Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

The Fisher is a forest-loving predator that eats anything it can catch, usually small-to-medium-sized rodents, rabbits, hares, and birds. It also eats carrion. Fishers are among the few predators able to kill Porcupines. They do it by biting the face, where there are no quills, until the animal is too weak to prevent being rolled over and attacked in the soft underbelly. Fishers are active by day or night. They tend to be solitary and defend territories. They were once hunted for their lustrous, chocolate-brown fur, and the range of this species has been reduced greatly in the United States. They are still hunted in some places, but some states and provinces of Canada list the fisher as endangered, and the population has recovered from extreme lows in the last century.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Erxleben, J.C.P., 1777.  Systema regni animalis per classes, ordines, genera, species, varietas, cum synonymia et historia animalium.  Classis I, Mammalia, p. 470. Wegand, Leipzig, 636 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Fishers range from Quebec, the Maritime Provinces, and New England west across boreal Canada to southeastern Alaska, south in the western mountains to Utah, Wyoming, Idaho, and California, and formerly south to Illinois, Indiana, Tennessee, and North Carolina. Large range in northern North America; extirpation from southern portion of range, due mainly to habitat loss, has been counteracted by recent natural and human-aided range expansions in the eastern U.S.; adequate population data are unavailable for much of the range, but the species currently is regarded as secure.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Fishers are found only in North America, from the Sierra Nevada of California to the Appalachians of West Virginia and Virginia. They range along the Sierra Nevada to their southernmost extent and south along the Appalachian mountain chain. They do not occur in the prairie or southern regions of the United States. Populations have declined in the southern parts of their range in recent history.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

More info for the terms: cover, natural

According to reviews, the fisher occurs from southern Yukon and southwestern Northwest Territories southeast through British Columbia and possibly extreme southeastern Alaska, Alberta, Saskatchewan, Manitoba, Ontario, southern Quebec, and New Brunswick to Nova Scotia. Its distribution extends south through several forested areas of the northeastern United States including Maine, New Hampshire, Vermont, northern New York, Pennsylvania, western Massachusetts, the upper peninsula of Michigan, and northern Wisconsin and Minnesota. There is also a population in West Virginia. In the western United States, fisher populations are known to occur in western Montana, the Idaho panhandle [94,96,97], the southern Sierra Nevada of California, the Klamath and Siskiyou mountains of northwestern California and extreme southwestern Oregon, and the southern Cascade Range of southwestern Oregon [14,136]. The fisher may be extirpated from Washington [14,118]. For more detailed summaries of the fisher's historic and current distribution, see these sources: [94,96,97]. For a map of the fisher's current and historic distribution, search the National Museum of Natural History's Mammal Species of the World website for fisher.

The following lists are speculative. They are based on distribution information reported no earlier than 1993 and the habitat characteristics and species composition of communities fishers are known to occupy. There is not conclusive evidence that fishers occur in all the habitat types listed, and some community types may have been omitted, especially in areas where fishers have not been recently documented. In addition, the following cover types provide habitat of varying quality for fishers. See Preferred Habitat for more detail.

  • 14. Aubry, Keith B.; Lewis, Jeffrey C. 2003. Extirpation and reintroduction of fishers (Martes pennanti) in Oregon: implications for their conservation in the Pacific states. Biological Conservation. 114(1): 79-90. [63937]
  • 94. Powell, Roger A. 1993. The fisher: Life history, ecology, and behavior. 2nd ed. Minneapolis, MN: University of Minnesota Press. 237 p. [63997]
  • 96. Powell, Roger A.; Buskirk, Steven W.; Zielinski, William J. 2003. Fisher and marten: Martes pennanti and Martes americana. In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: The Johns Hopkins University Press: 635-649. [64017]
  • 97. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]
  • 118. Thompson, Jonathan. 2005. Fisher conservation in the Pacific states: field data meet genetics. PNW Science Findings. Issue 70. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 5 p. [64040]
  • 136. Zielinski, William J.; Truex, Richard L.; Schlexer, Fredrick V.; Campbell, Lori A.; Carroll, Carlos. 2005. Historical and contemporary distributions of carnivores in forests of the Sierra Nevada, California, USA. Journal of Biogeography. 32(8): 1385-1407. [64028]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

States or Provinces

(key to state/province abbreviations)
UNITED STATES
AK CA CT ID ME MA MI MN MT NH
NY PA OR VT WI WY WV

CANADA
AB BC MB NB NT NS ON QC SK YT

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

BLM PHYSIOGRAPHIC REGIONS [25]:

1 Northern Pacific Border

2 Cascade Mountains

4 Sierra Mountains

8 Northern Rocky Mountains
  • 25. Bernard, Stephen R.; Brown, Kenneth F. 1977. Distribution of mammals, reptiles, and amphibians by BLM physiographic regions and A.W. Kuchler's associations for the eleven western states. Tech. Note 301. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 169 p. [434]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Fishers are found only in North America, from the Sierra Nevada of California to the Appalachians of West Virginia and Virginia. They range along the Sierra Nevada to their southernmost extent and south along the Appalachian mountain chain. They do not occur in the prairie or southern regions of the United States. Populations have declined in the southern parts of their range in recent history.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male fishers are, on average, larger than females, with a body length of 900 to 1200 mm and a body weight of 3500 to 5000 grams. Females range from 750 to 950 mm in length and 2000 to 2500 grams in weight. Tail length of males is between 370 and 410 mm and tail length of females is between 310 and 360 mm. Their coats range from medium to dark brown, with gold to silver hair tips on their head and shoulders, and with black legs and tail. They may also have a cream chest patch of variable size and shape. Fur color and pattern varies among individuals, sexes and seasons. Fishers have five toes on their feet, and their claws can be drawn up into the paws, like a cat's.

Range mass: 2000 to 5000 g.

Range length: 750 to 1200 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Males fishers are, on average, larger than females, with a body length of 900 to 1200 mm and a body weight of 3500 to 5000 grams. Females range from 750 to 950 mm in length and 2000 to 2500 grams in weight. Tail length of males is between 370 and 410 mm and tail length of females is between 310 and 360 mm. Their coats range from medium to dark brown, with gold to silver hoariness on their head and shoulders, and with black legs and tail. They may also have a cream chest patch of variable size and shape. Fur color and pattern varies among individuals, sexes and seasons. Fishers have five toes on their feet, and their claws are retractable.

Range mass: 2000 to 5000 g.

Range length: 750 to 1200 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 900-1,200 mm males; 750-950 mm females

Weight:
Average: 3,500 g males; 2,000-2,500 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Fishers inhabit upland and lowland forests, including coniferous, mixed, and deciduous forests. They occur primarily in dense coniferous or mixed forests, including early successional forest with dense overhead cover (Thomas, 1993). They generally avoid areas with little forest cover or significant human disturbance. The fisher is adapted for climbing but is primarily terrestrial. It is a generalized predator whose major prey are small to medium-sized mammals and birds, and carrion (Powell, 1981).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fishers prefer coniferous forests, but they are also found in mixed and deciduous forests. They prefer habitats with thick canopies. They also prefer habitats with many hollow trees for dens. Trees typically found in fisher habitats include spruce, fir, white cedar and some hardwoods. Also, as would be expected, their habitat preference reflects that of their favored prey species.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: avoidance, cover, density, hardwood, selection, shrub, snag, tree

Throughout their range fishers prefer closed canopy habitats and avoid open areas. In a mixed-wood forest in central Alberta, open fields and stands with <50% total canopy were used less than expected based on availability (P<0.05). In addition, average canopy cover at 72 locations of 4 fishers was significantly (P<0.001) greater than at 70 random sites adjacent to fishers' home ranges [17]. In coniferous forests of north-central Idaho, hunting (P≤0.0001) and resting (P≤0.001) fishers selected dense (≥81%) and avoided open (≤20%) canopies. In addition, summer fisher locations had significantly (P≤0.0001) greater canopy cover (69.5%) than random sites (59.4%) [65]. Average canopy closure at 599 resting locations of 36 fishers in 2 California study areas was 93.4%, which was significantly (P<0.0033) greater than the 88.8% average canopy closure at random sites [137]. In the southern Sierra Nevada of California, stands with canopy closure of 60% to100% occupied the highest proportion of area (66.3%) within fisher home ranges. Females' (n=8) home ranges included more dense-canopy area (71.7%) than males' (55.6%, n=4). [138]. In predominantly open, upland hardwoods of upper peninsular Michigan, fishers used open areas significantly (P<0.001) less than available in the study area and in the vicinity of tracks [95]. In 75-year-old, even-age hardwood, mixed, and coniferous forests of northern New Hampshire, there was a significant (P<0.01) difference between the use of various canopy classes and their availability. Fishers avoided stands with 30% to 50% (observed=4, expected=18.5) and 51% to 80% cover (observed=13, expected=26.8) and preferred stands with 80% to 100% cover (observed=445, expected=416.7) [66].

Despite their preference for closed-canopy habitats, there are cases where fishers use open areas. For instance, in south-central Maine, natal dens occurred in areas with <50% cover (21.9%) more often than random points (5.0%). Although availability of cavities was not measured, the lack of use of this relatively open habitat at other times, and the stand history, suggested that cavities were comparatively abundant in this area. In addition, most dens were near areas of relatively greater cover [88]. Although recent clearcuts and alpine zones were typically avoided, pole/sawtimber stands with 10% to 49% canopy closure were used in accordance with availability by translocated fishers in coniferous forests of northwestern Montana [108]. In addition, clearcuts in 75-year-old, even-age hardwood, mixed, and coniferous forests of northern New Hampshire were used (observed=24) in proportion to availability (expected=24.3) in summer [66].

Fishers prefer structurally complex habitats. Although canopy diversity was not significantly (P=0.138) different at locations of translocated fishers and random sites in a mixed-wood forest in central Alberta, canopy diversity was 1 of 4 variables in a significant (P<0.001) function for discriminating fisher locations and random sites [17]. The lack of fisher hunting (observed=21%) and resting (observed=3%) sites in coniferous forests of north-central Idaho with only 1 canopy level suggests that structurally complex forests were preferred [65]. Multiple analyses of structural features at 599 resting locations of 36 fishers in 2 California study areas, one predominantly comprised of Douglas-fir, white fir, Oregon white oak, and tanoak stands and the other primarily Sierran mixed conifer, ponderosa pine, red fir, and montane hardwoods habitats, implied a preference for a range of sizes and types of structural elements, including greater variation in bole size than random [137]. Selectivity for specific cover of various shrub layers and high volumes of coarse woody debris suggests the importance of structural complexity to fishers in coniferous forest of south-central British Columbia [129].

Fishers generally prefer coniferous stands and avoid hardwood stands. In northern hardwood-eastern white pine-eastern hemlock (Pinus strobus-Tsuga canadensis) forests of north-central Massachusetts and southwestern New Hampshire, maternal dens were located more often in conifer and less often in hardwood canopy (P<0.001) when compared with the relative availability of these overstory types [99]. In predominantly open, upland hardwoods of upper peninsular Michigan, resting fishers avoided (P<0.05) northern hardwoods and selected lowland-conifer and other habitats [95]. In a northwestern Connecticut forest comprised of hardwoods, softwoods, and mixed woods, fishers used hardwoods as rest sites (62%) less than expected (73.1%, P<0.05) in winter [68]. In south-central Maine, aerial locations (n=782) of 43 fishers occurred in coniferous forest significantly (P<0.05) more than expected based on availability in fall, winter, and spring and occurred in deciduous forest significantly (P<0.05) less than expected all year [10]. In a south-central British Columbia forest dominated by Douglas-fir, lodgepole pine, and hybrid white spruce, transient fishers (n=15) used coniferous habitat (56%) more than expected (P<0.05) based on availability (32%) [128]. Fishers reintroduced to coniferous forests of northwestern Montana avoided "hardwoods" (P<0.01), preferring western redcedar/western hemlock (Thuja plicata/Tsuga heterophylla) (P<0.001) and mixed-conifer stands (P<0.01) [108].

Despite an apparent preference for conifers in many areas, there are exceptions to this trend. For instance, in a mixed-wood forest of central Alberta, stands with ≥50% total cover comprised of >75% deciduous species were preferred [17]; and in northwestern Connecticut fishers showed no apparent preference for coniferous habitats dominated by eastern hemlock and eastern white pine [68]. Although fishers preferred (P<0.01) western redcedar/western hemlock and mixed-conifer stands in northwestern Montana, subalpine fir stands were avoided (P<0.001) [108]. In some areas, fishers selected habitats with a hardwood component. For example, fishers in south-central British Columbia selected (P<0.05) stands with 21% to 40% deciduous cover and avoided stands with no deciduous component in the summer [129]. In 75-year-old, even-aged forests of northern New Hampshire, fishers occurred in habitats comprised of 51% to 74% coniferous species significantly (P<0.05) more than expected based on availability [66], and in northern Michigan fishers preferred stands with intermediate (14-76%) amounts of deciduous canopy cover [117]. There are several possible explanations for differences in fisher selection of cover types, including certain habitat types being in better condition in some areas than in others [17], prey availability and efficiency of capturing prey [95], and variation in availability of habitats across the fisher's range [137].

Fishers generally prefer stands with large trees. In a predominantly deciduous and mixed-wood forest in central Alberta, tree height averaged 20.7 feet (6.3 m), and tree diameter at breast height (DBH) averaged 2.6 inches (65.5 mm) at 72 locations of 4 translocated fishers. These values were significantly (P=0.027 and 0.041, respectively) greater than at 70 random sites (tree height=14.4 feet (4.4 m), tree DBH=1.7 inches (44.0 mm)) adjacent to fishers' home ranges [17]. In Douglas-fir forest of northwestern California, fishers were positively associated with the density of large (>35 inches (>90 cm) DBH) Douglas-fir trees [103]. Fishers in sugar maple (Acer saccharum), red maple (A. rubrum), and northern red oak (Quercus rubra) forests of the Ottawa Forest in northern Michigan appeared to prefer habitats with trees larger than 10.6 inches (27 cm) DBH [117]. Although fishers occurred (observed=56) in low (0-20 feet (0-6.1 m)) canopy forests significantly (P<0.01) more than expected (expected = 40.2) based on availability in 75-year-old, even-age hardwood, mixed, and coniferous forests of northern New Hampshire, this was most likely due to their strong preference for the wetland habitat type that was comprised entirely of this canopy class [66].

Understory characteristics and composition may be important to fishers in some areas. In a predominantly deciduous and mixed-wood forest in central Alberta, the density of woody stems was significantly (P=0.001) greater at 72 locations of four translocated fishers (25.3 stems/m²) than at 70 random sites (12.5 stems/m²) adjacent to fishers' home ranges. In addition, woody stem density was 1 of 4 variables in a significant (P<0.001) function for distinguishing fisher locations from random sites [17]. In an area of south-central British Columbia dominated by Douglas-fir, lodgepole pine, and hybrid white spruce, specific structural features of the of the forest floor were selected, including shrub layer and canopy closure, and high volumes of coarse woody debris. It is suggested that the complexity provides habitat for fisher prey species, and that too much cover near the ground could reduce hunting success, which may explain the avoidance of stands with >80% canopy closure of the low shrub layer [129]. In predominantly grand fir and subalpine cover types of north-central Idaho, fisher winter (11.2%) and summer (8.8%) use sites had significantly (P≤0.0004) greater understory coverage of Pacific yew (Taxus brevifolia) than random sites (3.6%) [65]. In northern hardwood-eastern white pine-eastern hemlock forests of north-central Massachusetts and southwestern New Hampshire, coniferous understory was used more and hardwood understory was used less than would be expected based on availability in the subunit (P<0.001) [99].

Due to their importance as Denning/resting habitat, density and size of snags and coarse woody debris are important characteristics of fisher habitat. In predominantly grand fir and subalpine fir cover types of north-central Idaho, there were significantly (P≤0.0002) more large (9.5-inch (24.1-cm) DBH) snags on fisher summer use sites, and 3 of 4 snag size classes had significantly (P=0.0001) greater densities on winter use sites than random sites. In addition, fisher summer use sites had greater densities of 3 of 5 log size classes (P<0.02), and winter use sites had significantly (P=0.034) greater densities (23.3 m³/ha) of large (>21 inches (54.6 cm) in diameter at small end) logs than random sites (10.7 m³/ha) [65]. In an area of south-central British Columbia dominated by Douglas-fir, lodgepole pine, and hybrid white spruce, fishers avoided stands with no coarse woody debris in both summer and winter, selected stands with >200 m³ of coarse woody debris/ha in the summer, and selected stands with >50 m³ of coarse woody debris with diameters >7.9 inches (20 cm) in winter [129]. In a mixed-wood forest in central Alberta, the diameter of downed logs was significantly (P=0.01) greater at 72 locations of 4 translocated fishers (28.1 mm) than at 70 random sites (19.2 mm) adjacent to fishers' home ranges [17].

Fishers select different habitats throughout the year. As detailed in the Denning/resting habitat section, fishers are more likely to use burrows and coarse woody debris for resting in winter than in summer [10,65,68,127]. In addition, open habitats may be used more often in summer. In 75-year-old, even-age hardwood, mixed, and coniferous forests of northern New Hampshire, clearcuts (observed=3, expected=9) were avoided (P<0.01) in winter, but were used (observed=24) in proportion to availability (expected=24.3) in summer [66]. In predominantly hardwood forest of northwestern Connecticut, hardwoods were used as resting sites (62%) less (P<0.05) than expected (73.1%) in winter but in accordance with availability in summer [68]. Similarly, in an area of south-central British Columbia dominated by Douglas-fir, lodgepole pine, and hybrid white spruce, nonforested stands were avoided in winter, but used in accordance with availability at the stand scale in summer and autumn [129]. Lack of cover [66], decreased snow interception [129], and thermoregulation [68] have been suggested as reasons for decreased use of deciduous habitats in winter. Use of successional classes varied seasonally in coniferous forests of north-central Idaho. Young forests were used more in winter (P≤0.0001), while mature forests were preferred (P=0.028) in summer. This seasonal change in habitat selection may have been related to changes in prey availability [65].

Habitat selection can also vary between sex and age classes. Males used conifers in proportion with availability, while females avoided conifers in mixed-wood forests of central Alberta [17]. In hardwood, mixed and coniferous forests in northwestern Connecticut, females used significantly (P<0.05) smaller cavity trees (x DBH=21 inches (54.3 cm)) than males (x DBH=29 inches (73.0 cm)) [68]. Females used snags as resting sites (31.7%) significantly (P<0.001) more than males (18%) in 2 study areas of California [137]. In New Hampshire, females selected sites with significantly (P<0.01) higher elevations (1,824 feet (556 m)) than males (1,657 feet (505 m)) [66], while in the southern Sierra Nevada females may select lower-elevation sites compared to males [138]. Females had stronger habitat preferences than males in mostly Douglas-fir and white fir forests of northwestern California [30] and in Sierran mixed-conifer, ponderosa pine, red fir, and montane hardwoods habitats of southern Sierra Nevada [138]. However, in New Hampshire females were only selective of cover types in winter, while males were selective year-round [66]. Juveniles were less selective than adults in predominantly Douglas-fir and white fir forests of northwestern California [30]. Many of these differences are likely due to biology. For instance, the relatively small females (See sexual dimorphism) can occupy smaller trees, and wider-roaming males are more likely detected in relatively rare habitats [17]. Some differences may reflect the comparatively larger males excluding females and juveniles from preferred habitat rather than fishers of different age and sex classes preferring different habitats [30].

Foraging habitat: Prey availability or diversity is an often suggested cause of fisher selection or avoidance of a given habitat [17,65,66,68,95,129]. For instance, one possible reason for the avoidance of coniferous forests in central Alberta was low prey densities due to the high degree of browsing pressure in these areas [17]. In south-central British Columbia, selection of structurally complex coniferous forests may have been related to prey availability and hunting success in these habitats [129]. In Maine [10], northwest Connecticut [68], and central Alberta [17], the diversity and availability of prey in hardwood and mixed forests may explanation the lack of a stronger associations with conifers. In addition, in north-central Idaho the change in preference from mature and old-growth coniferous forests in summer to young coniferous forests in winter may reflect a seasonal switch in prey species [65].

Fishers do not appear as selective of hunting and traveling habitat as they are of resting and denning habitat. In primarily grand fir and subalpine fir cover types of north-central Idaho, fishers used pole-sapling forests (observed=13%) significantly (P≤0.001) more when hunting than when resting (observed=0%). Hunting fishers were less selective of canopy cover classes than resting fishers. Hunting fishers occurred in stands with 20-80% cover as expected based on availability, while only stands with 40-63% cover were used in accordance with availability by resting fishers. Hunting fishers also used forests with only one canopy level more often (observed=21%) than resting fishers (observed=3%) [65]. In Maine, fishers rested in coniferous forest more than expected in summer, while active fishers used comparatively diverse habitats [10]. In 75-year-old, even-age hardwood, mixed, and coniferous forests of northern New Hampshire stationary fishers occurred in the mixed coniferous-hardwoods and wetland associations more often than expected based on availability of these types. However, occurrence of traveling fishers in these habitat types was similar to their availability [66]. In predominantly open, upland hardwoods of upper peninsular Michigan, cover types used by resting fishers and traveling fishers were significantly (P<0.01) different [95]. The fisher's diverse diet may explain the greater variability of hunting habitats [10,66,97].

Denning/resting habitat:
Although fishers rest in many structures, they typically use downed logs, snags, or living trees.

Fisher resting sites in the snow, slash piles, and underground have been reported in Maine [40], Ontario [42], and the upper peninsula of Michigan [95]. In a coniferous forest of south-central British Columbia, 2 of 32 resting locations were in slash piles [129] and 4 of 86 were either under rocks or in underground burrows [127]. In predominantly hardwood forests of northwestern Connecticut, burrows were not used in summer, but comprised 19% of winter resting sites [68]. In south-central Maine, burrows were used most often from December to February [10], and in Wisconsin 2 of 8 winter rest sites were underground [55].

Fishers rest in downed logs and other woody debris [40,42,95]. Four of 14 resting and denning sites in upland mixed hardwoods and upland conifer habitats of Wisconsin were in downed woody debris [55]. In a coniferous forest of south-central British Columbia, 4 of 32 resting sites were in individual pieces of coarse woody debris. The pieces of coarse woody debris fishers used averaged 31.6 inches (80.3 cm) in diameter, which was significantly (P=0.001) larger than the average size (9.2 inches (23.4 cm)) of coarse woody debris available in the patch [129]. In predominantly grand fir and subalpine fir cover types of north-central Idaho, median diameter of the small end of logs used by fishers for denning was 21 inches (53.3 cm), and the median length of these logs was 47 feet (14.3 m). Logs were used as denning sites significantly (P=0.0005) more often in winter (27%) than in summer (8%) [65]. In coniferous forests of central British Columbia, the average temperature when fishers used coarse woody debris for resting was significantly (P<0.05) colder ( x= -10.7 °C) than when they used branches (x=2.4 °C) or cavities (x=1.3 °C) [127].

Snags are used as fisher resting sites. In predominantly grand fir and subalpine fir cover types of north-central Idaho, 8% of summer and 6.7% of winter resting sites were in snags. Snags used had a median DBH of 34 inches (86.4 cm) and a median height of 39 feet (11.9 m). Of the 13 snags used, 12 were grand fir and 1 was Douglas-fir. Three of the snags were young, 9 were soft and had sloughing bark, and 1 had no branches or bark [65]. In 2 study areas in California, female fishers used snags (31.7%) significantly (P<0.001) more than males (18.0%). The conifer snags used as resting sites had an average DBH of 47.2 inches (119.8 cm) [137].

Fishers rest on tree branches, in bird (Aves) and squirrel (Sciuridae) nests, on witches' brooms (Arceuthobium spp.), and in tree cavities. Fifty-seven percent of fishers' resting locations in coniferous forest of British Columbia were on branches [127]. In south-central Maine, open nests and tree branches were used in 70% of spring (March-May) and 94% of summer (June-August) resting sites [10]. In predominantly hardwood forests of northwestern Connecticut, fishers selected (P<0.05) nests as rest sites in summer (82%) and used them in accordance with availability in winter (30%). Twenty-one percent was crow (Corvus spp.) or raptor (Falconiformes or Strigiformes) nests, and the remainder was squirrel leaf-nests. Nests used for resting occurred at an average height of 35.4 feet (10.8 m) in trees with a mean DBH of 15.2 inches (38.7 cm) [68]. In coniferous forest of north-central Idaho, fishers rested on witches' brooms in 67.9% of live-tree resting sites. In addition, 91% of Engelmann spruce (Picea engelmannii,) and 56% of grand fir used for resting contained witches' brooms [65]. In coniferous forest of south-central British Columbia, hybrid white spruce used by fishers had an average of 3.2 witches' brooms, while hybrid spruce not used for resting had an average of 0.2 witches' brooms (P<0.001) [129]. In hardwood, mixed-woods, and coniferous forests of northwestern Connecticut, 18% of summer and 51% of winter rest sites were in tree cavities. The average height of cavities used by fishers was 17.4 feet (5.3 m) and the mean DBH of cavity trees was 23 inches (58.4 cm). Most (95%) of the cavity trees were hardwoods [68]. In south-central Maine, 34% of fall (September-November), 19% of winter (December-February), 19% of spring (March-May), and 6% of summer (June-August) resting sites were in cavities [10]. In coniferous forest of central British Columbia, 21% of resting sites were in cavities [127].

Fishers use relatively large individuals of several tree species as resting sites. In predominantly grand fir and subalpine fir cover types of north-central Idaho, 83.9% of temporary summer dens and 66.7% of temporary winter dens were in live trees, typically Engelmann spruce (63.4%) or grand fir (32.1%). Dens occurred at an average height of 54 feet (16.4 m) in trees with an average DBH of 22 inches (56.1 cm) [65]. California black oak (Quercus kelloggii) comprised 37.5% of rest sites in a southern Sierra Nevada study site, and Douglas-fir was used in 65.6% of resting locations in a northwestern California study area. The average maximum DBH of trees used by 21 resting fishers was 51.7 inches (131.2 cm), which was significantly (P<0.05) larger than the maximum DBH (43.7 inches (111.0 cm)) for random trees [137]. In south-central British Columbia the hybrid white spruce (x DBH=18.2 inches (46.3 cm)), black cottonwood (Populus balsamifera subsp. trichocarpa, x DBH=40.6 inches (103.2 cm)), and Douglas-fir (x DBH=43.7 inches (111.0 cm)) used by fishers for resting were significantly (P≤0.05) larger than the average size of these trees (x DBH=12.6-24.4 inches (32.1-62.1 cm)) in the vicinity of fisher locations [129]. In Maine, 2 fisher dens were in yellow birch (Betula alleghaniensis), and 1 was in a sugar maple [40].

Reuse of resting sites by fishers is uncommon. Percentages of reused resting sites were 13.8% in the southern Sierra Nevada and 3.5% in northwestern California [137]. In predominantly hardwood forests of northwestern Connecticut, 10% of summer sites and 24% of winter sites were reused [68]. Resting sites were rarely reused in south-central Maine [10].

Cavities are generally used for whelping litters and rearing young kits. These maternal dens occur in large live trees and snags of various species. Maternal dens in north-central Massachusetts and southwestern New Hampshire (n=56) [99], Maine (n=33) [88], and south-central British Columbia (n=5) [129] were all in cavities. However, a natal den in a hollow log was observed in northwestern Montana [108]. In Massachusetts and New Hampshire, 60% of maternal dens occurred in eastern white pine or eastern hemlock. Several hardwood species were used including northern red oak, red maple, sugar maple, and American beech (Fagus grandifolia). Species were used in accordance with availability, while snags were used (19%) significantly (P<0.01) more than would be expected based on availability (2%). The average DBH of maternal den trees (x=26 inches (66 cm)) was significantly (P<0.01) larger than the average DBH available (>90% were 13.4-23.2 inches (34-59 cm)) [99]. In south-central Maine, 95% of maternal dens were in hardwoods, primarily balsam poplar (P. balsamifera) and bigtooth aspen (P. grandidentata). Half of dens were in snags, 30% were in partially dead trees, and 20% were in living trees. The DBH of maternal den trees ranged from 9.8 to 36.2 inches (25-92 cm) [88]. In south-central British Columbia, the average DBH (40.6 inches (103.1 cm)) of the declining black cottonwood trees used as natal dens was significantly (P=0.025) larger than the average DBH (x=20.7 inches (52.5 cm)) of these trees in the vicinity of fisher locations [129]. Average height of cavities used for maternal dens was 20.6 feet (6.28 m) in north-central Massachusetts and southwestern New Hampshire [99] and ranged from 3 to 39 feet (0.9-12 m) in south-central Maine. In south-central Maine, cavities faced south (x=171° southeast) significantly (P=0.048) more than would be expected at random [88], while in north-central Massachusetts and southwestern New Hampshire fishers did not appear to select (P>0.05) maternal dens with openings of a particular aspect [99].

  • 10. Arthur, Stephen M.; Krohn, William B.; Gilbert, James R. 1989. Habitat use and diet of fishers. Journal of Wildlife Management. 53(3): 680-688. [8671]
  • 17. Badry, Micheal J.; Proulx, Gilbert; Woodard, Paul M. 1997. Home-range and habitat use by fishers translocated to the aspen parkland of Alberta. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. New York: Cornell University Press: 233-251. [65897]
  • 30. Buck, Slader G.; Mullis, Curt; Mossman, Archie S.; Show, Ivan: Coolahan, Craig. 1994. Habitat use by fishers in adjoining heavily and lightly harvested forest. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 368-376. [65918]
  • 40. Coulter, Malcolm Wilford. 1966. Ecology and management of fishers in Maine. Syracuse, NY: Syracuse University. 183 p. Dissertation. [63950]
  • 55. Gilbert, Jonathan H.; Wright, John L.; Lauten, David J., Probst, John R. 1997. Den and rest-site characteristics of American marten and fisher in northern Wisconsin. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 135-145. [65890]
  • 65. Jones, Jeffrey L. 1991. Habitat use of fisher in northcentral Idaho. Moscow, ID: University of Idaho. 147 p. Thesis. [63964]
  • 68. Kilpatrick, Howard J.; Rego, Paul W. 1994. Influence of season, sex, and site availability on fisher (Martes pennanti) res-site selection in the central hardwood forest. Canadian Journal of Zoology. 72(8): 1416-1419. [63968]
  • 88. Paragi, Thomas F.; Arthur, Stephen M.; Krohn, William B. 1996. Importance of tree cavities as natal dens for fishers. Northern Journal of Applied Forestry. 13(2): 79-83. [27232]
  • 97. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]
  • 99. Powell, Shawn M.; York, Eric C.; Scanlon, John J.; Fuller, Todd K. 1997. Fisher maternal den sites in central New England. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 265-278. [65900]
  • 103. Raphael, Martin G. 1988. Long-term trends in abundance of amphibians, reptiles, and mammals in Douglas-fir forests of northwestern California. In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America: Proceedings of the symposium; 1988 July 19-21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 23-31. [22597]
  • 108. Roy, Kevin D. 1991. Ecology of reintroduced fishers in the Cabinet Mountains of northwest Montana. Missoula, MT: University of Montana. 94 p. Thesis. [64013]
  • 117. Thomasma, Linda E.; Drummer, Thomas D., Peterson, Rolf O. 1994. Modeling habitat selection by fishers. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 316-325. [65917]
  • 127. Weir, Richard D.; Corbould, Fraser; Harestad, Alton. 2004. Effect of ambient temperature on the selection of rest structures by fishers. In: Harrison, Daniel J.; Fuller, Angela K.; Proulx, Gilbert., eds. Martens and fishers (Martes) in human-altered environments: an international perspective. New York: Springer Science and Business Media, Inc: 187-197. [65882]
  • 128. Weir, Richard D.; Harestad, Alton S. 1997. Landscape-level selectivity by fishers in south-central British Columbia. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 252-264. [65896]
  • 129. Weir, Richard D.; Harestad, Alton S. 2003. Scale-dependent habitat selectivity by fishers in south-central British Columbia. Journal of Wildlife Management. 67(1): 73-82. [64024]
  • 137. Zielinski, William J.; Truex, Richard L.; Schmidt, Gregory A.; Schlexer, Fredrick V.; Schmidt, Kristin N.; Barrett, Reginald H. 2004. Resting habitat selection by fishers in California. Journal of Wildlife Management. 68(3): 475-492. [64029]
  • 138. Zielinski, William J.; Truex, Richard L.; Schmidt, Gregory A.; Schlexer, Fredrick V.; Schmidt, Kristin N.; Barrett, Reginald H.; O'Shea, Thomas J. 2004. Home range characteristics of fishers in California. Journal of Mammalogy. 85(4): 649-657. [64030]
  • 95. Powell, Roger A. 1994. Effects of scale on habitat selection and Foraging behavior of fishers in winter. Journal of Mammalogy. 75(2): 349-356. [64036]
  • 42. de Vos, Anton. 1952. The ecology and management of fisher and marten in Ontario. [Publication location unknown]: Ontario Department of Lands and Forests:. 90 p. [66784]
  • 66. Kelly, George M. 1977. Fisher (Martes pennanti) biology in the White Mountain National Forest and adjacent areas. [Amherst, MA]: University of Massachusetts. 178 p. Dissertation. [63967]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, density, hardwood, presence, selection, shrubs, succession

Fishers are associated with areas of high cover and structural complexity (see Cover Requirements) in large tracts (see Landscape/scale effects) of mature and old-growth forests. Other site characteristics that can be important include presence of nearby water, slope, elevation, and snow characteristics.

Much of the information regarding fisher habitat is based on occurrence of fishers compared to availability. It is important to note that preference does not necessarily equate to superior habitat [30]. As a measure of preference, time spent in available habitat assumes that individuals have equal access to available habitats, which is unlikely (review by [35]). In addition, Powell [95] describes the case where foraging techniques for various prey have different efficiencies, resulting in relatively less time spent in the habitat of the prey associated with the more efficient foraging technique.

Fishers generally avoid early and/or prefer late successional stages, but in some cases they use fairly young forests extensively. For example, in predominantly grand fir (Abies grandis) and subalpine fir (Abies lasiocarpa) forests of north-central Idaho, stands subjectively categorized as pole-sapling age or younger were rarely used in summer or winter. In summer, mature forest and old-growth were preferred, but in winter young grand fir forests were preferred [65]. In Douglas-fir, lodgepole pine, and hybrid white spruce forests of south-central British Columbia, early seral stands (<10 years) were used by transient fishers significantly (P<0.05) less than expected, and young (41-80 years) forests were used more than expected based on availability in the landscape [128]. In northwestern California, fishers were associated with old-growth Douglas-fir forest [106]. However, use of varying succession classes by fishers in conifer stands of northwestern Montana was in accordance with availability [108].

In some locations, fishers prefer areas near water. In a relatively hot and dry California study area comprised primarily of Sierra mixed conifer, ponderosa pine (Pinus ponderosa), red fir (Abies magnifica), and montane hardwood habitats, there were significantly (P<0.05) more resting sites (51.9%) than random sites (27.8%) within 330 feet (100 m) of water [137]. In coniferous forests of north-central Idaho, several factors demonstrated the fisher's preference for riparian areas. Summer fisher locations were significantly (P<0.0001) closer (223 feet (68.0 m)) to water than random sites (400 feet (121.9 m)). In addition, fishers preferred grand fir/arrowleaf ragwort (Abies grandis/Senecio triangularis) riparian habitat in both summer and winter [65]. Similarly, fisher rest sites in northwestern Connecticut occurred in forest wetland habitat significantly (P<0.05) more often than expected (17%) in both winter (39%) and summer (29%) [68].

In some areas, fishers prefer comparatively steep slopes. In a mixed-wood forest of central Alberta, the average slope of fisher locations (5.8°) was significantly (P=0.002) greater than the average slope of random locations (1.9°) [17]. The average slope at resting sites (49.8%) in 2 California study areas, one predominantly comprised of Douglas-fir, white fir (Abies concolor), Oregon white oak (Quercus garryana), and tanoak (Lithocarpus densiflorus) stands and the other primarily Sierran mixed conifer, ponderosa pine, red fir, and montane hardwoods habitats, was significantly (P<0.05) steeper than random sites (42.6%) [137]. In coniferous forests of north-central Idaho, level slopes and benches were used (38%) much less than expected based on availability (71%) [65].

Fishers occur in a wide range of elevations, but generally prefer relatively low-elevation sites. In Maine, fishers were studied in an area that ranged from 0 to 1,210 feet (0-370 m) in elevation [10]. In the southern Sierra Nevada, fishers have been reported as high as 8,000 feet (2,438 m) [26]. In 75-year-old, even-age hardwood, mixed, and coniferous forests of White Mountain National Forest and surrounding areas of New Hampshire, use of varying elevations differed significantly (P<0.01) from expected. Based on availability fishers were expected to occur on sites from 1,100 to 2,000 feet (329-607 m) in elevation 264.7 times, and were expected on sites above 2,000 feet (≥608 m) 197.3 times. However, they preferred the low sites, occurring 363 and 99 times on low and high sites, respectively [66]. West of the Cascade Range crest in Washington, 87% of sighting and trapping records from 1894 to 1991 were from <3,300 feet (1,000 m), and none were from elevations >5,900 feet (1,800 m). However, east of the crest 70% of records were from sites >3,300 feet (1,000 m) and 18% were from sites 5,900 to 7,200 feet (1,800-2,200 m) in elevation. [13].

Fishers are likely affected by snow characteristics such as depth and consistency. Ninety-nine percent of the area in California where fishers were detected but American martens (Martes americana) were not was in the <5-inch (<13 cm) average snowfall zone; 1% was in the 5- to 9-inch (13-23 cm) average snowfall zone; and none was in the >9-inch (>23 cm) average snowfall zone [71]. In the low boreal region of southeastern Manitoba, significantly (P<0.005) fewer fisher tracks were observed during midwinter, when deep, soft snow conditions prevailed. Method of travel was also affected by snow conditions, with fishers walking in midwinter instead of bounding or galloping, and traveling on snowshoe hare (Lepus americanus) and their own trails more than they did during the thin snow cover of early winter and the crust conditions of late winter [102]. In addition, the stronger selection for low elevations west of the Cascade crest compared to the east (see previous paragraph) could have been due to the rain shadow, resulting in less snow on the east side compared to similar elevations on the west side [13]. However, in predominantly grand fir and subalpine fir cover types of north-central Idaho, fishers did not appear influenced by snow characteristics. Use of various elevations did not change over the seasons, and fishers preferred young forests in winter: a rather open habitat with large amounts of deciduous shrubs [65]. In addition, in an area of northwestern Connecticut with maximum snow depths less than 10 inches (<25 cm), there was no evidence that snow affected the fisher's habitat preferences [68].

Home range/density: Fisher home range size and density exhibit substantial variation, although male home ranges are larger than those of females. Small average female home range sizes (1,300 acres (527.5 ha), n=8) occurred in the southern Sierra Nevada [138]. Home ranges in the hardwoods and mixed-woods of southern Quebec were also comparatively small, with female (n=7) home ranges averaging 5.4 km² and male (n=3) home ranges averaging 9.2 km². Based on these estimates fishers occurred at a density of 2.7 fishers/10 km², while estimates from tracking and radio-collaring resulted in density estimates of 3.0 fishers/10 km² [53]. In conifer and mixed forests of south-central Maine, the median home range was 12.2 km² for females (n=5) and 25.5 km² for males (n=6). Density estimates in this area were 1 fisher/2.8-10.5 km² in the summer and 1 fisher/8.3-20.0 km² in winter [11]. Male home ranges in 2 California study areas, one predominantly comprised of Douglas-fir, white fir, Oregon white oak, and tanoak stands and the other primarily Sierran mixed conifer, ponderosa pine, red fir, and montane hardwoods habitats, were significantly (P<0.0001) larger (9,700 acres (3,934.5 ha), n=6) than female home ranges (2,400 acres (980.5 ha), n=15) [138]. In conifer forests of Idaho, fishers had very large home ranges. Average "year-long" estimates of home range size were 40.8 km² and 82.6 km² for females and males, respectively [65]. Powell and Zielinski [97] provide a thorough review of home ranges throughout the fisher's distribution, including notes on the methods used for calculation.

Landscape/scale effects: Fishers require large, well-connected habitat patches. In addition to their large home ranges, fishers can apparently be excluded from nearby habitat by relatively small expanses, possibly as short as 6 to 12 miles (10-20 km), of unsuitable environment [12,16]. In Douglas-fir forests of northwestern California, fishers were sensitive to habitat fragmentation. Fishers were detected in 70% of stands where <10% of the perimeter was clearcut edge and in less than 20% of stands where >75% of the stand's perimeter was clearcut edge. Fisher detections decreased markedly in stands <250 acres (100 ha) in area [106]. In mixed-wood forest of central Alberta, fishers used continuous (> 2 km²) forest blocks significantly (P<0.01) more than expected based on availability, and the woodlots (independent forested blocks ≤2 km²) used were significantly (P<0.01) larger (x=0.4 km²) than random woodlots (x=0.18 km²) [17].

Although edges between fisher habitats and open areas are apparently avoided [106], edges between various types of fisher habitat are often used. In 75-year-old, even-aged hardwood, mixed, and coniferous forests of the White Mountain National Forest, fishers occurred within 98 feet (30 m) of an edge (change in species composition, height or density class) significantly (P<0.01) more often than expected (observed=60, expected=42.5) in winter. The trend was the same in summer (observed=130, expected=114.6), but was not significant (P≥0.05) [66]. In a study in Douglas-fir, lodgepole pine, and hybrid white spruce forests of south-central British Columbia, Weir and Harestad [128] concluded that the fine-grained nature of the early and later seral stages provided sustainable fisher habitat. Likewise, fisher habitat use in central Maine suggested that areas with high interspersion of many forest types provided optimal habitat [10]. In addition, a review states that diverse forest communities would better conserve mustelids than a homogenous mature forest due to the variability of mustelid responses to conditions such as snow accumulations, microclimate conditions, prey availability, and predator densities [100].

Fishers select habitat on several scales. In predominantly upland hardwood habitat of upper peninsular Michigan, fishers used mixed pine (P. banksiana, P. resinosa, and P. strobus) habitat in accordance with availability at a fine scale (the area around fisher tracks), but used it more than expected based on its availability at a coarser scale (the general study area). Fishers selected (P<0.001) dense, lowland forests as rest sites at both these scales [95]. In forests dominated by Douglas-fir, lodgepole pine, and hybrid white spruce in south-central British Columbia, fishers displayed selectivity at the stand, patch, and element (resting, maternal den, and natal den habitat) scales [129]. In Douglas-fir forests of northwestern California, fishers were sensitive to fragmentation at the plot, stand, and 2,500-acre (1,000-ha) block scales [106].

  • 10. Arthur, Stephen M.; Krohn, William B.; Gilbert, James R. 1989. Habitat use and diet of fishers. Journal of Wildlife Management. 53(3): 680-688. [8671]
  • 11. Arthur, Stephen M.; Krohn, William B.; Gilbert, James R. 1989. Home range characteristics of adult fishers. Journal of Wildlife Management. 53(3): 674-679. [63933]
  • 12. Arthur, Stephen M.; Paragi, Thomas F.; Krohn, William B. 1993. Dispersal of juvenile fishers in Maine. Journal of Wildlife Management. 57(4): 868-874. [63934]
  • 13. Aubry, Keith B.; Houston, Douglas B. 1992. Distribution and status of the fisher (Martes pennanti) in Washington. Northwestern Naturalist. 73(3): 69-79. [63936]
  • 16. Aubry, Keith; Wisely, Samantha; Raley, Catherine; Buskirk, Steven. 2004. Zoogeography, spacing patterns, and dispersal in fishers: insights gained from combining field and genetic data. In: Harrison, Daniel J.; Fuller, Angela K.; Proulx, Gilbert., eds. Martens and fishers (Martes) in human-altered environments: an international perspective. New York: Springer Science and Business Media, Inc: 201-220. [66324]
  • 17. Badry, Micheal J.; Proulx, Gilbert; Woodard, Paul M. 1997. Home-range and habitat use by fishers translocated to the aspen parkland of Alberta. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. New York: Cornell University Press: 233-251. [65897]
  • 26. Boroski, Brian B.; Golightly, Richard T.; Mazzoni, Amie K.; Sager, Kimberly A. 2002. Fisher research and the Kings River Sustainable Forest Ecosystems Project: current results and future efforts. In: Verner, Jared, tech. ed. Proceedings of a symposium on the Kings River Sustainable Forest Ecosystems Project: progress and current status; 1998 January 26; Clovis, CA. Gen. Tech. Rep. PSW-GTR-183. Albany, C: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 143-154. [44211]
  • 30. Buck, Slader G.; Mullis, Curt; Mossman, Archie S.; Show, Ivan: Coolahan, Craig. 1994. Habitat use by fishers in adjoining heavily and lightly harvested forest. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 368-376. [65918]
  • 35. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 53. Garant, Yves; Crete, Michel. 1997. Fisher, Martes pennanti, home range characteristics in a high density untrapped population in southern Quebec. The Canadian Field-Naturalist. 111(3): 359-364. [63958]
  • 65. Jones, Jeffrey L. 1991. Habitat use of fisher in northcentral Idaho. Moscow, ID: University of Idaho. 147 p. Thesis. [63964]
  • 68. Kilpatrick, Howard J.; Rego, Paul W. 1994. Influence of season, sex, and site availability on fisher (Martes pennanti) res-site selection in the central hardwood forest. Canadian Journal of Zoology. 72(8): 1416-1419. [63968]
  • 71. Krohn, William B.; Zielinski, William J., Boone, Randall B. 1997. Relations among fishers, snow, and martens in California: results from small-scale spatial comparisons. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 211-232. [65898]
  • 97. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]
  • 100. Proulx, Gilbert. 2000. The impact of human activities on North American mustelids. In: Griffiths, Huw I., ed. Mustelids in a modern world: Management and conservation aspects of small carnivore: human interactions. Leiden, The Netherlands: Backhuys Publishers: 53-75. [64006]
  • 102. Raine, R. Michael. 1983. Winter habitat use and responses to snow cover of fisher (Martes pennanti) and marten (Martes americana) in southeastern Manitoba. Canadian Journal of Zoology. 61(1): 25-34. [64009]
  • 106. Rosenberg, Kenneth V.; Raphael, Martin G. 1986. Effects of forest fragmentation on vertebrates in Douglas-fir forests. In: Verner, Jared; Morrison, Michael L.; Ralph, C. John, eds. Wildlife 2000: modeling habitat relationships of terrestrial vertebrates: Proceedings of an international symposium; 1984 October 7-11; Fallen Leaf Lake, CA. Madison, WI: The University of Wisconsin Press: 263-272. [61627]
  • 108. Roy, Kevin D. 1991. Ecology of reintroduced fishers in the Cabinet Mountains of northwest Montana. Missoula, MT: University of Montana. 94 p. Thesis. [64013]
  • 128. Weir, Richard D.; Harestad, Alton S. 1997. Landscape-level selectivity by fishers in south-central British Columbia. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 252-264. [65896]
  • 129. Weir, Richard D.; Harestad, Alton S. 2003. Scale-dependent habitat selectivity by fishers in south-central British Columbia. Journal of Wildlife Management. 67(1): 73-82. [64024]
  • 137. Zielinski, William J.; Truex, Richard L.; Schmidt, Gregory A.; Schlexer, Fredrick V.; Schmidt, Kristin N.; Barrett, Reginald H. 2004. Resting habitat selection by fishers in California. Journal of Wildlife Management. 68(3): 475-492. [64029]
  • 138. Zielinski, William J.; Truex, Richard L.; Schmidt, Gregory A.; Schlexer, Fredrick V.; Schmidt, Kristin N.; Barrett, Reginald H.; O'Shea, Thomas J. 2004. Home range characteristics of fishers in California. Journal of Mammalogy. 85(4): 649-657. [64030]
  • 95. Powell, Roger A. 1994. Effects of scale on habitat selection and Foraging behavior of fishers in winter. Journal of Mammalogy. 75(2): 349-356. [64036]
  • 66. Kelly, George M. 1977. Fisher (Martes pennanti) biology in the White Mountain National Forest and adjacent areas. [Amherst, MA]: University of Massachusetts. 178 p. Dissertation. [63967]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the term: cover

SRM (RANGELAND) COVER TYPES [111]:

203 Riparian woodland

216 Montane meadows
  • 111. Shiflet, Thomas N., ed. 1994. Rangeland cover types of the United States. Denver, CO: Society for Range Management. 152 p. [23362]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

SAF COVER TYPES [46]:

1 Jack pine

5 Balsam fir

12 Black spruce

13 Black spruce-tamarack

15 Red pine

16 Aspen

18 Paper birch

20 White pine-northern red oak-red maple

21 Eastern white pine

22 White pine-hemlock

23 Eastern hemlock

24 Hemlock-yellow birch

25 Sugar maple-beech-yellow birch

26 Sugar maple-basswood

27 Sugar maple

28 Black cherry-maple

30 Red spruce-yellow birch

31 Red spruce-sugar maple-beech

32 Red spruce

33 Red spruce-balsam fir

34 Red spruce-Fraser fir

35 Paper birch-red spruce-balsam fir

37 Northern white-cedar

38 Tamarack

39 Black ash-American elm-red maple

45 Pitch pine

52 White oak-black oak-northern red oak

53 White oak

55 Northern red oak

57 Yellow-poplar

58 Yellow-poplar-eastern hemlock

59 Yellow-poplar-white oak-northern red oak

60 Beech-sugar maple

61 River birch-sycamore

62 Silver maple-American elm

97 Atlantic white-cedar

107 White spruce

108 Red maple

201 White spruce

202 White spruce-paper birch

203 Balsam poplar

204 Black spruce

205 Mountain hemlock

206 Engelmann spruce-subalpine fir

207 Red fir

208 Whitebark pine

210 Interior Douglas-fir

211 White fir

212 Western larch

213 Grand fir

215 Western white pine

217 Aspen

218 Lodgepole pine

219 Limber pine

221 Red alder

222 Black cottonwood-willow

223 Sitka spruce

224 Western hemlock

225 Western hemlock-Sitka spruce

226 Coastal true fir-hemlock

227 Western redcedar-western hemlock

228 Western redcedar

229 Pacific Douglas-fir

230 Douglas-fir-western hemlock

231 Port-Orford-cedar

232 Redwood

233 Oregon white oak

234 Douglas-fir-tanoak-Pacific madrone

237 Interior ponderosa pine

243 Sierra Nevada mixed conifer

244 Pacific ponderosa pine-Douglas-fir

245 Pacific ponderosa pine

246 California black oak

247 Jeffrey pine

248 Knobcone pine

249 Canyon live oak

250 Blue oak-foothills pine

251 White spruce-aspen

252 Paper birch

253 Black spruce-white spruce

254 Black spruce-paper birch

255 California coast live oak

256 California mixed subalpine
  • 46. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: bog, shrub

KUCHLER [72] PLANT ASSOCIATIONS:

K001 Spruce-cedar-hemlock forest

K002 Cedar-hemlock-Douglas-fir forest

K003 Silver fir-Douglas-fir forest

K004 Fir-hemlock forest

K005 Mixed conifer forest

K006 Redwood forest

K007 Red fir forest

K008 Lodgepole pine-subalpine forest

K010 Ponderosa shrub forest

K011 Western ponderosa forest

K012 Douglas-fir forest

K013 Cedar-hemlock-pine forest

K014 Grand fir-Douglas-fir forest

K015 Western spruce-fir forest

K025 Alder-ash forest

K026 Oregon oakwoods

K029 California mixed evergreen forest

K030 California oakwoods

K093 Great Lakes spruce-fir forest

K094 Conifer bog

K095 Great Lakes pine forest

K096 Northeastern spruce-fir forest

K099 Maple-basswood forest

K102 Beech-maple forest

K103 Mixed mesophytic forest

K106 Northern hardwoods

K107 Northern hardwoods-fir forest

K108 Northern hardwoods-spruce forest

K109 Transition between K104 and K106
  • 72. Kuchler, A. W. 1964. United States [Potential natural vegetation of the conterminous United States]. Special Publication No. 36. New York: American Geographical Society. 1:3,168,000; colored. [3455]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

ECOSYSTEMS [54]:

FRES10 White-red-jack pine

FRES11 Spruce-fir

FRES15 Oak-hickory

FRES18 Maple-beech-birch

FRES19 Aspen-birch

FRES20 Douglas-fir

FRES21 Ponderosa pine

FRES22 Western white pine

FRES23 Fir-spruce

FRES24 Hemlock-Sitka spruce

FRES25 Larch

FRES26 Lodgepole pine

FRES27 Redwood

FRES28 Western hardwoods

FRES44 Alpine
  • 54. Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; Lewis, Mont E.; Smith, Dixie R. 1977. Vegetation and environmental features of forest and range ecosystems. Agric. Handb. 475. Washington, DC: U.S. Department of Agriculture, Forest Service. 68 p. [998]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fishers prefer coniferous forests, but they are also found in mixed and deciduous forests. They prefer habitats with high canopy closure. They also prefer habitats with many hollow trees for dens. Trees typically found in fisher habitats include spruce, fir, white cedar and some hardwoods. Also, as would be expected, their habitat preference reflects that of their favored prey species.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Fishers are predators, and most of their prey are plant-eating mammalia. Fishers eat muridae, erithizon dorsatum, sciuridae, lepus americanus, aves, and soricidae, and sometimes, other carnivora. They may also feed on fruits and berries, such as beechnuts and apples.

They have also been seen to eat odocoileus virginianus, though they are most likely scavenging a deer carcass.

Fishers and martes americana are the only medium-sized predators agile in trees that also have the ability to stretch themselves to look for prey in holes in the ground, hollow trees and other small areas. Fishers are hunt alone, and look for prey that is their own size or smaller, although they are capable of taking on prey larger than themselves.

Animal Foods: birds; mammals

Plant Foods: fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: frequency

Fishers are generalist predators. Their diets are comprised predominantly of snowshoe hares, North American porcupines (Erethizon dorsatum), small mammals, birds, carrion, and/or plants. Snowshoe hares are important prey throughout much of the fisher's range [40,108,130]. Snowshoe hares occurred in 39% of 215 fisher stomachs collected in British Columbia in winter [130] and 28% of 242 fisher digestive tracts collected in Maine from September to April [40]. North American porcupines are another often preyed-upon species [10,98,130]. North American porcupines occurred in 21% of 69 fisher scats collected Maine in winter [10] and 19.5% of 215 stomachs collected in British Columbia in winter [130]. Fishers prey on several small mammals including squirrels, shrews (Soricidae), voles, and mice (Muridae) [66,98,108,124,134]. Of 215 stomachs collected in British Columbia from November to February, 33.5% contained red squirrels (Tamiasciurus hudsonicus), 14.9% contained shrews, 23.3% contained southern red-backed voles (Clethrionomys gapperi), and 15.8% contained deer mice (Peromyscus maniculatus) [130]. Squirrel remains were found in 20.4% of 201 scats collected year-round in the southern Sierra Nevada and included western gray squirrels (Sciurus griseus), Douglas's squirrels (Tamiasciurus douglasii), and northern flying squirrels (Glaucomys sabrinus) [134]. Birds found in stomach contents or scats include Passeriformes [124], Galliformes [10,124,130], and Falconiformes [98]. Fishers also eat carrion, typically from ungulates such as deer (Odocoileus spp.) [10,98,124,130,134] and moose (Alces alces) [130]. American martens and fishers occur in fisher diets [65,130]. It not certain whether the fishers were preyed on or scavenged [130]. Common muskrats (Ondatra zibethicus) [10,124,130], northern raccoons (Procyon lotor) [10,98,124], reptiles (Reptilia), insects (Insecta), [124,134], and several genera of fungi [134] have been found in fisher scats or stomach contents. Fishers also eat plant material, including apples (Malus spp.) [10,124], common winterberries (Ilex verticillata) [10,98], manzanitas (Arctostaphylos spp.), currents (Ribes spp.) [134], black cherries (Prunus serotina), serviceberries (Amelanchier spp.), and blueberries (Vaccinium spp.) [98]. Willson [131] reviews fruits eaten by mammals including the fisher.

In some areas there are differences in diet between age classes and gender. For instance, in Massachusetts and New Hampshire juvenile fishers ate significantly more northern raccoons (P=0.002) than adult fishers, and females ate significantly (P=0.006) more eastern gray squirrels (Sciurus carolinensis) than males [98]. The stomachs of female fishers collected in British Columbia had significantly (P≤0.04) higher occurrence of small mammal remains than males [130], and in New Hampshire significantly (P<0.01) more males contained North American porcupine quills [66]. However, no significant differences in diet were observed between the sexes in Maine (P>0.1) [40] or Vermont (P=0.883). Adults and juveniles also had similar diets in Vermont (P=0.836) [124].

Fishers are likely capable of changing diets with changing availably of prey. For instance, in Massachusetts and New Hampshire fisher diets changed with the seasons. Fruits were common in summer and early autumn, while northern raccoons and eastern gray squirrels were common prey in winter. In addition, birds were not detected in the diets of fishers in the early autumn or winter [98]. There was a significant (P<0.1) shift in diet composition from autumn to spring in Maine, with snowshoe hare and white-tailed deer (Odocoileus virginianus) increasing and shrews decreasing in frequency as the winter progressed [40]. In Ontario, fishers displayed a delayed positive response to lagomorph (Lepus americanus and Sylvilagus floridanus) abundance, but appeared to use alternate prey during a period of low lagomorph abundance [27]. In northern Minnesota, predation of small mammals was negatively associated with predation of snowshoe hares for male and female fishers (P<0.02), suggesting the importance of small mammals during snowshoe hare population declines [73].

Reviews of fisher diet [82,97], hunting behavior [94,97], and ecological energetics [94] are available.

  • 10. Arthur, Stephen M.; Krohn, William B.; Gilbert, James R. 1989. Habitat use and diet of fishers. Journal of Wildlife Management. 53(3): 680-688. [8671]
  • 27. Bowman, Jeff; Donovan, Dennis; Rosatte, Richard C. 2006. Numerical response of fishers to synchronous prey dynamics. Journal of Mammalogy. 87(3): 480-484. [63939]
  • 40. Coulter, Malcolm Wilford. 1966. Ecology and management of fishers in Maine. Syracuse, NY: Syracuse University. 183 p. Dissertation. [63950]
  • 65. Jones, Jeffrey L. 1991. Habitat use of fisher in northcentral Idaho. Moscow, ID: University of Idaho. 147 p. Thesis. [63964]
  • 73. Kuehn, David W. 1989. Winter foods of fishers during a snowshoe hare decline. Journal of Wildlife Management. 53(3): 688-692. [63970]
  • 82. Martin, Sandra K. 1994. Feeding ecology of American martens and fishers. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 297-315. [65916]
  • 94. Powell, Roger A. 1993. The fisher: Life history, ecology, and behavior. 2nd ed. Minneapolis, MN: University of Minnesota Press. 237 p. [63997]
  • 97. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]
  • 98. Powell, Shawn M., York, Eric C., Fuller, Todd K. 1997. Seasonal food habits of fishers in central New England. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd International Martes Symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: Provincial Museum of Alberta: 279-305. [65895]
  • 108. Roy, Kevin D. 1991. Ecology of reintroduced fishers in the Cabinet Mountains of northwest Montana. Missoula, MT: University of Montana. 94 p. Thesis. [64013]
  • 124. Van Why, Kyle R.; Giuliano, William M. 2001. Fall food habits and reproductive condition of fishers, Martes pennanti, in Vermont. The Canadian Field-Naturalist. 115(1): 52-56. [64021]
  • 130. Weir, Richard D.; Harestad, Alton S.; Wright, Randy C. 2005. Winter diet of fishers in British Columbia. Northwestern Naturalist. 86(1): 12-19. [64023]
  • 131. Willson, Mary F. 1993. Mammals as seed-dispersal mutualists in North America. Oikos. 67: 159-176. [27081]
  • 134. Zielinski, William J.; Duncan, Neil P.; Farmer, Emma C.; Truex, Richard L.; Clevenger, Anthony P.; Barrett, Reginald H. 1999. Diet of fishers (Martes pennanti) at the southernmost extent of their range. Journal of Mammalogy. 80(3): 961-971. [55515]
  • 66. Kelly, George M. 1977. Fisher (Martes pennanti) biology in the White Mountain National Forest and adjacent areas. [Amherst, MA]: University of Massachusetts. 178 p. Dissertation. [63967]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Fishers are predators, and most of their prey are herbivores. Fishers eat mice, porcupines, squirrels, snowshoe hares, birds, and shrews, and sometimes, other carnivores. They may also feed on fruits and berries, such as beechnuts and apples.

They have also been seen to eat white-tailed deer, though they are most likely scavenging a deer carcass.

Fishers and American martens are the only medium-sized predators agile in trees that also possess the ability to elongate themselves to seek prey in holes in the ground, hollow trees and other small areas. Fishers are solitary hunters, and seek prey that is their own size or smaller, although they are capable of taking on prey larger than themselves.

Animal Foods: birds; mammals

Plant Foods: fruit

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Fishers are important predators in their ecosystems. They are often in competition for food with canidae, lynx rufus, lynx canadensis, canis latrans, gulo gulo, martes americana and mustela. Fishers rarely get diseases.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Young fishers fall prey to accipitridae, vulpes vulpes, lynx canadensis and lynx rufus. Adult fishers are generally safe from predation.

Known Predators:

  • accipitridae
  • vulpes vulpes
  • lynx canadensis
  • lynx rufus
  • hawks (Accipitridae)
  • red foxes (Vulpes_vulpes)
  • lynx (Lynx_canadensis)
  • bobcats (Lynx_rufus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

There are few documented cases of predation on fishers. However, in predominantly coniferous forest of northwestern Montana, reintroduced fishers were likely killed by mountain lions (Puma concolor, 3), coyotes (Canis latrans, 3), a wolverine (Gulo gulo, 1), a Canada lynx (Lynx canadensis, 1), and an eagle (probably Aquila chrysaetos, 1) [108]. In south-central Maine, coyotes were probably responsible for 1 fisher death out of 50 that were recorded [70]. In northwestern California, carnivores killed 4 fishers, and a juvenile was killed by another fisher [30]. No signs of predation of fishers were detected in Maine [40] or the upper peninsula of Michigan [22].
  • 22. Belant, Jerrold L. 2007. Human-caused mortality and population trends of American marten and fisher in a U.S. national park. Natural Areas Journal. 27(2): 155-160. [66787]
  • 30. Buck, Slader G.; Mullis, Curt; Mossman, Archie S.; Show, Ivan: Coolahan, Craig. 1994. Habitat use by fishers in adjoining heavily and lightly harvested forest. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 368-376. [65918]
  • 40. Coulter, Malcolm Wilford. 1966. Ecology and management of fishers in Maine. Syracuse, NY: Syracuse University. 183 p. Dissertation. [63950]
  • 70. Krohn, William B.; Arthur, Stephen M.; Paragi, Thomas F. 1994. Mortality and vulnerability of a heavily trapped fisher population. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: biology and conservation. Ithaca, NY: Cornell University Press: 137-145. [65906]
  • 108. Roy, Kevin D. 1991. Ecology of reintroduced fishers in the Cabinet Mountains of northwest Montana. Missoula, MT: University of Montana. 94 p. Thesis. [64013]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Fishers are important predators in their ecosystems. They are often in competition for food with foxes, bobcats, lynx, coyotes, wolverines, American martens and weasels. Fishers have a low incidence of diseases.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Young fishers fall prey to hawks, red foxes, lynx and bobcats. Adult fishers are generally safe from predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Martes pennanti preys on:
Arborimus longicaudus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, density, fire-return interval, frequency, mixed-severity fire, prescribed fire, severity, snag, stand-replacement fire, taiga, tree, wildfire

Little research is available on the effects of fire on fishers. The available information is mainly anecdotal and does not include varying temporal and spatial scales. Few data address the effects of various site and fire characteristics on fishers. As of 2007 few studies include estimates of fisher demographic parameters, and there are no comparisons between burned and unburned areas. Due to these limitations, the majority of the information that follows is speculation based on fishers' habitat and cover requirements.

Fishers are rarely observed in burned areas, and negative initial impacts of fire on fishers are widely reported. For instance, several reviews state that fishers are adversely affected by fire [63,74,107,110]. Other reviews note the lack of literature documenting fishers in recently (<25 years) burned areas [48] and the lack of habitat characteristics required by fishers in most early successional stands [67,80,107,126]. However, trappers occasionally observed fishers in burned areas of Ontario [42], and a review [97] states that "fisher populations should tolerate" severe disturbances such as stand-replacing fires as long as late-successional conifer habitat is nearby. Another review notes that American martens have been observed in high densities in postfire communities with complex structures, such as horizontal boles or dense herbaceous cover [100]. However, in a 21-year-old burn in the taiga of Mackenzie Valley, Northwest Territories, American martens had comparatively large home ranges, and occurred in unburned areas more and burned areas less than expected based on availability [75]. In addition, American marten demography in a burned stand of Alaskan taiga suggests the burn was a population sink [89].

Due to the relatively generalized nature of their foraging habitat (see Foraging habitat) and their varied diet (see Food Habits), fishers are likely more sensitive to effects of fire in resting habitat than in foraging areas. For instance, fire and/or mechanical harvesting at Blodgett Forest Research Station in the Sierra Nevada had significant impacts on the suitability of fisher resting habitat (P=0.024), but did not significantly (P=0.468) affect fisher foraging habitat suitability. However, early and late-season fires in Sequoia-Kings Canyon National Park, California, had marginally significant (0.06≤P>0.05) effects on both resting and foraging habitat [120]. Reviews and anecdotal reports suggest the open areas created by fire may provide improved fisher foraging habitat due to the increased vulnerability of fisher prey, as well as greater abundance of prey species and their forage in these areas [2,42,78,83,100,133]. The greater abundance of American marten in recent (<10 years old) burns compared to older stands of Alaskan taiga may have been due to the abundance and stability of small prey in the recently burned areas [89]. However, Pilliod and others [93] summarize cases where small mammal populations declined following thinning treatments, including prescribed fire. FEIS reviews of several fisher prey species, including snowshoe hare, red squirrel, northern raccoon, common muskrat, and deer mouse are available.

Fire consumes and alters snags and coarse woody debris used by fishers for denning and resting. In ponderosa pine forest of Arizona, volume of coarse woody debris was lower on recently (≤4 years) burned sites (2.99-4.85 Mg/ha) than on somewhat older (8-9 years) sites (5.85-10.03 Mg/ha) [90]. In a Sierran mixed-conifer forest, thin-and-burn and burn-only treatments resulted in a decline in the amount of fine and coarse debris, a reduction in the size of woody debris, and a shift to less decayed woody debris [64]. Almost half of ponderosa pine snags with DBH >6 inches (15 cm) were seriously damaged or destroyed after moderately severe surface fires in southeastern Arizona [62]. In an Illinois study where the majority of snags were oak (Quercus spp.) or elm (Ulmus spp.), burned areas had lower snag densities (P<0.2), and there was a negative relationship between density of snags and frequency and severity of prescribed fire. However, burned sites contained more snags rated as "excellent" (37%) than unburned sites (21%) [44]. Vulnerability of existing snags and coarse woody debris to fire depends on several factors including characteristics of the site, the fire, and of the snags and coarse woody debris. For instance, size and age/decay class can influence the vulnerability of a snag [44,62,76,109]. In addition, reviews note that charring of snags and coarse woody debris can alter their value to wildlife [28,93]. The suitability of burned snags and coarse woody debris as fisher resting and denning sites is not addressed in the literature.

Fire also creates new snags and coarse woody debris in the years following the fire. Amount of coarse woody debris was greatest in ponderosa pine forests of Arizona that burned by wildfire about 8 years previously [90], while studies of mostly pine (Pinus spp.) trees in the western United States found the majority of tree mortality occurred within 5 years of fire [62,76,115]. In at least some cases, snag recruitment can be low [109], and fire-created snags may be comparatively small [62,64] or short lived [76,90]. Longevity of snags created by fire is addressed in these sources: [32,90,109]. Recruitment of large snags is dependent on the retention of large trees [64] and, according to a review, "loss of larger snags could take decades to recover" [93].

Fisher may also be affected, at least in the short term, by the reduction in canopy cover due to fire. In the Sierra Nevada, fire-treated areas had significantly lower canopy cover in Sequoia-Kings Canyon National Park (P<0.0001) than unburned sites, and fire and/or mechanical harvest treatments had significantly (P=0.0086) decreased canopy cover at Blodgett Forest Research Station compared to unburned sites. Despite the significant effects of fire on canopy cover, of the 3 fire-only treatments, only the late-season burn resulted in significant (P≤0.05) impacts on fisher habitat suitability [120]. In addition, the effect of fire on canopy cover is likely short lived [120,137]. A review suggests that even in the absence of canopy and understory cover, the large amounts of coarse woody debris present in some recently burned areas may provide the cover necessary for fishers [35]. However, Native Americans of northern Alberta did not burn mature forests due to the absence of fisher and other fur-bearers in sites with no canopy [78]. According to a review, differences between unburned and burned sites such as decreased canopy cover can result in altered snow characteristics [80].

The extent to which a fire would affect fishers would likely depend on several factors including fire size, frequency, timing, uniformity, and severity. Substantial impacts of fire on fishers are not likely unless prescribed burns are implemented on a large scale or wildfires cover fairly large areas. Most prescribed burns, and even small wildfires, only affect a fraction of a fisher's home range [83,93]. In a study of the effect of fire on fisher habitat suitability in the central Sierra Nevada , the largest treatment units were 74 acres (30 ha) [120]. This is <6% of the average female fisher home range size in the southern Sierra Nevada [138], where some of the smallest home ranges are reported (see Home range/density). Conversely large wildfires could have substantial impacts on fishers within a burned area due to loss of resting structures, decreases in cover, and reduced habitat connectivity (see Landscape/scale effects).

Frequent fires are likely to have negative impacts on fisher habitats. Changes to habitat structure and stand composition due to relatively short fire intervals are likely detrimental (see Preferred Habitat and Cover Requirements). For instance, in Washington and Oregon conversion from grand fir forests to drier, more open ponderosa pine stands would probably decrease habitat suitability [119]. Decreasing the frequency of prescribed burns could reduce impacts on individual fishers [120] and may provide temporally continuous foraging habitats [83].

Timing of the fire will probably influence the degree to which fishers are affected. Although early season fires may have greater detrimental direct impacts on fishers (see DIRECT FIRE EFFECTS ON ANIMAL) than fires outside the denning period, they may have less impact on fisher habitat. For instance, late-season fires resulted in greater reductions in canopy cover and fisher habitat suitability than early season burns in Sequoia-Kings Canyon National Park [120]. Also, a review [83] notes that early season fires generally have fewer detrimental effects on wildlife habitat than late-season fires. In addition, burning in cool, wet conditions has been recommended to reduce fire damage to snags [44].

Patchy fires will likely have less of an effect on fishers in the short term, and may benefit fishers in the long term. Since fishers can be isolated by relatively small expanses of an unsuitable environment (see Landscape/scale effects), areas that burned at low severity or were not burned in a patchy fire may allow for greater connectivity across a landscape. In addition, in at least some portions of their range fishers may be less impacted or benefit from patchy burns that produce diverse habitats with high interspersion (see Landscape/scale effects). The vegetation mosaic created by the 1910 wildfires in north-central Idaho provided favorable American marten habitat [69], and a review states that fishers are dependent on fire-created mosaics due to the reliance of their herbivore prey on open foraging areas [133]. Arranging burns across the landscape could reduce impacts on individual fishers [120], improve the spatial availability of foraging habitat [83], and, if travel corridors such as riparian habitats are left unburned, provide connectivity across the landscape [83,104].

More severe fires probably have greater negative impacts on fishers than less severe fires. In Idaho, the young forest that fishers selected in winter retained several structures after fire, including large-diameter trees, snags, and logs [65]. According to a review, small, low-severity fires in which some of the canopy remains may not be detrimental to American martens [100]. Reduced loss of canopy cover, coarse woody debris, and snags also suggests that low-severity fires would have less of an impact on fishers.

Fire Ecology: Fishers typically occur in forests with moderate to long fire-return intervals. According to reviews, most fisher habitats have mixed-severity or stand-replacement fire regimes, with the majority of fires occurring in summer [5,45,125]. Over time, environments with mixed-severity FIRE REGIMES may have more coarse woody debris than those with low- or high-severity regimes [2]. Fishers in south-central British Columbia occur in a habitat where large-scale fires burn most stands about every 125 years [129]. Information on the fire ecology of areas occupied by fishers, including the boreal forests of Boundary Waters Canoe Area, Minnesota [60], and the Sierra Nevada [123] is available.

The following table provides fire-return intervals for plant communities and ecosystems where fishers occur. For further information, see the FEIS review of the dominant plant species listed below.>/p>

Community or Ecosystem Dominant Species Fire-Return Interval Range (years)
silver fir-Douglas-fir Abies amabilis-Pseudotsuga menziesii var. menziesii >200 
grand fir Abies grandis 35-200 [5]
maple-beech Acer-Fagus spp. 684-1,385 [39,125]
maple-beech-birch Acer-Fagus-Betula spp. >1,000 
silver maple-American elm Acer saccharinum-Ulmus americana <5 to 200 
sugar maple Acer saccharum >1,000 
sugar maple-basswood Acer saccharum-Tilia americana >1,000 [125]
birch Betula spp. 80-230 [114]
Atlantic white-cedar Chamaecyparis thyoides 35 to >200 
beech-sugar maple Fagus spp.-Acer saccharum >1,000 
black ash Fraxinus nigra 125]
tamarack Larix laricina 35-200 [91]
western larch Larix occidentalis 25-350 [6,21,41]
yellow-poplar Liriodendron tulipifera <35 [125]
Great Lakes spruce-fir Picea-Abies spp. 35 to >200 
northeastern spruce-fir Picea-Abies spp. 35-200 [45]
southeastern spruce-fir Picea-Abies spp. 35 to >200 [125]
Engelmann spruce-subalpine fir Picea engelmannii-Abies lasiocarpa 35 to >200 [5]
black spruce Picea mariana 35-200 
conifer bog* Picea mariana-Larix laricina 35-200 
red spruce* Picea rubens 35-200 [45]
whitebark pine* Pinus albicaulis 50-200 [1,4]
jack pine Pinus banksiana 39,45]
Rocky Mountain lodgepole pine* Pinus contorta var. latifolia 25-340 [20,21,116]
Sierra lodgepole pine* Pinus contorta var. murrayana 35-200
Jeffrey pine Pinus jeffreyi 5-30
western white pine* Pinus monticola 50-200 
Pacific ponderosa pine* Pinus ponderosa var. ponderosa 1-47 [5]
interior ponderosa pine* Pinus ponderosa var. scopulorum 2-30 [5,18,77]
red pine (Great Lakes region) Pinus resinosa 3-18 (x=3-10) [38,49]
red-white pine* (Great Lakes region) Pinus resinosa-P. strobus 3-200 [39,59,79]
pitch pine Pinus rigida 6-25 [29,61]
pocosin Pinus serotina 3-8 
eastern white pine Pinus strobus 35-200 
eastern white pine-eastern hemlock Pinus strobus-Tsuga canadensis 35-200 
eastern white pine-northern red oak-red maple Pinus strobus-Quercus rubra-Acer rubrum 35-200 [125]
aspen-birch Populus tremuloides-Betula papyrifera 35-200 [45,125]
quaking aspen (west of the Great Plains) Populus tremuloides 7-120 [5,57,85]
black cherry-sugar maple Prunus serotina-Acer saccharum >1,000 [125]
Rocky Mountain Douglas-fir* Pseudotsuga menziesii var. glauca 25-100 [5,7,8]
coastal Douglas-fir* Pseudotsuga menziesii var. menziesii 40-240 [5,86,105]
Pacific coast mixed evergreen Pseudotsuga menziesii var. menziesii-Lithocarpus densiflorus-Arbutus menziesii <35-130 [5,37]
California oakwoods Quercus spp. <35 [5]
oak-hickory Quercus-Carya spp. <35
northeastern oak-pine Quercus-Pinus spp. 10 to <35 [125]
white oak-black oak-northern red oak Quercus alba-Q. velutina-Q. rubra <35 [125]
Oregon white oak Quercus garryana <35 [5]
California black oak Quercus kelloggii 5-30 [91]
northern red oak Quercus rubra 10 to <35 [125]
redwood Sequoia sempervirens 5-200 [5,47,113]
western redcedar-western hemlock Thuja plicata-Tsuga heterophylla >200 [5]
eastern hemlock-yellow birch Tsuga canadensis-Betula alleghaniensis 100-240 [114,125]
eastern hemlock-white pine Tsuga canadensis-Pinus strobus x=47 [39]
western hemlock-Sitka spruce Tsuga heterophylla-Picea sitchensis >200
mountain hemlock* Tsuga mertensiana 35 to >200 [5]
*fire-return interval varies widely; trends in variation are noted in the species review
  • 28. Brown, Timothy K. 2002. Creating and maintaining wildlife, insect, and fish habitat structures in dead wood. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 883-892. [44408]
  • 32. Bull, Evelyn L.; Parks, Catherine G.; Torgersen, Torolf R. 1997. Trees and logs important to wildlife in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 55 p. [27653]
  • 35. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 63. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 65. Jones, Jeffrey L. 1991. Habitat use of fisher in northcentral Idaho. Moscow, ID: University of Idaho. 147 p. Thesis. [63964]
  • 83. McMahon, Thomas E.; deCalesta, David S. 1990. Effects of fire on fish and wildlife. In: Walstad, John D.; Radosevich, Steven R.; Sandberg, David V., eds. Natural and prescribed fire in Pacific Northwest forests. Corvallis, OR: Oregon State University Press: 233-250. [47606]
  • 97. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]
  • 100. Proulx, Gilbert. 2000. The impact of human activities on North American mustelids. In: Griffiths, Huw I., ed. Mustelids in a modern world: Management and conservation aspects of small carnivore: human interactions. Leiden, The Netherlands: Backhuys Publishers: 53-75. [64006]
  • 129. Weir, Richard D.; Harestad, Alton S. 2003. Scale-dependent habitat selectivity by fishers in south-central British Columbia. Journal of Wildlife Management. 67(1): 73-82. [64024]
  • 137. Zielinski, William J.; Truex, Richard L.; Schmidt, Gregory A.; Schlexer, Fredrick V.; Schmidt, Kristin N.; Barrett, Reginald H. 2004. Resting habitat selection by fishers in California. Journal of Wildlife Management. 68(3): 475-492. [64029]
  • 138. Zielinski, William J.; Truex, Richard L.; Schmidt, Gregory A.; Schlexer, Fredrick V.; Schmidt, Kristin N.; Barrett, Reginald H.; O'Shea, Thomas J. 2004. Home range characteristics of fishers in California. Journal of Mammalogy. 85(4): 649-657. [64030]
  • 45. Duchesne, Luc C.; Hawkes, Brad C. 2000. Fire in northern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 35-51. [36982]
  • 5. Arno, Stephen F. 2000. Fire in western forest ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 97-120. [36984]
  • 77. Laven, R. D.; Omi, P. N.; Wyant, J. G.; Pinkerton, A. S. 1980. Interpretation of fire scar data from a ponderosa pine ecosystem in the central Rocky Mountains, Colorado. In: Stokes, Marvin A.; Dieterich, John H., tech. coords. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 46-49. [7183]
  • 29. Buchholz, Kenneth; Good, Ralph E. 1982. Density, age structure, biomass and net annual aboveground productivity of dwarfed Pinus rigida Moll. from the New Jersey Pine Barren Plains. Bulletin of the Torrey Botanical Club. 109(1): 24-34. [8639]
  • 7. Arno, Stephen F.; Gruell, George E. 1983. Fire history at the forest-grassland ecotone in southwestern Montana. Journal of Range Management. 36(3): 332-336. [342]
  • 1. Agee, James K. 1994. Fire and weather disturbances in terrestrial ecosystems of the eastern Cascades. Gen. Tech. Rep. PNW-GTR-320. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 52 p. (Everett, Richard L., assessment team leader; Eastside forest ecosystem health assessment; Hessburg, Paul F., science team leader and tech. ed., Volume III: assessment). [23656]
  • 8. Arno, Stephen F.; Scott, Joe H.; Hartwell, Michael G. 1995. Age-class structure of old growth ponderosa pine/Douglas-fir stands and its relationship to fire history. Res. Pap. INT-RP-481. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 25 p. [25928]
  • 4. Arno, Stephen F. 1976. The historical role of fire on the Bitterroot National Forest. Res. Pap. INT-187. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 29 p. [15225]
  • 125. Wade, Dale D.; Brock, Brent L.; Brose, Patrick H.; Grace, James B.; Hoch, Greg A.; Patterson, William A., III. 2000. Fire in eastern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 53-96. [36983]
  • 6. Arno, Stephen F.; Fischer, William C. 1995. Larix occidentalis--fire ecology and fire management. In: Schmidt, Wyman C.; McDonald, Kathy J., comps. Ecology and management of Larix forests: a look ahead: Proceedings of an international symposium; 1992 October 5-9; Whitefish, MT. Gen. Tech. Rep. GTR-INT-319. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 130-135. [25293]
  • 18. Baisan, Christopher H.; Swetnam, Thomas W. 1990. Fire history on a desert mountain range: Rincon Mountain Wilderness, Arizona, U.S.A. Canadian Journal of Forest Research. 20: 1559-1569. [14986]
  • 37. Chappell, Christopher B.; Giglio, David F. 1999. Pacific madrone forests of the Puget Trough, Washington. In: Adams, A. B.; Hamilton, Clement W., eds. The decline of the Pacific madrone (Arbutus menziesii Pursh): Current theory and research directions: Proceedings of the symposium; 1995 April 28; Seattle, WA. Seattle, WA: Save Magnolia's Madrones, Center for Urban Horticulture, Ecosystems Database Development and Research: 2-11. [40472]
  • 38. Clark, James S. 1990. Fire and climate change during the last 750 yr in northwestern Minnesota. Ecological Monographs. 60(2): 135-159. [11650]
  • 41. Davis, Kathleen M. 1980. Fire history of a western larch/Douglas-fir forest type in northwestern Montana. In: Stokes, Marvin A.; Dieterich, John H., tech. coords. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 69-74. [12813]
  • 44. Domazlicky, Roy S.; Swartz, David E. 1996. Effects of prescribed fire on snag tree density and quality. In: Warwick, Charles, ed. 15th North American prairie conference: Proceedings; 1996 October 23-26; St. Charles, IL. Bend, OR: The Natural Areas Association: 50-54. [30279]
  • 47. Finney, Mark A.; Martin, Robert E. 1989. Fire history in a Sequoia sempervirens forest at Salt Point State Park, California. Canadian Journal of Forest Research. 19: 1451-1457. [9845]
  • 48. Fisher, Jason T.; Wilkinson, Lisa. 2005. The response of mammals to forest fire and timber harvest in the North American boreal forest. Mammal Review. 35(1): 51-81. [55373]
  • 49. Frissell, Sidney S., Jr. 1968. A fire chronology for Itasca State Park, Minnesota. Minnesota Forestry Research Notes No. 196. Minneapolis, MN: University of Minnesota. 2 p. [34527]
  • 57. Gruell, G. E.; Loope, L. L. 1974. Relationships among aspen, fire, and ungulate browsing in Jackson Hole, Wyoming. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 33 p. In cooperation with: U.S. Department of the Interior, National Park Service, Rocky Mountain Region. [3862]
  • 59. Heinselman, Miron L. 1970. The natural role of fire in northern conifer forests. In: The role of fire in the Intermountain West: Symposium proceedings; 1970 October 27-29; Missoula, MT. Missoula, MT: Intermountain Fire Research Council: 30-41. In cooperation with: University of Montana, School of Forestry. [15735]
  • 60. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 62. Horton, Scott P.; Mannan, R. William. 1988. Effects of prescribed fire on snags and cavity-nesting birds in southeastern Arizona pine forests. Wildlife Society Bulletin. 16: 37-44. [5549]
  • 64. Innes, James C.; North, Malcolm P.; Williamson, Nathan. 2006. Effect of thinning and prescribed fire restoration treatments on woody debris and snag dynamics in a Sierran old-growth, mixed-conifer forest. Canadian Journal of Forest Research. 36: 3183-3193. [67115]
  • 67. Kelsall, John P.; Telfer, E. S.; Wright, Thomas D. 1977. The effects of fire on the ecology of the boreal forest, with particular reference to the Canadian north: a review and selected bibliography. Occasional Paper Number 32. Ottawa: Fisheries and Environment Canada, Canadian Wildlife Service. 58 p. [8403]
  • 69. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. Journal of Wildlife Management. 41(2): 500-505. [7637]
  • 74. Larsen, James A. 1980. The trophic pyramid: animal populations. In: Larsen, James A., ed. The boreal ecosystem. New York: Academic Press: 381-411. [64913]
  • 75. Latour, Paul B.; Maclean, Norm; Poole, Kim G. 1994. Movements of martens, Martes americana, in burned and unburned taiga in the Mackenzie Valley, Northwest Territories. Canadian Field-Naturalist. 108(3): 351-354. [25918]
  • 78. Lewis, Henry T. 1982. A time for burning. Occasional Publication Number 17. Edmonton, AB: The University of Alberta, Boreal Institute for Northern Studies. 62 p. [40183]
  • 79. Loope, Walter L. 1991. Interrelationships of fire history, land use history, and landscape pattern within Pictured Rocks National Seashore, Michigan. The Canadian Field-Naturalist. 105(1): 18-28. [5950]
  • 80. Lyon, L. Jack; Crawford, Hewlette S.; Czuhai, Eugene; Fredriksen, Richard L.; Harlow, Richard F.; Metz, Louis J.; Pearson, Henry A. 1978. Effects of fire on fauna: a state-of-knowledge review. Gen. Tech. Rep. WO-6. Washington, DC: U.S. Department of Agriculture, Forest Service, Washington Office. 41 p. [25066]
  • 85. Meinecke, E. P. 1929. Quaking aspen: A study in applied forest pathology. Tech. Bull. No. 155. Washington, DC: U.S. Department of Agriculture. 34 p. [26669]
  • 86. Morrison, Peter H.; Swanson, Frederick J. 1990. Fire history and pattern in a Cascade Range landscape. Gen. Tech. Rep. PNW-GTR-254. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 77 p. [13074]
  • 89. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1996. Marten selection of postfire seres in the Alaskan taiga. Canadian Journal of Zoology. 74: 2226-2237. [28567]
  • 90. Passovoy, M. David; Fule, Peter Z. 2006. Snag and woody debris dynamics following severe wildfires in northern Arizona ponderosa pine forests. Forest Ecology and Management. 223(1-3): 237-246. [61334]
  • 91. Paysen, Timothy E.; Ansley, R. James; Brown, James K.; Gottfried, Gerald J.; Haase, Sally M.; Harrington, Michael G.; Narog, Marcia G.; Sackett, Stephen S.; Wilson, Ruth C. 2000. Fire in western shrubland, woodland, and grassland ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 121-159. [36978]
  • 93. Pilliod, David S.; Bull, Evelyn L.; Hayes, Jane L.; Wales, Barbara C. 2006. Wildlife and invertebrate response to fuel reduction treatments in dry coniferous forests of the western United States: a synthesis. Gen. Tech. Rep. RMRS-GTR-173. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 34 p. [65071]
  • 105. Ripple, William J. 1994. Historic spatial patterns of old forests in western Oregon. Journal of Forestry. 92(11): 45-49. [33881]
  • 107. Rowe, J. S.; Scotter, G. W. 1973. Fire in the boreal forest. Quaternary Research. 3: 444-464. [72]
  • 109. Russell, Robin E.; Saab, Victoria A.; Dudley, Jonathan G.; Rotella Jay J. 2006. Snag longevity in relation to wildfire and postfire salvage logging. Forest Ecology and Management. 232(1/3): 179-187. [65023]
  • 113. Stuart, John D. 1987. Fire history of an old-growth forest of Sequoia sempervirens (Taxodiaceae) forest in Humboldt Redwoods State Park, California. Madrono. 34(2): 128-141. [7277]
  • 114. Swain, Albert M. 1978. Environmental changes during the past 2000 years in north-central Wisconsin: analysis of pollen, charcoal, and seeds from varved lake sediments. Quaternary Research. 10: 55-68. [6968]
  • 115. Swezy, D. Michael; Agee, James K. 1991. Prescribed-fire effects on fine-root and tree mortality in old-growth ponderosa pine. Canadian Journal of Forest Research. 21: 626-634. [15551]
  • 116. Tande, Gerald F. 1979. Fire history and vegetation pattern of coniferous forests in Jasper National Park, Alberta. Canadian Journal of Botany. 57: 1912-1931. [18676]
  • 119. Tiedemann, Arthur R.; Klemmedson, James O.; Bull, Evelyn L. 2000. Solution of forest health problems with prescribed fire: are forest productivity and wildlife at risk? Forest Ecology and Management. 127(1-3): 1-18. [36435]
  • 123. van Wagtendonk, Jan W.; Fites-Kaufman, Jo Ann. 2006. Sierra Nevada bioregion. In: Sugihara, Neil G.; van Wagtendonk, Jan W.; Shaffer, Kevin E.; Fites-Kaufman, Joann; Thode, Andrea E., eds. Fire in California's ecosystems. Berkeley, CA: University of California Press: 264-294. [65544]
  • 126. Wales, Barbara C. 2001. The management of insects, diseases, fire, and grazing and implications for terrestrial vertebrates using riparian habitats in eastern Oregon and Washington. Northwest Science. 75: 119-127. [43247]
  • 133. Wright, H. E., Jr.; Heinselman, M. L. 1973. Ecological role of fire. Quaternary Research. 3(3): 319-328. [36472]
  • 2. Agee, James K. 2005. The complex nature of mixed severity FIRE REGIMES. In: Taylor, Lagene; Zelnik, Jessica; Cadwallader, Sara; Hughes, Brian, comps. Mixed severity FIRE REGIMES: ecology and management: symposium proceedings; 2004 November 17-19; Spokane, WA. Pullman, WA: Washington State University Extension: 1-10. [61392]
  • 20. Barrett, Stephen W. 1993. FIRE REGIMES on the Clearwater and Nez Perce National Forests north-central Idaho. Final Report: Order No. 43-0276-3-0112. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 21 p. [41883]
  • 21. Barrett, Stephen W.; Arno, Stephen F.; Key, Carl H. 1991. FIRE REGIMES of western larch - lodgepole pine forests in Glacier National Park, Montana. Canadian Journal of Forest Research. 21: 1711-1720. [17290]
  • 39. Cleland, David T.; Crow, Thomas R.; Saunders, Sari C.; Dickmann, Donald I.; Maclean, Ann L.; Jordan, James K.; Watson, Richard L.; Sloan, Alyssa M.; Brosofske, Kimberley D. 2004. Characterizing historical and modern FIRE REGIMES in Michigan (USA): a landscape ecosystem approach. Landscape Ecology. 19: 311-325. [54326]
  • 42. de Vos, Anton. 1952. The ecology and management of fisher and marten in Ontario. [Publication location unknown]: Ontario Department of Lands and Forests:. 90 p. [66784]
  • 61. Hendrickson, William H. 1972. Perspective on fire and ecosystems in the United States. In: Fire in the environment: Symposium proceedings; 1972 May 1-5; Denver, CO. FS-276. [Washington, DC]: U.S. Department of Agriculture, Forest Service: 29-33. In cooperation with: Fire Services of Canada, Mexico, and the United States; Members of the Fire Management Study Group; North American Forestry Commission; FAO. [17276]
  • 76. Laudenslayer, William F., Jr. 2002. Effects of prescribed fire on live trees and snags in eastside pine forests in California. In: Sugihara, Neil G.; Morales, Maria; Morales, Tony, eds. Fire in California ecosystems: integrating ecology, prevention and management: Proceedings of the symposium; 1997 November 17-20; San Diego, CA. Misc. Pub. No. 1. [Place of publication unknown]: Association for Fire Ecology: 256-262. [45082]
  • 104. Reynolds, Julia. 1994. Martens and fishers--habitat use in managed forests. In: Proceedings of the 15th annual forest vegetation management conference; 1994 January 25-27; Redding, CA. [Publication location unknown]: [Publisher unknown]: 147-153. [64011]
  • 110. Scotter, George W. 1972. Fire as an ecological factor in boreal forest ecosystems of Canada. In: Fire in the environment: Symposium proceedings; 1972 May 1-5; Denver, CO. FS-276. [Washington, DC]: U.S. Department of Agriculture, Forest Service: 15-24. [13404]
  • 120. Truex, Richard L.; Zielinski, William J. 2005. Short-term effects of fire and fire surrogate treatments on fisher habitat in the Sierra Nevada. Final Report. Project JFSP 01C-3-3-02. [Boise, ID]: Joint Fire Science Program. [66471]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Direct Effects of Fire

More info for the terms: altricial, bog, direct effects of fire, wildfire

Despite a lack of data on the direct effects of fire on fishers, mortality from fire is probably rare. According to reviews, medium to large mammals typically have the mobility to avoid fire, although large, fast-moving fires can result in mortality [81,83,93]. Due to the altricial nature of young fishers (see Timing of Major Life History Events) and vulnerability of some denning structures to fire (see HABITAT RELATED FIRE EFFECTS), kits are likely at higher risk than adults. However, according to reviews severe fires in many fisher habitats are uncommon during the denning period [5,45,125]. An American marten, a closely related species that occurs in similar habitats, survived a wildfire that severely burned ridges but did not burn most bogs in a southeastern Manitoba study area. This American marten's home range was approximately 33% bog [101].
  • 83. McMahon, Thomas E.; deCalesta, David S. 1990. Effects of fire on fish and wildlife. In: Walstad, John D.; Radosevich, Steven R.; Sandberg, David V., eds. Natural and prescribed fire in Pacific Northwest forests. Corvallis, OR: Oregon State University Press: 233-250. [47606]
  • 45. Duchesne, Luc C.; Hawkes, Brad C. 2000. Fire in northern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 35-51. [36982]
  • 5. Arno, Stephen F. 2000. Fire in western forest ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 97-120. [36984]
  • 125. Wade, Dale D.; Brock, Brent L.; Brose, Patrick H.; Grace, James B.; Hoch, Greg A.; Patterson, William A., III. 2000. Fire in eastern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 53-96. [36983]
  • 81. Lyon, L. Jack; Telfer, Edmund S.; Schreiner, David Scott. 2000. Direct effects of fire and animal responses. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 17-23. [44435]
  • 93. Pilliod, David S.; Bull, Evelyn L.; Hayes, Jane L.; Wales, Barbara C. 2006. Wildlife and invertebrate response to fuel reduction treatments in dry coniferous forests of the western United States: a synthesis. Gen. Tech. Rep. RMRS-GTR-173. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 34 p. [65071]
  • 101. Raine, R. Michael. 1982. Ranges of juvenile fisher, Martes pennanti, and marten, Martes americana, in southeastern Manitoba. The Canadian-Field Naturalist. 96(4): 431-438. [64010]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: altricial, avoidance, litter, polygamous, presence

Reviews state that the fisher breeding cycle begins with mating starting in March. For females this is a few days after giving birth, since fishers exhibit delayed implantation lasting about 10 months. Active pregnancy typically begins in February and lasts until March or early April, when fishers give birth to an average of 2 to 3 kits [84,94,97]. Captive females trapped in Maine had an average initial litter size of 2.7 kits, with litters ranging from 1 to 4 kits [83]. Several years of observations showed the average litter size of 12 females in coastal Maine varied from 2.0 to 2.2 kits. Females gave birth from 3 March to 1 April [87]. In north-central Massachusetts and southwestern New Hampshire, the birth of 20 litters occurred from 4 March to 24 March with the median on 17 March [99]. According to reviews, males are reproductive beginning in early March [84,97]. During this time they often leave their home ranges in search of mates [11,16,17]. Fishers are likely polygamous [40].

Females den with their altricial kits for several weeks [40]. In Maine the denning period ranged from 8 to 12 weeks, with an average of 71 days, and ended as late as 1 June. Individual dens were used for 2 to 12 weeks, with a median of 22 days [9,87]. In north-central Massachusetts and southwestern New Hampshire, maternal dens were used until 3 June [99]. Kits in south-central Maine stayed with their mothers until they were about 150 days old, with males exhibiting more variation than females. Kits occurred within their mothers' home range from August to January. During this period mothers and young showed no attraction to or avoidance of each other. Two female kits dispersed in January [12,87]. Field and genetic evidence from an untrapped population in Oregon suggests males disperse further from their natal home range than females [16]. For information on development of young fishers, see these sources: [52,94]. According to reviews, males apparently can breed after a year, but the extent to which this actually occurs is unknown. Females also reach sexual maturation at a year. Due to delayed implantation they do not give birth to their first litter until they are 2 years old [40,84,97]. A review states that fishers can live to about 10 years [97]. Average annual survival rates over a 6-year period in a trapped fisher population in coastal Maine were 0.74 for adult females and 0.33 for juveniles [87]. In the upper peninsula of Michigan, the survival rate of fishers from June to December was 0.889, with 95% confidence intervals ranging from 0.500 to 0.985 [22].

Fisher denning rates are often lower than pregnancy rates. Reviews note cases of pregnancy rates ≥95% [9,24,97]. However, denning rates are typically much lower. For instance, in south-central Maine denning rates varied from 0% to 100% (n=12 females) over several years. The average annual recruitment was 0.7 to 1.3 kits/female. This recruitment rate and the estimated survivorship suggested the population was declining [9,87]. Factors influencing reproductive success of female fishers are addressed by McMahon and deCalesta [83].

Fishers exhibit sexual dimorphism, with females much smaller than males. Average female weight (4.3-4.9 lbs (1.97- 2.24 kg)) was substantially less than average male weight (7.9-9.5 lbs (3.6-4.3 kg)) in New Hampshire [66], northwest Connecticut [68], Vermont [124], and the southern Sierra Nevada of California [26]. The ratio of average male mass to average female mass for fishers collected throughout British Columbia was 1.64:1.00 [130].

Although fishers have large home ranges and are capable of moving long distances, in at least some instances their dispersal ability may be rather poor. In Douglas-fir (Pseudotsuga menziesii), lodgepole pine (Pinus contorta), and hybrid white spruce (Picea engelmannii × P. glauca)- dominated forests of south-central British Columbia, translocated fishers moved extensively before establishing their home ranges. The average area traversed was 442.5 km² for females and 1,438.0 km² for males. The majority of fishers traveled more than 100 km before establishing a home range [128]. In Oregon, dispersal distances greater than 31 miles (50 km) were observed. However, lack of gene flow to a population approximately 31 miles away suggests there is no dispersal between the populations [16]. In mixed second-growth coniferous and deciduous forest of south-central Maine, the greatest natal dispersal distance observed was 14 miles (23 km) [12]. There are several possible reasons for the variability in fisher dispersal distances, such as the presence of recently vacated territories nearby [12] and the degree of habitat connectivity (see Landscape/scale effects).

For detailed information on fisher reproductive behavior such as territoriality, parental care, and denning see these sources: [40,87,94,97]. For information on periods of activity and regular movements of fisher, see: [9,40,66,94].

  • 9. Arthur, Stephen M.; Krohn, William B. 1991. Activity patterns, movements, and reproductive ecology of fishers in southcentral Maine. Journal of Mammalogy. 72(2): 379-385. [64031]
  • 11. Arthur, Stephen M.; Krohn, William B.; Gilbert, James R. 1989. Home range characteristics of adult fishers. Journal of Wildlife Management. 53(3): 674-679. [63933]
  • 12. Arthur, Stephen M.; Paragi, Thomas F.; Krohn, William B. 1993. Dispersal of juvenile fishers in Maine. Journal of Wildlife Management. 57(4): 868-874. [63934]
  • 16. Aubry, Keith; Wisely, Samantha; Raley, Catherine; Buskirk, Steven. 2004. Zoogeography, spacing patterns, and dispersal in fishers: insights gained from combining field and genetic data. In: Harrison, Daniel J.; Fuller, Angela K.; Proulx, Gilbert., eds. Martens and fishers (Martes) in human-altered environments: an international perspective. New York: Springer Science and Business Media, Inc: 201-220. [66324]
  • 17. Badry, Micheal J.; Proulx, Gilbert; Woodard, Paul M. 1997. Home-range and habitat use by fishers translocated to the aspen parkland of Alberta. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. New York: Cornell University Press: 233-251. [65897]
  • 22. Belant, Jerrold L. 2007. Human-caused mortality and population trends of American marten and fisher in a U.S. national park. Natural Areas Journal. 27(2): 155-160. [66787]
  • 24. Berg, William E.; Kuehn, David W. 1994. Demography and range of fishers and American martens in a changing Minnesota landscape. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 262-271. [65914]
  • 26. Boroski, Brian B.; Golightly, Richard T.; Mazzoni, Amie K.; Sager, Kimberly A. 2002. Fisher research and the Kings River Sustainable Forest Ecosystems Project: current results and future efforts. In: Verner, Jared, tech. ed. Proceedings of a symposium on the Kings River Sustainable Forest Ecosystems Project: progress and current status; 1998 January 26; Clovis, CA. Gen. Tech. Rep. PSW-GTR-183. Albany, C: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 143-154. [44211]
  • 40. Coulter, Malcolm Wilford. 1966. Ecology and management of fishers in Maine. Syracuse, NY: Syracuse University. 183 p. Dissertation. [63950]
  • 52. Frost, Herbert; Krohn, William. 2004. Postnatal growth and development in fishers. In: Harrison, Daniel J.; Fuller, Angela K.; Proulx, Gilbert., eds. Martens and fishers (Martes) in human-altered environments: an international perspective. New York: Springer Science and Business Media, Inc: 253-263. [65880]
  • 68. Kilpatrick, Howard J.; Rego, Paul W. 1994. Influence of season, sex, and site availability on fisher (Martes pennanti) res-site selection in the central hardwood forest. Canadian Journal of Zoology. 72(8): 1416-1419. [63968]
  • 83. McMahon, Thomas E.; deCalesta, David S. 1990. Effects of fire on fish and wildlife. In: Walstad, John D.; Radosevich, Steven R.; Sandberg, David V., eds. Natural and prescribed fire in Pacific Northwest forests. Corvallis, OR: Oregon State University Press: 233-250. [47606]
  • 84. Mead, Rodney A. 1994. Reproduction in Martes. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 404-422. [65920]
  • 87. Paragi, Thomas F. 1990. Reproductive biology of female fishers in southcentral Maine. Orono, ME: University of Maine. 106 p. Thesis. [63976]
  • 94. Powell, Roger A. 1993. The fisher: Life history, ecology, and behavior. 2nd ed. Minneapolis, MN: University of Minnesota Press. 237 p. [63997]
  • 97. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]
  • 99. Powell, Shawn M.; York, Eric C.; Scanlon, John J.; Fuller, Todd K. 1997. Fisher maternal den sites in central New England. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 265-278. [65900]
  • 124. Van Why, Kyle R.; Giuliano, William M. 2001. Fall food habits and reproductive condition of fishers, Martes pennanti, in Vermont. The Canadian Field-Naturalist. 115(1): 52-56. [64021]
  • 128. Weir, Richard D.; Harestad, Alton S. 1997. Landscape-level selectivity by fishers in south-central British Columbia. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 252-264. [65896]
  • 130. Weir, Richard D.; Harestad, Alton S.; Wright, Randy C. 2005. Winter diet of fishers in British Columbia. Northwestern Naturalist. 86(1): 12-19. [64023]
  • 66. Kelly, George M. 1977. Fisher (Martes pennanti) biology in the White Mountain National Forest and adjacent areas. [Amherst, MA]: University of Massachusetts. 178 p. Dissertation. [63967]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Fishers have good senses of smell, hearing and sight. They communicate with each other by scent marking.

Communication Channels: chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Fishers have good senses of smell, hearing and sight. They communicate with each other by scent marking.

Communication Channels: chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Fishers can live up to ten years in the wild.

Range lifespan

Status: wild:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Fishers can live up to ten years in the wild.

Range lifespan

Status: wild:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14.3 years (captivity) Observations: Depending on how long the implantation takes to occur, the total gestation time can vary from 270 to 370 days. In the wild, fishers may live up to 10 years (Bernhard Grzimek 1990). One specimen lived 14.3 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

No information is available on the mating system of these mammals.

The breeding season is late winter and early spring, from March to May. After fertilization, the embryos stop developing for 10 to 11 months, and start developing again late in the winter following mating. Overall, pregnancy lasts almost a full year, 11 to 12 months. The average number of young in a litter is 3, ranging from 1 to 6. Shortly after giving birth, females mate again. Healthy females first breed at age 1, produce their first litter at age 2, and probably breed every year after that. So females essentially spend almost all of their adult life either pregnant or nursing young. Males breed for the first time when they are two years old.

Breeding interval: Fishers breed once per year.

Breeding season: Fishers breed in the late winter to early spring, from March to May. Breeding times vary with location.

Range number of offspring: 1 to 6.

Average number of offspring: 3.

Range gestation period: 11 to 12 months.

Range weaning age: 8 to 16 weeks.

Range time to independence: 5 (low) months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation ; embryonic diapause ; post-partum estrous

Average birth mass: 35 g.

Average number of offspring: 2.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Young fishers are born blind and nearly naked. Each weighs about 40 grams at birth. The eyes open after about 53 days. Young begin to be weaned at 8 to 10 weeks, but may nurse occasionally for up to 4 months after birth. By the time they are four months old, the young are able to hunt for themselves, and they leave their mother at least one month later. Most dens in which young fishers are raised are high up in hollow trees, and females may choose to move their young up to several times if the litter is at all disturbed. Male fishers do not help raise their young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor: University of Michigan Press.
  • Powell, R. 1981. Martes pennanti. Mammalian Species, 156: 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known about mating in fishers. Copulation may last up to seven hours.

The breeding season is late winter and early spring, from March to May. After fertilization, the embryos sit in suspended development for 10 to 11 months, and resume developing late in the winter following mating. Overall, gestation lasts almost a full year, 11 to 12 months. The average number of young in a litter is 3, ranging from 1 to 6. Shortly after giving birth, females experience a postpartum estrus and mate again. Healthy females first breed at age 1, produce their first litter at age 2, and probably breed every year after that. So females essentially spend almost all of their adult life in a state of pregnancy or lactation. Males breed for the first time when they are two years old. Females reach adult weights at 5.5 months, whereas males reach adult weights after 1 year old.

Breeding interval: Fishers breed once per year.

Breeding season: Fishers breed in the late winter to early spring, from March to May. Breeding times vary with location.

Range number of offspring: 1 to 6.

Average number of offspring: 3.

Range gestation period: 11 to 12 months.

Range weaning age: 8 to 16 weeks.

Range time to independence: 5 (low) months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation ; embryonic diapause ; post-partum estrous

Average birth mass: 35 g.

Average number of offspring: 2.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Young fishers are born blind and nearly naked. Each weighs about 40 grams at birth. The eyes open after about 53 days. Young begin to be weaned at 8 to 10 weeks, but may nurse occasionally for up to 4 months after birth. By the time they are four months old, the young are able to hunt for themselves, and they disperse at least one month later. Most dens in which young fishers are raised are high up in hollow trees, and females may choose to move their young up to several times if the litter is disturbed. Male fishers do not help raise their young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor: University of Michigan Press.
  • Powell, R. 1981. Martes pennanti. Mammalian Species, 156: 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Martes pennanti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAATCGATGATTATTTTCCACAAATCATAAGGACATCGGCACCCTTTACCTTTTATTCGGCGCCTGAGCCGGAATAGTAGGCACTGCCCTTAGTCTATTAATTCGTGCCGAATTGGGTCAACCTGGCGCTTTACTAGGAGACGACCAGATTTATAATGTAGTCGTAACCGCTCATGCATTTGTAATAATTTTCTTTATGGTAATACCCATCATGATCGGGGGCTTTGGAAACTGACTAGTGCCCTTAATAATCGGTGCCCCCGATATAGCATTTCCACGTATAAATAATATAAGCTTTTGACTTCTACCCCCTTCCTTCCTTCTACTTCTAGCCTCCTCCATGGTGGAGGCAGGCGCAGGGACAGGATGAACCGTATATCCCCCTCTAGCAGGAAACCTAGCACATGCAGGAGCATCCGTAGACCTAACAATCTTTTCTTTACATCTGGCAGGTGTCTCATCCATCCTAGGAGCCATCAACTTTATTACAACCATCATCAACATAAAACCACCCGCAATGTCACAATACCAAACCCCCTTATTCGTATGATCCGTCCTAATCACGGCTGTGCTTCTACTTCTATCCCTGCCAGTTCTAGCAGCCGGTATTACTATACTACTTACAGATCGAAACCTAAACACCACTTTCTTTGACCCTGCTGGAGGGGGAGACCCCATTCTGTACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTGTATATCCTAATTCTACCTGGATTTGGAATTATTTCACATGTCGTAACATATTATTCAGGTAAAAAGGAACCGTTCGGTTACATGGGAATAGTTTGGGCAATAATATCCATTGGGTTCTTAGGGTTTATTGTATGAGCCCACCACATATTTACTGTAGGAATGGATGTTGATACACGAGCATATTTCACCTCAGCTACTATAATTATTGCCATTCCAACGGGGGTAAAAGTATTTAGCTGGCTGGCCACCCTGCACGGAGGAAATATTAAATGATCACCGGCCATACTATGAGCCCTGGGTTTTATTTTTCTTTTCACGGTAGGCGGTTTAACGGGTATCGTATTATCGAACTCATCGCTAGACATCGTTCTCCACGACACATACTACGTGGTGGCACACTTCCATTACGTCCTCTCAATGGGGGCAGTATTCGCAATCATAGGCGGATTTGTCCACTGATTCCCACTGTTCACGGGTTACACACTAAATGACACTTGAGCAAAAATTCACTTCACAATTATATTTGTAGGGGTTAATATAACATTTTTCCCTCAACATTTTCTAGGCCTGTCGGGCATGCCACGACGATACTCCGACTACCCAGATGCTTACACGACATGAAATACGGTATCTTCCATAGGTTCATTCATTTCACTAACAGCAGTAATACTAATAATCTTCATAATTTGAGAAGCCTTTGCATCTAAGCGAGAAGTATTAACAGTAGAACTCACCTCAACGAATATTGAATGACTACACGGATGCCCTCCCCCATACCACACATTCGAAGAGCCAACCTACGTGTTAACAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Martes pennanti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as although habitat loss and trapping are major threats, protective regulations and reintroductions have recovered the past decline. In addition, the species is widely distributed and occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Candidate
Date Listed:
Lead Region:   California/Nevada Region (Region 8) 
Where Listed: West coast DPS


For most current information and documents related to the conservation status and management of Martes pennanti, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Logging of forests greatly affects fishers and fisher populations by destroying their preferred habitat--continuous or nearly continuous coniferous forests.

Zoos have had a hard time breeding fishers in captivity, but there has been some success. Because there are many thriving and healthy fisher populations, there has been little desire to develop fisher breeding programs in captivity.

In some areas of North America, such as Michigan, Ontario, New York, and some areas of New England, fisher populations seem to have rebounded in recent years.

Fisher populations in the southern Sierra Nevada have been said to need protection under the Endangered Species Act.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

Candidate [122]
  • 122. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Logging of forests greatly impacts fishers and fisher populations by destroying their preferred habitat--continuous or nearly continuous coniferous forests.

Zoos have had a hard time breeding fishers in captivity, but there has been some success. Because there are numerous thriving and healthy fisher populations, there has been little pressure or initiative to develop fisher breeding or maintaining programs in captivity.

In some areas of North America, such as Michigan, Ontario, New York, and some areas of New England, fisher populations seem to have rebounded in recent years.

Fisher populations in the southern Sierra Nevada have been proposed as candidates for protection under the Endangered Species Act.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Densities in preferred habitat are about one fisher per 2.6 to 7.5 km2 (Coulter, 1966; Kelly, 1977). Total population size is unknown but probably is at least in the low hundreds of thousands; for example, the harvest in North America during the 1983-1984 trapping season was about 20,000 (Novak et al. 1987), and the average in the 1960s and 1970s was about 13,000 (Strickland et al. 1982).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
During the 19th and early 20th centuries the fisher declined over most of its range because of excessive fur trapping and habitat destruction through logging. Aubry and Lewis (2003) state that over trapping appears to have been the primary initial cause of fisher population losses in southwestern Oregon. The high value of the skins, the ease of trapping fishers (Powell, 1993), year-round accessibility in the low to mid-elevation coniferous forests, and the lack of trapping regulations resulted in heavy trapping pressure on fishers in the late 1800s and early 1900s (Aubry and Lewis, 2003). Timber harvest can fragment fisher habitat, reduce it in size, or change the forest structure to be unsuitable for fishers. Habitat loss and fragmentation appear to be significant threats to the fisher.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are currently efforts underway to implement a conservation strategy to reintroduce the fisher into its former range along the Pacific Coast. Genetic data indicate that British Columbia would be the most appropriate source population for future translocations that may be necessary to recover populations in Washington and portions of Oregon and California (Drew et al., 2003). The species is protect in large tracts of habitat in areas well distributed throughout the range. The primary conservation measure necessary is to prevent excessive harvest.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the terms: avoidance, wildfire

Although research on the response of fishers to fire is lacking, burning at low severities, burning small areas, burning at appropriate times, and protecting resting structures have been recommended to minimize the impact of fire on fishers. Low-severity burns would have less impact on fisher resting structures than more severe fires [44]. In California, broadcast burn prescriptions that preserve 100- and 1,000-hour timelag fuels were suggested in fisher habitat [104]. Burning small areas would likely reduce the impacts on fishers by minimizing the effects on individuals and maintaining connectivity. Leaving riparian areas unburned has been recommended as a way to maintain connectivity [83,104]. Spreading burns over the landscape and through time could minimize impacts on individual fishers and would also provide the diverse habitats used by fishers' prey [83,104]. Increasing fire return intervals has also been suggested as a way to reduce the impact of fire on downed wood and the forest floor [119]. When possible burning in mid-May [120] or early June [88], when fires typically have less impact on the habitat [83,120] and the fisher denning period is over, is preferred. If burning must be done earlier in the spring, avoidance of areas with high densities of denning structures has been recommended to reduce impacts on female fishers and their litters [120]. Identification of structures to preserve for resting fishers such as large trees, snags, and logs is addressed in these sources: [28,88,119]. Suggestions for protecting structures include wetting them or burning in moist conditions [44,83], raking debris away from their bases [44,83,119,120], or applying fire retardant at bases of snags [83]. Monitoring fisher populations and habitat response to fires has been recommended to address the lack of data available [120]. Avoidance of salvage logging and creation of denning structures [32,44] may assist fishers after fire. Minimizing the risk of wildfire and maintaining complex forest structures can be compatible at the landscape scale in some circumstances. For instance, on the east side of the Cascade Range in Washington, when ≤45% of the area is reserved in a late-successional stage, the 2 objectives can be met [36].
  • 28. Brown, Timothy K. 2002. Creating and maintaining wildlife, insect, and fish habitat structures in dead wood. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 883-892. [44408]
  • 32. Bull, Evelyn L.; Parks, Catherine G.; Torgersen, Torolf R. 1997. Trees and logs important to wildlife in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 55 p. [27653]
  • 83. McMahon, Thomas E.; deCalesta, David S. 1990. Effects of fire on fish and wildlife. In: Walstad, John D.; Radosevich, Steven R.; Sandberg, David V., eds. Natural and prescribed fire in Pacific Northwest forests. Corvallis, OR: Oregon State University Press: 233-250. [47606]
  • 88. Paragi, Thomas F.; Arthur, Stephen M.; Krohn, William B. 1996. Importance of tree cavities as natal dens for fishers. Northern Journal of Applied Forestry. 13(2): 79-83. [27232]
  • 36. Calkin, David E.; Hummel, Susan Stevens; Agee, James K. 2005. Modeling trade-offs between fire threat reduction and late-seral forest structure. Canadian Journal of Forest Research. 35: 2562-2574. [61585]
  • 44. Domazlicky, Roy S.; Swartz, David E. 1996. Effects of prescribed fire on snag tree density and quality. In: Warwick, Charles, ed. 15th North American prairie conference: Proceedings; 1996 October 23-26; St. Charles, IL. Bend, OR: The Natural Areas Association: 50-54. [30279]
  • 119. Tiedemann, Arthur R.; Klemmedson, James O.; Bull, Evelyn L. 2000. Solution of forest health problems with prescribed fire: are forest productivity and wildlife at risk? Forest Ecology and Management. 127(1-3): 1-18. [36435]
  • 104. Reynolds, Julia. 1994. Martens and fishers--habitat use in managed forests. In: Proceedings of the 15th annual forest vegetation management conference; 1994 January 25-27; Redding, CA. [Publication location unknown]: [Publisher unknown]: 147-153. [64011]
  • 120. Truex, Richard L.; Zielinski, William J. 2005. Short-term effects of fire and fire surrogate treatments on fisher habitat in the Sierra Nevada. Final Report. Project JFSP 01C-3-3-02. [Boise, ID]: Joint Fire Science Program. [66471]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the term: tree

Status: According to reviews, fishers are apparently recovering in much of the northeastern United States but remain vulnerable in the West [24,97,118]. A 2003 distribution of the fisher in the Pacific states is provided by Aubry and Lewis [14].

  Methods: Information regarding methods for the detection and monitoring [15,135], capture and care [50], and reintroduction [23,108] of fishers is available.

Trapping: According to reviews, fishers are quite vulnerable to trapping [97,100]. In addition to possible population declines [66,100], trapping may also change age distributions and sex ratios [53,70]. Recommendations for maintaining stable populations include closing trapping seasons for other furbearers as well as fishers and closely regulating and monitoring trapped fisher populations [22,97]. The history, methods, and effects of fisher trapping are summarized in [24,97,100].

  Michael Schwartz, Rocky Mountain Research Station  

Timber harvesting: Forest management practices recommended to mitigate effects on fisher are summarized in several reviews and include minimizing the size [63,65,97,100] and extending the rotation [3,92] of shelterwood and clearcuts, increasing interspersion of mature and harvested areas, [3,10], avoiding harvests in riparian areas [3,63,104], using uneven-aged techniques [3,30,65,97,100], conserving and minimizing damage to snags and live denning trees [3,28,31,88,99,104], cutting cavity trees or snags outside of the March to June denning period [88], and retaining coarse woody debris [3,31,63,65,100,104]. In addition, salvage logging after fires in western forests is discouraged [34], as is planting sites with ponderosa pine in northwestern California, since it results in a dry vegetation community that may not provide quality fisher habitat [30].

Information on denning tree [28,32,33,34,43,121] and coarse woody debris management [32,33,112] is available.
  • 3. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 10. Arthur, Stephen M.; Krohn, William B.; Gilbert, James R. 1989. Habitat use and diet of fishers. Journal of Wildlife Management. 53(3): 680-688. [8671]
  • 14. Aubry, Keith B.; Lewis, Jeffrey C. 2003. Extirpation and reintroduction of fishers (Martes pennanti) in Oregon: implications for their conservation in the Pacific states. Biological Conservation. 114(1): 79-90. [63937]
  • 15. Aubry, Keith B.; Wahl, Fred E.; Von Kienast, Jeff; Catton, Timothy J., Armentrout, Scott G. 1997. Use of remote video cameras for the detection of forest carnivores and in radiotelemetry studies of fishers. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd International Martes Symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 350-361. [65893]
  • 22. Belant, Jerrold L. 2007. Human-caused mortality and population trends of American marten and fisher in a U.S. national park. Natural Areas Journal. 27(2): 155-160. [66787]
  • 23. Berg, William E. 1982. Reintroduction of fisher, pine marten, and river otter. In: Sanderson, Glen C., ed. Midwest furbearer management. Chicago, IL: University of Illinois: 159-173. [63938]
  • 24. Berg, William E.; Kuehn, David W. 1994. Demography and range of fishers and American martens in a changing Minnesota landscape. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 262-271. [65914]
  • 28. Brown, Timothy K. 2002. Creating and maintaining wildlife, insect, and fish habitat structures in dead wood. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 883-892. [44408]
  • 30. Buck, Slader G.; Mullis, Curt; Mossman, Archie S.; Show, Ivan: Coolahan, Craig. 1994. Habitat use by fishers in adjoining heavily and lightly harvested forest. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 368-376. [65918]
  • 31. Bull, Evelyn L.; Aubry, Keith B.; Wales, Barbara C. 2001. Effects of disturbance on forest carnivores of conservation concern in eastern Oregon and Washington. Northwest Science. 75: 180-184. [43073]
  • 32. Bull, Evelyn L.; Parks, Catherine G.; Torgersen, Torolf R. 1997. Trees and logs important to wildlife in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 55 p. [27653]
  • 33. Bunnell, Fred L.; Boyland, Mark; Wind, Elke. 2002. How should we spatially distribute dying and dead wood? In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 739-752. [44395]
  • 34. Bunnell, Fred L.; Houde, Isabelle; Johnston, Barb; Wind, Elke. 2002. How dead trees sustain live organisms in western forests. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 291-318. [44365]
  • 43. DeGraaf, Richard M; Shigo, Alex L. 1985. Managing cavity trees for wildlife in the Northeast. Gen. Tech. Rep. NE-101. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 21 p. [13481]
  • 50. Frost, Herbert C.; Krohn, William B. 1994. Capture, care, and handling of fishers (Martes pennanti). Tech. Bull. 157. Orono, ME: University of Maine, Maine Agricultural and Forest Experiment Station. 38 p. [63957]
  • 53. Garant, Yves; Crete, Michel. 1997. Fisher, Martes pennanti, home range characteristics in a high density untrapped population in southern Quebec. The Canadian Field-Naturalist. 111(3): 359-364. [63958]
  • 63. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 65. Jones, Jeffrey L. 1991. Habitat use of fisher in northcentral Idaho. Moscow, ID: University of Idaho. 147 p. Thesis. [63964]
  • 70. Krohn, William B.; Arthur, Stephen M.; Paragi, Thomas F. 1994. Mortality and vulnerability of a heavily trapped fisher population. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: biology and conservation. Ithaca, NY: Cornell University Press: 137-145. [65906]
  • 88. Paragi, Thomas F.; Arthur, Stephen M.; Krohn, William B. 1996. Importance of tree cavities as natal dens for fishers. Northern Journal of Applied Forestry. 13(2): 79-83. [27232]
  • 92. Peterson, E. B.; Peterson, N. M. 1992. Ecology, management, and use of aspen and balsam poplar in the prairie provinces, Canada. Special Report 1. Edmonton, AB: Forestry Canada, Northwest Region, Northern Forestry Centre. 252 p. [22689]
  • 97. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine in the western United States. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]
  • 99. Powell, Shawn M.; York, Eric C.; Scanlon, John J.; Fuller, Todd K. 1997. Fisher maternal den sites in central New England. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995; Edmonton, AB. Edmonton, AB: The Provincial Museum of Alberta: 265-278. [65900]
  • 100. Proulx, Gilbert. 2000. The impact of human activities on North American mustelids. In: Griffiths, Huw I., ed. Mustelids in a modern world: Management and conservation aspects of small carnivore: human interactions. Leiden, The Netherlands: Backhuys Publishers: 53-75. [64006]
  • 108. Roy, Kevin D. 1991. Ecology of reintroduced fishers in the Cabinet Mountains of northwest Montana. Missoula, MT: University of Montana. 94 p. Thesis. [64013]
  • 112. Stevenson, Susan K.; Jull, Michael J.; Rogers, Bruce J. 2006. Abundance and attributes of wildlife trees and coarse woody debris at three silvicultural systems study areas in the interior cedar-hemlock zone, British Columbia. Forest Ecology and Management. 233(1): 176-191. [64073]
  • 118. Thompson, Jonathan. 2005. Fisher conservation in the Pacific states: field data meet genetics. PNW Science Findings. Issue 70. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 5 p. [64040]
  • 121. Tubbs, Carl H.; DeGraaf, Richard M.; Yamasaki, Mariko; Healy, William M. 1987. Guide to wildlife tree management in New England northern hardwoods. Gen. Tech. Rep. NE-118. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 30 p. [21365]
  • 66. Kelly, George M. 1977. Fisher (Martes pennanti) biology in the White Mountain National Forest and adjacent areas. [Amherst, MA]: University of Massachusetts. 178 p. Dissertation. [63967]
  • 104. Reynolds, Julia. 1994. Martens and fishers--habitat use in managed forests. In: Proceedings of the 15th annual forest vegetation management conference; 1994 January 25-27; Redding, CA. [Publication location unknown]: [Publisher unknown]: 147-153. [64011]
  • 135. Zielinski, William J.; Kucera, Thomas E. 1995. American marten, fisher, lynx, and wolverine: survey methods for their detection. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station; Gen. Tech. Rep. PSW-GTR-157: 163 p. Available: http://www.fs.fed.us/psw/publications/documents/gtr-157/ [2007, June 7]. [64042]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In recent years fisher populations in some areas, particularly southern Ontario and New York, have been recovering. In these areas they may be becoming used to humans and venturing into suburban areas. There have been many reports of fisher attacks on domestic animals and even children. It is important to recognize that fishers are simply trying to find food and protect themselves. It is important to not allow them access to garbage, pet foods, pets, and domestic fowl. When startled, fishers may react aggressively to what they see as a threat. Diseased animals may react unpredictably.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Fishers are trapped and killed for their pelts. Trapping, in the past, had a large effect on fisher populations, but the problem is not as severe now. Fishers hunt erethizon dorsatum, and can effectively control porcupine populations (porcupines are known to damage timber crops by eating the bark and killing trees).

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

In recent years fisher populations in some areas, particularly southern Ontario and New York, have been recovering. In these areas they may be becoming habituated to human presence and venturing into suburban areas. There have been numerous reports of fisher attacks on domestic animals and even children. It is important to recognize that fishers are simply trying to find food and protect themselves. It is important to restrict access to garbage, pet foods, pets, and domestic fowl. When startled, fishers may react aggressively to the perceived threat. Diseased individuals may react unpredictably.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Fishers are trapped and killed for their pelts. Trapping, in the past, had a significant effect on fisher populations, but the problem is not as severe now. Fishers hunt porcupines, and can effectively control porcupine populations (porcupines are known to damage timber crops by debarking and killing trees).

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Fisher (animal)

Not to be confused with the Fishing cat, a medium-size wild felid.
For other uses, see Fisher (disambiguation).

The fisher (Martes pennanti) is a weasel native to North America. It is a member of the mustelid family, commonly referred to as the weasel family. The fisher is closely related to but larger than the American Marten (Martes americana). The fisher is a forest-dwelling creature whose range covers much of the boreal forest in Canada to the northern fringes of the United States. Names derived from aboriginal languages include pekan, pequam, and wejack. It is also sometimes referred to as a fisher cat, although it is not a feline.

Males and females are similar in appearance but the males are larger. Males are 90–120 cm (35–47 in) in length and weigh 3.5 to 6 kilograms (8–13 lb). Females measure 75–95 cm (30–37 in) and weigh 2–2.5 kg (4–6 lb). The fur of the fisher varies seasonally, being denser and glossier in the winter. During the summer, the color becomes more mottled, as the fur goes through a moulting cycle. Fishers prefer to hunt in full forest. While they are agile climbers, most of their time is spent on the forest floor. They also prefer to forage where there is fallen dead wood on the forest floor. Fishers are omnivorous and feed on a wide variety of small animals and occasionally fruits and mushrooms. They show a preference for the snowshoe hare and are one of the few predators able to successfully hunt porcupine. Despite their name, fishers seldom eat fish.

The reproductive cycle of the fisher lasts almost the entire year. Female fishers give birth to a litter of three or four kits in the spring. They nurse and care for their kits up until late summer, when they are old enough to set out on their own. Females enter estrus shortly after giving birth and leave the den to find a mate. Implantation of the blastocyst is delayed until the following spring when they give birth and the cycle is renewed.

Fishers have few predators aside from humans. They have been trapped since the 18th century for their fur. Their pelts were in such demand that they were extirpated from several parts of the United States in the early part of the 20th century. Conservation and protection measures have allowed the species to rebound, but their current range is still reduced from its historic limits. In the 1920s, when pelt prices were high, some fur farmers attempted to raise fishers. However, their unusual delayed reproduction made breeding difficult. When pelt prices fell in the late 1940s, most fisher farming ended. While fishers usually avoid human contact, encroachments into forest habitats have resulted in some conflicts. There are anecdotal reports of fishers attacking pets and, in a 2009 case in Rhode Island, a 6-year-old boy.[2][3] In 2014, a 12 year old boy was attacked by what was believed to be a fisher cat in Massachusetts.[4]

Etymology[edit]

Despite the name fisher, the animal is not known to eat fish. The name comes from colonial Dutch fisse or visse due to its resemblance to the European polecat (Mustela putorius). In the French language, the pelt of a polecat is also called fiche or fichet.[5]

In some regions the fisher is known as a pekan, derived from its name in the Abenaki language. Wejack is an Algonquian word (cf. Cree wuchak, otchock, Ojibwa ojiig) borrowed by fur traders. Other American Indian names for the fisher are Chipewyan thacho[6] and Carrier chunihcho,[7] both meaning "big marten", and Wabanaki uskool.[5]

Taxonomy[edit]

Skull diagram

The Latin specific name pennanti is named for Thomas Pennant who described the fisher in 1771. Buffon had first described the creature in 1765, calling it a pekan. Pennant examined the same specimen but called it a fisher, unaware of Buffon's earlier description. Other 18th-century scientists gave it similar names, such as Schreber, who named it Mustela canadensis, and Boddaert, who named it Mustela melanorhyncha.[8] The fisher was eventually placed in the genus Martes by Smith in 1843.[9]

Members of the genus Martes are distinguished by their four premolar teeth on the upper and lower jaws. Its close relative Mustela has only three. The fisher has 38 teeth. The dentition formula (ref:Dental formula) is:[10]

Dentition
3.1.4.1
3.1.4.2

Evolution[edit]

There is evidence that ancestors of the fisher migrated to North America during the Pliocene era between 2.5 and 5 million years ago. Two extinct mustelids M. palaeosinensis and M. anderssoni have been found in eastern Asia. The first true fisher, M. divuliana, has been found only in North America. There are strong indications that M. divuliana is related to the Asian finds, which suggests a migration. M. pennanti has been found as early as the Late Pleistocene era about 125,000 years ago. There are no major differences between the Pleistocene fisher and the modern fisher. Fossil evidence indicates that the fisher's range extended farther south than it does today.[5]

Three subspecies were identified by Goldman in 1935, M.p. columbiana, M.p. pacifica, and M.p. pennanti. Later research has debated whether these subspecies could be positively identified. In 1959, E.M. Hagmeier concluded that the subspecies are not separable based on either fur or skull characteristics. Although some debate still exists, in general it is recognized that the fisher is a monotypic species with no extant subspecies.[11]

Biology and behavior[edit]

Physical characteristics[edit]

Fisher in winter coat

Fishers are a medium-sized mammal, comparable to the size of domestic cat, and the largest species in the marten genus. Their bodies are long, thin, and low to the ground. The sexes have similar physical features but they are sexually dimorphic in size, with the male being much larger than the female. Males are 90–120 cm (35–47 in) in length and weigh 3.5–6 kg (8–13 lb). Females measure 75–95 cm (30–37 in) and weigh 2–2.5 kg (4–6 lb).[12][13] The largest ever male fisher recorded weighed 9 kg (20 lb).[14]

The fisher's fur changes with the season and differs slightly between sexes. Males have coarser coats than females. In the early winter, the coats are dense and glossy, ranging from 30 mm (1 in) on the chest to 70 mm (3 in) on the back. The color ranges from deep brown to black, although it appears to be much blacker in the winter when contrasted with white snow. From the face to the shoulders, fur can be hoary-gold or silver due to tricolored guard hairs. The underside of a fisher is almost completely brown except for randomly placed patches of white or cream-colored fur. In the summer, the fur color is more variable and may lighten considerably. Fishers undergo moulting starting in late summer and finishing by November or December.[15]

Fishers have five toes on each foot with unsheathed, retractable claws.[5] Their feet are disproportionately larger than their legs, making it easier for them to move on top of snow packs. In addition to the toes, there are four central pads on each foot. On the hind paws there are coarse hairs that grow between the pads and the toes, giving them added traction when walking on a variety of surfaces.[16] Fishers have extremely mobile ankle joints, which can rotate their hind paws almost 180 degrees, allowing them to agilely move through tree branches and climb down trees head first.[17]

A circular patch of hair on the central pad of their hind paws marks plantar glands that give off a distinctive odor. Since these patches become enlarged during breeding season, they are likely used to make a scent trail to allow fishers to find each other so that they can mate.[16]

Hunting and diet[edit]

Fishers are generalist predators. Although their primary prey is snowshoe hare and porcupine, they are also known to supplement their diet with insects, nuts, berries, and mushrooms. Since they are solitary hunters their choice of prey is limited to their size. Analyses of stomach contents and scat have found evidence of birds, small mammals, and even moose and deer. The latter food sources shows that they are not averse to eating carrion. Fishers have been observed to feed on the carcasses of deer left by hunters.[18] While uncommon, fishers have been found to kill larger animals such as wild turkey, bobcat and lynx.[19][20][21]

Fishers are one of the few predators that seek out and kill porcupines. There are stories in popular literature that fishers can flip a porcupine onto its back and "scoop out its belly like a ripe melon."[22] This was identified as an exaggerated misconception as early as 1966.[23] Observational studies show that fishers will make repeated biting attacks on the face of a porcupine and kill it after about 25–30 minutes.[24]

Reproduction[edit]

The female fisher begins to breed at about one year of age and her reproductive cycle is an almost year-long event. Mating takes place in late March to early April. Blastocyst implantation is then delayed for 10 months until mid-February of the following year when active pregnancy begins. After gestating for about 50 days, the female gives birth to one to four kits.[25] The female then enters estrus 7–10 days later and the breeding cycle begins again.[26]

Females den in hollow trees. Kits are born blind and helpless. They are partially covered with fine hair. Kits begin to crawl after about 3 weeks. After about 7 weeks they open their eyes. They start to climb after 8 weeks. Kits are completely dependent on their mother's milk for the first 8–10 weeks, after which they begin to switch to a solid diet. After 4 months, kits become intolerant of their litter mates, and at 5 months the mother pushes them out on their own. After one year, juveniles will have established their own range.[26]

Social structure and home range[edit]

Fishers are generally crepuscular. They are most active during dawn and dusk hours of the day. They are active year-round. Fishers are solitary, associating with other fishers only for mating purposes. Males become more active during mating season. Females are least active during pregnancy and gradually increase activity after birth of their kits.[26]

A fisher's hunting range varies from 6.6 km2 (3 sq mi) in the summer to 14.1 km2 (5 sq mi) in the winter. Ranges of up to 20.0 km2 (8 sq mi) in the winter are possible depending on the quality of the habitat. Male and female fishers have overlapping territories. This behavior is imposed on females by males due to dominance in size and a male desire to increase mating success.[27]

Habitat[edit]

A fisher in the woods near Ipswich, Massachusetts

Although fishers are competent tree climbers, they spend most of their time on the forest floor. They prefer continuous forest to other habitats. Fishers have been found in extensive conifer forests typical of the boreal forest but are also common in mixed hardwood and conifer forests. Fishers prefer areas with continuous overhead cover with greater than 80% coverage and will avoid areas with less than 50% coverage.[28] Fishers are more likely to be found in old-growth forests. Since female fishers require moderately large trees for denning, forests that have been heavily logged and have extensive second growth appears to be unsuitable for their needs.[29]

Another factor that fishers select for are forest floors that have large amounts of coarse woody debris. In western forests where fire regularly removes understorey debris, fishers show a preference for riparian woodland habitat.[27][30][31] Fishers tend to avoid areas with deep snow. Habitat is also affected by snow compaction and moisture content.[32]

Distribution[edit]

Footage of a fisher in a tree in New Hampshire
A fisher climbing a tree at night

Fishers are widespread throughout the northern forests of North America. They are found from Nova Scotia in the east to the Pacific shore of British Columbia and Alaska. They can be found as far north as Great Slave Lake in the Northwest Territories and as far south as the mountains of Oregon. There are isolated populations in the Sierra Nevada of California and the Appalachian Mountains of Pennsylvania and West Virginia.[33]

In the late 19th century and early 20th century, fishers were virtually eliminated from the southern and eastern parts of their range including most American states and eastern Canada including Nova Scotia. Over-trapping and loss of forest habitat were the reasons for the decline.[34][35]

Most states had placed restrictions on fisher trapping by the 1930s, coincidental with the end of the logging boom. A combination of forest regrowth in abandoned farm lands and improved forest management practices increased available habitat and allowed remnant populations to recover. Populations have since recovered sufficiently that the species is no longer endangered. Increasing forest cover in eastern North America means that fisher populations will remain sufficiently robust for the near future. Between 1955 and 1985, some states had allowed limited trapping to resume. In areas where fishers were eliminated, porcupine populations subsequently increased. Areas with a high density of porcupines were found to have extensive damage to timber crops. In these cases, fishers were reintroduced by releasing adults relocated from other places into the forest. Once the fisher populations became reestablished, porcupine numbers returned to natural levels.[36]

Scattered fisher populations now exist in the Pacific Northwest. In 1961 fishers from British Columbia and Minnesota were re-introduced in Oregon to the southern Cascades near Klamath Falls and also to the Wallowa Mountains near La Grande. From 1977-1980 fishers were introduced to the region around Crater Lake.[37] In January 2008, fishers were reintroduced into the Olympic National Park in Washington State.[38] From 2008 to 2011, about 40 fishers were re-introduced in the northern Sierra Nevada near Stirling City, complementing fisher populations in Yosemite National Park and along California's northern boundary between the Pacific Coast Ranges and the Klamath Mountains.[39] Fishers are a protected species in Oregon, Washington, and Wyoming. In Idaho and California, fishers are protected through a closed trapping season, but they are not afforded any specific protection;[40] however, it is expected that in California the fisher will probably be granted listing under the Endangered Species Act in 2014.[41] In June 2011, the U.S. Fish and Wildlife Service recommended that fishers be removed from the endangered list in Idaho, Montana, and Wyoming. It also recommended further study to ensure that current populations are managed properly.[13]

Recent studies, as well as anecdotal evidence, show that fishers have begun making inroads into suburban backyards, farmland, and periurban areas in several US states and eastern Canada, as far south as most of northern Massachusetts and New York.[42][43] Some reports have even shown that populations have begun on Cape Cod, although the populations are likely smaller than the populations in the western part of New England.[44][45]

Fishers and people[edit]

Fishers have had a long history of contact with humans but most of the contact has been to the detriment of fisher populations. Unprovoked attacks on humans are extremely rare, but they will attack if they feel threatened or cornered. In one case a fisher was blamed for an attack on a six-year-old boy.[2][3] In another case, a fisher is believed to be responsible for an attack on a twelve-year old boy.[4]

In 2003, a new minor league baseball team based in Manchester, New Hampshire held a "Name The Team" contest; the name New Hampshire Fisher Cats was chosen by the public from a list of suggestions reflecting the local culture and environment.[46]

Fur trade and conservation[edit]

Fisher pelts sold: 1920–1984[47][48]

Fishers have been trapped since the 18th century. They have been popular with trappers due to the value of their fur. Their fur has been used for scarfs and neck pieces. The best pelts are from winter trapping with secondary quality pelts from spring trapping. The lowest-quality furs come from out of season trapping when fishers are moulting. They are easily trapped, and the value of their fur was a particular incentive for catching this species.[49]

Prices for pelts have varied considerably over the past 100 years. They were highest in the 1920s and 1930s, when average prices were about $100 US.[50] In 1936, pelts were being offered for sale in New York City for $450–750 per pelt.[51] Prices declined through the 1960s but picked up again in the late 1970s. In 1979, the Hudson's Bay Company paid $410 for one female pelt.[51] In 1999, 16,638 pelts were sold in Canada for $449,307 (CAN) at an average price of $27.[52]

Between 1900 and 1940, fishers were threatened with near-extinction in the southern part of their range due to overtrapping and alterations to their habitat. In New England, fishers, along with most other furbearers, were nearly exterminated due to unregulated trapping. Fishers became extirpated in many northern U.S. states after 1930, but fishers were still abundant enough in Canada to maintain a harvest of over 3,000 fishers per year (see figure). Limited protection was afforded in the early 20th century, but it was not until 1934 that total protection was finally given to the few remaining fishers. Closed seasons, habitat recovery, and reintroductions have restored fishers to much of their original range.[5]

Trapping resumed in the U.S. after 1962 once numbers had recovered to sufficient numbers. During the early 1970s, the value of fisher pelts soared, leading to another population crash in 1976. After a couple of years of closed seasons, fisher trapping re-opened in 1979 with a shortened season and restricted bag limits. The population has steadily increased since then, with steadily increasing numbers of trapped animals, despite a much lower pelt value.[47]

Captivity[edit]

Fisher fur pelt (dyed)

Fishers have been captured live for fur farming, zoo specimens, and scientific research. From 1920–1946, pelt prices averaged about $137 CAN. Since pelts were relatively valuable, attempts were made to raise fishers on farms. Fur farming was popular with other species such as mink and ermine, so it was thought that the same techniques could be applied to fishers. However, farmers found it difficult to raise fishers due to their unusual reproductive cycle. In general, knowledge of delayed implantation in fishers was unknown at the time. Farmers noted that females mated in the spring but did not give birth. Due to declining pelt prices, most fisher farms closed operations by the late 1940s.[53]

Fishers have also been captured and bred by zoos, but they are not a common zoo species. Fishers are poor animals to exhibit because, in general, they hide from visitors all day. Some zoos have had difficulty keeping fishers alive since they are susceptible to many diseases in captivity.[54] Yet there is at least one example of a fisher kept in captivity that lived to be ten years old, well beyond its natural lifespan.[55]

In 1974, R.A. Powell raised two fisher kits for the purpose of performing scientific research. His primary interest was an attempt to measure the activity of fishers in order to determine how much food the animals required to function. He did this by running them through treadmill exercises that simulated activity in the wild. He compared this to their food intake and used the data to estimate daily food requirements. The research lasted for two years. After one year, one of the fishers died due to unknown causes. The second was released back into the wilderness of Michigan's Upper Peninsula.[56]

Interactions with domestic animals[edit]

Fisher raiding a farmer's duck coop

In some areas, fishers can become pests to farmers when they raid chicken coops. There have been a few instances of fishers preying on cats and small dogs;[57][58][59][60][61][62] but in general, the evidence suggests these attacks are rare. A 1979 study examined the stomach contents of all fishers trapped in the state of New Hampshire; cat hairs were found in only 1 of over 1,000 stomachs.[63] More recent studies in suburban upstate New York and Massachusetts found no cat remains in 24 and 226 fisher diet samples (scat and stomach contents) respectively.[64] While there is popular belief for more frequent attacks on pets, zoologists suggest bobcats or coyote are more likely to prey upon domestic cats and chickens. In 2012, a UC Davis study showed that the fisher population was falling victim to rat poison, commonly used on marijuana farms in northern California.[65]

Literature[edit]

One of the first mentions of fishers in literature occurred in The Audubon Book of True Nature Stories. Robert Snyder relates a tale of his encounter with fishers in the woods of the Adirondack Mountains of New York. He recounts three sightings, including one where he witnessed a fisher attacking a porcupine.[66]

In Winter of the Fisher, Cameron Langford relates a fictional encounter between a fisher and an aging recluse living in the forest. The recluse frees the fisher from a trap and nurses it back to health. The fisher tolerates the attention, but being a wild animal, returns to the forest when well enough. Langford uses the ecology and known habits of the fisher to weave a tale of survival and tolerance in the northern woods of Canada.[67]

Fishers are mentioned in several other books including The Blood Jaguar (an animal shaman), Ereth's Birthday (a porcupine hunter) and in The Sign of the Beaver where a fisher is thought to have been caught in a trap.[68][69][70]

Notes[edit]

  1. ^ Reid, F. & Helgen, K. (2008). Martes pennanti. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ a b "Fisher cat attacks boy". Westerly Sun. 
  3. ^ a b "Fisher Cat Attacks Child at Bus Stop". FOX News, Providence, RI. 2009-06-23. 
  4. ^ a b "Family says boy, 12, attacked by fisher cat". WCVB News. Jul 1, 2014. Retrieved July 1, 2014. 
  5. ^ a b c d e Powell, R.A. (1981). Mammalian Species: Martes pennanti (PDF). The American Society of Mammologists. pp. 156:1–6. Retrieved 2011-10-21. 
  6. ^ "Fort Resolution Chipewyan Dictionary" (PDF). 22 January 2011. p. 40. Retrieved 21 December 2012. 
  7. ^ Poser, William J. (1998). Nak'albun/Dzinghubun Whut'enne Bughuni (Stuart/Trembleur Lake Carrier Lexicon), 2nd edition. Vanderhoof, BC: Yinka Dene Language Institute. 
  8. ^ Coues, p. 66.
  9. ^ Powell, pp. 11–12.
  10. ^ Powell, p. 12.
  11. ^ Powell, p. 14.
  12. ^ "Martes pennanti: Fisher". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 2010-04-28. 
  13. ^ a b "Fisher". 2011. 
  14. ^ Powell, p. 3.
  15. ^ Powell, pp. 4–6.
  16. ^ a b Powell, p. 9.
  17. ^ Fergus, p. 101.
  18. ^ Fergus, p. 102.
  19. ^ "Ecological Characteristics of Fishers in the Southern Oregon Cascade Range" (PDF). USDA Forest Service – Pacific Northwest Research Station 2006. 
  20. ^ Vashon, Jennifer; Vashon, Adam; Crowley, Shannon. "Partnership for Lynx Conservation in Main December 2001 – December 2002 Field Report" (PDF). Maine Department of Inland Fisheries and Wildlife. p. 9. 
  21. ^ Richardson, John (17 March 2010). "Researchers collect data to track health of, threats to Canada lynx". The Portland Press Herald (Pressherald.com). Retrieved 20 December 2012. 
  22. ^ Doyle, Brian (2006-03-06). "Fishering". High Country News. Retrieved 2010-04-28. 
  23. ^ Coulter, M.W. (1966). Ecology and management of fishers in Maine. (Ph.D. thesis). Syracuse, N.Y.: St. Univ. Coll. Forest. Syracuse University. 
  24. ^ Powell, pp. 134–6.
  25. ^ Burt, Henry W. (1976) A Field Guide to the Mammals. Boston, p. 55. ISBN 0-395-24084-0.
  26. ^ a b c Feldhamer, pp. 638–9.
  27. ^ a b Feldhamer, p. 641.
  28. ^ Powell, p. 88.
  29. ^ Powell, p. 92.
  30. ^ "Fisher Martes pennanti". Defenders of Wildlife. Retrieved 2010-04-28. 
  31. ^ "Martes pennanti: North American range map". Discover Life. Retrieved 2010-04-28. 
  32. ^ Powell, p. 93.
  33. ^ Feldhamer, p. 636.
  34. ^ Powell, p. 77.
  35. ^ Hardisky, Thomas, ed. (July 2001). "Pennsylvania Fisher Reintroduction Project" (PDF). Pennsylvania Game Commission, Bureau of Wildlife Management. Retrieved 20 December 2012. 
  36. ^ Powell, pp. 77–80.
  37. ^ Keith B. Aubry, Jeffrey C. Lewis (November 2003). "Extirpation and reintroduction of fishers (Martes pennanti) in Oregon: implications for their conservation in the Pacific states". Biological Conservation: 79–90. doi:10.1016/S0006-3207(03)00003-X. Retrieved 2012-01-02. 
  38. ^ Mapes, Lynda V (2008-01-28). "Weasel-like fisher back in state after many decades". Seattle Times. Retrieved 2010-04-28. 
  39. ^ Peter Fimrite (2011-12-09). "Fishers returned to area in Sierra after 100 years". San Francisco Chronicle. Retrieved 2012-01-02. 
  40. ^ Zielinski, William J.; Kucera, Thomas E. (1998). American Marten, Fisher, Lynx, and Wolverine: Survey Methods for Their Detection. DIANE Publishing Company. ISBN 978-0-7881-3628-3. Retrieved 2011-10-21. 
  41. ^ "Pacific Fisher Mammal Research," [1] accessed 2013-02-22.
  42. ^ Zezima, Katie (2008-06-10). "A Fierce Predator Makes a Home in the Suburbs". New York Times. Retrieved 2010-04-28. 
  43. ^ LaPoint S, Gallery P, Wikelski M, Kays R (2013) Animal behavior, cost-based corridor models, and real corridors. Landscape Ecology 28:1615-1630
  44. ^ Davis, Chase (November 13, 2005). "Elusive fisher cats returning to Cape". Retrieved 2014-03-06. 
  45. ^ Brennan, George (April 3, 2008). "Rare Cape fisher caught on camera". Retrieved 2014-03-06. 
  46. ^ "'Fisher Cats' Chosen For Baseball Team Name". 2003-12-03. Retrieved 2011-10-22. [dead link]
  47. ^ a b Milan Novak, ed. (1987). Furbearer harvests in North America, 1600–1984. Ontario Trappers Association. 
  48. ^ "Bank of Canada inflation calculator". Bank of Canada. Retrieved 2012-11-21. 
  49. ^ Hodgson, pp. 17–18.
  50. ^ Powell, Roger A. Martes pennanti. The American Society of Mammalogists. May 8, 1981.
  51. ^ a b Hodgson, pp. 97–98.
  52. ^ Statistics Canada. Agriculture Division (2008). Fur Statistics (Report).
  53. ^ Hodgson, pp. 4–5.
  54. ^ Powell, pp. 207–8.
  55. ^ New York Zoological Society (1971). Bronx Zoo (Report).
  56. ^ Powell, pp. xi–xv.
  57. ^ "Weasel-like fishers rebound; backyard pets become prey". San Diego Union-Tribune. 2008-06-12. Retrieved 2010-04-28. 
  58. ^ "Fisher: The fisher is a North American marten, a medium sized mustelid". Science Daily. Retrieved 2010-04-28. 
  59. ^ "What is a Fisher Cat?". WPRI.com. 2009-06-23. Retrieved 2010-04-28. 
  60. ^ "Fisher [sic] in Massachusetts". Massachusetts Division of Fisheries and Wildlife. Retrieved 2010-04-28. 
  61. ^ O'Brian, Brian (2005-08-25). "On the wild side: Once nearly extinct, weasel-like fishers thrive in the suburbs, where their ravenous feeding habits threaten family pets". Boston Globe. Retrieved 2010-04-28. 
  62. ^ Fahim, Kareem (2007-07-04). "A Cat Fight? Sort of, only louder and uglier". New York Times. Retrieved 2010-04-28. 
  63. ^ Orff, Eric B. "The Fisher: New Hampshire's Rodney Dangerfield". New Hampshire Fish and Wildlife News. Retrieved 2010-04-28. 
  64. ^ Kays, Roland. April 6, 2011. Do fishers really eat cats. New York Times http://scientistatwork.blogs.nytimes.com/2011/04/06/do-fishers-really-eat-cats/?_php=true&_type=blogs&_r=0
  65. ^ "Pot Growers' Use of Rat Poison Killing Rare Carnivores". Retrieved 2012-07-19. 
  66. ^ Snyder, Robert G. (1958). Terres JK, ed. The Audubon Book of True Nature Stories. Thomas Y. Crowell Company, New York. pp. 205–9. 
  67. ^ Langford, Cameron (1971). Winter of the Fisher. Macmillan of Canada Company, Toronto, Ontario. ISBN 0708929370. 
  68. ^ Payne, Michael H. (1998). The Blood Jaguar. Tor, New York. ISBN 0312867832. 
  69. ^ Avi (2000). Ereth's Birthday. HarperCollins, New York. ISBN 0380804905. 
  70. ^ Speare, Elizabeth George (1983). The Sign of the Beaver. Bantam Doubleday Dell Books for Young Readers, New York. ISBN 0547348703. 

References[edit]

Further reading[edit]

  • Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A. (1994). Martens, sables, and fishers: biology and conservation. Comstock Publishing Associates. ISBN 978-0-8014-2894-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Martes pennanti (Erxleben) is the scientific name of the fisher, a member
of the Mustelidae family [19,132].

Although not typically distinguished [19,132], 3
subspecies were described by Hall [58]:

Martes pennanti columbiana Goldman

Martes pennanti pacifica (Rhoads)

Martes pennanti pennanti (Erxleben)
  • 19. Baker, Robert J.; Bradley, Lisa C.; Bradley, Robert D.; Dragoo, Jerry W.; Engstrom, Mark D.; Hoffmann, Robert S.; Jones, Cheri A.; Reid, Fiona; Rice, Dale W.; Jones, Clyde. 2003. Revised checklist of North American mammals north of Mexico, 2003. Occasional Papers No. 229. Lubbock, TX: Museum of Texas Tech University. 23 p. [50946]
  • 58. Hall, E. Raymond. 1981. Martes pennanti: Fisher. In: The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley & Sons: 985-987. [54713]
  • 132. Wilson, Don E.; Reeder, DeeAnn M., eds. 1993. Mammal species of the world: a taxonomic and geographic reference. 2nd ed. Washington, DC: Smithsonian Institution Press. 1206 p. [52580]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

fisher

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!