1976) speculated that some Colorado populations may have declined because of the elimination of prairie dogs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Since badgers have extremely large home ranges, many parks would not totally protect an individual occurrence or population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
In Canada, the species was designated as “Not At Risk”, while the two subspecies T. t. jeffersonii (British Columbia) and T. t. jacksoni (Ontario) were designated as “Endangered”(COSEWIC, 2002) with as few as 600 and 200 animals remaining, respectively (Kyle et al., 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

Ecological Considerations: American badgers create patch disturbances in
tallgrass prairie, altering local plant communities and loosening the
soil [4]. American badger holes are sometimes used by burrowing owls for nest
sites; in some areas American badger holes are the only size-appropriate holes
available. Nest success is, however, somewhat lower for owls using
American badger holes [23]. American badger activity was noted on some reclaimed surface
coal mine plots that were seeded to grasses. American badger populations in
neighboring undisturbed big sagebrush communities were larger and more
stable [24].

Economic Considerations: American badgers may help control, and even
substantially reduce, rodent populations in agricultural areas, but
numerous large holes are produced in the process. These holes are
sometimes hazardous to livestock and machinery [1,19].

Parasites and diseases of American badgers have been discussed by Lindzey [16]
and Long and Killingley [19].

REFERENCES :
NO-ENTRY
  • 1. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 4. Collins, Scott L.; Gibson, David J. 1990. Effects of fire on community structure in tallgrass and mixed-grass prairie. In: Collins, Scott L.; Wallace, Linda L., eds. Fire in North American tallgrass prairies. Norman, OK: University of Oklahoma Press: 81-98. [14196]
  • 16. Lindzey, Frederick G. 1982. Badger: Taxidea taxus. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 653-663. [25233]
  • 19. Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing. 404 p. [25718]
  • 23. Olendorff, Richard R.; Stoddart, John W., Jr. 1974. The potential for management of raptor populations in western grasslands. In: Hamerstrom, B. E., Jr.; Harrell, W.; Olendorff, R. R., eds. Raptor Research: Report 2: 47-88. [22982]
  • 24. Parmenter, Robert R.; MacMahon, James A.; Waaland, Marco E.; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Relatively little recent demand for pelt, which is of variable quality (Caire et al. 1989). In the early 1980s, an annual average of about 10,000 pelts, with an average value of about $10.00, was reported taken in the U.S. and Canada (Nowak 1991).

Valued in helping control populations of rodents deemed undesireable by some ranchers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Unfortunately, badger burrows sometimes present a hazard to cattle and horses. They have been known to break legs by stepping into a badger hole.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Badgers eat many rodent pests, which may carry disease or damage crops. In addition, their burrows provide shelter for small game mammals, like Sylvilagus floridanus. The fur is attractive, it has been used as a trim on Native American garments and historically it was used to make shaving and painting brushes.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Badger burrows may present a hazard to cattle and horses. Such animals have been known to break legs by stepping into badger holes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Badgers eat many rodent pests, which may carry disease or damage crops. In addition, their burrows provide shelter for small game mammals, like cottontail rabbits. The fur is attractive, it has been used as a trim on Native American garments and historically it was used to make shaving and painting brushes.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

American badger

The American badger (Taxidea taxus) is a North American badger, somewhat similar in appearance to the European badger. It is found in the western and central United States, northern Mexico, and south-central Canada to certain areas of southwestern British Columbia.

American badger habitat is typefied by open grasslands with available prey (such as mice, squirrels, and groundhogs). The species prefers areas with sandy loam soils where it can dig more easily for its prey, such as prairie regions.

Taxonomy[edit]

The American badger is a member of the Mustelidae, a diverse family of carnivorous mammals that also includes the weasel, otter, ferret, and wolverine.[2] The American badger belongs to the Taxidiinae, one of three subfamilies of badgers - the other two being the Melinae (9 species, including the Eurasian badger) and the Mellivorinae (honey badger). The American badger's closest relative is the prehistoric Chamitataxus.

Recognized subspecies include: the nominate subspecies T. t. taxus, found in central Canada and central US; T. t. jacksoni, found in the southern Great Lakes region including southern Ontario; T. t. jeffersoni, in British Columbia and the western US; and T. t. berlandieri, in the southwestern US and northern Mexico.[3][4] Ranges of subspecies overlap considerably, with intermediate forms occurring in the areas of overlap.

In Mexico, this animal is sometimes called tlalcoyote. The Spanish word for badger is tejón, but in Mexico this word is also used to describe the coati. This can lead to confusion, as both coatis and badgers are found in Mexico.

Description[edit]

American badger

The American badger has most of the general characteristics common to badgers; with stocky and low-slung bodies with short, powerful legs, they are identifiable by their huge foreclaws (measuring up to 5 cm in length) and distinctive head markings. Measuring generally between 60 to 75 cm (23.6 to 29.5 inches) in length, males of the species are slightly larger than females (with an average weight of roughly 7 kg (15.5 pounds) for females and up to almost 9 kg (19.8 pounds) for males). Northern subspecies such as T. t. jeffersonii are heavier than the southern subspecies. In the fall, when food is plentiful, adult male badgers can exceed 11.5 kg (25.3 pounds).[5]

Except for the head, the American badger is covered with a grizzled, brown, black and white coat of coarse hair or fur, giving almost a mixed brown-tan appearance. The coat aids in camouflage in grassland habitat. Its triangular face shows a distinctive black and white pattern, with brown or blackish "badges" marking the cheeks and a white stripe extending from the nose to the base of the head. In the subspecies T. t. berlandieri, the white head stripe extends the full length of the body, to the base of the tail.[6]

Diet[edit]

The American badger is a fossorial carnivore. It preys predominantly on pocket gophers (Geomyidae), ground squirrels (Spermophilus), moles (Talpidae), marmots (Marmota), prairie dogs (Cynomys), pika (Ochotona), woodrats (Neotoma), kangaroo rats (Dipodomys), deer mice (Peromyscus), and voles (Microtus), often digging to pursue prey into their dens, and sometimes plugging tunnel entrances with objects.[7] They also prey on ground-nesting birds, such as the bank swallow or sand martin (Riparia riparia) and burrowing owl (Athene cunicularia), and lizards, amphibians, carrion, fish, skunks (Mephitis and Spilogale), insects, including bees and honeycomb, and some plant foods such as corn (Zea mais), peas, green beans, mushrooms and other fungi, and sunflower seeds (Helianthus).

Behavior[edit]

American badgers are generally nocturnal, but have been reported to be active during the day. In remote areas with no human encroachment, badgers are routinely observed foraging during the day. Seasonally, however, a badger observed during daylight hours in the Spring months of late March to early May often represents a female badger, foraging during daylight to then return and stay with her young at night. Badgers do not hibernate, but may become less active in winter. A badger may spend much of the winter in cycles of torpor that last around 29 hours. They do emerge from their burrows when the temperature is above freezing.[4]

Badger burrows that are abandoned may then be occupied by foxes, skunks or animals of similar size. Abandoned badger burrows also provide ready-made homes for burrowing owl, California Tiger Salamander and California Red-Legged Frog. A misconception about badgers and coyotes is reflected in the human projected perception that badgers and coyotes form a mutually beneficial relationship in hunting and foraging. In fact, the benefit is for the coyote. Coyotes are not as effective in digging prey out of burrows and will remain in proximity to a foraging badger, to then capture prey if it escapes the badger's claw-paws. Widely reported has been the misconception that badgers and coyotes hunt together. Badgers are solitary foragers and coyotes who observe badgers in the process of seeking prey will position themselves in proximity in order to attempt to capture any prey that eludes a badger in its attempt to escape.

Life cycle[edit]

Badgers are normally solitary animals for most of the year, but are thought to expand their territories in the breeding season to seek out mates. Males may breed with more than one female. Mating occurs in late summer and early fall. American badgers experience delayed implantation. Pregnancies are suspended until December or as late as February. Young are born from late March to early April.[4] Litters range from one to five young,[8] averaging about three.[9]

Badgers are born blind, furred, and helpless.[4] Eyes open at four to six weeks. The female feeds her young solid foods prior to complete weaning, and for a few weeks thereafter.[9] Young American badgers first emerge from the den on their own at five to six weeks old.[8][10] Families usually break up and juveniles disperse from the end of June to August; young American badgers leave their mothers as early as late May or June.[10] Juvenile dispersal movements are erratic.[8]

American badger at Omaha's Henry Doorly Zoo

Most female American badgers become pregnant for the first time after they are a year old. A minority of females four to five months old ovulate and a few become pregnant. Males usually do not breed until their second year.[4]

Major causes of adult American badger mortality include, first and foremost, loss of habitat and habitat fragmentation, preventing the ability to move through a normal range, and then automobiles, ranchers and farmers (by various methods), sport shooting, and fur trapping. Identifying habitat areas preferred by adult female badgers for breeding, birthing and raising young are critically important to support biodiversity in the context of climate change impacts, loss of habitat and competition among species for habitat areas as coastal wildlife migrate inland, seeking cooler temperatures in upland habitat areas that often represent established habitat for American Badger. Large predators occasionally kill American badgers.[8] The average longevity in the wild is 9–10 years and the record is 14 years;[11] a captive American badger lived at least 15 years and five months.[8]

Habitat[edit]

American badgers occur primarily in grasslands and open areas with grasslands, which can include parklands, farms, and treeless areas with friable soil and a supply of rodent prey.[12][13] They may also be found in forest glades and meadows, marshes, brushy areas, hot deserts, and mountain meadows. They are sometimes found at elevations up to 12,000 feet (3,600 m) but are usually found in the Sonoran and Transition life zones (which are at elevations lower and warmer than those characterized by coniferous forests).[9] In Arizona, they occur in desert scrub and semidesert grasslands.[14] In California, American badgers are primarily able to survive through a combination of open grasslands of agricultural lands, protected land trust and open space lands, and even regional and state and national park lands with grassland habitat. An identified population in South Sonoma County fragilely survives with areas of abundant prey, but threatened from fragmentation. The Sonoma County badger population also includes some protected and private lands near the Sonoma Coast. Badgers are occasionally found in open chaparral (with less than 50% plant cover) and riparian zones. They are not usually found in mature chaparral.[15] In Manitoba aspen parklands, American badger abundance was positively associated with the abundance of Richardson's ground squirrels (Spermophilus richardsonii).[16]

American badger use of home range varies with season and sex. Different areas of the home range are used more frequently at different seasons and usually are related to prey availability. Males generally have larger home ranges than females. In a study almost 40 years ago, radiotransmitter-tagged American badgers had an average annual home range of 2,100 acres (850 ha). The home range of one female was 1,790 acres (725 ha) in summer, 131 acres (53 ha) in fall, and 5 acres (2 ha) in winter.[17] Lindzey reported average home ranges of 667 to 1,550 acres (270–627 ha).[18] In 2014, severe fragmentation of American Badger habitat from over-development of land and blockage of wildlife movement areas equate to the range of a badger being significantly influenced by available land for habitat and foraging as well as the ability to move within a preferred range. Direct observations in Sonoma County, documenting habitat and badger sightings and foraging, reflect various ranges within the fragmented habitat areas from less than 1/2 mile to approximately 4 miles. Within these areas, the availability of prey and a fresh water source are key factors for the preferred habitat areas and ability to survive. Identifying and conserving habitat areas where there is year-round activity, along with identified burrowing patterns and observations of female badger territory for birthing and raising young have become critical factors in survival of the species.

Estimated density of American badgers in Utah scrub-steppe was one per square mile (2.6 km2), or 10 dens per square mile (assuming a single American badger has 10 dens in current or recent use).[4]

The American badger in Ontario, is restricted primarily to the extreme southwestern portion of the province – largely along the north shore of Lake Erie in open areas generally associated with agriculture and woodland edges. There have been a few reports from the Bruce-Grey region.[19]

Plant communities[edit]

American badgers are most commonly found in treeless areas, including tallgrass and shortgrass prairies, grass-dominated meadows and fields within forested habitats, and shrub-steppe communities. In the Southwest, plant indicators of the Sonoran and Transition life zones (relatively low, dry elevations) commonly associated with American badgers include creosotebush (Larrea tridentata), junipers (Juniperus spp.), gambel oak (Quercus gambelii), willows (Salix spp.), cottonwoods (Populus spp.), ponderosa pine (Pinus ponderosa), grasses, and sagebrushes (Artemisia spp.).[9]

In Colorado 37 years ago, American badgers were common in grass–forb and ponderosa pine habitats.[20] In Kansas, they are common in tallgrass prairie dominated by big bluestem (Andropogon gerardii), little bluestem (Schizachyrium scoparium), and Indian grass (Sorghastrum nutans).[21] In Montana 24 years ago, badgers were present in Glacier National Park in fescue (Festuca spp.) grasslands.[22] In Manitoba, they occur in grassland extensions within aspen (Populus spp.) parklands.[16]

Cover requirements[edit]

American badgers enlarge foraged out gopher holes or other prey holes or burrows to create a burrow for sleeping and concealment, protection from weather, and natal dens; burrows range from about 4 feet to 10 feet in depth and 4 feet to 6 feet in width. A female American Badger may create 2 to 4 burrows in proximity with a connecting tunnel for concealment and safety for her young. Displaced soil from digging out the burrow characteristically appears in front of the burrow entrance, and a view from a distance reveals a mound-like roof of the burrow, with the living and concealment space created underneath the raised-roof appearing mound. During summer and autumn, badgers range more frequently, with mating season generally in November, and burrowing patterns reflect 1 to 3 burrows may be dug from foraged out prey holes in a day, used for a day to a week, and then abandoned, with possible returns later, and other small wildlife utilizing abandoned burrows in the interim. Where prey is particularly plentiful, they will reuse dens,[9] especially in the fall, sometimes for a few days at a time. In winter, a single den may be used for most of the season.[4] Natal dens are dug by the female and are used for extended periods, but litters may be moved, probably to allow the mother to forage in new areas close to the nursery. Natal dens are usually larger and more complex than diurnal dens.[8]

Predators[edit]

The American badger is an aggressive animal and has few natural enemies. Predation on smaller individuals by golden eagles (Aquila chrysaetos), coyotes,[4] cougars (Felis concolor), and bobcats (Lynx rufus) have been reported.[23] Bears (Ursus spp.) and gray wolves (Canis lupus) occasionally kill American badgers.[8]

Conservation status[edit]

In May 2000, the Canadian Species at Risk Act listed both the Taxidea taxus jacksoni and the T. t. jeffersonii subspecies as an endangered species in Canada.[24] The California Department of Fish and Game designated the American badger as a California species of special concern.[25]

See also[edit]

References[edit]

 This article incorporates public domain material from the United States Department of Agriculture document "Taxidea taxus".

  1. ^ Reid, F. & Helgen, K. (2008). Taxidea taxus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 619. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ "Taxidea". Retrieved 2007-08-07. 
  4. ^ a b c d e f g h Long, Charles A. (1972). "Taxidea taxus". Journal of Mammalogy 26: 1–4. doi:10.2307/3504047. Archived from the original on 13 July 2007. Retrieved 2007-08-07. Long, Charles A. (1972). "Taxonomic Revision of the North American Badger, Taxidea taxus". Journal of Mammalogy (Journal of Mammalogy) 53 (4): 725–759. doi:10.2307/1379211. JSTOR 1379211. 
  5. ^ Feldhamer, George A.; Bruce Carlyle Thompson; Joseph A. Chapman (2003). Wild Mammals of North America: Biology, Management, and Conservation. JHU Press. p. 683. ISBN 0-8018-7416-5. 
  6. ^ American Society of Mammalogists Staff; Smithsonian Institution Staff (1999). The Smithsonian Book of North American Mammals. UBC Press. p. 179. ISBN 0-7748-0762-8. 
  7. ^ Michener, Gail R. (2004). "Hunting techniques and tool use by North American badgers preying on Richardson's ground squirrels". Journal of mammalogy 85 (5): 1019–1027. doi:10.1644/BNS-102. JSTOR 1383835. 
  8. ^ a b c d e f g Lindzey, Frederick G. 1982. Badger: Taxidea taxus. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 653–663
  9. ^ a b c d e Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing
  10. ^ a b Messick, John P.; Hornocker, Maurice G. (1981). "Ecology of the Badger in Southwestern Idaho". Wildlife Monographs 76 (76): 1–53. JSTOR 3830719. 
  11. ^ Lindsey, Frederick G. 1971. Ecology of badgers in Curlew Valley, Utah and Idaho with emphasis on movement and activity patterns. Logan, UT: Utah State University
  12. ^ Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press
  13. ^ de Vos, A. 1969. Ecological conditions affecting the production of wild herbivorous mammals on grasslands. In: Advances in ecological research. [Place of publication unknown]: [Publisher unknown]: 137–179. On file at: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT
  14. ^ Davis, Russell; Sidner, Ronnie. 1992. Mammals of woodland and forest habitats in the Rincon Mountains of Saguaro National Monument, Arizona. Technical Report NPS/WRUA/NRTR-92/06. Tucson, AZ: The University of Arizona, School of Renewable Natural Resources, Cooperative National Park esources Study Unit
  15. ^ Quinn, Ronald D. 1990. Habitat preferences and distribution of mammals in California chaparral. Res. Pap. PSW-202. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station
  16. ^ a b Bird, Ralph D. (1930). "Biotic communities of the aspen parkland of central Canada". Ecology 11 (2): 356–442. doi:10.2307/1930270. JSTOR 1930270. 
  17. ^ Sargeant, Alan B.; Warner, Dwain W. (1972). "Movements and denning habits of a badger". Journal of Mammalogy 53 (1): 207–210. doi:10.2307/1378851. 
  18. ^ Lindzey, Frederick G. (1978). "Movement patterns of badgers in northwestern Utah". Journal of Wildlife Management 42 (2): 418–422. doi:10.2307/3800282. JSTOR 3800282. 
  19. ^ "Ontario Badgers". ontariobadgers.org. 
  20. ^ Morris, Meredith J.; Reid, Vincent H.; Pillmore, Richard E.; Hammer, Mary C. 1977. Birds and mammals of Manitou Experimental Forest, Colorado. Gen. Tech. Rep. RM-38. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment.
  21. ^ Gibson, David J. (1989). "Effects of animal disturbance on tallgrass prairie vegetation". American Midland Naturalist 121 (1): 144–154. doi:10.2307/2425665. JSTOR 2425665. 
  22. ^ Tyser, Robin W. 1990. Ecology of fescue grasslands in Glacier National Park. In: Boyce, Mark S.; Plumb, Glenn E., eds. National Park Service Research Center, 14th annual report. Laramie, WY: University of Wyoming, National Park Service Research Center: 59–60
  23. ^ Skinner, Scott. 1990. Earthmover. Wyoming Wildlife. 54(2): 4–9
  24. ^ "Species at Risk Act: List of Wildlife Species at Risk accessdate=14 March 2013". 
  25. ^ "Mammal Species of Special Concern". dfg.ca.gov. Archived from the original on 23 November 2010. Retrieved 27 November 2010. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Four subspecies have been recognized on the basis of differences in skull size and pelage color (Long 1972): T. t. berlandieri, found in the southern United States; T. t. jacksoni, found in the north-central United States and southern Ontario in Canada; T. t. taxus, found in the Great Plains ecosystem ranging from the United States into the prairie provinces of Canada; and T. t. jeffersonii, found in western United States and southern British Columbia.

Genetic data support the current geographic delineation of the northwestern subspecies taxus and jeffersonii (Kyle et al. 2004). Gene flow between prairie populations of T. t taxus did not seem to be restricted, nor did there seem to be a restriction of gene flow for populations within mountain ranges for T. t. jeffersonii. In contrast, minimal gene flow was observed between populations separated by mountain ranges.

Taxus is a generic synonym.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

American badger
North American badger

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for American badger is Taxidea taxus
(Schreber). It is a member of the weasel family (Mustelidae) and is the
only extant member of its genus. The accepted subspecies are as follows [12]:

T. t. berlandieri Baird
T. t. jacksoni Schautz
T. t. jeffersonii (Harlan)
T. t. taxus (Schreber)
  • 12. Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley and Sons. 1271 p. [14765]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!