Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Description

"Badgers look like short, shaggy, medium-sized dogs. They are powerful diggers. One, taken to a football game as a mascot, escaped and dug its way under the field. They dig after and feed on ground squirrels and pocket gophers, and also eat toads, frogs, birds, snakes, insects and insect grubs, wasps, bees, and worms. They sleep through most of the winter in a den, spending about 29 hours at a time in a state of torpor, rousing briefly, and then sleeping again. In torpor, which is not true hibernation, the Badger's heartbeat slows to about half the normal rate and its temperature drops. Humans are the Badgers' worst enemy, trapping and poisoning them, but they are now protected in some states and provinces."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: "Schreber, J.C.D., 1777.  in Schreber's Die Säugthiere in Abbildungen nach der Natur mit Beschreibungen, Wolfgang Walther, Erlangen, 7 volumes, 1774-1846; 3(26):pl. 142[1778], text, 3(26):520[1777]."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species is distributed from southern Canada (British Columbia, Alberta, Saskatchewan, Manitoba, and southern Ontario), over a majority of the northern, western and central United States, and south to Puebla and Baja California, Mexico (Wozencraft, in Wilson and Reeder 1993; Long, in Wilson and Ruff 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Badgers are found primarily in the Great Plains region of North America. Badgers occur north through the central western Canadian provinces, in appropriate habitat throughout the western United States, and south throughout the mountainous areas of Mexico. They have expanded their range since the turn of the 20th century and are now found as far east as Ontario, Canada.

Biogeographic Regions: nearctic (Native )

  • Long, C. 1999. American badger: Taxidea taxus. Pp. 177-179 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Southern Canada (British Columbia, Alberta, Saskatchewan, Manitoba, and southern Ontario), south and west to Texas, and Puebla and Baja California, Mexico (Wozencraft, in Wilson and Reeder 1993; Long, in Wilson and Ruff 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Badgers measure 520 to 875 mm from head to tail, with the tail making up only 100 to 155 mm of this length. Badgers weigh 4 to 12 kg. The body is flattened, and the legs are short and stocky. The fur on the back and flanks of the animal ranges from grayish to reddish. The ventrum is a buffy color. The face of the badger is distinct. The throat and chin are whitish, and the face has black patches. A white dorsal stripe extends back over the head from the nose. In northern populations, this stripe ends near the shoulders. In southern populations, however, it continues over the back to the rump. Males are significantly larger than females and animals from northern populations are larger than those from southern populations.

Range mass: 4 to 12 kg.

Range length: 520 to 875 mm.

Other Physical Features: endothermic ; heterothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 15.062 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: "600-790 mm "

Weight:
Range: up to 12 kg in the wild, 18 kg in captivity
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 87 cm

Weight: 11400 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Other North American mammals of similar size and shape (low flat profile) include skunks and wolverine; differs from skunks in lacking extensive black pelage, differs from wolverine in having a white middorsal head stripe.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Prefers open areas and may also frequent brushlands with little groundcover. When inactive, occupies underground burrow. Badgers are known to inhabit regions ranging from below sea level to elevations 3,600 m (Kyle et al., 2004). They are usually found in relative dry, grasslands and open forests (Rahme et al. 1995). Taxidea may be active at any hour but is mainly nocturnal.

Feeds primarily on small rodents usually captured by digging out burrow. Ground squirrels often major item in diet, as are pocket gophers, kangaroo rats, priairie dogs, and mice; also eats scorpions, insects, snakes, lizards, and birds, especially when ground squirrel population is low (Messick and Hornocker 1981).

Its movements are restricted, especially in winter, and it shows a strong attachment to a home area. Estimated home ranges vary from 2 to 725 ha changing seasonally (Sargeant and Warne, 1972). The badger is active all year, but it may sleep in its den for several days or weeks during severe winter weather (Nowak, 2005). Most food is obtained by excavating the burrows of fossorial rodents. Also eaten are other small mammals, birds, reptiles and arthropods.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Badgers prefer to live in dry, open grasslands, fields, and pastures. They are found from high alpine meadows to sea level (or below in Death Valley, California).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; mountains

Wetlands: marsh

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers open areas and may also frequent brushlands with little groundcover. When inactive, occupies underground burrow.

Young are born in underground burrows. In Idaho, activites of females with young (March-May) centered on a sequence of maternal dens (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In Idaho, home ranges of adult males averaged 2.4 square kilometers, whereas those of females averaged 1.6 square kilometers; most young-of-the-year dispersed during their first summer, up to 110 km in males, up to 52 km in females (Messick and Hornocker 1981).

In southeastern Wyoming, home ranges averaged 12.3 square kilometers in males, 3.4 square kilometers in females (Goodrich and Buskirk 1998).

A female in Minnesota had a summer home range of 7.5 square kilometers and moved to an adjacent, but much smaller area in the winter (Sargeant and Warner 1972).

Where favorable habitat is patchier, home ranges can be significantly larger. In southeastern British Columbia, male home ranges averaged 69 square kilometers (fixed kernel method) and those of females averaged 38 square kilometers (Newhouse and Kinley 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Badgers are carnivorous. Their dominant prey are pocket gophers (Geomyidae), ground squirrels (Spermophilus), moles (Talpidae), marmots (Marmota), prairie dogs (Cynomys), woodrats (Neotoma), kangaroo rats (Dipodomys), deer mice (Peromyscus), and voles (Microtus). They also prey on ground nesting birds, such as bank swallows (Riparia riparia and burrowing owls Athene cunicularia), lizards, amphibians, carrion, fish, hibernating skunks (Mephitis and Spilogale), insects, including bees and honeycomb, and some plant foods, such as corn (Zea) and sunflower seeds (Helianthus). Unlike many carnivores that stalk their prey in open country, badgers catch most of their food by digging. They can tunnel after ground dwelling rodents with amazing speed. They have been known to cache food.

Animal Foods: birds; mammals; amphibians; reptiles; insects; terrestrial non-insect arthropods

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on small rodents usually captured by digging out burrow. Ground squirrels often major item in diet, as are pocket gophers, kangaroo rats, priairie dogs, and mice; also eats scorpions, insects, snakes, lizards, and birds, especially when ground squirrel population is low (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Badgers are important consumers of many small prey items in their ecosystem. They help to control rodent populations, kill venomous snakes, and eat insects and carrion. Their burrows provide shelter for other species and their digging activity helps in soil development.

Badgers and coyotes are sometimes seen hunting at the same time in an apparently cooperative manner. Badgers can readily dig rodents out of burrows but cannot run them down readily. Coyotes, on the other hand, can readily run rodents down while above ground, but cannot effectively dig them out of burrows. When badgers and coyotes hunt in the same area at the same time, they may increase the number of rodents available to the other. Coyotes take advantage of rodents attempting to escape from badgers attacking their burrows and it has been demonstrated that coyotes benefit from the association. Badgers may be able to take advantage of rodents that are escaping coyotes by fleeing into burrows, but it is more difficult to assess whether badgers actually do benefit from this association. Badgers and coyotes tolerate each other's presence and may even engage in play behavior.

Ecosystem Impact: creates habitat; soil aeration

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Natural predation on badgers is rare, with young animals being most vulnerable. The primary predators of badgers are humans who are responsible for habitat destruction, trapping, hunting, automobile fatalities, and poisoning. Other reported predators of American badgers include golden eagles (Aquila chrysaetos), bobcats (Lynx rufus), cougars (Puma concolor), and coyotes (Canis latrans). Bears (Ursus) and gray wolves (Canis lupus) may also sometimes take badgers.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: U.S. population roughly estimated to be on the order of several hundred thousand; Canadian population less than 50,000 (Newhouse and Kinley 1999). No estimates for Mexican population. In areas of abundance, can reach densities of 3-5/square kilometer (Long, in Wilson and Ruff 1999).

In Canada, both T. t. jacksoni in Ontario and T. t. jeffersonii in British Columbia are recognized as endangered, with as few as 200 and 600 animals remaining, respectively (Kyle et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Basicaly solitary, though home ranges may overlap (Messick and Hornocker 1981).

Density averages 1 per sq mile in prime open country (Long 1973). In southeastern Wyoming, density was 0.8-1.1 per sq km (Goodrich and Buskirk 1998).

In Idaho, half of the population was young-of-the-year (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Badgers have keen vision, scent, and hearing. They have nerve endings in the foreclaws that may make them especially sensitive to touch in their forepaws, but this has not been investigated. Not much is known about communication in these normally solitary animals, but it is likely that home ranges are marked with scents that are used by conspecifics to determine reproductive readiness.

Communication Channels: chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Usually active day/night; reported as chiefly nocturnal in Caire et al. 1989. In Idaho, rarely stayed underground for more than 24 hours except in winter; one female emerged from winter den only once during 72-day period (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Badgers have lived to be 26 years old in captivity. The average lifespan in the wild has been estimated by different researchers at 4 to 5 years and at 9 to 10 years. The oldest wild badger lived to 14 years. Yearly mortality was estimated at 35% by one study. Some populations are estimated to be up to 80% yearlings or young of the year, suggesting high mortality rates.

Range lifespan

Status: wild:
14 (high) years.

Range lifespan

Status: captivity:
26 (high) years.

Typical lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: captivity:
26.0 years.

Average lifespan

Status: captivity:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity) Observations: The implantation can be delayed up to 10 months. One captive specimen was at least 25 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The home ranges of both male and female badgers expands during the breeding season, indicating that males and females travel more extensively to find mates. Males have larger home ranges that are likely to overlap with the home ranges of several females.

Mating System: polygynandrous (promiscuous)

Mating occurs in late summer or early autumn but embryos are arrested early in development. Implantation is delayed until December or as late as February. After this period embryos implant into the uterine wall and resume development. So, although a female is technically pregnant for 7 months, gestation is a mere 6 weeks. Litters of 1 to 5 offspring, with an average of 3, are born in early spring. Females are able to mate when they are 4 months old, but males do not mate until the autumn of their second year. Most females mate after their first year.

Breeding interval: Badgers breed once per year.

Breeding season: Badgers mate in late summer or early autumn.

Range number of offspring: 1 to 5.

Average gestation period: 6 weeks.

Range weaning age: 2 to 3 months.

Range time to independence: 5 to 6 months.

Range age at sexual or reproductive maturity (female): 4 (low) months.

Average age at sexual or reproductive maturity (female): 12 months.

Average age at sexual or reproductive maturity (male): 16 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 93.5 g.

Average gestation period: 41 days.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
441 days.

Female badgers prepare a grass-lined den in which to give birth. Badgers are born blind and helpless with a thin coat of fur. The eyes of the youngsters open at 4 to 6 weeks old, and the young are nursed by their mother until they are 2 to 3 months old. Females give their young solid food before they are weaned and for a few weeks after they are weaned. Young may emerge from the den as early as 5 to 6 weeks old. Juveniles disperse at 5 to 6 months.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Long, C. 1999. American badger: Taxidea taxus. Pp. 177-179 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: Smithsonian Institution Press.
  • Sullivan, J. 1996. "Taxidea taxus" (On-line). USDA Forest Service, Wildlife Species. Accessed September 08, 2006 at http://www.fs.fed.us/database/feis/wildlife/mammal/tata/all.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mates mid- to late summer. Implantation is delayed until December-February. One litter averaging 3 (2-5) is born March-early April (probably late May or early June in Kansas). Young leave family group in fall. In Idaho, 30% of young-of-the-year females bred; males were sexually mature as yearlings (Messick and Hornocker 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taxidea taxus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0294-06|AY598564|Taxidea taxus| AACCGGTGACTATTCTCCACAAATCATAAGGATATCGGCACTCTCTACCTCCTATTCGGTGCATGAGCTGGAATAGTAGGCACCGCTCTC---AGCCTATTAATCCGCGCAGAACTAGGCCAACCAGGCACCCTACTGGGAGAT---GACCAGATCTACAATGTCATTGTGACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATTATAATCGGGGGCTTCGGAAACTGATTAGTTCCCTTAATA---ATTGGCGCACCCGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTGCCTCCTTCCCTTCTTCTCCTACTAGCCTCCTCCATAGTGGAAGCAGGAGCAGGAACAGGATGAACCGTATACCCTCCTCTAGCAGGTAATCTAGCGCATGCAGGAGCGTCCGTAGACTTA---ACAATTTTCTCCCTACATTTAGCAGGTGTCTCGTCCATCCTAGGGGCTATCAACTTTATCACCACTATTATTAATATAAAACCCCCCGCAATATCACAATACCAAACTCCTCTATTCGTGTGATCCGTCCTAATCACAGCCGTACTTCTGCTCTTATCCTTACCAGTACTAGCTGCC---GGAATTACAATGCTACTCACAGACCGAAACCTAAACACTACTTTCTTCGACCCAGCAGGAGGAGGAGATCCTATTTTATATCAACACTTATTTTGATTCTTTGGCCACCCTGAAGTATATATTCTAATTTTACCAGGCTTTGGAATAATCTCGCACATTGTTACCTATTACTCAGGAAAGAAA---GAACCTTTCGGGTACATAGGAATAGTCTGAGCCATAATATCAATCGGCTTCCTGGGATTTATCGTGTGAGCCCACCATATATTTACTGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Taxidea taxus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern as the species has large range and is relatively common over much of range, but probably has declined substantially in areas converted from grassland to intensive agriculture and where colonial rodents such as prairie dogs and ground squirrels have been reduced or eliminated. Also threatened by collisions with vehicles and by direct persecution but not at a rate sufficient to qualify for a threat category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

American badgers are fairly common in appropriate habitats and are not generally considered threatened. In some areas they are uncommon or rare. In Michigan, Wisconsin, Illinois, and British Columbia they are protected from hunting by law.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in the western and central U.S., southern Canada, and northern and central Mexico; relatively common over much of range, but probably has declined substantially in areas converted from grassland to intensive agriculture and where colonial rodents such as prairie dogs and groundsquirrels have been reduced or eliminated. Also threatened by collisions with vehicles and by direct persecution.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Large range in the western and central U.S., southern Canada, and northern and central Mexico; relatively common over much of range, but probably has declined substantially in areas converted from grassland to intensive agriculture and where colonial rodents such as prairie dogs and groundsquirrels have been reduced or eliminated. Also threatened by collisions with vehicles and by direct persecution.

U.S. population roughly estimated to be on the order of several hundred thousand; Canadian population less than 50,000 (Newhouse and Kinley 1999). No estimates for Mexican population. In areas of abundance, can reach densities of 3-5/square kilometer (Long, in Wilson and Ruff 1999). In Canada, both T. t. jacksoni in Ontario and T. t. jeffersonii in British Columbia are recognized as endangered, with as few as 200 and 600 animals remaining, respectively (Kyle et al. 2004).

Badgers have experienced negative demographic trends throughout their northern range as a result in declining habitat suitability (Newhouse and Kinley, 2000). Population sizes for the United States are not well known, but the total American population is probably several hundred thousand animals (Newhouse and Kinley, 2000). Badgers can occur at densities up to 6 individuals/km2 (Messick and Hornocker, 1981). In Canada, the T. taxus population, according to a 1998 questionnaire, is estimated to be between 13,700 and 28,900 in Saskatchewan province and 3,000 and 5,000 in Manitoba province, providing an estimated Prairie population to between 17,700 and 43,900 animals (Scobie, 2002).

Density averages 1 per sq mile in prime open country (Long 1973). In southeastern Wyoming, density was 0.8-1.1 per sq km (Goodrich and Buskirk 1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Secretive nature makes it difficult to determine trends. Long and Killingley (1983) presented evidence that badgers were declining in several western states. Messick (1987) indicated that declines were evident in Idaho, California, New Mexico, and parts of South Dakota; whereas populations appeared to be increasing in Kansas, Missouri, Wisconsin and Michigan. Trends are unknown in much of U.S. range (Newhouse and Kinley 1999). Definitely has declined and is declining in British Columbia (Newhouse and Kinley 1999, 2000). Probably have declined where prairie dogs have been eliminated or reduced a great deal in numbers.

Global Long Term Trend: Increase of 10-25% to decline of 70%

Comments: Has undoubtedly declined substantially in parts of the west, where grassland habitat has been replaced by intensive agriculture, and where prey such as prairie dogs and ground squirrels have been reduced or eliminated. Numbers have "declined dramatically" in Alberta over the past 70 years-- 18,000 were harvested there in 1928 alone; now only 1000-10,000 remain in the provincial population (Scobie 2002). However, forest clearing has apparently resulted in some range expansion to the north and east in North America (Messick 1987, Scobie 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Changing land uses, resulting from agriculture, urban development, and forest ingrowth and loss of prey appears to be the major factors negatively affecting badgers. The loss of prey is considered to be one of the primary factors limiting badger populations in British Columbia (Newhouse and Kinley, 2000). Trapping for pelts has affected badger populations, mainly in response to rising fur prices, but has not had a significant influence on badger populations in recent years. Badgers are also trapped, shot and poisoned because their diggings are thought to cause broken legs in livestock, lead to water loss from irrigation canals, and cause damage to vehicles encountering their burrows (Scobie, 2002).

Although clearing of forests for agricultural land has probably resulted in some range expansion, cultivation of grassland has undoubtedly caused declines (Soper 1964, Stardom 1979, Lindzey 1982, Messick 1987, Smith 1992, Newhouse and Kinley 1999). Likewise, intensification of agriculture is likely to cause declines in the future.

In the west, infill of formerly open woodlands and encroachment of forests into grassland as a result of effective fire suppression has eliminated or degraded much badger habitat (Newhouse and Kinley 1999).

Most mortality is caused by vehicles or deliberate killing by humans (Stardom 1979, Messick et al. 1981, Fitzgerald et al. 1994, Newhouse and Kinley 2000, Apps et al. 2002). Badgers may actually be attracted to roads, both because ground squirrels often burrow alongside them (Ketcheson and Bauer 1995), and because they are good travel routes (Warner and Ver Steeg 1995).

Badgers are trapped, shot and poisoned because their diggings are thought to cause broken legs in livestock, lead to water loss from irrigation canals, and cause damage to vehicles encountering their burrows (Scobie 2002). Declines may also be related to the persecution of their primary prey, prairie dogs and ground squirrels (Apps et al. 2002). Finley et al. (1976) speculated that some Colorado populations may have declined because of the elimination of prairie dogs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Although clearing of forests for agricultural land has probably resulted in some range expansion, cultivation of grassland has undoubtedly caused declines (Soper 1964, Stardom 1979, Lindzey 1982, Messick 1987, Smith 1992, Newhouse and Kinley 1999). Likewise, intensification of agriculture is likely to cause declines in the future.

In the west, infill of formerly open woodlands and encroachment of forests into grassland as a result of effective fire suppression has eliminated or degraded much badger habitat (Newhouse and Kinley 1999).

Most mortality is caused by vehicles or deliberate killing by humans (Stardom 1979, Messick et al. 1981, Fitzgerald et al. 1994, Newhouse and Kinley 2000, Apps et al. 2002). Badgers may actually be attracted to roads, both because ground squirrels often burrow alongside them (Ketcheson and Bauer 1995), and because they are good travel routes (Warner and Ver Steeg 1995).

Badgers are trapped, shot and poisoned because their diggings are thought to cause broken legs in livestock, lead to water loss from irrigation canals, and cause damage to vehicles encountering their burrows (Scobie 2002). Declines may also be related to the persecution of their primary prey, prairie dogs and ground squirrels (Apps et al. 2002). Finley et al. (1976) speculated that some Colorado populations may have declined because of the elimination of prairie dogs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Canada, the species was designated as “Not At Risk”, while the two subspecies T. t. jeffersonii (British Columbia) and T. t. jacksoni (Ontario) were designated as “Endangered”(COSEWIC, 2002) with as few as 600 and 200 animals remaining, respectively (Kyle et al., 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Since badgers have extremely large home ranges, many parks would not totally protect an individual occurrence or population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Badger burrows may present a hazard to cattle and horses. Such animals have been known to break legs by stepping into badger holes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Badgers eat many rodent pests, which may carry disease or damage crops. In addition, their burrows provide shelter for small game mammals, like cottontail rabbits. The fur is attractive, it has been used as a trim on Native American garments and historically it was used to make shaving and painting brushes.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Relatively little recent demand for pelt, which is of variable quality (Caire et al. 1989). In the early 1980s, an annual average of about 10,000 pelts, with an average value of about $10.00, was reported taken in the U.S. and Canada (Nowak 1991).

Valued in helping control populations of rodents deemed undesireable by some ranchers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American badger

The American badger (Taxidea taxus) is a North American badger, somewhat similar in appearance to the European badger. It is found in the western and central United States, northern Mexico and central Canada, as well as in certain areas of southwestern British Columbia.

Their habitat is typified by open grasslands with available prey (such as mice, squirrels, and groundhogs). They prefer areas with sandy loam soils where they can dig more easily for their prey, such as prairie regions.

In Mexico, this animal is sometimes called tlalcoyote. The Spanish word for badger is tejón, but in Mexico this word is also used to describe the coati. This can lead to confusion; both coatis and badgers are found in Mexico.

Contents

Taxonomy

The American badger is a member of the Mustelidae, a diverse family of carnivorous mammals which also includes the weasel, ferret, and wolverine.[2] The American badger belongs to one of three subfamilies of badgers, the other two being the Eurasian badger and the honey badger. The American badger's closest relative is the prehistoric Chamitataxus.

Recognized subspecies include: Taxidea taxus jacksoni, found in the western Great Lakes region; T. t. jeffersoni, on the west coast of Canada and the US; and T. t. berlandieri, in the southwestern US and northern Mexico.[3][4] Ranges of subspecies overlap considerably, with intermediate forms occurring in the areas of overlap.

Description

American badger

The American badger has most of the general characteristics common to badgers; stocky and low-slung bodies with short, powerful legs, they are identifiable by their huge foreclaws (measuring up to 5 cm in length) and distinctive head markings. Measuring generally between 60 to 75 cm (23.6 to 29.5 inches) in length, males of the species are slightly larger than females (with an average weight of roughly 7 kg (15.5 pounds) for females and up to almost 9 kg (19.8 pounds) for males). Northern subspecies such as T. t. jeffersonii are heavier than the southern subspecies. In the fall, when food is plentiful, adult male badgers can exceed 11.5 kg (25.3 pounds).[5]

Excluding the head, the American badger is covered with a grizzled, silvery coat of coarse hair or fur. The American badger's triangular face shows a distinctive black and white pattern, with brown or blackish "badges" marking the cheeks and a white stripe extending from the nose to the base of the head. In the subspecies T. t. berlandieri, the white head stripe extends the full length of the body, to the base of the tail.[6]

Food habits

The American badger is a fossorial carnivore. It preys predominantly on pocket gophers (Geomyidae), ground squirrels (Spermophilus), moles (Talpidae), marmots (Marmota), prairie dogs (Cynomys), pack rats, pika (Ochotona), woodrats (Neotoma), kangaroo rats (Dipodomys), deer mice (Peromyscus), and voles (Microtus), often digging to pursue prey into their dens, and sometimes plugging tunnel entrances with objects.[7] They also prey on ground-nesting birds, such as the bank swallow or sand martin (Riparia riparia) and burrowing owl (Athene cunicularia), and lizards, amphibians, carrion, fish, skunks (Mephitis and Spilogale), insects, including bees and honeycomb and some plant foods such as corn (Zea mais), peas, green beans, mushrooms and other fungi, and sunflower seeds (Helianthus).[4]

Behavior

American badgers are largely nocturnal, but have been reported to be active during the day, as well. They do not hibernate, but become less active in winter. A badger may spend much of the winter in cycles of torpor that last around 29 hours. They do emerge from their setts when the temperatures are above freezing.[4]

Badgers sometimes use abandoned burrows of other animals such as foxes or animals similar in size. They will sometimes form a mutually beneficial relationship with coyotes. Because coyotes are not very effective at digging rodents out of their burrows, they will chase the animals while they are above ground. Badgers, on the other hand, are not fast runners, but are well-adapted to digging. When hunting together, they effectively leave little escape for prey in the area.[8]

Major life events

American badger at Omaha's Henry Doorly Zoo

Badgers are normally solitary animals for most of the year, but are thought to expand their territories in the breeding season to actively seek out mates. Males may breed with more than one female. Mating occurs in late summer and early fall. American badgers experience delayed implantation. Pregnancies are suspended until December or as late as February. Young are born from late March to early April.[4] Litters range from one to five young,[9] averaging about three.[10]

Badgers are born blind, furred, and helpless.[4] Eyes open at four to six weeks. The female feeds her young solid foods prior to complete weaning, and for a few weeks thereafter.[10] Young American badgers first emerge from the den on their own at five to six weeks old.[9][11] Families usually break up and juveniles disperse from the end of June to August; young American badgers leave their mothers as early as late May or June.[11] Juvenile dispersal movements are erratic.[9]

Most female American badgers become pregnant for the first time after they are a year old. A minority of females four to five months old ovulate and a few become pregnant. Males usually do not breed until their second year.[4]

Major causes of adult American badger mortality include, in order, automobiles, farmers (by various methods), sport shooting, and fur trapping. Large predators occasionally kill American badgers.[9] Yearly mortality has been estimated at 35% for populations in equilibrium. The average longevity in the wild is 9–10, and the record is 14 years;[12] a captive American badger lived at least 15 years and five months.[9]

Conservation status

In May 2000, the Canadian Species at Risk Act listed both the Taxidea taxus jacksoni and the T. t. jeffersonii subspecies as an endangered species in Canada.[citation needed] The California Department of Fish and Game designated the American badger as a California species of special concern.[13]

Habitat

American badgers occur primarily in grasslands, parklands, farms, and other treeless areas with friable soil and a supply of rodent prey.[14][15] They are also found in forest glades and meadows, marshes, brushy areas, hot deserts, and mountain meadows. They are sometimes found at elevations up to 12,000 feet (3,600 m) but are usually found in the Sonoran and Transition life zones (which are at elevations lower and warmer than those characterized by coniferous forests).[10] In Arizona, they occur in desert scrub and semidesert grasslands.[16] In California, American badgers are occasionally found in open chaparral (with less than 50% plant cover) and riparian zones. They are not usually found in mature chaparral.[17] In Manitoba aspen parklands, American badger abundance was positively associated with the abundance of Richardson's ground squirrels (Spermophilus richardsonii).[18]

American badger use of home range varies with season and sex. Different areas of the home range are used more frequently at different seasons and usually are related to prey availability. Males generally have larger home ranges than females. Radiotransmitter-tagged American badgers had an average annual home range of 2,100 acres (850 ha). The home range of one female was 1,790 acres (725 ha) in summer, 131 acres (53 ha) in fall, and 5 acres (2 ha) in winter.[19] Lindzey reported average home ranges of 667 to 1,550 acres (270–627 ha).[20]

Estimated density of American badgers in Utah scrub-steppe was one per square mile (2.6 km2), or 10 dens per square mile (assuming a single American badger has 10 dens in current or recent use).[4]

The American badger in Ontario,is primarily restricted to the extreme southwestern portion of the province – largely along the north shore of Lake Erie in open areas generally associated with agriculture and woodland edges. There have been a few reports from the Bruce-Grey region. Additionally, although not recently, there have been reports from the southwestern portion of the province, adjacent to the Minnesota border.[21]

Plant communities

American badgers are most commonly found in treeless areas, including tallgrass and shortgrass prairies, grass-dominated meadows and fields within forested habitats, and shrub-steppe communities. In the Southwest, plant indicators of the Sonoran and Transition life zones (relatively low, dry elevations) commonly associated with American badgers include creosotebush (Larrea tridentata), junipers (Juniperus spp.), gambel oak (Quercus gambelii), willows (Salix spp.), cottonwoods (Populus spp.), ponderosa pine (Pinus ponderosa), grasses, and sagebrushes (Artemisia spp.).[10] In Colorado, American badgers are common in grass-forb and ponderosa pine habitats.[22] In Kansas, they are common in tallgrass prairie dominated by big bluestem (Andropogon gerardii), little bluestem (Schizachyrium scoparium), and Indian grass (Sorghastrum nutans).[23] In Montana, these badgers are present in Glacier National Park in fescue (Festuca spp.) grasslands.[24] In Manitoba, they occur in grassland extensions within aspen (Populus spp.) parklands.[18]

Cover requirements

American badgers enlarge hunting burrows for concealment, protection from weather, and natal dens; burrows are up to 30 feet (10 m) long and 10 feet (3 m) deep. Large mounds of soil are built up at burrow entrances.[14] During the summer, they usually use a new den each day; holes are usually excavated at least a few days prior to their being used as a den. An average of 0.64 dens were in use (signified by an open hole) per acre (1.6/ha) in northern Utah scrub steppe.[20] Where prey is particularly plentiful, they will reuse dens,[10] especially in the fall, sometimes for a few days at a time. In winter, a single den may be used for the majority of the season.[4] Natal dens are dug by the female and are used for extended periods, but litters are often moved several times, probably to allow the mother to forage in new areas close to the nursery. Natal dens are usually larger and more complex than diurnal dens.[9]

Predators

The American badger is an aggressive animal and has few natural enemies. Predation on smaller individuals by golden eagles (Aquila chrysaetos), coyotes,[4] cougars (Felis concolor), and bobcats (Lynx rufus) have been reported.[25] Bears (Ursus spp.) and gray wolves (Canis lupus) occasionally kill American badger.[9]

See also

References

 This article incorporates public domain material from the United States Department of Agriculture document "Taxidea taxus".

  1. ^ Reid, F. & Helgen, K. (2008). Taxidea taxus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 619. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001508. 
  3. ^ "Taxidea". http://www.funet.fi/pub/sci/bio/life/mammalia/carnivora/mustelidae/taxidea/index.html. Retrieved 2007-08-07. 
  4. ^ a b c d e f g h i Long, Charles A. (1972). "Taxidea taxus". Journal of Mammalogy 26: 1–4. http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-026-01-0001.pdf. Retrieved 2007-08-07. Long, Charles A. (1972). "Taxonomic Revision of the North American Badger, Taxidea taxus". Journal of Mammalogy (Journal of Mammalogy) 53 (4): 725–759. doi:10.2307/1379211. JSTOR 1379211. 
  5. ^ Feldhamer, George A.; Bruce Carlyle Thompson, Joseph A. Chapman (2003). Wild Mammals of North America: Biology, Management, and Conservation. JHU Press. p. 683. ISBN 0-8018-7416-5. http://books.google.com/?id=-xQalfqP7BcC&pg=PA683. 
  6. ^ American Society of Mammalogists Staff; Smithsonian Institution Staff (1999). The Smithsonian Book of North American Mammals. UBC Press. p. 179. ISBN 0-7748-0762-8. http://books.google.com/?id=qNFgzIPGuSUC&pg=PA179. 
  7. ^ Michener, Gail R. (2004). "Hunting techniques and tool use by North American badgers preying on Richardson's ground squirrels". Journal of mammalogy 85 (5): 1019–1027. doi:10.1644/BNS-102. JSTOR 1383835. 
  8. ^ "Badger-Coyote Associations". ecology.info. http://www.ecology.info/article.aspx?cid=10&id=24. 
  9. ^ a b c d e f g Lindzey, Frederick G. 1982. Badger: Taxidea taxus. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 653–663
  10. ^ a b c d e Long, Charles A.; Killingley, Carl Arthur. 1983. The badgers of the world. Springfield, IL: Charles C. Thomas Publishing
  11. ^ a b Messick, John P.; Hornocker, Maurice G. (1981). "Ecology of the Badger in Southwestern Idaho". Wildlife Monographs 76 (76): 1–53. JSTOR 3830719. 
  12. ^ Lindsey, Frederick G.. 1971. Ecology of badgers in Curlew Valley, Utah and Idaho with emphasis on movement and activity patterns. Logan, UT: Utah State Univeristy
  13. ^ "Mammal Species of Special Concern". dfg.ca.gov. http://www.dfg.ca.gov/wildlife/nongame/ssc/mammals.html. Retrieved 27 November 2010. 
  14. ^ a b Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press
  15. ^ de Vos, A. 1969. Ecological conditions affecting the production of wild herbivorous mammals on grasslands. In: Advances in ecological research. [Place of publication unknown]: [Publisher unknown]: 137–179. On file at: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT
  16. ^ Davis, Russell; Sidner, Ronnie. 1992. Mammals of woodland and forest habitats in the Rincon Mountains of Saguaro National Monument, Arizona. Technical Report NPS/WRUA/NRTR-92/06. Tucson, AZ: The University of Arizona, School of Renewable Natural Resources, Cooperative National Park esources Study Unit
  17. ^ Quinn, Ronald D. 1990. Habitat preferences and distribution of mammals in California chaparral. Res. Pap. PSW-202. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station
  18. ^ a b Bird, Ralph D. (1930). "Biotic communities of the aspen parkland of central Canada". Ecology 11 (2): 356–442. doi:10.2307/1930270. JSTOR 1930270. 
  19. ^ Sargeant, Alan B.; Warner, Dwain W. (1972). "Movements and denning habits of a badger". Journal of Mammalogy 53 (1): 207–210. doi:10.2307/1378851. 
  20. ^ a b Lindzey, Frederick G. (1978). "Movement patterns of badgers in northwestern Utah". Journal of Wildlife Management 42 (2): 418–422. doi:10.2307/3800282. JSTOR 3800282. 
  21. ^ "Ontario Badger". ontariobadgers.com. http://www.ontariobadgers.com/index.html. 
  22. ^ Morris, Meredith J.; Reid, Vincent H.; Pillmore, Richard E.; Hammer, Mary C. 1977. Birds and mammals of Manitou Experimental Forest, Colorado. Gen. Tech. Rep. RM-38. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment.
  23. ^ Gibson, David J. (1989). "Effects of animal disturbance on tallgrass prairie vegetation". American Midland Naturalist 121 (1): 144–154. doi:10.2307/2425665. JSTOR 2425665. 
  24. ^ Tyser, Robin W. 1990. Ecology of fescue grasslands in Glacier National Park. In: Boyce, Mark S.; Plumb, Glenn E., eds. National Park Service Research Center, 14th annual report. Laramie, WY: University of Wyoming, National Park Service Research Center: 59–60
  25. ^ Skinner, Scott. 1990. Earthmover. Wyoming Wildlife. 54(2): 4–9

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Four subspecies have been recognized on the basis of differences in skull size and pelage color (Long 1972): T. t. berlandieri, found in the southern United States; T. t. jacksoni, found in the north-central United States and southern Ontario in Canada; T. t. taxus, found in the Great Plains ecosystem ranging from the United States into the prairie provinces of Canada; and T. t. jeffersonii, found in western United States and southern British Columbia.

Genetic data support the current geographic delineation of the northwestern subspecies taxus and jeffersonii (Kyle et al. 2004). Gene flow between prairie populations of T. t taxus did not seem to be restricted, nor did there seem to be a restriction of gene flow for populations within mountain ranges for T. t. jeffersonii. In contrast, minimal gene flow was observed between populations separated by mountain ranges.

Taxus is a generic synonym.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!