Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

The Striped Skunk is the most common skunk in North America, yet most of what we know about it comes from studies of captive individuals. Like all skunks, it has a superb defense system, the ability to spray a foul-smelling fluid from two glands near the base of its tail. Skunk musk is oily and difficult to remove. If sprayed in the eyes, it causes intense pain and temporary blindness. Skunk kittens can spray when they are only eight days old, long before they can aim, a skill they exhibit only after their eyes open at about 24 days. Skunks attempt to give a warning before they spray: both Hooded and Striped skunks stamp their front feet before turning around and spraying. Like all skunks, Striped Skunks are nocturnal and eat a variable diet, mostly of insects, but also including small mammals, carrion, and some vegetation.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: "Schreber, J.C.D., 1776.  in Schreber's Die Säugthiere in Abbildungen nach der Natur mit Beschreibungen, Wolfgang Walther, Erlangen, 7 volumes, 1774-1846; 3(17):pl. 121[1776], text, 3(26):444, 588 (index)[1777]."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Striped skunks (Mephitis mephitis) have a range spanning most of North America. From east to west, they reach from the Atlantic to the Pacific Ocean, covering most of the continental United States and southern regions of Canada. They also range to the south over a portion of northern Mexico.

Biogeographic Regions: nearctic (Native )

  • Kurta, A. 1995. Mammals of the Great Lakes Region, Revised Edition. Ann Arbor, MI: University of Michigan Press.
  • Wade-Smith, J., B. Verts. 1982. Mephitis mephitis. Mammalian Species, 173: 1-7.
  • Whitaker, J. 1996. National Audubon Society Field Guide To North American Mammals, Revised Edition. New York: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The species occurs throughout most of southern Canada from British Columbia, Hudson Bay, and Nova Scotia, throughout the United States and into northern Mexico (Walker, 1964; Godin, 1982; Honacki et al., 1982).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Throughout much of North America, from northern Baja California, northern Durango, northern Tamaulipas, and Florida to central Canada (southwestern Northwest Territories, Hudson Bay, southern Quebec).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Striped skunks are native only to the Nearctic region. They are found throughout much of North America, ranging from central Canada, throughout the United States, and south into northern Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Striped skunks are easily distinguishable by their coloration pattern. With overall black pelage, they have a thin, white stripe along the center-top of their snout and forehead as well as a prominent white marking on their nape. While pattern varies greatly across individuals, the white marking on their nape typically runs along the dorsum, splitting into a thick, V-shape as it approaches their rump. Additionally, there are frequently white hairs on the edges of their bushy, black tail. With their small, triangular-shaped heads, striped skunks have short ears and black eyes that lack a nictitating membrane. Their maw holds 34 total teeth, with the following dental formula: I 3/3, C 1/1, P 3/3, M 1/2. Their legs are stout, with five-toed plantigrade feet and long foreclaws for digging.

They display minor sexual dimorphism, the males are slightly larger than the females. While most sources agree that M. mephitis is about the size of domestic cats, there is some discrepancy in their measurements. Their total length has been documented many times and estimates range from 465 to 815 mm. Their tail length differs slightly less; with measurements ranging 170 to 400 mm. Discrepancies are not as severe in the hindfoot measurements, with a range of 55 to 85 mm.

Measurements of body mass in M. mephitis also show a large range, between 0.7 to 6.3 kg. However, during periods of wintering, a reduction in body mass can result in losses of up to 47.7% in males and 50.1% in females, mostly due to fat metabolism. These overall differences could be an indication that M. mephitis differs in size across geographic ranges in the same way it differs in pelage patterns.

Range mass: 0.7 to 6.3 kg.

Range length: 465 to 815 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Nowak, R., D. Wilson. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore, MD: John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Striped skunks are easily recognized by their unique colors and pattern. Their fur is black with a white stripe that begins as a triangular shape on the top of the head and splits into two stripes that travel down the sides of the back. These two stripes come together again near the base of the tail. They also have a white stripe running from their nose between their eyes and ending on their forehead. Striped skunks are about the size of small house cats, with a small head, small ears, short legs, and a long, fluffy tail. Claws are longer on the front feet to aid in digging. Skunks are from 575 to 800 mm in body length and have tails that are from 173 to 307 mm in length.

Range mass: 1200 to 5300 g.

Range length: 575 to 800 mm.

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 80 cm

Weight: 6300 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are 15% larger than females, but females have longer tails.

Length:
Range: 575-800 mm

Weight:
Range: 1,200-5,300 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Mephitis mephitis is commonly found in a variety of habitats including woodlands, forests, wooded ravines and grassy plains. Over time, however, they have become more prominent in areas of extreme cultivation as well as in suburban neighborhoods. Other habitats may include scrubland, riparian areas and urban environments. On average, M. mephitis is found at elevations from sea level to 1,800 m, but have been documented as high as 4,200 m.

Range elevation: sea level to 4,200 m.

Average elevation: sea level to 1,800 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North American: Biology, Management, and Conservation. Baltimore, MD: John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
There is no single well-defined land type that can be classed as skunk range. They live in a variety of habitats: woods, plains, and desert areas but prefer open or forest-edge zones (Walker, 1964). Striped skunks are most abundant on agricultural lands where there is an ample supply of food and cover (Hamilton and Whitaker, 1979). They also adapt to life in urban areas under houses and garages (Rue, 1981; Rosatte, 1986; Larivière et al., 1999). They have been known to inhabit poorly drained marsh areas (Mutch, 1977). Although recorded from 4,200 m skunks usually are found from sea level to 1,800 m (Rue, 1981). Frequently found in suburban areas. Striped skunks are opportunistic omnivorous predatory feeders (Carr, 1974). Their diet varies depending on season and geographic location. In most areas, they feed extensively on insects (usually grasshoppers and beetles) associated with grassland areas (as opposed to forests). However, when insects are not available (early spring, late fall), their diet shifts to small mammals, birds, or vegetation (Verts, 1967).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Prefers semi-open country with woodland and meadows interspersed, brushy areas, bottomland woods. Frequently found in suburban areas. Dens often under rocks, log, or building. May excavate burrow or use burrow abandoned by other mammal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Striped skunks prefer open areas with a mixture of habitats such as woods, grasslands, and farms. They are found in all but the most arid habitat types. They usually live within two miles of a water source. They are frequently found in suburban areas where buildings provide them with burrows.

Habitat Regions: temperate

Terrestrial Biomes: chaparral ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Mephitis mephitis is an opportunistic feeder and will change its diet as needed. During the warmer spring and summer seasons, they are primarily insectivorous, known to feed on various grasshoppers, crickets, beetles, larvae and social insects such as bees. Other invertebrates may include worms, crayfish and other non-insect arthropods. Small mammals such as voles, as well as the eggs and young of ground-nesting birds are commonly consumed over the wintering period. Mephitis mephitis is also known to consume amphibians, reptiles, carrion and fish. While up to 80-90% of its diet is from an animal origin, M. mephitis is also known to feed on plant matter when in season. This includes corn, nightshade and fruits such as black and ground cherries.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms; aquatic crustaceans

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Varied diet of plant/animal foods (insects, small mammals, eggs, carrion, fruit, etc.) Opportunistic. Half of summer diet is insects (Banfield 1974). Excellent digger.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Striped skunks are true omnivores. A skunk's diet depends on what is available in its foraging territory. They eat many things including insecta, small mammalia (such as baby Peromyscus maniculatus and baby Peromyscus leucopus), carrion, Aves, crustaceans (such as Orconectes propinquus), fruits, grasses, leaves, buds, grains, and nuts.

Insects make up approximately 70% of their diet. Striped skunks often attack the nests of colonial insects, such as Apoidea and Formicidae. When attacking a bee hive, they wait for the angry bees to emerge from the hive, then bat them out of the air and eat them. Striped skunks also eat large numbers of Orthoptera and Coleoptera.

Animal Foods: mammals; fish; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms; aquatic crustaceans

Plant Foods: leaves; seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Mephitis mephitis is an important source of insect control; however, it also a vector for parasitism and disease. These may include fleas, lice, mites, ticks, and botfly larvae as well as various parasitic worms. Among diseases, there have been reports of leptospirosis and canine distemper, though M. mephitis is better known as a notorious carrier of rabies. Some sources believe that communal denning aids in the spread of these infectious diseases. They may also carry a variety of other diseases including Q fever, listeriosis, pulmonary aspergillosis, pleuritis, ringworm, murine typhus, tularemia, Chagas' disease and canine parvovirus.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most mammals avoid Mephitis mephitis due to its defensive capabilities, however, large birds of prey are unaffected by the musk. The most prominent of these are great horned owls and eagles. Mammalian species known to prey on M. mephitis include mountain lions, bobcats, coyotes, foxes, and badgers. Even though coyotes are known to prey on them, recent research showed that M. mephitis does not avoid areas of coyote activity.

Known Predators:

Anti-predator Adaptations: aposematic

  • Prange, S., S. Gehrt. 2007. Response of Skunks to a Simulated Increase in Coyote Activity. Journal of Mammalogy, 88/4: 1040-1049.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Skunks help to control insect populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Striped skunks have perhaps the most widely known defense system of any mammal, the scent-spraying mechanism. Striped skunks usually do not spray unless their life is in danger. When faced with danger, striped skunks arch their back and put up their tail and hair. If they feel that their life is in danger, they will bend into a U-shape with both head and rear-end facing the enemy. They then squirt out two streams of fluid from their rear-end that can travel up to 3 meters. The spray often causes nausea and burns the eyes and nasal cavities of the unfortunate target. Skunks advertise their noxious characteristic with their bright coloration, a phenomenon called aposematism. When an animal is sprayed by this brightly colored animal it will quickly learn to associate the skunk's appearance with their unpleasant experience and avoid skunks in the future. Because of their offensive odor, skunks are rarely preyed on by mammalian predators, which typically have an excellent sense of smell. Instead they are eaten primarily by large birds, such as Bubo virginianus and Buteo jamaicensis.

Known Predators:

  • great horned owls (Bubo_virginianus)
  • red-tailed hawks (Buteo_jamaicensis)

Anti-predator Adaptations: aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Home range up to several hundred ha; males tend to wander more than do females. Population density may fluctuate greatly. Several individuals, mainly females, may share winter den

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Mephitis mephitis relies primarily on visual displays to ward off predators or unwanted visitors and may resort to a chemical discharge if not left alone. Although they are usually silent, an individual can produce a wide variety of sounds from low growls to birdlike chirps. Little is known about their perception; however, an individual may react to auditory or visual cues at close range. Deprivation in visual, acoustic and even olfactory sensation has been considered a potential result of their defensive capabilities in additional to their passivity.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Verts, B. 1967. The Biology of the Striped Skunk. Urbana, IL: University of Illinois Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Striped skunks use scent marking to communicate presence and reproductive state to other skunks. They also communicate visually, by raising their fur and changing posture. Skunks have a good sense of hearing, but their vision is poor. They are mostly silent, but do make a variety of sounds such as churring, hisses, and screams.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Mostly crepuscular or nocturnal, sometimes active during daytime. May be dormant during extended periods of cold snowy weather; males more likely to be active in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Mephitis mephitis has a high mortality rate and usually does not survive its first year due to severe weather conditions and infectious disease. Past their first year, they can live up to seven years in the wild and up to 10 years in captivity. Other factors contributing to mortality include predation and parasitism as well as risk from human road systems and a vulnerability to hunting.

Range lifespan

Status: wild:
7.0 (high) years.

Range lifespan

Status: captivity:
10 (high) years.

Average lifespan

Status: wild:
less than one years.

Average lifespan

Status: wild:
6.0 years.

Average lifespan

Status: captivity:
10.0 years.

  • Gehrt, S. 2005. Seasonal Survival and Cause-Specific Mortality of Urban and Rural Striped Skunks in the Absence of Rabies. Journal of Mammalogy, 86/6: 1164-1170.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Up to 90% of skunks die in their first winter. In the wild skunks may live to be 2 to 3 years old. In captivity they have been known to survive for up to 15 years

Range lifespan

Status: wild:
3 (high) years.

Range lifespan

Status: captivity:
15 (high) years.

Typical lifespan

Status: wild:
1 (high) years.

Average lifespan

Status: wild:
<1 years.

Average lifespan

Status: captivity:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Under normal circumstances, female striped skunks only reproduce once a year, although males will reproduce with multiple females. Beyond fertilization, a female no longer associates with males and in fact will become aggressive towards them through vocalizing, stamping their feet and fighting if necessary.

Mating System: polygynous

Males approach from behind and begin by smelling and licking the female’s vulva. Seeking to mount, the male moves by the female's side where he proceeds to seize her nape. Females often resist, not becoming receptive until estrous, in which case they will usually take a submissive posture. Once successfully mounted, the male continues his copulatory thrusts. Copulation typically ends one minute after the male's acceptance.

Breeding usually occurs sometime between February and April. However, a secondary period can take place in May if the first litter is lost or in other cases, such as pseudopregnancy. Gestation lasts about 59 to 77 days, beginning with a period of delayed implantation that can last up to 19 days. Mephitis mephitis can produce a litter that ranges from 2 to 10 individuals, with individual masses of 32 to 35 g.

Breeding interval: Female striped skunks breed once a year under normal circumstances.

Breeding season: Breeding occurs from February to April, or during May under extenuating circumstances.

Range number of offspring: 2.0 to 10.0.

Average number of offspring: 4.0 to 7.0.

Range gestation period: 59 to 77 days.

Range weaning age: 6.0 to 7.0 weeks.

Range time to independence: 0.5 to 1.0 years.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous ; delayed implantation

Average birth mass: 33.5 g.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
335 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
335 days.

Although they are altricial with sparse pelage at birth, younglings have discernable patterns prior to birth. The younglings do not open their eyes until about three weeks of age and are typically weaned at six to seven weeks. It is at this time they learn to forage and hunt by following their mother in a single file line during her outings. Younglings rely on the protection of their mother, during this time she will display extremely defensive behavior. Male younglings become independent by July or August, while the female younglings may remain with their mother until the following spring. Both male and female younglings become sexually mature by the end of the first year, around 10 months of age on average.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents

  • Kurta, A. 1995. Mammals of the Great Lakes Region, Revised Edition. Ann Arbor, MI: University of Michigan Press.
  • Wade-Smith, J., B. Verts. 1982. Mephitis mephitis. Mammalian Species, 173: 1-7.
  • Whitaker, J. 1996. National Audubon Society Field Guide To North American Mammals, Revised Edition. New York: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds February-late March, peak in mid-February. Reported pregnancy rate is 78-96%. Gestation lasts 62-68 days. Litter of 2-10 (average 6-8) is born from late April to early June; one litter per year. Young are weaned and begin to follow female at 6-7 weeks; some on their own by fall. Sexually mature in first spring.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males usually live alone, except for a few days during the breeding season.

Mating System: polygynous

Striped skunks breed from mid-February until mid-March. The mother carries the babies for 59 to 77 days. From 1 to 10 helpless young are born. They are blind, deaf, and hairless but are capable of spraying skunk must as early as 8 days old. Their eyes open at 24 days old and their ears open soon after that. They are cared for in the den by their mother for two months, after which they are weaned. Young may stay with their mother for up to a year after reaching their adult size.

Breeding season: February and March

Range number of offspring: 1.0 to 10.0.

Range gestation period: 77 (high) days.

Average weaning age: 2 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 33.5 g.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
335 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
335 days.

Female striped skunks nurture their young inside their bodies before they are born and then provide them with milk afterward. Male skunks provide no parental care.

Parental Investment: altricial ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mephitis mephitis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAATCGGTGATTATTTTCTACTAATCACAAAGACATCGGCACTCTTTATCTTTTATTCGGCGCATGAGCCGGAATAGCAGGAACTGCCCTTAGCTTATTAATTCGGGCTGAGCTGGGGCAACCCGGAGCCCTATTAGGTGATGACCAAATTTATAATGTAGTTGTAACAGCTCATGCATTTGTCATAATCTTTTTTATAGTAATACCTATTATAATCGGTGGATTTGGGAACTGATTAGTTCCTTTAATAATTGGAGCCCCCGATATAGCATTTCCACGAATAAATAACATGAGCTTCTGACTATTACCCCCATCCTTTCTGTTACTATTAGCTTCCTCCATAGTAGAAGCAGGAGCAGGAACCGGATGAACAGTGTATCCCCCATTAGCAGGTAACCTAGCCCACGCAGGAGCATCTGTAGATTTGACAATCTTCTCTCTTCATTTAGCAGGGGTATCATCCATTTTAGGGGCTATTAACTTTATTACTACAATCATTAATATAAAACCCCCTGCAATATCACAATATCAGACCCCTCTATTCGTATGGTCTGTTCTAATTACAGCAGTTCTACTTCTCCTGTCATTACCAGTACTAGCAGCTGGTATTACTATGCTACTAACAGATCGAAATCTTAATACAACCTTTTTTGACCCAGCTGGAGGAGGAGACCCCATTTTGTATCAACACCTGTTCTGATTCTTTGGACACCCAGAAGTCTATATCTTAATCTTGCCAGGATTTGGAATAATTTCACACATTGTAACCTACTACTCAGGTAAAAAAGAACCTTTTGGGTATATAGGAATAGTGTGAGCAATAATATCTATTGGCTTCTTAGGCTTTATTGTATGAGCACATCACATATTTACAGTAGGCATAGATGTAGATACGCGAGCTTATTTTACCTCTGCCACCATGATTATTGCAATCCCAACTGGAGTAAAAGTATTCAGTTGGCTAGCTACACTGCATGGAGGTAATATCAAATGATCACCCGCTATACTGTGAGCACTAGGGTTCATTTTCTTATTTACTGTAGGAGGTCTTACAGGGATTGTATTATCTAATTCCTCACTGGATATTGTACTCCACGACACATATTATGTAGTAGCTCATTTCCACTATGTATTATCAATGGGGGCAGTATTTGCCATTATAGGCGGTTTTGTTCACTGATTCCCTTTATTCTCAGGCTATACACTCAATGACACATGAGCAAAAATTCACTTTACAATTATATTTGTAGGAGTAAACATAACATTTTTCCCTCAACACTTCCTAGGTCTATCAGGAATACCTCGACGTTACTCAGATTACCCTGACGCCTACACAACATGAAACACAGTATCCTCTATAGGCTCATTCATCTCACTCACAGCAGTTATATTAATAGTCTTCATGATTTGAGAAGCCTTTGCATCCAAACGAGAGGTGCTAACAATTAGCTATACTTCAACCAACATTGAATGGTTACATGGATGCCCTCCTCCATATCATACATTCGAAGAACCCGCCTATGTTTTATTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mephitis mephitis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Striped skunks have an abundant population and are not threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as they are widely distributed in a variety of habitats including human altered habitats and have increased in abundance in many regions during recent years (Andren 1995, Kuehl and Clark 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Striped skunks are abundant and are not of any conservation concern.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Density estimates for striped skunk populations ranged from 0.7 to 18.5/km2 but most were 1.8 to 4.8/km2 (Allen and Shapton, 1942; Bailey, 1971; Bennitt and Nagel, 1937; Burt, 1946; Jones, 1939; Stout and Sonenshine, 1974; Verts, 1967). Density levels reported fluctuated widely between years, possibly in response to outbreaks of diseases (Allen and Shapton, 1942; Brown and Yeager, 1943; Verts, 1967). Skunk populations seemingly have high recruitment and turnover rates because 50 to 71% of striped skunks do not attain an age of 1 year (Bailey, 1971; Casey and Webster, 1975; Verts, 1967). Due to removal of top predators (Crooks and Soulé, 1999; Rogers and Caro, 1998; Soulé et al., 1988), altered land use (Dijak and Thompson, 2000; Donovan et al. 1997; Oehler and Litvaitis, 1996), reduced harvest of skunks (Hamilton and Vangilder, 1992), and perhaps other factors, populations of M. mephitis, have increased in abundance in many regions during recent years (Andren, 1995; Kuehl and Clark, 2002).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Striped skunks (Mephitis mephitis) are vulnerable to a variety of mortality agents such as predation, disease, environmental conditions (e.g., severe winter or drought), chemicals, and anthropogenic activities (Gehrt, 2005; Hansen et al., 2004; Rosatte and Larivière, 2003). Another limiting factor in skunk populations are diseases such as rabies and the resultant control programs (Sikes, 1970). Terrestrial rabies apparently was the case for skunks in Illinois, where population fluctuations are closely tied to rabies outbreaks (Verts, 1967). Striped skunk pelts were considered valuable commodities in the fur trade in the first half of the 20th century, but their value and the number of skunks harvested for fur declined dramatically in the 1950's and 1960's as fashions shifted away from long-haired furs (Verts, 1967). Striped skunks may be harvested in most areas of the United States and Canada. In some states, such as Florida, skunks may be taken only in season, but most states allow harvests year-round (Rosatte, 1987).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Given the ecological and economic importance of this species, there is a need to better understand microhabitat factors that are associated with occurrence of the taxon (Baldwin et al., 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: See Conover (1990) for information on the use of emetine dihydrochloride to reduce predation on chicken eggs. See Bickle et al. (1991) for information on the use of hormone implants to limit populations through control fertility; this method could be useful in urban/suburban situations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Mephitis mephitis can carry diseases and parasites infectious not only to humans, but also to other domesticated animals. They are sometimes considered general pests when they dig up lawns, take up residents in buildings or when they are provoked into discharging their musk.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In addition to the ecosystem, Mephitis mephitis serves as an important source of insect control for human populations. At one time, their pelts were valuable for the fur trade; however, they are not currently in high demand. Mephitis mephitis may have been a source of food for native North Americans and they may have been used in medical treatments for both the natives and the pioneers. There is no indication that they are still used as a source of food or medicine, however, the clinging quality of their musk has made it valuable as a perfume foundation. Along with other members of family Mephitidae, M. mephitis can be kept as a household pet in certain areas throughout the United States as well as in other countries, though this often requires a permit.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; source of medicine or drug ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Large numbers of pelts taken in some areas, but value relatively low (pelt yielded average of about $1.60 in Ok in early 1980s (Caire et al. 1989). Can do considerable damage to poultry. Major carrier and reservoir of rabies (though most skunks are not rabid).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Striped skunks sometimes eat crops and raid chicken pens, though this is rare. They are one of the primary carriers of sylvatic rabies and thus can be very dangerous to pets and humans. They can also cause some damage when building their burrows.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Striped skunks, because of their diet, often eliminate insect and rodent pests that cause destruction of crops. In the past, skunk furs were of great importance to the fur industry, but skunk fur value has declined along with the industry. Skunks are also kept as pets, though this is illegal in most states because of their role in rabies transmission.

Positive Impacts: pet trade ; body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Striped skunk

The striped skunk (Mephitis mephitis) is an omnivorous mammal of the skunk family Mephitidae. Found north of Mexico, it is one of the best-known mammals in Canada and the United States.[3]

Description[edit]

The striped skunk has a black body with a white stripe along each side of its body; the two stripes join into a broader white area at the nape. Its forehead has a narrow white stripe. Similar in size to a domestic cat, this species is the heaviest species of skunk, though it is not as long (in body or tail length) as the American hog-nosed skunk.[4] Adults can weigh from 2.5 to 15 lb (1.1 to 6.8 kg), although the average weight is 6–8 lb (2.7–3.6 kg). The animal's length (excluding the tail) is 13 to 18 in (33 to 46 cm). Males tend to be around 10% larger than females.[5] The bushy tail is 7 to 10 in (18 to 25 cm), and sometimes has a white tip. The presence of a striped skunk is often first made apparent by its odor. It has well-developed anal scent glands (characteristic of all skunks) that can emit a highly unpleasant odor when the skunk feels threatened.

Range and ecology[edit]

Striped skunk

The striped skunk is widespread in North America. Its range includes south Canada from Nova Scotia to British Columbia as well as most of the continental United States and parts of northern Mexico.[5][6] It can be found in elevations up to 1800 m but rarely above 4000 m.[7] Skunks can be found in a number of habitats, including woodlands, grasslands and agricultural lands. The skunk has increased its range with the cutting of forests throughout North America.[5]

The striped skunk is omnivorous and has a varied diet. Its diet consists mostly of insects such as beetles, grasshoppers and crickets.[5][6][8] It also eats earthworms, snails, crayfish, wasps and ants.[5][8] It preys on vertebrates like frogs and small mammals including voles, mice, moles, rats and squirrels.[5][8][9] It also eats bird eggs. Plant matter the skunk eats include blackberries, raspberries, black cherries, blueberries, grains, corn, and nuts.[5] Skunks eat mostly insects and mammals during the spring and summer.[7] During the fall and winter, more plant matter is consumed.[6] In settled areas, skunks also seek human garbage. Less often, skunks may be found acting as scavengers, eating bird and rodent carcasses left by cats or other animals. Pet owners, particularly those of cats, may experience a skunk finding its way into a garage or basement where pet food is kept. Skunks commonly dig holes in lawns in search of grubs and worms.

Skunks are one of the primary predators of the honeybee, relying on their thick fur to protect them from stings. The skunk scratches at the front of the beehive and eats the guard bees that come out to investigate.

Most predatory animals of the Americas, such as wolves, foxes and badgers, seldom attack skunks – presumably out of fear of being sprayed. The exception is the great horned owl—the animal's only serious predator—which, like most birds, has a poor-to-nonexistent sense of smell.

Behavior and reproduction[edit]

Skunk kit
In Parc Omega, Quebec, Canada

The skunk is crepuscular. Beginning its search for food at dawn and dusk, it feeds on mice, eggs, carrion, insects, grubs, and berries. At sunrise, it retires to its den, which may be in a ground burrow, or beneath a building, boulder, or rock pile. While the male dens by itself, several females may live together. The striped skunk does not hibernate but instead goes into a dormant or semi-active state. Outside the breeding season, males are solitary and try to build fat reserves while females defend their maternity dens.[5]

Breeding in the skunk mostly occurs from mid-February to mid-April.[5][8] A skunk breeds only once a year.[5][9] Male skunks are polygamous and will mate with several females in succession.[5] When encountering an estrous female, a male will approach her from the rear and then smell and lick the vulva area.[5] The male then grasps the female by the nape and then mounts and copulates with her.[5][9]

Once a female is impregnated she doesn’t allow any more copulations and will fight off any male that tries to mount her.[5] However, females that lose their litters may lead to a later mating.[8] The young are born in May or early June.[8] Skunks tend to have litters of 4 to 8 with 2 and 10 being extremes.[8] The young are born hairless but have their striping pattern.[8] By eight days, the young’s musk odor can be emitted. By 22 days, the young’s eyes open.[8] After an eight week nursing, the litter then hunt with their mothers and eventually they disperse.[8]

In captivity[edit]

Main article: Pet skunk
Domesticated skunk

The striped skunk can be kept as a pet in the United States (not all states), Germany, the Netherlands, Italy and the United Kingdom. The striped skunk – but not other species, depending on the province – is illegal to keep as a pet in Canada. Although capable of living indoors with humans similarly to dogs or cats, pet skunks are relatively rare, partly due to restrictive laws and the complexity of their care. Pet skunks are mainly kept in the United States, Germany, the Netherlands, and Italy.

In the United States, pet skunks can be purchased from licensed animal shelters, non-profit skunk educational organizations such as the American Domestic Skunk Association, Inc., or breeders with a permit from the U.S. Department of Agriculture's Animal and Plant Health Inspection Service. Baby skunk availability peaks during springtime, immediately following the skunk mating season. Some large fur farms sell surplus skunks.

Classification and first identification[edit]

The striped skunk was first described by Johann Christian Daniel von Schreber in 1776.[10]

Thirteen subspecies of striped skunk are generally recognized:[1]

  • M. m. avia Bangs, 1898
  • M. m. elongata Bangs, 1895
  • M. m. estor Merriam, 1890
  • M. m. holzneri Mearns, 1898
  • M. m. hudsonica Richardson, 1829
  • M. m. major Howell, 1901
  • M. m. mephitis Schreber, 1776
  • M. m. mesomelas Lichtenstein, 1832
  • M. m. nigra Peale and Palisot de Beauvois, 1796
  • M. m. notata Hall, 1936
  • M. m. occidentalis Baird, 1858
  • M. m. spissigrada Bangs, 1898
  • M. m. varians Gray, 1837

In popular culture[edit]

Skunks have made their way into popular culture, as Flower in Disney's Bambi and Chuck Jones's Pepé Le Pew

References[edit]

  1. ^ a b Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Reid, F. & Helgen, K. (2008). "Mephitis mephitis". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 2010-01-18. 
  3. ^ Burt, William H.; Grossenheider, Richard P. A Field Guide to the Mammals (of America North of Mexico). he Petersen Field Guide Series. Houghton Mifflin Company. p. 65. ISBN 0-395-24084-0. 
  4. ^ Luke, Hunter (2011). Carnivores of the World. Princeton University Press. ISBN 9780691152288. 
  5. ^ a b c d e f g h i j k l m n Godin, A. J. 1982. "Striped and hooded skunks." In: J. A. Chapman and G. A. Feldhamer (eds), Wild mammals of North America: biology, management, and economics, pp. 674–687. Johns Hopkins University Press, Baltimore, Maryland, USA.
  6. ^ a b c Rosatte, R. C. 1987. Striped, Spotted, Hooded, and Hog-nosed Skunk. In: M. Novak, J. A. Baker, M. E. Obbard and B. Malloch (eds), Wild furbearer management and conservation in North America, pp. 1150 pp.. Ontario Ministry of Natural Resources and the Ontario Trappers Association, Ontario, Canada, Toronto, Ontario, Canada.
  7. ^ a b Rue, L. L. 1981. Furbearing animals of North America. Crown Publications, New York, USA.
  8. ^ a b c d e f g h i j Hamilton Jr., W. J. and Whitaker Jr., J. O. 1979. Mammals of the Eastern United States. Cornell University Press, Ithaca, New York, USA.
  9. ^ a b c Verts, B. J. 1967. The biology of the striped skunk. University of Illinois Press, Urbana, USA.
  10. ^ ITIS Report. "ITIS Standard Report: Mephitis Mephitis". Retrieved 2010-01-18. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Based on patterns of mtDNA variation in Mustelidae, Dragoo and Honeycut (1997) recommended that skunks (Mehitis, Conepatus, Spilogale) and the Oriental stink badger (MYDAUS) be separated as a distinct family (Mephitidae). Wozencraft (in Wilson and Reeder 2005) recognized the family Mephitidae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!