Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

American Martens are widely distributed in northern forests across Canada and into Alaska. Only 200 years ago, they were also abundant in the southeastern United States. Smaller than the Fisher and larger than the Ermine, Martens are omnivores, including insects, fruits, and seeds as well as birds and small-to-medium-sized mammals in their diet. Martens most frequently hunt on the ground, but they are capable climbers, and will pursue Red Squirrels in trees. Martens are solitary and territorial.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Turton, W., 1806.  A general system of nature, through the three grand kingdoms of animals, vegetables, and minerals.  Lackington and Allen.  London, 1:60.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

American martens occur accross most of North America from Alaska through much of forested Canada, into the northeastern United States, and south along northern California, south in the Sierra Nevada and Rocky Mountains.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

American martens, Martes_americana, are found in the northern parts of North America. Martens are found from Newfoundland and Nova Scotia to Alaska. They are found sporadically in parts of California and in northern states, although loss of forests in these areas have reduced populations of martens since Colonial times.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

American martens, Martes americana, are found in the northern reaches of North America. The species is present from Newfoundland and Nova Scotia west to Alaska and south into sections of the rocky mountain range and California. Martens are found sporadically in parts of New York state, Michigan, Minnesota, Maine, and Wisconsin. Although populations were greater in the southeastern portion of the species range in Colonial times, loss of forest habitat in these areas has restricted their range. Programs for reintroduction of these animals in Minnesota and Ontario may help populations to recover.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species occurs throughout most of Canada and Alaska, and its range extends southward through the Great Lakes region and northern New England; most marten populations in the western contiguous United States and southwestern Canada are now included in Martes caurina; Alaska, British Columbia, Idaho, and Montana have both species (Dawson and Cook 2012). See map in Clark et al. (1987) for comparison of present and historical range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Morphology

Physical Description

American martens measure 320 to 450 mm, with the tail adding 135 to 230 mm more. These animals weigh between 280 and 1,300 g. Females are slightly smaller and lighter than males.

A marten's fur is long and shiny. The head is gray, legs and tail are very dark brown or black, the chest has a cream colored patch, and the back is light brown.

American martens are long, slender animals. The eyes are large, the ears are cat-like, and the claws are sharp and curved.

Range mass: 280 to 1,300 g.

Range length: 320 to 450 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 3.579 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Male American martens measure 360 to 450 mm, with the tail adding 150 to 230 mm more. Weights of males range between 470 and 1,300 g. Females are slightly smaller and lighter, with head-body lengths between 320 and 400 mm, and tails measuring 135 to 200 mm. Females weigh betweeen 280 and 850 g.

The fur is long and shiny. The head is gray, legs and tail are very dark brown or black, the chest has a cream colored patch, and the back is light brown.

American martens are long, slender animals. Eyes are large and ears are cat-like. Claws are sharp and curved.

Range mass: 280 to 1,300 g.

Range length: 320 to 450 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 3.579 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 68 cm

Weight: 1568 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Length:
Range: 560-680 mm males; 500-600 mm females

Weight:
Range: 470-1,250 g males; 280-850 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: This species usually occurs in dense deciduous, mixed, or (especially) coniferous upland and lowland forest. In Newfoundland, it prefers undisturbed mature coniferous or mixed forest. When inactive, martens occupy holes in dead or live trees or stumps, abandoned squirrel nests, conifer crowns, rock piles, burrows, snow cavities, etc.; they use mainly subnivean sites, often associated with coarse woody debris, in winter. Young are born in a den, usually in a hollow tree, sometimes in rock den.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species is typically associated with late-seral coniferous forests characterized by closed canopies, large trees, and
abundant standing and down woody material (Buskirk and Powell, 1994; Thompson and Harestad, 1994). It dens in hollow trees or logs, in rocky crevices, or in burrows. The marten is primarly nocturnal and partly arboreal but spends considerable time on the ground. The diet consists mostly of rodents and other small mammals and also includes birds, insects, fruit and carrion (Nowak, 2005). Average home size throughout North America is 8.1 km2 for males and 2.3 km2 for females, and degree of overlap varies (Powell, 1994).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American martens are found primarily in mature, northern forests dominated by pines, firs, spruce, birch, and aspen. They like mature forests, which can provide hollow trees, crevices, or vacant ground burrows in which they can make their homes.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: Climate

More info for the terms: cover, presence, shrub

In general, American marten inhabit areas with northern, continental climates receiving low mean annual temperatures and substantial winter snow, like the climate of Maine [129], Wyoming [39], or Ontario. Average minimum temperature in Ontario in January is -13 °F (-25 °C); average maximum temperature in July is 77 °F (25 °C). Snow accumulates to 30 to 35 inches (75-90 cm) from early November to about March, melting by mid-May [171]. American marten also inhabit areas with maritime climates that experience heavy rainfall and sporadic snowfall, including Chichagof Island, southeastern Alaska [9], coastal northwestern California [154], and the Queen Charlotte Islands, British Columbia [118]. Transition zones between maritime and continental climate occur at the Kenai National Wildlife Refuge in south-central Alaska [148].

Weather may impact American marten activity, resting site use, and prey availability. One review notes that individuals may become inactive during storms or extreme cold [165]. In Yosemite National Park, American marten were generally inactive during "severe" storms [74]. In interior Alaska, a decrease in above-the-snow activity occurred when ambient temperatures fell below -4 °F (-20 °C) [178]. In southeastern Wyoming, temperature influenced resting site location. Above-snow sites were used during the warmest weather, while subnivean sites were used during the coldest weather [25,182], particularly when temperatures were low and winds were high following storms [182]. High mortality may occur if American marten become wet in cold weather, as when unusual winter rains occur during live trapping (review by [38]). In southeastern Wyoming, temperature was linked to resting site use; above-snow sites were used during the warmest weather, while subnivean sites were used during the coldest weather (P=0.007) [25]. In Yosemite National Park, drought conditions increased the diversity of prey items; American marten consumed fish and small mammal species made more accessible by low snow conditions in a drought year [74].

Importance of snow: Snow is an important habitat feature in many parts of the range of the American marten, providing thermal protection [8,148] and opportunities for foraging and resting [30,37,45,76]. American marten may travel extensively under the snowpack. Subnivean travel routes of >98 feet (30 m) were documented in northeastern Oregon [168], >33 feet (10 m) on the Upper Peninsula of Michigan [168], and up to 66 feet (20 m) in Wyoming [76].

American marten are well adapted to snow. On the Kenai Peninsula, individuals navigated through deep snow regardless of depth, with tracks rarely sinking >2 inches (5 cm) into the snowpack [8]. Researchers on the Kenai Peninsula suggested that snowfall pattern was the most limiting factor to American marten distribution, with American marten presence linked to areas with deep snow [8,148].

Adaptations to deep snow are particularly important in areas where the American marten is sympatric with the fisher, which may compete with and/or prey on American marten. In southeastern Manitoba, one study reported that American marten were less hindered by soft snow cover than fishers [139,141]. In California, American marten were closely associated with areas of deep snow (>9 inches (23 cm)/winter month), while fishers were more associated with shallow snow (<5 inches (13 cm)/winter month). Overlap zones were areas with intermediate snow levels [99]. In Maine, American marten were only common in northern parts of the state, which had frequent, deep snowfalls. They were not common in southern Maine, where snowfall was less and fishers were more abundant. Age and recruitment ratios suggested that there were few reproductive American marten where snow was shallow and few reproductive fishers where snow was deep [98].

Where deep snow accumulates, American marten prefer cover types that prevent snow from packing hard and have structures near the ground that provide access to subnivean sites (review by [27]). While American marten select habitats with deep snow, they may concentrate activity in patches with relatively shallow snow. In north-central Idaho, American marten activity was highest in areas where snow depths were <12 inches (30 cm); the authors suggested that shallow snow allowed for easier burrowing for food and more shrub and log cover [94,96]. In southeastern Ontario, winter snow tracks indicated that activity was concentrated in conifer forests, where snow was shallower relative to other sites and red-backed voles were most abundant [58].

  • 8. Baltensperger, Andrew P. 2009. Behavior and distribution of American marten (Martes americana) in relation to snow and forest cover on the Kenai Peninsula, Alaska. Fort Collins, CO: Colorado State University. 69 p. Thesis. [76964]
  • 9. Ben-David, Merav. 1996. Seasonal diets of mink and martens: Effects of spatial and temporal changes in resource abundance. Fairbanks, AK: University of Alaska Fairbanks. 207 p. Dissertation. [76902]
  • 27. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 30. Campbell, Thomas M., III. 1979. Short term effects of timber harvest on pine marten ecology. Fort Collins, CO: Colorado State University. 71 p. Thesis. [76941]
  • 37. Clark, T. W.; Campbell, T. M.; Hauptman, T. N.; Weaver, J. L. 1980. Habitat ecology of the pine marten in Jackson Hole, Wyoming. In: Clark, Tim W. Population organizational systems and regulatory mechanisms of a forest carnivore (pine martens) in Grand Teton National Park. Final report: Contract No. CX-1200-8-B026. Pocatello, ID: Idaho State University, Biology Department: 2-9. [76987]
  • 38. Clark, Tim W.; Anderson, Elaine; Douglas, Carman; Strickland, Marjorie. 1987. Martes americana. Mammalian Species. 289: 1-8. [76016]
  • 39. Clark, Tim W.; Campbell, Thomas M., III; Hauptman, Tedd N. 1989. Demographic characteristics of American marten populations in Jackson Hole, Wyoming. Great Basin Naturalist. 49: 587-596. [76033]
  • 45. Corn, Janelle G.; Raphael, Martin G. 1992. Habitat characteristics at marten subnivean access sites. The Journal of Wildlife Management. 56(3): 442-448. [76075]
  • 74. Hargis, Christina Devin. 1981. Winter habitat utilization and food habits of the pine marten (Martes americana) in Yosemite National Park. Berkeley, CA: University of California. 57 p. Thesis. [76916]
  • 76. Hauptman, Tedd N. 1979. Spatial and temporal distribution and feeding ecology of the pine marten. Pocatello, ID: Idaho State University. 84 p. Thesis. [76933]
  • 94. Koehler, Gary M. 1975. The effects of fire on marten distribution and abundance in the Selway-Bitterroot Wilderness. Moscow, ID: University of Idaho. 26 p. Thesis. [76942]
  • 98. Krohn, William B.; Elowe, Kenneth D.; Boone, Randall B. 1995. Relations among fishers, snow, and martens: development and evaluation of two hypotheses. Forestry Chronicle. 71(1): 97-105. [26732]
  • 99. Krohn, William B.; Zielinski, William J., Boone, Randall B. 1997. Relations among fishers, snow, and martens in California: results from small-scale spatial comparisons. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 211-232. [65898]
  • 118. Nagorsen, David W.; Campbell, R. Wayne; Giannico, Guillermo R. 1991. Winter food habits of marten, Martes americana, on the Queen Charlotte Islands. The Canadian Field-Naturalist. 105(1): 55-59. [76496]
  • 129. Phillips, David M.; Harrison, Daniel J.; Payer, David C. 1998. Seasonal changes in home-range area and fidelity of martens. Journal of Mammalogy. 79(1): 180-190. [76038]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 141. Raine, R. Michael. 1983. Winter habitat use and responses to snow cover of fisher (Martes pennanti) and marten (Martes americana) in southeastern Manitoba. Canadian Journal of Zoology. 61(1): 25-34. [64009]
  • 148. Schumacher, Thomas V.; Bailey, Theodore N.; Portner, Mary F.; Bangs, Edward E.; Larned, William W. 1989. Marten ecology and distribution on the Kenai National Wildlife Refuge, Alaska. Draft manuscript. Soldotna, AK: U.S. Fish and Wildlife Service, Kenai National Wildlife Refuge. 67 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab, Missoula, MT; FEIS files. [78733]
  • 154. Slauson, Keith M.; Zielinski, William J. 2009. Characteristics of summer and fall diurnal resting habitat used by American martens in coastal northwestern California. Northwest Science. 83(1): 35. [76044]
  • 165. Strickland, Marjorie A.; Douglas, Carman W. 1987. Marten. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 531-546. [50679]
  • 168. Thomasma, Linda Ebel. 1996. Winter habitat selection and interspecific interactions of American martens (Martes americana) and fishers (Martes pennanti) in the McCormick Wilderness and surrounding area. Houghton, MI: Michigan Technological University. 116 p. Dissertation. [76871]
  • 25. Buskirk, Steven W.; Forrest, Steven C.; Raphael, Martin G.; Harlow, Henry J. 1989. Winter resting site ecology of marten in the central Rocky Mountains. The Journal of Wildlife Management. 53(1): 191-196. [6896]
  • 96. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. The Journal of Wildlife Management. 41(3): 500-505. [7637]
  • 171. Thompson, Ian D.; Colgan, Patrick W. 1987. Numerical responses of martens to a food shortage in northcentral Ontario. The Journal of Wildlife Management. 51(4): 824-835. [76040]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 182. Wilbert, Connie J. 1992. Spatial scale and seasonality of habitat selection by American martens in southeastern Wyoming. Laramie, WY: University of Wyoming. 91 p. Thesis. [77043]
  • 58. Francis, George Reid. 1958. Ecological studies of marten, Martes americana, in Algonquin Park, Ontario. Vancouver, BC: University of British Columbia. 74 p. [+ appendices]. Thesis. [76922]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: Predation and/or competition

More info for the terms: avoidance, competition, selection

Potential predation by or competition with sympatric fishers may influence American marten habitat selection or use ([98,99,139,168], review by [28]). See Importance of snow for more information on this topic. Some authors suggest that the threat of predation may be an important factor shaping American marten habitat preferences, a hypothesis inferred from their avoidance of open areas and from behavioral observations of the Eurasian pine marten (review by [28]).
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 98. Krohn, William B.; Elowe, Kenneth D.; Boone, Randall B. 1995. Relations among fishers, snow, and martens: development and evaluation of two hypotheses. Forestry Chronicle. 71(1): 97-105. [26732]
  • 99. Krohn, William B.; Zielinski, William J., Boone, Randall B. 1997. Relations among fishers, snow, and martens in California: results from small-scale spatial comparisons. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 211-232. [65898]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 168. Thomasma, Linda Ebel. 1996. Winter habitat selection and interspecific interactions of American martens (Martes americana) and fishers (Martes pennanti) in the McCormick Wilderness and surrounding area. Houghton, MI: Michigan Technological University. 116 p. Dissertation. [76871]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: Prey dynamics

More info for the term: cover

Though some sources relate American marten habitat preference to the habitat preferences of prey species, it is not clear whether American marten prefer habitats occupied by prey that is easy to catch or if the habitat contains physical structures that render prey more vulnerable. American marten do not consistently select habitat where prey is more abundant (review by [27]), though higher prey numbers and American marten habitat use have been linked in studies from Maine [61], Ontario [58,62,169], Manitoba [139,141], Wyoming [40,149], Montana [23,44], Idaho [110,176], Northwest Territories [49], and British Columbia [106]. In some areas, American marten use of what would seem to be unsuitable habitat (e.g., early-seral [106], open, or burned [94,96] cover types) was explained by regionally or seasonally abundant prey items in these cover types.
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 27. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 40. Clark, Tim W.; Campbell, Tom M. 1979. Population organization and regulatory mechanisms of pine martens in Grand Teton National Park, Wyoming. In: Linn, Robert M., ed. Proceedings, 1st conference on scientific research in the National Parks: Vol. 2; 1976 November 9-12; New Orleans, LA. Transactions and Proceedings No. 5. Washington, DC: U.S. Department of the Interior, National Park Service: 293-295. [76021]
  • 44. Coffin, Kenneth Wesley; Kujala, Quentin J.; Douglass, Richard J.; Irby, Lynn R. 1995. Interactions among marten prey availability, vulnerability, and habitat structure. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 199-210. [76955]
  • 49. Douglass, Richard J.; Fisher, Lorne G.; Mair, Marnie. 1983. Habitat selection and food habits of marten, Martes americana, in the Northwest Territories. The Canadian Field-Naturalist. 97(1): 71-74. [76116]
  • 61. Fuller, Angela K.; Harrison, Daniel J. 2005. Influence of partial timber harvesting on American martens in north-central Maine. The Journal of Wildlife Management. 69(2): 710-722. [76064]
  • 62. Gelok, Paul A. 2005. Seasonal habitat associations of American martens ( Martes americana) in central Ontario. Toronto, ON: University of Toronto. 109 p. Thesis. [76891]
  • 94. Koehler, Gary M. 1975. The effects of fire on marten distribution and abundance in the Selway-Bitterroot Wilderness. Moscow, ID: University of Idaho. 26 p. Thesis. [76942]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 141. Raine, R. Michael. 1983. Winter habitat use and responses to snow cover of fisher (Martes pennanti) and marten (Martes americana) in southeastern Manitoba. Canadian Journal of Zoology. 61(1): 25-34. [64009]
  • 149. Sherburne, Stuart Scott. 1992. Marten use of subnivean access points in Yellowstone National Park, Wyoming. Logan, UT: Utah State University. 37 p. Thesis. [77498]
  • 169. Thompson, Ian D. 1986. Diet choice, hunting behaviour, activity patterns, and ecological energetics of marten in natural and logged areas. Kingston, ON: Queen's University at Kingston. 181 p. Dissertation. [76913]
  • 176. Tomson, Scott Dean. 1998. Ecology and summer/fall habitat selection of American marten in northern Idaho. Missoula, MT: University of Montana. 75 p. Thesis. [76921]
  • 96. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. The Journal of Wildlife Management. 41(3): 500-505. [7637]
  • 58. Francis, George Reid. 1958. Ecological studies of marten, Martes americana, in Algonquin Park, Ontario. Vancouver, BC: University of British Columbia. 74 p. [+ appendices]. Thesis. [76922]
  • 110. Marshall, William H. 1942. The biology and management of the pine marten in Idaho. Ann Arbor, MI: University of Michigan. 107 p. [+ appendices]. Dissertation. [76923]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Foraging

More info for the terms: association, cover, tree, xeric

American marten foraging is often associated with woody debris [1,23,30,45,76,133,139,148,149,178], clumps of small trees [45,76,110,139], or the bases of large trees [139,148], because these structure often offer subnivean access [1,23,30,45,76,139,142,148,149,178] or are preferred microhabitats of favored prey species [1,40,110,149]. Subnivean hunting may be more common than surface hunting in winter [30,37,76]. In Grand Teton National Park, evidence of successful above-snow hunting was limited to one observation; 77% of 75 foraging investigations involved American marten descending to subnivean levels, with access typically gained via a cavity in a the snow formed below a partially fallen tree [37].

In southeastern Manitoba, foraging individuals often stopped or circled the roots of fallen trees, logs, coverts of young conifers, or the snow-laden branches of larger trees. American marten stopped 2.2 times/km, dug holes in the snow cover 1.0 time/km, and climbed 1 tree/10 km of trail while foraging [139,142]. In Wyoming, prey were frequently captured in association with large (diameter >15 inches (38 cm)) dead, fallen trees protruding out of the snow. American marten would follow downed trees below the snow's surface to extensive snow-free galleries formed by snow-covered vegetation and fallen trees near ground level [40].

In western Montana, American marten traveled a zigzag course that covered all down logs and windfalls in a large area and ultimately covered "every inch of an area one-tenth to one-fifth acre in size." In areas without downed logs, such as small openings and brushy swamps, individuals tunneled and dug through the snow every few inches [77]. In northeastern California, foraging American marten followed well-traveled routes that appeared to be nonrandom. Their travel pattern while hunting was a weaving or zigzag pattern that investigated all structures (e.g., logs, stumps, tree bases) within a given area [152]. In Grand Teton National Park, most investigation sites (83%) were below the snow surface, and 75% of the investigations were in areas that had >25% canopy cover. Subnivean investigations were usually under forest cover (89% of observations), with the rest occurring in an ecotone between forest and meadow. Entry below the snow surface was usually via a cavity in the snow formed by a fallen tree or sapling. Most sites (88.4%) were associated with fallen trees or saplings, and movement under the snow appeared to be within a network of fallen trees [76].

Several studies report that American marten prefer to hunt in areas with canopy cover and avoid hunting in open areas lacking cover [30,53,73,74,86,94,96,152,159]. In the northern Sierra Nevada, American marten preferred stands with 40% to 60% canopy closure at foraging sites and avoided stands with <30% canopy closure [159]. In Grand Teton National Park, mean canopy cover at foraging sites was 28.9%, with 75% of foraging investigations in areas that had >25% canopy cover [76]. Foraging in open areas has been documented in some areas. In western Montana, American marten hunted in small grassy openings within the forest [181]. In southeastern Manitoba, American marten sometimes hunted in moderately open black spruce-tamarack bogs up to 650 feet (200 m) wide in winter [139,142]. American marten use of open areas is often associated with a specific food resource or with adequate cover nearby. Vernam [178] suggested that American marten may use open areas regenerating after fire to forage on abundant summer berry crops. In northeastern California, logged areas were avoided in winter but used for foraging in summer if they were adjacent to dense stands of intact forest, contained slash, and had some canopy cover [152]. In logged areas in northern Maine, hunting activity was associated with uncut and partially cut stands and not with regenerating clearcuts [162].

Several studies suggest that American marten forage in edge habitat between forested and open areas [29,76,77,86,152,159,181]. In Montana, American marten foraged along edges between regenerating and mature lodgepole pine forest [77] and between large grassy meadows and forest [181]. In Grand Teton National Park, 11% of subnivean foraging investigations occurred in an ecotone between forest and meadow [76]. In southern British Columbia, American marten activity was concentrated in forests adjacent to openings creating by logging [86]. In south-central Alaska, American marten foraged in black spruce woodlands, particularly where this cover type interfaced with other forest types and sedge (Carex spp.) meadows [29]. In the northern Sierra Nevada, American marten hunted primarily beneath dense forest canopy near meadow edges or in riparian lodgepole pine forests with lush herbaceous cover [159].

Not all reports indicate that edges provide suitable foraging habitat for American marten. Winter travel patterns of foraging American marten in Idaho and Wyoming were more linear along edges between intact forest and clearcuts than in the forest interior, suggesting that edge habitat did not provide suitable foraging opportunities in the study areas [81].

Other features associated with American marten foraging include riparian areas [23,86,152,159,178], squirrel middens [149,159], and garbage dumps [152]. American marten in central British Columbia avoided wetlands and cover types that were xeric or in young seral stages while foraging in winter [106].

  • 1. Andruskiw, Mark; Fryxell, John M.; Thompson, Ian D.; Baker, James A. 2008. Habitat-mediated variation in predation risk by the American marten. Ecology. 89(8): 2273-2280. [76045]
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 29. Buskirk, Steven William. 1983. The ecology of marten in southcentral Alaska. Fairbanks, AK: University of Alaska. 142 p. Dissertation. [76929]
  • 30. Campbell, Thomas M., III. 1979. Short term effects of timber harvest on pine marten ecology. Fort Collins, CO: Colorado State University. 71 p. Thesis. [76941]
  • 37. Clark, T. W.; Campbell, T. M.; Hauptman, T. N.; Weaver, J. L. 1980. Habitat ecology of the pine marten in Jackson Hole, Wyoming. In: Clark, Tim W. Population organizational systems and regulatory mechanisms of a forest carnivore (pine martens) in Grand Teton National Park. Final report: Contract No. CX-1200-8-B026. Pocatello, ID: Idaho State University, Biology Department: 2-9. [76987]
  • 40. Clark, Tim W.; Campbell, Tom M. 1979. Population organization and regulatory mechanisms of pine martens in Grand Teton National Park, Wyoming. In: Linn, Robert M., ed. Proceedings, 1st conference on scientific research in the National Parks: Vol. 2; 1976 November 9-12; New Orleans, LA. Transactions and Proceedings No. 5. Washington, DC: U.S. Department of the Interior, National Park Service: 293-295. [76021]
  • 45. Corn, Janelle G.; Raphael, Martin G. 1992. Habitat characteristics at marten subnivean access sites. The Journal of Wildlife Management. 56(3): 442-448. [76075]
  • 53. Fager, Craig William. 1991. Harvest dynamics and winter habitat use of the pine marten in southwestern Montana. Bozeman, MT: Montana State University. 73 p. Thesis. [76939]
  • 73. Hargis, Christina D.; McCullough, Dale R. 1984. Winter diet and habitat selection of marten in Yosemite National Park. The Journal of Wildlife Management. 48(1): 140-146. [76070]
  • 74. Hargis, Christina Devin. 1981. Winter habitat utilization and food habits of the pine marten (Martes americana) in Yosemite National Park. Berkeley, CA: University of California. 57 p. Thesis. [76916]
  • 76. Hauptman, Tedd N. 1979. Spatial and temporal distribution and feeding ecology of the pine marten. Pocatello, ID: Idaho State University. 84 p. Thesis. [76933]
  • 77. Hawley, Vernon D. 1955. The ecology of the marten in Glacier National Park. Missoula, MT: The University of Montana. 131 p. Thesis. [76943]
  • 81. Heinemeyer, Kimberly Sue. 2002. Translating individual movements into population patterns: American marten in fragmented forested landscapes. Santa Cruz, CA: University of California. 150 p. Dissertation. [76895]
  • 86. Huggard, David J. 1999. Marten use of different harvesting treatments in high-elevation forest at Sicamous Creek. Research Report 17. Victoria, BC: British Columbia Ministry of Forests, Research Program. 17 p. [76104]
  • 94. Koehler, Gary M. 1975. The effects of fire on marten distribution and abundance in the Selway-Bitterroot Wilderness. Moscow, ID: University of Idaho. 26 p. Thesis. [76942]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 133. Porter, Aswea Dawn. 2002. Habitat selection by American marten (Martes americana ) at the element, patch and stand scales in a young deciduous forest in northern British Columbia. Edmonton, AB: University of Alberta. 79 p. Thesis. [76894]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 142. Raine, R. Michael. 1987. Winter food habits and foraging behaviour of fishers (Martes pennanti) and martens (Martes americana) in southeastern Manitoba. Canadian Journal of Zoology. 65(3): 745-747. [76121]
  • 148. Schumacher, Thomas V.; Bailey, Theodore N.; Portner, Mary F.; Bangs, Edward E.; Larned, William W. 1989. Marten ecology and distribution on the Kenai National Wildlife Refuge, Alaska. Draft manuscript. Soldotna, AK: U.S. Fish and Wildlife Service, Kenai National Wildlife Refuge. 67 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab, Missoula, MT; FEIS files. [78733]
  • 149. Sherburne, Stuart Scott. 1992. Marten use of subnivean access points in Yellowstone National Park, Wyoming. Logan, UT: Utah State University. 37 p. Thesis. [77498]
  • 152. Simon, Terri Lee. 1980. An ecological study of the marten in the Tahoe National Forest, California. Sacramento, CA: California State University. 187 p. Thesis. [76935]
  • 159. Spencer, Wayne D.; Barrett, Reginald H.; Zielinski, William J. 1983. Marten habitat preferences in the northern Sierra Nevada. The Journal of Wildlife Management. 47(4): 1181-1186. [76083]
  • 162. Steventon, Douglas; Major, John T. 1982. Marten use of habitat in a commercially clear-cut forest. The Journal of Wildlife Management. 46(1): 175-182. [76076]
  • 96. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. The Journal of Wildlife Management. 41(3): 500-505. [7637]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 181. Weckwerth, Richard P.; Hawley, Vernon D. 1962. Marten food habits and population fluctuations in Montana. The Journal of Wildlife Management. 26(1): 55-74. [76088]
  • 110. Marshall, William H. 1942. The biology and management of the pine marten in Idaho. Ann Arbor, MI: University of Michigan. 107 p. [+ appendices]. Dissertation. [76923]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat associations: Traveling

More info for the terms: cover, density, presence, tree, xeric

American marten travel to maintain territories, forage, and find resting sites (review by [27]). Though they can climb trees, American marten travel mostly on the ground. In winter, tracks in snow follow circuitous routes covering an individual's entire home range. Travel routes stay close to areas with overhead cover, with travel interrupted by frequent investigations where coarse woody debris penetrates the snow surface and provides subnivean access (review by [28]). In northeastern California, movements were variously influenced by cover and topography (e.g., forest-meadow edges, open ridgetop, lakeshores), and negatively influenced by the presence of other American marten [152].

 

American marten in Alaska.

In southeastern Ontario in the summer, American marten often used fallen logs as runways and appeared to select a travel route that allowed the fullest use of fallen logs [58]. In western Montana, individuals often made repeated use of the same trail [77]. In southwestern Montana logging roads, snowmobile trails, paved highways, and small streams did not impede movement; at least one individual swam the Madison River [43]. In northern Idaho, hiking trails and skid roads were used as travel routes [176].

In general, American marten avoid openings while traveling. In central British Columbia most individuals avoided traveling through xeric cover types, early-seral forests, lakes, or wetlands [106]. However, American marten may use the ecotone between open areas and forests while traveling [23]. If individuals travel through an open area, they may use scattered trees as cover [73,74] or travel in a more direct pattern [8,158]. Open areas that American marten have crossed while traveling include alpine areas, 25-year-old burned areas [155], frozen aquatic areas [53,155], sparse forests [8,155], open sagebrush-grassland [53], meadows [73,74,94,96], and regenerating clearcuts [158].

Travel patterns from 3 areas of the American marten's range are described below.

On the Kenai Peninsula, American marten traveling in winter selected snow and cover types largely in proportion to type availability at the home range scale. At the forest patch scale, movement paths were more winding or twisting through dense forest types compared to open forest types (P<0.001). These movement patterns suggest that individuals were responding to the denser canopy cover, elevated levels of coarse woody debris, and higher density of red squirrel middens present in dense forest types compared to other available vegetation types. Movement patterns may also reflect more foraging opportunities because individuals stop to investigate subnivean access points near coarse woody debris. Travel routes through open or ice-covered areas were significantly more straight than travel routes in vegetated areas (P<0.001) [8].

In Yosemite National Park, winter travel routes occurred in all cover types with no detectible preferences. Topographical features did not restrict travel; streams were crossed repeatedly and rock domes were climbed, though often with the aid of scattered tree cover. Individuals traveled across meadows ≤160 feet (50 m) wide but did not rest or hunt in them. Meadows >160 feet (50 m) wide were crossed using scattered tree cover; the longest open distance crossed was 440 feet (135 m). Individuals also skirted meadows by traveling along the ecotone between meadow and lodgepole pine forest. Microhabitat structure varied between travel routes and random points; travel routes had lower branch height, greater overhead cover, and shorter distance to nearest tree than random points (P<0.01). While moving, individuals preferred areas with 100% overhead cover (P<0.01), but they did not show a preference for dense forest stands. Instead, cover was selected by using a zigzag travel pattern that moved from tree to tree; two-thirds of all travel points were <7 feet (2 m) from a tree. Travel paths were also frequently adjusted to investigate the tracks of other animals [73,74].

In heavily logged forests in western Newfoundland, 74% of American marten winter trails were in forested cover types. The other 26% of tracks were in regenerating clearcuts, even though clearcuts represented 41% of the study area. Sixteen- to 23-year-old clearcuts with balsam fir regeneration >7 feet (2 m) high were not used at all. American marten showed no preference for residual stands >60 acre (25 ha) or undisturbed forest. They demonstrated a strong preference for small residual stands (<60 acre (25 ha)); while small residual stands comprised only 4.2% of the study area, 32.4% of travel routes were in this cover type. Travel patterns varied by cover type; travel routes through clearcuts were generally in a straight line, moving from one residual stand to another. Travel routes in forested habitats often exhibited a zigzag and looped pattern. While traveling, individuals crossed openings 70 to 1,970 feet (20-600 m) wide (87% of crossings were <820 feet (250 m)), though only 21% of pauses occurred in nonforested cover types. Pauses in all cover types were often associated with trees, sticks, or slash protruding above the snowpack or with the tracks of prey species such as the snowshoe hare and red squirrel [157].

  • 8. Baltensperger, Andrew P. 2009. Behavior and distribution of American marten (Martes americana) in relation to snow and forest cover on the Kenai Peninsula, Alaska. Fort Collins, CO: Colorado State University. 69 p. Thesis. [76964]
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 27. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 43. Coffin, Kenneth Wesley. 1994. Population characteristics and winter habitat selection by pine marten in southwest Montana. Bozeman, MT: Montana State University. 94 p. Thesis. [76932]
  • 53. Fager, Craig William. 1991. Harvest dynamics and winter habitat use of the pine marten in southwestern Montana. Bozeman, MT: Montana State University. 73 p. Thesis. [76939]
  • 73. Hargis, Christina D.; McCullough, Dale R. 1984. Winter diet and habitat selection of marten in Yosemite National Park. The Journal of Wildlife Management. 48(1): 140-146. [76070]
  • 74. Hargis, Christina Devin. 1981. Winter habitat utilization and food habits of the pine marten (Martes americana) in Yosemite National Park. Berkeley, CA: University of California. 57 p. Thesis. [76916]
  • 77. Hawley, Vernon D. 1955. The ecology of the marten in Glacier National Park. Missoula, MT: The University of Montana. 131 p. Thesis. [76943]
  • 94. Koehler, Gary M. 1975. The effects of fire on marten distribution and abundance in the Selway-Bitterroot Wilderness. Moscow, ID: University of Idaho. 26 p. Thesis. [76942]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 152. Simon, Terri Lee. 1980. An ecological study of the marten in the Tahoe National Forest, California. Sacramento, CA: California State University. 187 p. Thesis. [76935]
  • 155. Slough, Brian G. 1989. Movements and habitat use by transplanted marten in the Yukon Territory. The Journal of Wildlife Management. 53(1): 991-997. [76073]
  • 157. Snyder, Joyce E.; Bissonette, John A. 1987. Marten use of clear-cuttings and residual forest stands in western Newfoundland. Canadian Journal of Zoology. 65: 169-174. [76039]
  • 158. Soutiere, Edward C. 1989. Effects of timber harvesting on marten in Maine. The Journal of Wildlife Management. 43(4): 850-860. [76074]
  • 176. Tomson, Scott Dean. 1998. Ecology and summer/fall habitat selection of American marten in northern Idaho. Missoula, MT: University of Montana. 75 p. Thesis. [76921]
  • 96. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. The Journal of Wildlife Management. 41(3): 500-505. [7637]
  • 58. Francis, George Reid. 1958. Ecological studies of marten, Martes americana, in Algonquin Park, Ontario. Vancouver, BC: University of British Columbia. 74 p. [+ appendices]. Thesis. [76922]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat associations: Resting

More info for the terms: cover, lichen, mesic, selection, shrub, shrubs, tree, wildfire

American marten select rest sites based on their potential for thermal cover, protection from predators, and subnivean access in winter (review by [28]).

Rest site structures: American marten use a variety of structures for resting, including live tree platforms [18,23,53,154,176], canopies [8,63,162,182], or cavities [18,23,53], snags [8,30,43,53,89,106,111,152,154,176], witch's broom structures resulting from dwarf mistletoe (Arceuthobium spp.) or fungal infection [18,23,30,37,125,182,187,188], red squirrel nests [23,24,43], red or Douglas's squirrel (T. douglasii) middens [8,24,53,139,143,178], logs [8,25,43,63,111,113,154,162,176,182], stumps [25,63,106,111,113,143,162], slash [18,30,53,63,89,143,152,154] or log [23,37,152] piles, tree root masses [30,37,58,63,89,106,139,143], shrubs [8,154], underground burrows [8,18,24,36,63,143,176], rock or boulder piles [25,37,43,53,58,63,143,154,176,182], roadside debris [143], and human structures [74,143]. Resting site structure varies by season, with higher use of arboreal structures in summer and groundlevel, subnivean structures in winter [18,23,36,37,63,111,162].

In northeastern Oregon, tree platforms were the most common resting site, and 77% of platforms were sheltered by 100% canopy cover. Type of resting site structure varied by tree species, with most platforms in Engelmann spruce and subalpine fir and most cavities in grand fir and western larch. Most hollow logs were also grand fir and western larch. Most (67%) of the cavity trees were dead. Rest site structure varied seasonally. In summer, most resting sites were tree platforms. In winter, most resting sites were located under the snow and were associated with horizontal structures, usually logs or slash piles. At least 75% of the subnivean resting sites had evidence of red squirrel middens. Use of cavities as resting sites peaked in April and from November to December [18].

Structures used as resting sites by American marten in northeastern Oregon over 5 years (adapted from [18])
Structure Percent of total resting sites (n=1,184)
Tree platform* 43
Tree cavity 23
Subnivean 23
Hollow log 6
Underground 3
Slash pile 1
*Tree platforms include horizontal branches and/or structures associated with broom rust, dwarf mistletoe, or clumps of lichen (Bryoria spp.).

In northwestern Montana, DBH of live and dead trees used as resting sites for American marten ranged from 2 to 28 inches (5-71 cm). Total canopy cover ranged from 17% to 82% [23]. Data from northeastern Oregon also show that trees with a wide range of characteristics were used as resting sites [18].

Average tree characteristics (SD) of resting sites used by American marten in northeastern Oregon (adapted from [18])
Characteristic Tree platforms
(n=517)
Tree cavity
(n=271)
Hollow log
(n=67)
Tree diameter (cm) 51.7 (20.94) 78.9 (21.22) 66.1 (18.38)
Tree height/length (m) 26.4 (7.85) 21.2 (9.85) 19.7 (10.68)
Resting site height (m) 12.6 (5.99) 11.2 (6.74) NA
Canopy depth (%)* 89.1 (18.62) 52.4 (39.63) NA
*Canopy depth defined as the % of the bole that contained live or dead branches.

Selection of resting site structure may be influenced by availability. A study comparing resting sites in the eastern Cascade Range of central Oregon to the western Cascade Range of Washington reported that structures varied by study area, with slash piles used most often in Oregon and live trees used most often in Washington. Slash piles were 4 times more abundant in Oregon than in Washington [143].

American marten often reuse resting sites [24,25,37,53,111,113,162,182]. In southeastern Wyoming, subnivean resting sites with deep snow were likely to be reused, particularly when temperatures were low. One resting site was reused 19 times, and reused sites were sometimes reused by different individuals, though never concurrently [182]. In California, 10% of resting structures were reused up to 5 times [111], while spring resting structures in western Montana were used 1 to 6 times [53]. Males in northwestern Maine did not reuse summer tree canopy resting sites [187,188].

Habitat features at rest sites: One review reports that habitat features are inconsistent at resting sites [27]. In coastal northwestern California, summer and fall resting locations had high tree canopy closure (76%), dense shrub cover, and abundant dead woody structures. At the stand level, resting sites occurred in late-mature or old-growth stands, with old-growth stands used more than expected based on their availability (P<0.0001). Selection for early-seral stands was either neutral or negative (P<0.0001) [154]. In northern Maine, summer rest site selection decreased with increasing canopy cover and understory foliage <1.5 feet (0.5 m). Increases in coniferous stems (<3.0 inches (7.6 cm) DBH) were associated with increased selection of winter resting sites, which the authors suggested offered subnivean access points and facilitated subnivean travel. The distribution of resting sites in coniferous, deciduous, or mixed forests did not vary seasonally, which may have been because structures for resting were abundant throughout the study area [36].

American marten resting sites have been associated with abundant dead wood [25,53,63,154,182] or snags [176], late-seral stage [24,63,154,182], mesic sites [53], riparian areas [25,143,154], or high overhead cover [24,73,143,154,159,182]. However, a preference for high canopy cover was not found at resting sites on the Kenai Peninsula [8] or in northern Maine [36]. Selection for aspect is not consistent across geographic areas, which may relate to local forest cover types associated with specific aspects; 74% of resting sites in northwestern California were on north aspects [154], while most in south-central Alaska were on southerly aspects [24]. Selection for specific local cover types was observed in northern Wisconsin [63], southeastern Wyoming [25,182], western Montana [53], and California [159], though preferences were often linked to the structural attributes occurring in the preferred cover type [25,53,182]. In interior Alaska, male American marten selected burned, open conifer-wet meadow and white spruce forest for resting in summer. Females were observed more often resting in unburned white spruce, black spruce, and mixed-wood (white spruce, paper birch, and balsam poplar) stands, but also rested in burned white spruce forest [178]. (See Wildfire Case Study 1 for more information on this study).

Two studies suggest that American marten avoid logged stands when choosing rest sites. Of 43 winter resting sites in industrial forests in northern Maine, 2 were in regenerating coniferous clearcuts, 18 were in uncut coniferous stands, 12 were in partially cut coniferous-deciduous stands, and 11 were along edges between clearcuts and residual stands. Of 27 summer resting sites, 5 were in regenerating coniferous clearcuts, 13 were in uncut coniferous stands, and 9 were in partially cut coniferous-deciduous stands [162]. In coastal northwestern California, most (65%) summer and fall resting sites were >330 feet (100 m) from logged areas (65%).

  • 8. Baltensperger, Andrew P. 2009. Behavior and distribution of American marten (Martes americana) in relation to snow and forest cover on the Kenai Peninsula, Alaska. Fort Collins, CO: Colorado State University. 69 p. Thesis. [76964]
  • 18. Bull, Evelyn L.; Heater, Thad W. 2000. Resting and denning sites of American martens in northeastern Oregon. Northwest Science. 74(3): 179-185. [37479]
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 24. Buskirk, Steven W. 1984. Seasonal use of resting sites by marten in south-central Alaska. The Journal of Wildlife Management. 48(3): 950-953. [76082]
  • 27. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 30. Campbell, Thomas M., III. 1979. Short term effects of timber harvest on pine marten ecology. Fort Collins, CO: Colorado State University. 71 p. Thesis. [76941]
  • 36. Chapin, Theodore G.; Phillips, David M.; Harrison, Daniel J.; York, Eric C. 1995. Seasonal selection of habitats by resting martens in Maine. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 166-181. [76954]
  • 37. Clark, T. W.; Campbell, T. M.; Hauptman, T. N.; Weaver, J. L. 1980. Habitat ecology of the pine marten in Jackson Hole, Wyoming. In: Clark, Tim W. Population organizational systems and regulatory mechanisms of a forest carnivore (pine martens) in Grand Teton National Park. Final report: Contract No. CX-1200-8-B026. Pocatello, ID: Idaho State University, Biology Department: 2-9. [76987]
  • 43. Coffin, Kenneth Wesley. 1994. Population characteristics and winter habitat selection by pine marten in southwest Montana. Bozeman, MT: Montana State University. 94 p. Thesis. [76932]
  • 53. Fager, Craig William. 1991. Harvest dynamics and winter habitat use of the pine marten in southwestern Montana. Bozeman, MT: Montana State University. 73 p. Thesis. [76939]
  • 63. Gilbert, Jonathan H.; Wright, John L.; Lauten, David J., Probst, John R. 1997. Den and rest-site characteristics of American marten and fisher in northern Wisconsin. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 135-145. [65890]
  • 73. Hargis, Christina D.; McCullough, Dale R. 1984. Winter diet and habitat selection of marten in Yosemite National Park. The Journal of Wildlife Management. 48(1): 140-146. [76070]
  • 74. Hargis, Christina Devin. 1981. Winter habitat utilization and food habits of the pine marten (Martes americana) in Yosemite National Park. Berkeley, CA: University of California. 57 p. Thesis. [76916]
  • 89. Jones, Lawrence L. C.; Raphael, Martin G. 1994. Ecology of American martens in a lodgepole pine-bitterbrush community in south-central Oregon: an early progress report. Northwest Science. 68(2): 133. Abstract. [76515]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 111. Martin, Sandra K. 1987. The ecology of the pine marten (Martes americana) at Sagehen Creek, California. Berkeley, CA: University of California. 239 p. Dissertation. [76909]
  • 125. Parks, Catherine G.; Bull, Evelyn L. 1997. American marten use of rust and dwarf mistletoe brooms in northeastern Oregon. Western Journal of Applied Forestry. 12(4): 131-133. [29703]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 143. Raphael, Martin G.; Jones, Lawrence L. C. 1995. Characteristics of resting and denning sites of American martens in central Oregon and western Washington. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 146-165. [76953]
  • 152. Simon, Terri Lee. 1980. An ecological study of the marten in the Tahoe National Forest, California. Sacramento, CA: California State University. 187 p. Thesis. [76935]
  • 154. Slauson, Keith M.; Zielinski, William J. 2009. Characteristics of summer and fall diurnal resting habitat used by American martens in coastal northwestern California. Northwest Science. 83(1): 35. [76044]
  • 159. Spencer, Wayne D.; Barrett, Reginald H.; Zielinski, William J. 1983. Marten habitat preferences in the northern Sierra Nevada. The Journal of Wildlife Management. 47(4): 1181-1186. [76083]
  • 162. Steventon, Douglas; Major, John T. 1982. Marten use of habitat in a commercially clear-cut forest. The Journal of Wildlife Management. 46(1): 175-182. [76076]
  • 176. Tomson, Scott Dean. 1998. Ecology and summer/fall habitat selection of American marten in northern Idaho. Missoula, MT: University of Montana. 75 p. Thesis. [76921]
  • 25. Buskirk, Steven W.; Forrest, Steven C.; Raphael, Martin G.; Harlow, Henry J. 1989. Winter resting site ecology of marten in the central Rocky Mountains. The Journal of Wildlife Management. 53(1): 191-196. [6896]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 182. Wilbert, Connie J. 1992. Spatial scale and seasonality of habitat selection by American martens in southeastern Wyoming. Laramie, WY: University of Wyoming. 91 p. Thesis. [77043]
  • 187. Wynne, Kathleen M.; Sherburne, J. A. 1984. Summer home range use by adult marten in northwestern Maine. Canadian Journal of Zoology. 62: 941-943. [76041]
  • 113. Martin, Sandra K.; Barrett, Reginald H. 1983. The importance of snags to pine marten habitat in the northern Sierra Nevada. In: Davis, Jerry W.; Goodwin, Gregory A.; Ockenfeis, Richard A., technical coordinators. Snag Habitat management: proceedings of the symposium; 1983 June 7-9; Flagstaff, AZ. Gen. Tech. Rep. RM-99. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 114-116. [17824]
  • 58. Francis, George Reid. 1958. Ecological studies of marten, Martes americana, in Algonquin Park, Ontario. Vancouver, BC: University of British Columbia. 74 p. [+ appendices]. Thesis. [76922]
  • 188. Wynne, Kathleen Mary. 1981. Summer home range use by adult marten in northwestern Maine. Orono, ME: University of Maine. 19 p. [+ appendices]. Thesis. [76915]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: General cover requirements

More info for the terms: basal area, cover, selection, shrubs, tree

American marten prefer habitat with complex physical structure ([35,44,64,81,106,127], reviews by [28,132]), which may be more important than plant community composition (review by [27]). Complex vertical and horizontal structure provides protection from predators, access to subnivean space for winter foraging, and protective thermal microenvironments, particularly in winter (reviews by [13,28]). Horizontal heterogeneity allows individuals to meet their needs in small areas, reducing travel distances (review by [28]). Components of complex physical structure positively associated with American marten habitat use include abundant and/or dense snags [13,21,106,126,127,147,159,176], downfall [44,111,186], logs [13,21,25,106,111,127,147,159,182], stumps [25,127,159,186], coarse woody debris [66,88,123,149], root tip-up mounds [186], shrubs [44,106], and live ground cover [44,111,159].

American marten habitat use has also been linked to relatively high tree basal area [44,62,111,126], tree diameter [13,21,176], tree height [13,126], and canopy closure [13,23,35,37,61,66,68,73,133,159]. Over 5 years of study in northeastern Oregon, 20 American marten showed a strong preference for forests with ≥50% canopy closure; based on availability, stands with 50% to 74% canopy closure were used more than expected while stands with <50% canopy closure were used less than expected (P<0.01) [21]. In Sequoia-Kings Canyon National Park, California, 72% of American marten detections were at sites with ≥40% canopy cover [68]. Some studies suggest that closed canopies are not required, at least not in all seasons. In central Maine, American marten used insect-defoliated stands with <50% canopy closure intensively from May to October. The author suggested that the vertical structure provided by large snags was a suitable substitute for live tree cover [126]. Several studies suggest that American marten avoid habitats lacking canopy closure, particularly in winter, to avoid predation. Few data are available to directly support this hypothesis, and it is also possible that American marten avoid open areas in winter because there is less available prey there (review by [27]).

Other habitat features that provide important cover for American marten include snow (see Importance of snow) and red squirrel middens. In the western part of American marten's range, activity is often associated with red squirrel middens, which provide important structures for natal and maternal denning [18,147] and resting [8,24,139,178], and are associated with traveling [8] and subnivean investigation [149]. In southern Wyoming, predictive models identified the number of red squirrel middens as the most important variable influencing maternal den site selection. Red squirrel middens were also an important variable in natal den site selection [147]. In south-central Alaska, 26 of 37 resting sites were associated with red squirrel middens, with heaviest use of midden resting sites occurring from early November to early April [24]. In Yellowstone National Park, Wyoming, 33% of subnivean access points were associated with red squirrel middens [149].

  • 8. Baltensperger, Andrew P. 2009. Behavior and distribution of American marten (Martes americana) in relation to snow and forest cover on the Kenai Peninsula, Alaska. Fort Collins, CO: Colorado State University. 69 p. Thesis. [76964]
  • 13. Bowman, Jeffrey C.; Robitaille, Jean-Francois. 1997. Winter habitat use of American martens Martes americana within second-growth forest in Ontario, Canada. Wildlife Biology. 3(2): 97-105. [76105]
  • 18. Bull, Evelyn L.; Heater, Thad W. 2000. Resting and denning sites of American martens in northeastern Oregon. Northwest Science. 74(3): 179-185. [37479]
  • 21. Bull, Evelyn L.; Heater, Thad W.; Shepherd, Jay F. 2005. Habitat selection by the American marten in northeastern Oregon. Northwest Science. 79(1): 37-43. [61280]
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 24. Buskirk, Steven W. 1984. Seasonal use of resting sites by marten in south-central Alaska. The Journal of Wildlife Management. 48(3): 950-953. [76082]
  • 27. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 35. Chapin, Theodore G.; Harrison, Daniel J.; Phillips, David M. 1997. Seasonal habitat selection by marten in an untrapped forest preserve. The Journal of Wildlife Management. 61(3): 707-718. [76062]
  • 37. Clark, T. W.; Campbell, T. M.; Hauptman, T. N.; Weaver, J. L. 1980. Habitat ecology of the pine marten in Jackson Hole, Wyoming. In: Clark, Tim W. Population organizational systems and regulatory mechanisms of a forest carnivore (pine martens) in Grand Teton National Park. Final report: Contract No. CX-1200-8-B026. Pocatello, ID: Idaho State University, Biology Department: 2-9. [76987]
  • 44. Coffin, Kenneth Wesley; Kujala, Quentin J.; Douglass, Richard J.; Irby, Lynn R. 1995. Interactions among marten prey availability, vulnerability, and habitat structure. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 199-210. [76955]
  • 61. Fuller, Angela K.; Harrison, Daniel J. 2005. Influence of partial timber harvesting on American martens in north-central Maine. The Journal of Wildlife Management. 69(2): 710-722. [76064]
  • 62. Gelok, Paul A. 2005. Seasonal habitat associations of American martens ( Martes americana) in central Ontario. Toronto, ON: University of Toronto. 109 p. Thesis. [76891]
  • 64. Godbout, Guillaume; Ouellet, Jean-Pierre. 2008. Habitat selection of American marten in a logged landscape at the southern fringe of the boreal forest. Ecoscience. 15(3): 332. [76048]
  • 66. Gosse, John W.; Cox, Rodney; Avery, Shawn W. 2005. Home-range characteristics and habitat use by American martens in eastern Newfoundland. Journal of Mammalogy. 86(6): 1156-1163. [76061]
  • 68. Green, Rebecca E. 2007. Distribution and habitat associations of forest carnivores and an evaluation of the California Wildlife Habitat Relationships model for American marten in Sequoia and Kings Canyon National Parks. Arcata, CA: Humboldt State University. 90 p. Thesis. [77816]
  • 73. Hargis, Christina D.; McCullough, Dale R. 1984. Winter diet and habitat selection of marten in Yosemite National Park. The Journal of Wildlife Management. 48(1): 140-146. [76070]
  • 81. Heinemeyer, Kimberly Sue. 2002. Translating individual movements into population patterns: American marten in fragmented forested landscapes. Santa Cruz, CA: University of California. 150 p. Dissertation. [76895]
  • 88. Johnson, W. N.; Paragi, Thomas F.; Katnik, Donald D. 1995. The relationship of wildfire to lynx and marten populations and habitat in interior Alaska. Final Report 95-01. Galena, AK: U.S. Fish and Wildlife Service, Koyukuk/Nowitna Refuge Complex. 145 p. [77606]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 111. Martin, Sandra K. 1987. The ecology of the pine marten (Martes americana) at Sagehen Creek, California. Berkeley, CA: University of California. 239 p. Dissertation. [76909]
  • 123. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1996. Marten selection of postfire seres in the Alaskan taiga. Canadian Journal of Zoology. 74: 2226-2237. [28567]
  • 126. Payer, David C. 1999. Influences of timber harvesting and trapping on habitat selection and demographic characteristics of marten. Orono, ME: The University of Maine. 298 p. Dissertation. [76897]
  • 127. Payer, David C.; Harrison, Daniel J. 2003. Influence of forest structure on habitat use by American marten in an industrial forest. Forest Ecology and Management. 179(1-3): 145-156. [76056]
  • 132. Poole, Kim G.; Porter, Aswea D.; de Vries, Andrew; Maundrell, Chris; Grindal, Scott D.; St. Clair, Collen Cassady. 2004. Suitability of a young deciduous-dominated forest for American marten and the effects of forest removal. Canadian Journal of Zoology. 82(3): 423-435. [76099]
  • 133. Porter, Aswea Dawn. 2002. Habitat selection by American marten (Martes americana ) at the element, patch and stand scales in a young deciduous forest in northern British Columbia. Edmonton, AB: University of Alberta. 79 p. Thesis. [76894]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 147. Ruggiero, Leonard F.; Pearson, Dean E.; Henry, Stephen E. 1998. Characteristics of American marten den sites in Wyoming. The Journal of Wildlife Management. 62(2): 663-673. [76060]
  • 149. Sherburne, Stuart Scott. 1992. Marten use of subnivean access points in Yellowstone National Park, Wyoming. Logan, UT: Utah State University. 37 p. Thesis. [77498]
  • 159. Spencer, Wayne D.; Barrett, Reginald H.; Zielinski, William J. 1983. Marten habitat preferences in the northern Sierra Nevada. The Journal of Wildlife Management. 47(4): 1181-1186. [76083]
  • 176. Tomson, Scott Dean. 1998. Ecology and summer/fall habitat selection of American marten in northern Idaho. Missoula, MT: University of Montana. 75 p. Thesis. [76921]
  • 25. Buskirk, Steven W.; Forrest, Steven C.; Raphael, Martin G.; Harlow, Henry J. 1989. Winter resting site ecology of marten in the central Rocky Mountains. The Journal of Wildlife Management. 53(1): 191-196. [6896]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 182. Wilbert, Connie J. 1992. Spatial scale and seasonality of habitat selection by American martens in southeastern Wyoming. Laramie, WY: University of Wyoming. 91 p. Thesis. [77043]
  • 186. Wright, John L. 1999. Winter home range and habitat use by sympatric fishers (Martes pennanti) and American martens (Martes americana) in northern Wisconsin. Stevens Point, WI: University of Wisconsin. 73 p. Thesis. [76885]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: Plant community characteristics

More info for the terms: association, cover, density, layering, mesic, selection, shrub, wildfire, xeric

Characteristics associated with preferred plant communities include cover type, seral stage, moisture regime, use of riparian areas, and landscape characteristics. Use of burned areas has been documented in many studies.

Cover type: Studies from Maine [158,187], Michigan [168], British Columbia [116,132], Manitoba [139,141], Newfoundland [80], Ontario [58,167], Quebec [64], Yukon [155], and reviews [27,28,38,136,165] report a preference for coniferous forests, though it should be noted that deciduous forests are not widely available in many parts of the American marten's distribution. Also, some studies suggesting a preference for coniferous forests compare use of mature coniferous forest to use of regenerating deciduous forest, so it is not clear whether habitat preferences are related to cover type, seral stage, or both (review by ([62]). A variety of forest habitats, including young, deciduous forest, may be used if food and cover are available ([35,132,133], reviews by ([62,136,165]).

In general, American marten avoid cover types that lack overhead cover (e.g., prairies, herbaceous parklands or meadows, clearcuts, and tundra) ([53,73,74,176,187], reviews by [28,155]) due to an absence of preferred prey, structures for denning, concealment cover, escape cover, and/or access points to subnivean spaces (review by ([165]). Though they generally avoid open areas without overstory or shrub cover, American marten may occasionally travel along the edges of open areas or cross narrow open areas (review by [27]).

Use of nonforested habitats varies regionally, with open areas in some regions containing food and structure that open areas in other regions lack (review by [12]). Summer use of nonforested habitats above treeline is common in the montane part of American marten's distribution ([164], review by [28]). The type of nonforested habitat is important; open areas such as clearcuts, tornado blowdowns, or burned areas with large amounts of coarse woody debris may lack shrub or overstory cover but still provide adequate cover from tall herbs and debris, while protective cover in open grasslands, alpine zones, or other areas with short herbaceous vegetation may be lacking (review by [27]). Use of nonforested habitats may also be related to the proximity of and interspersion with closed-canopy cover types [159,176]. See General cover requirements for more information on this topic.

Seral stage: In general, American marten prefer late successional forests (e.g., see studies from California [92,93,153], Idaho [94,96,110,176,180], Maine [126,127,162,187], Oregon [21], Wyoming [30], Alberta [138], British Columbia [106,132], Newfoundland [50,66,157], Quebec [64], and Yukon [155]). The structural features important to American marten that develop with successional advancement include overhead cover, high volumes of large-diameter coarse woody debris, and small-scale horizontal heterogeneity of vegetation (review by [28]). American marten may use early-seral stands, particularly if complex physical structure is available ([6,35,62,88,116,123,132,186], review by [174]), stands contain attractions like seasonally abundant food items [110,162], or if mature stands are lacking across the landscape [6].

Moisture regime: Several studies indicate a preference for mesic over xeric sites, including studies in Colorado [7], Idaho [94,96], Montana [23,43,53], Oregon [21], Washington [117], British Columbia [106,116], and the Northwest Territories [115]. At temperate latitudes, mesic forests used by American marten are commonly riparian (review by [27]).

Riparian areas: Riparian areas contain habitat features important for American marten in many parts of their range [25,53,68,152,159,176,178]. They may provide large amounts of coarse woody debris [25,178] and/or high prey density [25], leading to enhanced foraging opportunities [152,176,178]. Riparian areas may also offer cool temperatures and access to water in summer [176]. In logged landscapes, riparian areas are often left uncut, providing structurally complex or mature forest [25,176].

In northeastern California, stream corridors were important for American marten movement and foraging [152]. In northern Idaho, individuals within a home range were located closer to streams than to random locations (P<0.01), and resting sites and travel routes were often located near riparian corridors [176]. In southeastern Wyoming, winter resting sites were closer to streams and lakes than expected (P=0.007) [25]. Below 6,725 feet (2,050 m) elevation in the northern Sierra Nevada, American marten strongly preferred riparian lodgepole pine plant associations (P<0.05). Riparian areas were used more for activity than resting, while adjacent mixed-conifer forests were used more for resting than activity. Riparian lodgepole pine forests with lush herbaceous cover were primary foraging areas [159]. In Grand Teton National Park, one natal den was located in a cottonwood (Populus spp.) along the Snake River [37].

Riparian areas were key components of American marten home ranges in areas burned 8 years previously in interior Alaska. The home ranges of 10 American marten were centered in habitat around the Pitka Fork and Salmon rivers. Home range boundaries coincided with transition areas between riparian and nonriparian habitats. American marten clearly associated with riparian areas in daily activities. The author attributed this association to the large amounts of dead and down wood and vertical layering of log debris in riparian areas, and suggested that these habitat features offered both foraging opportunities and sufficient protective cover [178]. See Wildfire Case Study 1 for more information on this study.

Some studies suggest that riparian areas may constitute a barrier to movement or may shape home range boundaries. On the Kenai Peninsula, Alaska, individuals avoided ice-covered water (P<0.001) [8]. Very few tracks (3 of 251) were found on frozen lakes and rivers >50 feet (15 m) wide in southeastern Manitoba [139,141]. In south-central Alaska, home range boundaries included creeks and a major river [29]. However, some individuals do cross large rivers. Individuals in interior Alaska regularly swam across a river 154 feet (50 m) wide, sometimes more than once a day [109]. In southwestern Montana, at least one individual swam the Madison River [43]. In Yosemite National Park, California, individuals regularly crossed streams and traveled up to 330 feet (100 m) on frozen creek beds [74]. In interior Alaska, although home range boundaries were coincident with riparian areas, rivers presented no barrier to movement. Animals crossed rivers freely even in summer, sometimes more than once in 24 hours: "One marten was observed swimming the Pitka Fork, even diving under water for a short distance before emerging on the bank" [178].

Landscape characteristics: Plant community landscape metrics, including the juxtaposition and configuration of patches, may be important in American marten habitat selection [159,180]. However, one review suggests that the impacts of landscape features like fragmentation likely vary by geographic location [12], making broad inferences difficult.

Several studies suggest that landscape fragmentation has negative consequences for American marten ([75,80,81,116,180], review by [27]). Landscape metrics associated with fragmentation include patch size, edge indices, and habitat interspersion. Though highly fragmented forests may contain suitable patches of habitat for American marten, preferred habitats may be so separated by open areas that they are essentially unavailable (review by [27]) and/or predation risk is increased [180]. A few studies suggest that American marten favor large patches [34,92,168]. In an industrial forest in north-central Maine, forest patches used by American marten were 18 times larger than unused patches (median 67 acres (27 ha) vs. 3.7 acres (1.5 ha)) (P<0.003). Patches used by residents were closer to the nearest patch >6.7 acres (2.7 ha) (P=0.057) and to an adjacent forest preserve (P=0.075) than patches with no observed use [34]. On the Upper Peninsula of Michigan, American marten selected for large patches (P=0.05); 194 out of 232 locations were in conifer patches >345 acres (140 ha) [168].

American marten show no clear association with edge habitat, probably because of the variety of habitats studied and the inability of telemetry studies to detect fine-scale habitat preferences (review by [27]). Some studies suggest that interior forest areas are preferred [92]. American marten habitat use is negatively related to the proportion of the landscape in high-contrast edge habitat, like that between adjacent logged and unlogged forest [62,180]. However, edge indices were unrelated to American marten habitat use in an industrial forest in north-central Maine [34]. American marten in an experimental forest in southern British Columbia tended to use edges between forest and small forest openings (0.2-25 acres (0.1-10 ha)), avoiding forest farther from openings [86]. Several studies have documented American marten foraging in edge habitat between forested and open areas [29,76,77,86,152,159,181] (see Foraging).

Habitat interspersion was an important habitat feature of American marten habitat in the northern Sierra Nevada. American marten selected for tall, dense forest stands that were near meadows and that had many large snags, stumps, and logs (P<0.001). When active, individuals preferred to be within 200 feet (60 m) of a meadow and rarely used sites more than 1,300 feet (400 m) from meadows [159]. Some sources suggest that the mosaic of seral stages and cover types created by disturbances such as fire [88,94,96,109,123] and insect outbreaks [148] are important components of American marten habitat.

  • 6. Baker, Judith Marie. 1993. Habitat use and spatial organization of pine marten on southern Vancouver Island, British Columbia. Burnaby, BC: Simon Fraser University. 134 p. Thesis. [76905]
  • 7. Baldwin, Roger A.; Louis C. Bender. 2008. Distribution, occupancy, and habitat correlates of American martens (Martes americana) in Rocky Mountain National Park, Colorado. Journal of Mammalogy. 89(2): 419-427. [76046]
  • 8. Baltensperger, Andrew P. 2009. Behavior and distribution of American marten (Martes americana) in relation to snow and forest cover on the Kenai Peninsula, Alaska. Fort Collins, CO: Colorado State University. 69 p. Thesis. [76964]
  • 12. Bissonette, John A.; Harrison, Daniel J.; Hargis, Christina D.; Chapin, Theodore G. 1997. The influence of spatial scale and scale-sensitive properties in habitat selection by American marten. In: Bissonette, John A., ed. Wildlife and landscape ecology: effects of pattern and scale. New York: Springer-Verlag: 368-385. [76521]
  • 21. Bull, Evelyn L.; Heater, Thad W.; Shepherd, Jay F. 2005. Habitat selection by the American marten in northeastern Oregon. Northwest Science. 79(1): 37-43. [61280]
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 27. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 29. Buskirk, Steven William. 1983. The ecology of marten in southcentral Alaska. Fairbanks, AK: University of Alaska. 142 p. Dissertation. [76929]
  • 30. Campbell, Thomas M., III. 1979. Short term effects of timber harvest on pine marten ecology. Fort Collins, CO: Colorado State University. 71 p. Thesis. [76941]
  • 34. Chapin, Theodore G.; Harrison, Daniel J.; Katnik, Donald D. 1998. Influence of landscape pattern on habitat use by American marten in an industrial forest. Conservation Biology. 12(6): 1327-1337. [76078]
  • 35. Chapin, Theodore G.; Harrison, Daniel J.; Phillips, David M. 1997. Seasonal habitat selection by marten in an untrapped forest preserve. The Journal of Wildlife Management. 61(3): 707-718. [76062]
  • 37. Clark, T. W.; Campbell, T. M.; Hauptman, T. N.; Weaver, J. L. 1980. Habitat ecology of the pine marten in Jackson Hole, Wyoming. In: Clark, Tim W. Population organizational systems and regulatory mechanisms of a forest carnivore (pine martens) in Grand Teton National Park. Final report: Contract No. CX-1200-8-B026. Pocatello, ID: Idaho State University, Biology Department: 2-9. [76987]
  • 38. Clark, Tim W.; Anderson, Elaine; Douglas, Carman; Strickland, Marjorie. 1987. Martes americana. Mammalian Species. 289: 1-8. [76016]
  • 43. Coffin, Kenneth Wesley. 1994. Population characteristics and winter habitat selection by pine marten in southwest Montana. Bozeman, MT: Montana State University. 94 p. Thesis. [76932]
  • 53. Fager, Craig William. 1991. Harvest dynamics and winter habitat use of the pine marten in southwestern Montana. Bozeman, MT: Montana State University. 73 p. Thesis. [76939]
  • 62. Gelok, Paul A. 2005. Seasonal habitat associations of American martens ( Martes americana) in central Ontario. Toronto, ON: University of Toronto. 109 p. Thesis. [76891]
  • 64. Godbout, Guillaume; Ouellet, Jean-Pierre. 2008. Habitat selection of American marten in a logged landscape at the southern fringe of the boreal forest. Ecoscience. 15(3): 332. [76048]
  • 66. Gosse, John W.; Cox, Rodney; Avery, Shawn W. 2005. Home-range characteristics and habitat use by American martens in eastern Newfoundland. Journal of Mammalogy. 86(6): 1156-1163. [76061]
  • 68. Green, Rebecca E. 2007. Distribution and habitat associations of forest carnivores and an evaluation of the California Wildlife Habitat Relationships model for American marten in Sequoia and Kings Canyon National Parks. Arcata, CA: Humboldt State University. 90 p. Thesis. [77816]
  • 73. Hargis, Christina D.; McCullough, Dale R. 1984. Winter diet and habitat selection of marten in Yosemite National Park. The Journal of Wildlife Management. 48(1): 140-146. [76070]
  • 74. Hargis, Christina Devin. 1981. Winter habitat utilization and food habits of the pine marten (Martes americana) in Yosemite National Park. Berkeley, CA: University of California. 57 p. Thesis. [76916]
  • 75. Hargis, Christina Devin. 1996. The influence of forest fragmentation and landscape pattern on American martens and their prey. Salt Lake City, UT: Utah State University. 142 p. Dissertation. [76904]
  • 76. Hauptman, Tedd N. 1979. Spatial and temporal distribution and feeding ecology of the pine marten. Pocatello, ID: Idaho State University. 84 p. Thesis. [76933]
  • 77. Hawley, Vernon D. 1955. The ecology of the marten in Glacier National Park. Missoula, MT: The University of Montana. 131 p. Thesis. [76943]
  • 80. Hearn, Brian J. 2007. Factors affecting habitat selection and population characteristics of American marten (Martes americana atrata) in Newfoundland. Orono, ME: The University of Maine. 226 p. Dissertation. [76888]
  • 81. Heinemeyer, Kimberly Sue. 2002. Translating individual movements into population patterns: American marten in fragmented forested landscapes. Santa Cruz, CA: University of California. 150 p. Dissertation. [76895]
  • 86. Huggard, David J. 1999. Marten use of different harvesting treatments in high-elevation forest at Sicamous Creek. Research Report 17. Victoria, BC: British Columbia Ministry of Forests, Research Program. 17 p. [76104]
  • 88. Johnson, W. N.; Paragi, Thomas F.; Katnik, Donald D. 1995. The relationship of wildfire to lynx and marten populations and habitat in interior Alaska. Final Report 95-01. Galena, AK: U.S. Fish and Wildlife Service, Koyukuk/Nowitna Refuge Complex. 145 p. [77606]
  • 92. Kirk, Thomas A. 2007. Landscape scale habitat associations of the American marten (Martes americana) in the greater Southern Cascades region of California. Arcata, CA: Humboldt State University. 103 p. Thesis. [76878]
  • 93. Kirk, Thomas A.; Zielinski, William J. 2009. Developing and testing a habitat suitability model for the American marten (Martes americana) in the Cascades Mountains of California. Landscape Ecology. 24: 759-773. [76947]
  • 94. Koehler, Gary M. 1975. The effects of fire on marten distribution and abundance in the Selway-Bitterroot Wilderness. Moscow, ID: University of Idaho. 26 p. Thesis. [76942]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 109. Magoun, Audrey J.; Vernam, Donald J. 1986. An evaluation of the Bear Creek burn as marten (Martes americana) habitat in interior Alaska. Final Report: Special Project Cooperative Agreement AK-950-CAH-0. Fairbanks, AK: U.S. Department of the Interior; Alaska Deppartment of Fish and Game. 58 p. [76025]
  • 115. More, Gavin. 1978. Ecological aspects of food selection in pine marten, Martes americana. Edmonton, AB: University of Alberta. 94 p. Thesis. [76874]
  • 116. Mowat, Garth. 2006. Winter habitat associations of American martens Martes americana in interior wet-belt forests. Wildlife Biology. 12(1): 51-61. [76054]
  • 117. Munzing, Danielle; Gaines, William L. 2008. Monitoring American marten on the east-side of the North Cascades of Washington. Northwestern Naturalist. 89(2): 67-75. [76529]
  • 123. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1996. Marten selection of postfire seres in the Alaskan taiga. Canadian Journal of Zoology. 74: 2226-2237. [28567]
  • 126. Payer, David C. 1999. Influences of timber harvesting and trapping on habitat selection and demographic characteristics of marten. Orono, ME: The University of Maine. 298 p. Dissertation. [76897]
  • 127. Payer, David C.; Harrison, Daniel J. 2003. Influence of forest structure on habitat use by American marten in an industrial forest. Forest Ecology and Management. 179(1-3): 145-156. [76056]
  • 132. Poole, Kim G.; Porter, Aswea D.; de Vries, Andrew; Maundrell, Chris; Grindal, Scott D.; St. Clair, Collen Cassady. 2004. Suitability of a young deciduous-dominated forest for American marten and the effects of forest removal. Canadian Journal of Zoology. 82(3): 423-435. [76099]
  • 133. Porter, Aswea Dawn. 2002. Habitat selection by American marten (Martes americana ) at the element, patch and stand scales in a young deciduous forest in northern British Columbia. Edmonton, AB: University of Alberta. 79 p. Thesis. [76894]
  • 138. Proulx, Gilbert. 2006. Winter habitat use by American marten, Martes americana, in western Alberta boreal forests. The Canadian Field-Naturalist. 120(1): 100-105. [76108]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 141. Raine, R. Michael. 1983. Winter habitat use and responses to snow cover of fisher (Martes pennanti) and marten (Martes americana) in southeastern Manitoba. Canadian Journal of Zoology. 61(1): 25-34. [64009]
  • 148. Schumacher, Thomas V.; Bailey, Theodore N.; Portner, Mary F.; Bangs, Edward E.; Larned, William W. 1989. Marten ecology and distribution on the Kenai National Wildlife Refuge, Alaska. Draft manuscript. Soldotna, AK: U.S. Fish and Wildlife Service, Kenai National Wildlife Refuge. 67 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab, Missoula, MT; FEIS files. [78733]
  • 152. Simon, Terri Lee. 1980. An ecological study of the marten in the Tahoe National Forest, California. Sacramento, CA: California State University. 187 p. Thesis. [76935]
  • 153. Slauson, Keith M. 2004. Habitat selection by American martens (Martes americana) in coastal northwestern California. Corvallis, OR: Oregon State University. 111 p. Thesis. [76883]
  • 155. Slough, Brian G. 1989. Movements and habitat use by transplanted marten in the Yukon Territory. The Journal of Wildlife Management. 53(1): 991-997. [76073]
  • 157. Snyder, Joyce E.; Bissonette, John A. 1987. Marten use of clear-cuttings and residual forest stands in western Newfoundland. Canadian Journal of Zoology. 65: 169-174. [76039]
  • 158. Soutiere, Edward C. 1989. Effects of timber harvesting on marten in Maine. The Journal of Wildlife Management. 43(4): 850-860. [76074]
  • 159. Spencer, Wayne D.; Barrett, Reginald H.; Zielinski, William J. 1983. Marten habitat preferences in the northern Sierra Nevada. The Journal of Wildlife Management. 47(4): 1181-1186. [76083]
  • 162. Steventon, Douglas; Major, John T. 1982. Marten use of habitat in a commercially clear-cut forest. The Journal of Wildlife Management. 46(1): 175-182. [76076]
  • 164. Streeter, Robert G.; Braun, Clait E. 1968. Occurrence of pine marten, Martes americana, (Carnivora:Mustelidae) in Colorado alpine areas. The Southwestern Naturalist. 13(4): 449-451. [76067]
  • 165. Strickland, Marjorie A.; Douglas, Carman W. 1987. Marten. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 531-546. [50679]
  • 167. Taylor, Mark E.; Abrey, Neil. 1982. Marten, Martes americana, movements and habitat use in Algonquin Provincial Park, Ontario. The Canadian Field-Naturalist. 96(4): 439-447. [76118]
  • 168. Thomasma, Linda Ebel. 1996. Winter habitat selection and interspecific interactions of American martens (Martes americana) and fishers (Martes pennanti) in the McCormick Wilderness and surrounding area. Houghton, MI: Michigan Technological University. 116 p. Dissertation. [76871]
  • 176. Tomson, Scott Dean. 1998. Ecology and summer/fall habitat selection of American marten in northern Idaho. Missoula, MT: University of Montana. 75 p. Thesis. [76921]
  • 25. Buskirk, Steven W.; Forrest, Steven C.; Raphael, Martin G.; Harlow, Henry J. 1989. Winter resting site ecology of marten in the central Rocky Mountains. The Journal of Wildlife Management. 53(1): 191-196. [6896]
  • 50. Drew, Gary S. 1995. Winter habitat selection by American marten Martes americana in Newfoundland: why old growth? Logan, UT: Utah State University, Department of Fisheries and Wildlife. 72 p. Dissertation. [76870]
  • 96. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. The Journal of Wildlife Management. 41(3): 500-505. [7637]
  • 136. Powell, Roger A.; Buskirk, Steven W.; Zielinski, William J. 2003. Fisher and marten (Martes pennanti and Martes americana). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: The Johns Hopkins University Press: 635-649. [64017]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 180. Wasserman, Tzeidle N. 2008. Habitat relationships and gene flow of Martes americana in northern Idaho. Bellingham, WA: Western Washington University. 128 p. Thesis. [76880]
  • 181. Weckwerth, Richard P.; Hawley, Vernon D. 1962. Marten food habits and population fluctuations in Montana. The Journal of Wildlife Management. 26(1): 55-74. [76088]
  • 186. Wright, John L. 1999. Winter home range and habitat use by sympatric fishers (Martes pennanti) and American martens (Martes americana) in northern Wisconsin. Stevens Point, WI: University of Wisconsin. 73 p. Thesis. [76885]
  • 187. Wynne, Kathleen M.; Sherburne, J. A. 1984. Summer home range use by adult marten in northwestern Maine. Canadian Journal of Zoology. 62: 941-943. [76041]
  • 174. Thompson, Ian D.; Harestad, Alton S. 1994. Effects of logging on American martens, and models for Habitat management. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 355-367. [76946]
  • 58. Francis, George Reid. 1958. Ecological studies of marten, Martes americana, in Algonquin Park, Ontario. Vancouver, BC: University of British Columbia. 74 p. [+ appendices]. Thesis. [76922]
  • 110. Marshall, William H. 1942. The biology and management of the pine marten in Idaho. Ann Arbor, MI: University of Michigan. 107 p. [+ appendices]. Dissertation. [76923]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: competition, cover, density, fitness, mesic, selection, snag, tree, xeric

Habitat characteristics preferred by American marten have been reviewed by several sources (e.g., [28,38,136,166]). Habitat quality for American marten is largely inferred from behavioral choices of individuals and indices of population density (review by [38]). Much of the information regarding American marten habitat is based on use of particular cover types compared to availability. As a measure of preference, this type of comparison assumes that individuals have equal access to available habitats and that time spent in a habitat translates into a fitness benefit, assumptions which may or may not be true (review by [27]).

American marten habitat preferences may vary by age ([23], reviews by [27,28]), sex ([186], review by [27]), residency [88,123], or season ([62,115], reviews by [27,28,136]). Measurement of habitat preferences may also vary with the scale of activity and method of analysis. Microhabitat selection includes preference for features at sites of specific use, such as resting, denning, or foraging. Stand selection includes preference for structural characteristics of stands, including snag density, tree size, or canopy closure. Home range or landscape selection includes preferences for habitat heterogeneity, interspersion, and juxtaposition. See the following studies for American marten habitat analyses at multiple scales: [62,81,92,106,116,133,134,153,176,180,182].

American marten are associated with many habitat features that are interrelated, including preferences for cover type, seral stage, structural complexity, moisture regime, landscape composition, and prey dynamics. In general, American marten occur mainly in forests and adjacent vegetation types. Late-successional stands of mesic coniferous forest, especially those with complex structure near the ground, are preferred (review by [28]). Forests with >30% canopy cover are considered optimal (review by [38]). Use of deciduous forest types is more common in the eastern part of the American marten distribution, where deciduous components are more typical of mature forests or some prey items are associated with early deciduous seres (review by [136]). Xeric forest types or those lacking complex physical structure are used little if at all. The preference for complex structure near the ground, particularly in winter, seems to be universal (review by [28]).

This section presents information on preferred habitat characteristics, including:
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 27. Buskirk, Steven W.; Powell, Roger A. 1994. Habitat ecology of fishers and American martens. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 283-296. [65915]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 38. Clark, Tim W.; Anderson, Elaine; Douglas, Carman; Strickland, Marjorie. 1987. Martes americana. Mammalian Species. 289: 1-8. [76016]
  • 62. Gelok, Paul A. 2005. Seasonal habitat associations of American martens ( Martes americana) in central Ontario. Toronto, ON: University of Toronto. 109 p. Thesis. [76891]
  • 81. Heinemeyer, Kimberly Sue. 2002. Translating individual movements into population patterns: American marten in fragmented forested landscapes. Santa Cruz, CA: University of California. 150 p. Dissertation. [76895]
  • 88. Johnson, W. N.; Paragi, Thomas F.; Katnik, Donald D. 1995. The relationship of wildfire to lynx and marten populations and habitat in interior Alaska. Final Report 95-01. Galena, AK: U.S. Fish and Wildlife Service, Koyukuk/Nowitna Refuge Complex. 145 p. [77606]
  • 92. Kirk, Thomas A. 2007. Landscape scale habitat associations of the American marten (Martes americana) in the greater Southern Cascades region of California. Arcata, CA: Humboldt State University. 103 p. Thesis. [76878]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 115. More, Gavin. 1978. Ecological aspects of food selection in pine marten, Martes americana. Edmonton, AB: University of Alberta. 94 p. Thesis. [76874]
  • 116. Mowat, Garth. 2006. Winter habitat associations of American martens Martes americana in interior wet-belt forests. Wildlife Biology. 12(1): 51-61. [76054]
  • 123. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1996. Marten selection of postfire seres in the Alaskan taiga. Canadian Journal of Zoology. 74: 2226-2237. [28567]
  • 133. Porter, Aswea Dawn. 2002. Habitat selection by American marten (Martes americana ) at the element, patch and stand scales in a young deciduous forest in northern British Columbia. Edmonton, AB: University of Alberta. 79 p. Thesis. [76894]
  • 134. Porter, Aswea Dawn; St. Clair, Colleen Cassady; de Vries, Andrew. 2005. Fine-scale selection by marten during winter in a young deciduous forest. Canadian Journal of Forest Research. 35: 901-909. [64114]
  • 153. Slauson, Keith M. 2004. Habitat selection by American martens (Martes americana) in coastal northwestern California. Corvallis, OR: Oregon State University. 111 p. Thesis. [76883]
  • 166. Strickland, Marjorie A.; Douglas, Carman W.; Novak, Milan; Hunziger, Nadine P. 1982. Marten: Martes americana. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 599-612. [76017]
  • 176. Tomson, Scott Dean. 1998. Ecology and summer/fall habitat selection of American marten in northern Idaho. Missoula, MT: University of Montana. 75 p. Thesis. [76921]
  • 136. Powell, Roger A.; Buskirk, Steven W.; Zielinski, William J. 2003. Fisher and marten (Martes pennanti and Martes americana). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: The Johns Hopkins University Press: 635-649. [64017]
  • 180. Wasserman, Tzeidle N. 2008. Habitat relationships and gene flow of Martes americana in northern Idaho. Bellingham, WA: Western Washington University. 128 p. Thesis. [76880]
  • 182. Wilbert, Connie J. 1992. Spatial scale and seasonality of habitat selection by American martens in southeastern Wyoming. Laramie, WY: University of Wyoming. 91 p. Thesis. [77043]
  • 186. Wright, John L. 1999. Winter home range and habitat use by sympatric fishers (Martes pennanti) and American martens (Martes americana) in northern Wisconsin. Stevens Point, WI: University of Wisconsin. 73 p. Thesis. [76885]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: Elevation

American marten occur in a wide range of elevations throughout their distribution.

Elevation at sites occupied by American marten
Location Elevation (feet)
Alaska 400 to 1,201 [109]
California 8,596 to 11,073 [73]

Colorado

7,874 to 14,255 [7]
Maine 1,085 to 2,410 [129]
Montana 6,400 to 8,200 [44]
Oregon 5,495
Washington 2,500 to 6,000 [143]
Wyoming 6,444 to 13,730 [39]
British Columbia 2,380 to 2,690 [132]
Newfoundland 260 to 2,300 [51]
  • 7. Baldwin, Roger A.; Louis C. Bender. 2008. Distribution, occupancy, and habitat correlates of American martens (Martes americana) in Rocky Mountain National Park, Colorado. Journal of Mammalogy. 89(2): 419-427. [76046]
  • 39. Clark, Tim W.; Campbell, Thomas M., III; Hauptman, Tedd N. 1989. Demographic characteristics of American marten populations in Jackson Hole, Wyoming. Great Basin Naturalist. 49: 587-596. [76033]
  • 44. Coffin, Kenneth Wesley; Kujala, Quentin J.; Douglass, Richard J.; Irby, Lynn R. 1995. Interactions among marten prey availability, vulnerability, and habitat structure. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 199-210. [76955]
  • 51. Drew, Gary S.; Bissonette, John A. 1997. Winter activity patterns of American martens (Martes americana): rejection of the hypothesis of thermal-cost minimization. Canadian Journal of Zoology. 75(5): 812-816. [76114]
  • 73. Hargis, Christina D.; McCullough, Dale R. 1984. Winter diet and habitat selection of marten in Yosemite National Park. The Journal of Wildlife Management. 48(1): 140-146. [76070]
  • 109. Magoun, Audrey J.; Vernam, Donald J. 1986. An evaluation of the Bear Creek burn as marten (Martes americana) habitat in interior Alaska. Final Report: Special Project Cooperative Agreement AK-950-CAH-0. Fairbanks, AK: U.S. Department of the Interior; Alaska Deppartment of Fish and Game. 58 p. [76025]
  • 129. Phillips, David M.; Harrison, Daniel J.; Payer, David C. 1998. Seasonal changes in home-range area and fidelity of martens. Journal of Mammalogy. 79(1): 180-190. [76038]
  • 132. Poole, Kim G.; Porter, Aswea D.; de Vries, Andrew; Maundrell, Chris; Grindal, Scott D.; St. Clair, Collen Cassady. 2004. Suitability of a young deciduous-dominated forest for American marten and the effects of forest removal. Canadian Journal of Zoology. 82(3): 423-435. [76099]
  • 143. Raphael, Martin G.; Jones, Lawrence L. C. 1995. Characteristics of resting and denning sites of American martens in central Oregon and western Washington. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 146-165. [76953]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Martes americana is found primarily in mature, northern forests. These animals are closely associated with lodgepole pine, Douglas fir, spruce, and mixed harwood forests. They tend to be found in structurally complex, mature forests, and can occur at all elevations where such habitat exists. They den in hollow trees, crevices, or vacant ground burrows.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Home range size is quite variable, usually averages less than 10 sq km, may be larger when food scarce; male range usually is larger than female range; see Slough (1989) for detailed summary of home ranges in several areas; see also Phillips et al. (1998). Male home range may overlap those of multiple females.

Young may disperse 25 miles or more.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet consists mainly of small mammals, birds, insects, carrion. Berries and other vegetable matter are eaten in season. Foraging occurs in trees and on the ground (mostly). Martens track prey, ambush, rob nests, excavate burrows, and use hunting perches (Spencer and Zielinski 1983). They also exploit subnivean prey (voles, squirrels, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

American martens eat mostly meat. They are willing to eat any animal they can catch. Most of the time, they catch squirrels and micebut can sometimes eat birds, fruit, nuts, insects, and carrion.

American martens kill their prey with a quick, powerful bite to the back of the prey animal's neck. They sometimes have fast-paced chases in trees with Tamiasciurus hudsonicus.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the terms: cover, frequency, selection, shrubs

American marten are opportunistic predators, influenced by local and seasonal abundance and availability of potential prey (review by [136]). They require about 80 kcal/day while at rest, the equivalent of about 3 voles (Microtus, Myodes, and Phenacomys spp.) (review by ([165]). Voles dominate diets throughout the American marten's geographic range (review by [136]), though larger prey—particularly snowshoe hares [42,139,142]—may be important, particularly in winter [61,148]. Red-backed voles (Myodes spp.) are generally taken in proportion to their availability, while meadow voles (Microtus spp.) are taken in excess of their availability in most areas. Deer mice (Peromyscus maniculatus) and shrews (Soricidae) are generally eaten less than expected, but may be important food items in areas lacking alternative prey species (review by [28]). Birds were the most important prey item in terms of frequency and volume on the Queen Charlotte Islands, British Columbia [118]. Fish may be important in coastal areas [9,118]. See Martin [112] for a review of American marten feeding ecology, including a summary of 22 studies on food use. For additional information on specific food items consumed by American marten, see the following sources: Alaska [9,29,88,109,123], Maine [61,158], Wyoming [30,76], Montana [181], Idaho [94,96,110], California [74,111,152,190], Oregon [16], Labrador [151], Northwest Territories [49,115,131], Ontario [42,58,169,171], Manitoba [139,142], and British Columbia [6,118].

Habitat preferences of dominant prey items are extremely variable. Red-backed voles prefer coniferous forests, where they are associated with large-diameter logs and understory cover. Meadow voles (Microtus spp.) occupy herbaceous and shrubby meadows. Red and Douglas's squirrels are largely restricted to coniferous forests in cone-producing stages, especially late-successional stages, though red squirrels may occur in deciduous forests in the eastern United States. Snowshoe hares generally prefer dense coniferous forest, dense early-seral shrubs, and swamps. Yellow-cheeked voles, important prey in Alaska, are variously reported to have wide habitat tolerances, be restricted to postfire seres, or be associated with lightly burned forest (review by [28]). Population dynamics of prey species may influence prey selection [9,131,151,169]. For more information on habitat associations of potential American marten prey, see the following FEIS reviews: snowshoe hare, red squirrel, northern red-backed vole, meadow vole, and deer mouse.

American marten diet may shift seasonally [6,16,29,58,96,111,115,148,152,181,190] or annually [29,74,115,131,151]. In general, diet is more diverse in summer than winter, with summer diets containing more fruit, other vegetation, and insects. Diet is generally more diverse in the eastern and southern parts of American marten's distribution compared to the western part (review by [136]), though there is high diversity in the Pacific states. American marten exhibit the least diet diversity in the subarctic, though diversity may also be low in areas where the diet is dominated by large prey species (e.g., snowshoe hares or red squirrels) (review by [112]).

American marten may be important seed dispersers; seeds generally pass through the animal intact, and seeds are likely germinable [183]. One study from Chichagof Island, southeast Alaska, found that Alaska blueberry (Vaccinium alaskensis) and ovalleaf huckleberry (V. ovalifolium) seeds had higher germination rates after passing through the gut of American marten compared to seeds that dropped from the parent plant. Analyses of American marten movement and seed passage rates suggested that American marten could disperse seeds long distances; 54% of the distances analyzed were >0.3 mile (0.5 km) [83].

  • 6. Baker, Judith Marie. 1993. Habitat use and spatial organization of pine marten on southern Vancouver Island, British Columbia. Burnaby, BC: Simon Fraser University. 134 p. Thesis. [76905]
  • 9. Ben-David, Merav. 1996. Seasonal diets of mink and martens: Effects of spatial and temporal changes in resource abundance. Fairbanks, AK: University of Alaska Fairbanks. 207 p. Dissertation. [76902]
  • 16. Bull, Evelyn L. 2000. Seasonal and sexual differences in American marten diet in northeastern Oregon. Northwest Science. 74(3): 186-191. [43759]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 29. Buskirk, Steven William. 1983. The ecology of marten in southcentral Alaska. Fairbanks, AK: University of Alaska. 142 p. Dissertation. [76929]
  • 30. Campbell, Thomas M., III. 1979. Short term effects of timber harvest on pine marten ecology. Fort Collins, CO: Colorado State University. 71 p. Thesis. [76941]
  • 42. Clem, Mark K. 1975. Interspecific relationship of fishers and martens in Ontario during winter. In: Phillips, Robert L.; Jonkel, Charles, eds. Proceedings of the 1975 predator symposium; 1975 June 16-19; Missoula, MT. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station: 165-182. [76602]
  • 49. Douglass, Richard J.; Fisher, Lorne G.; Mair, Marnie. 1983. Habitat selection and food habits of marten, Martes americana, in the Northwest Territories. The Canadian Field-Naturalist. 97(1): 71-74. [76116]
  • 61. Fuller, Angela K.; Harrison, Daniel J. 2005. Influence of partial timber harvesting on American martens in north-central Maine. The Journal of Wildlife Management. 69(2): 710-722. [76064]
  • 74. Hargis, Christina Devin. 1981. Winter habitat utilization and food habits of the pine marten (Martes americana) in Yosemite National Park. Berkeley, CA: University of California. 57 p. Thesis. [76916]
  • 76. Hauptman, Tedd N. 1979. Spatial and temporal distribution and feeding ecology of the pine marten. Pocatello, ID: Idaho State University. 84 p. Thesis. [76933]
  • 83. Hickey, Jena R. 1997. The dispersal of seeds of understory shrubs by American martens, Martes americana, on Chichagof Island, Alaska. Laramie, WY: University of Wyoming. 41 p. Thesis. [76899]
  • 88. Johnson, W. N.; Paragi, Thomas F.; Katnik, Donald D. 1995. The relationship of wildfire to lynx and marten populations and habitat in interior Alaska. Final Report 95-01. Galena, AK: U.S. Fish and Wildlife Service, Koyukuk/Nowitna Refuge Complex. 145 p. [77606]
  • 94. Koehler, Gary M. 1975. The effects of fire on marten distribution and abundance in the Selway-Bitterroot Wilderness. Moscow, ID: University of Idaho. 26 p. Thesis. [76942]
  • 109. Magoun, Audrey J.; Vernam, Donald J. 1986. An evaluation of the Bear Creek burn as marten (Martes americana) habitat in interior Alaska. Final Report: Special Project Cooperative Agreement AK-950-CAH-0. Fairbanks, AK: U.S. Department of the Interior; Alaska Deppartment of Fish and Game. 58 p. [76025]
  • 111. Martin, Sandra K. 1987. The ecology of the pine marten (Martes americana) at Sagehen Creek, California. Berkeley, CA: University of California. 239 p. Dissertation. [76909]
  • 112. Martin, Sandra K. 1994. Feeding ecology of American martens and fishers. In: Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press: 297-315. [65916]
  • 115. More, Gavin. 1978. Ecological aspects of food selection in pine marten, Martes americana. Edmonton, AB: University of Alberta. 94 p. Thesis. [76874]
  • 118. Nagorsen, David W.; Campbell, R. Wayne; Giannico, Guillermo R. 1991. Winter food habits of marten, Martes americana, on the Queen Charlotte Islands. The Canadian Field-Naturalist. 105(1): 55-59. [76496]
  • 123. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1996. Marten selection of postfire seres in the Alaskan taiga. Canadian Journal of Zoology. 74: 2226-2237. [28567]
  • 131. Poole Kim G.; Graf, Ron P. 1996. Winter diet of marten during a snowshoe hare decline. Canadian Journal of Zoology. 74(3): 456-466. [76115]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 142. Raine, R. Michael. 1987. Winter food habits and foraging behaviour of fishers (Martes pennanti) and martens (Martes americana) in southeastern Manitoba. Canadian Journal of Zoology. 65(3): 745-747. [76121]
  • 148. Schumacher, Thomas V.; Bailey, Theodore N.; Portner, Mary F.; Bangs, Edward E.; Larned, William W. 1989. Marten ecology and distribution on the Kenai National Wildlife Refuge, Alaska. Draft manuscript. Soldotna, AK: U.S. Fish and Wildlife Service, Kenai National Wildlife Refuge. 67 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab, Missoula, MT; FEIS files. [78733]
  • 151. Simon Neal P. P.; Schwab, Francis E.; LeCoure, Marcel I.; Phillips, Frank R. 1999. Fall and winter diet of martens, Martes americana, in central Labrador related to small mammal densities. The Canadian Field-Naturalist. 113(4): 678-680. [76111]
  • 152. Simon, Terri Lee. 1980. An ecological study of the marten in the Tahoe National Forest, California. Sacramento, CA: California State University. 187 p. Thesis. [76935]
  • 158. Soutiere, Edward C. 1989. Effects of timber harvesting on marten in Maine. The Journal of Wildlife Management. 43(4): 850-860. [76074]
  • 165. Strickland, Marjorie A.; Douglas, Carman W. 1987. Marten. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 531-546. [50679]
  • 169. Thompson, Ian D. 1986. Diet choice, hunting behaviour, activity patterns, and ecological energetics of marten in natural and logged areas. Kingston, ON: Queen's University at Kingston. 181 p. Dissertation. [76913]
  • 96. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. The Journal of Wildlife Management. 41(3): 500-505. [7637]
  • 136. Powell, Roger A.; Buskirk, Steven W.; Zielinski, William J. 2003. Fisher and marten (Martes pennanti and Martes americana). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: The Johns Hopkins University Press: 635-649. [64017]
  • 171. Thompson, Ian D.; Colgan, Patrick W. 1987. Numerical responses of martens to a food shortage in northcentral Ontario. The Journal of Wildlife Management. 51(4): 824-835. [76040]
  • 181. Weckwerth, Richard P.; Hawley, Vernon D. 1962. Marten food habits and population fluctuations in Montana. The Journal of Wildlife Management. 26(1): 55-74. [76088]
  • 183. Willson, Mary F. 1993. Mammals as seed-dispersal mutualists in North America. Oikos. 67: 159-176. [27081]
  • 190. Zielinski, William J.; Spencer, Wayne D.; Barrett, Reginald H. 1983. Relationship between food habits and activity patterns of pine martens. Journal of Mammalogy. 64(3): 387-396. [76043]
  • 58. Francis, George Reid. 1958. Ecological studies of marten, Martes americana, in Algonquin Park, Ontario. Vancouver, BC: University of British Columbia. 74 p. [+ appendices]. Thesis. [76922]
  • 110. Marshall, William H. 1942. The biology and management of the pine marten in Idaho. Ann Arbor, MI: University of Michigan. 107 p. [+ appendices]. Dissertation. [76923]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Martes americana is an opportunistic feeder. The diet consists primarily of small mammals, including squirrels and rodents. Occasionally birds, fruit, nuts, insects, and carrion are eaten as well. American martens usually kill their prey with a quick, powerful bite to the back of the prey animal's neck. American martens sometimes have fast-paced chases in trees with a favorite prey item, red squirrels.

American martens eat mostly meat. They are willing to eat any animal they can catch. Most of the time, they catch squirrels and micebut can sometimes eat birds, fruit, nuts, insects, and carrion.

American martens kill their prey with a quick, powerful bite to the back of the prey animal's neck. They sometimes have fast-paced chases in trees with red squirrels.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

As predators, American martens may have significant impact on prey populations, helping to structure the forest community.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators have not been reported for American martens. However, it is likely that young martens may be vulnerable to large carnivores like Canis lupus or owls.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

As predators, American martens may have significant impact on prey populations, helping to structure the forest community.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators have not been reported for American martens. However, it is likely that young martens may be vulnerable to large carnivores like wolves or owls.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Martes americana preys on:
Ochotonidae
Arvicolinae
Spermophilus
Junco hyemalis
Corvus corax
Clethrionomys californicus
Microtus longicaudus
Microtus xanthognathus
Arborimus longicaudus

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: The number of occurrences has not been determined using standardized criteria, btut surely there are hundreds of fairly distinct populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total population size is unknown but probably is at least several hundred thousand; for example, the harvest in North America in the 1983-1984 trapping season was nearly 190,000 (Novak et al. 1987). The Newfoundland population was estimated at less than 500 in early the 1990s, down from 630-875 in the early 1980s (Snyder, 1986 COSEWIC report).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Basically solitary. Densities of about l-2 per sq km have been recorded in early fall.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indirect Effects of Fire: Fire effects on food

More info for the terms: cover, high-severity fire, mesic, presence, sere, severity, surface fire, wildfire, xeric

American marten consume a wide variety of foods throughout their range, preferring certain food items in some areas and not others. Different prey species also have variable habitat needs, all of which might be impacted differently by fire or other ecological factors [88] (see Food Habits). A generalist diet and variability in prey habitat preferences makes it difficult to make broad generalizations about the impact of fire on American marten food resources. Numerous sources suggest that fire alters American marten food availability, largely through changes in diversity and/or abundance ([8,91,94,96,109,123,150,155,161,178], reviews by [68,189]). Some sources suggest that food resources may be reduced immediately after fire [23,96], while reviews suggests that certain food resources may be more available or abundant after fire [65,68,119,189], at least during the snow-free seasons [22,179]. Trappers in central Alaska attributed American marten presence in burned areas to an increase in microtine (Microtinae) rodents, the presence of berries, and the availability of downed timber available after fire [161]. In interior Alaska, small mammal species diversity was greater in black spruce forest burned by wildfire 7 to 8 years previously compared to unburned areas, and small mammal abundance in burned areas was equal to or surpassed that in unburned areas. Meadow voles (Microtus spp.), considered the preferred prey in this study area, were more common within the burned area, while red-backed voles (Myodes spp.) were more common outside the burned area [109]. See Wildfire Case Study 1 for more information on this study. Similar results were documented in a different study area in interior Alaska; American marten abundance was highest in an early postfire sere (postfire years 6-9) containing a mixture of birch (Betula spp.) and black spruce regeneration. This postfire sere had the highest abundance of yellow-cheeked voles, a preferred food item. This postfire sere also contained more diverse prey items and lacked the fluctuations in northern red-backed vole (M. rutilus) populations observed in other postfire seres [88]. See Wildfire Case Study 2 for more information on this study.

In east-central Alaska, the abundance and diversity of potential American marten small mammal prey differed between approximately 24-year-old quaking aspen stands regenerating from a severe fire and unburned black and white spruce forest. Northern red-backed voles were ubiquitous across cover types, while yellow-cheeked voles were most abundant in the burned habitat. Both species were potential prey items, though their relative value to American marten in this study area was not discussed. Over the 3 years of study, microtine rodent populations declined in burned forests and showed no clear trend in unburned forest. The author did not attribute small mammal population declines in burned areas to postfire conditions or any other factor. The study area did experience unusually cold spring temperatures [150].

Relative abundance of small mammals captured during August 1991-1993 in areas severely burned approximately 24 years previously and unburned areas, Yukon-Charley Rivers National Preserve, Alaska [150]
Small mammal species 1991 1992 1993
Burned Unburned Burned Unburned Burned Unburned
All microtine rodents 24.7 7.3 11.9 11.5 5.6 2.5
Northern red-backed vole 13.9 6.3 7.8 10.8 4.9 2.2
Yellow-cheeked vole 10.8 0.9 4.1 0.5 0.7 0.2
Shrews (Soricidae) 6.8 4.2 1.5 0.6 7.1 3.9

The ability of burned areas to provide preferred food items may be related to several factors, including those related to fire (e.g., severity, size, time since fire) or local site characteristics (e.g., moisture regime). On the Kenai Peninsula, black spruce forest burned 59 years previously had sufficient cover to support American marten prey. However, a young forest of northern hardwoods and immature conifer saplings that burned 37 years previously did not [8]. Approximately 12 years after wildfire on mesic sites in north-central Idaho, one plot that experienced low-severity surface fire supported American marten prey, while another plot that experienced high-severity fire did not. Microtine rodents, occurring in 71% of summer-fall scats, were abundant in areas burned 40 to 60 years previously or in mesic sites within meadows. Areas burned 10 to 15 years previously and exhibiting xeric conditions supported high numbers of deer mice, which were not a favored prey item, and supported few microtine rodents [94,96].

While most studies examining American marten food items and fire concentrate on small mammals, it is also likely that fire affects the abundance and availability of plant species used as forage, particularly berries. American marten summer diets in north-central Idaho contained high amounts of fruits, insects, and ground squirrels, all of which were available in open meadows and burned areas [94,96]. Seven to 8 years after wildfire in Alaska, Vernam [178] noted that berry production was highest in extensive areas of burned open meadows and black spruce forest, which may have caused American marten to expand their home range into burned areas in the summer. See Wildfire Case Study 1 for more information on this study.

For more information on fire effects on American marten food items, see the following FEIS reviews: snowshoe hare, red squirrel, northern red-backed vole, meadow vole, deer mouse, Alaska blueberry, and ovalleaf huckleberry.

  • 8. Baltensperger, Andrew P. 2009. Behavior and distribution of American marten (Martes americana) in relation to snow and forest cover on the Kenai Peninsula, Alaska. Fort Collins, CO: Colorado State University. 69 p. Thesis. [76964]
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 65. Golden, Howard N. 1987. Survey of furbearer populations on the Yukon Flats National Wildlife Refuge. Final report: Cooperative Agreement Project 14-16-007-84-7416. [Fairbanks, AK: Alaska Department of Fish and Game; U.S. Fish and Wildlife Service. 86 p. [77607]
  • 68. Green, Rebecca E. 2007. Distribution and habitat associations of forest carnivores and an evaluation of the California Wildlife Habitat Relationships model for American marten in Sequoia and Kings Canyon National Parks. Arcata, CA: Humboldt State University. 90 p. Thesis. [77816]
  • 88. Johnson, W. N.; Paragi, Thomas F.; Katnik, Donald D. 1995. The relationship of wildfire to lynx and marten populations and habitat in interior Alaska. Final Report 95-01. Galena, AK: U.S. Fish and Wildlife Service, Koyukuk/Nowitna Refuge Complex. 145 p. [77606]
  • 94. Koehler, Gary M. 1975. The effects of fire on marten distribution and abundance in the Selway-Bitterroot Wilderness. Moscow, ID: University of Idaho. 26 p. Thesis. [76942]
  • 109. Magoun, Audrey J.; Vernam, Donald J. 1986. An evaluation of the Bear Creek burn as marten (Martes americana) habitat in interior Alaska. Final Report: Special Project Cooperative Agreement AK-950-CAH-0. Fairbanks, AK: U.S. Department of the Interior; Alaska Deppartment of Fish and Game. 58 p. [76025]
  • 123. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1996. Marten selection of postfire seres in the Alaskan taiga. Canadian Journal of Zoology. 74: 2226-2237. [28567]
  • 150. Shults, Bradley Scott. 2001. Abundance and ecology of martens (Martes americana ) in interior Alaska. Fairbanks, AK: University of Alaska. 79 p. Thesis. [76896]
  • 155. Slough, Brian G. 1989. Movements and habitat use by transplanted marten in the Yukon Territory. The Journal of Wildlife Management. 53(1): 991-997. [76073]
  • 91. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Environment Yukon, Fish and Wildlife Branch: 1-36. [14071]
  • 119. Nelson, Joanna L.; Avaleta, Erika S.; Chapin, F. Stuart, III. 2008. Boreal fire effects on subsistence resources in Alaska and adjacent Canada. Ecosystems. 11: 156-171. [69760]
  • 96. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. The Journal of Wildlife Management. 41(3): 500-505. [7637]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 179. Viereck, Leslie A.; Schandelmeier, Linda A. 1980. Effects of fire in Alaska and adjacent Canada--a literature review. BLM-Alaska Tech. Rep. 6; BLM/AK/TR-80/06. Anchorage, AK: U.S. Department of the Interior, Bureau of Land Management, Alaska State Office. 124 p. [28862]
  • 189. Yeager, Lee E. 1950. Implications of some harvest and habitat factors on pine marten management. Transactions, 15th North American Wildlife Conference. 15: 319-334. [16768]
  • 22. Bunnell, Fred L. 1980. Fire and furbearers. Unpublished report on file at: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 60 p. [Report prepared for: Department of Indian Affairs and Northern Development, Forest Resources Division]. [76967]
  • 161. Stephenson, Robert B. 1984. The relationship of fire history to furbearer populations and harvest. Research Final Report--Project No. W-222-2. Furbearer Research: Job No. 7.13R.--1 July 1982 through 30 June 1983. [Anchorage, AK]: Alaska Department of Fish and Game. 86 p. [76535]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indirect Effects of Fire: Fire effects on cover

More info for the terms: cover, presence, selection, wildfire

Fire may result in a short-term loss of cover (reviews by [23,96,189]) through consumption of woody structures ([46], review by [68]) and/or reduction of canopy cover [46,66,109,123,178]. However, fire may also create structures used for cover; many sources suggest that American marten use of burned areas is related to postfire structural diversity [104], including abundant snags ([65], review by [68]), downed wood ([65,109,123,161,178], review by [28]), and dense herbaceous growth ([109,178], review by [28]). Postfire activity may be concentrated around deadfall, as was documented in southwestern Yukon 25 years after a high-severity wildfire [155]. Similarly, researchers in northwestern Montana observed a juvenile hunting on and under large-diameter logs (>15 inches (40 cm)) in a regenerating lodgepole pine forest approximately 20 years after fire, despite a lack of canopy cover [23]. Downed woody structures or herbaceous vegetation appear to provide adequate cover in place of canopy cover ([23,109,123,178], review by [28]). See Wildfire Case Study 1 for more information on the extensive use of deadfall by American marten 7 to 8 years following wildfire in Alaska.

Local habitat features, such as the presence of riparian areas or a mosaic of burn patterns, may improve the suitability of burned areas for American marten by providing adequate cover. See Wildfire Case Study 1 for information about the importance of riparian areas in providing cover after wildfire. Several studies have documented American marten use of unburned inclusions within burned areas [43,53,109,155,161,178], though one study in central Alaska did not detect selection for unburned inclusions [88,123]. Such inclusions have been used as resting sites [53,139], and interviews with trappers in interior Alaska suggested that unburned inclusions and the edges of burned areas were often centers of American marten activity [161]. In southwestern Yukon, 15 American marten used an area burned by severe wildfire about 25 years previously. The burned area had sparse lodgepole pine, quaking aspen, and willow regeneration, abundant deadfall, and a few small (<25 acre (10 ha)) unburned inclusions. American marten activity was concentrated around deadfall and the unburned inclusions [155]. Ten months after wildfire in southwestern Montana, one individual was located in an unburned 1.2-acre (0.5 ha) island of lodgepole pine forest within the burned area, approximately 0.6 mile (1 km) from contiguous, unburned lodgepole pine forest [53].

Nearby intact forest may also provide important habitat for American marten using burned areas. Intact spruce (Picea spp.) forest adjacent to burned areas was listed as a center of American marten activity by trappers from central Alaska [161]. Also in central Alaska, winter track surveys suggested high American marten use of unburned spruce forest adjacent to an area that burned 8 years previously [84]. In southwestern Yukon, 25 years after a severe wildfire, 13 transplanted, transient American marten spent a few days in a burned area with lodgepole pine, quaking aspen, and willow, but returned to unburned white spruce forest [155]. The ecotone between burned and unburned areas has been described as excellent foraging habitat for American marten ([91], review by [189]), offering both cover and access to prey items. The proximity of intact forest may also impact the ability of American marten to colonize burned areas by providing a source population [123].

American marten often use the edges of burned areas ([88,91,161], review by [189]) but also use or travel through the interior of burned areas [53,103,109,155]. In southwestern Yukon, 25 years after a severe wildfire, 13 transplanted, transient American marten moved ≥10 miles (20 km) into the burned area at times [155].

  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 43. Coffin, Kenneth Wesley. 1994. Population characteristics and winter habitat selection by pine marten in southwest Montana. Bozeman, MT: Montana State University. 94 p. Thesis. [76932]
  • 53. Fager, Craig William. 1991. Harvest dynamics and winter habitat use of the pine marten in southwestern Montana. Bozeman, MT: Montana State University. 73 p. Thesis. [76939]
  • 65. Golden, Howard N. 1987. Survey of furbearer populations on the Yukon Flats National Wildlife Refuge. Final report: Cooperative Agreement Project 14-16-007-84-7416. [Fairbanks, AK: Alaska Department of Fish and Game; U.S. Fish and Wildlife Service. 86 p. [77607]
  • 66. Gosse, John W.; Cox, Rodney; Avery, Shawn W. 2005. Home-range characteristics and habitat use by American martens in eastern Newfoundland. Journal of Mammalogy. 86(6): 1156-1163. [76061]
  • 68. Green, Rebecca E. 2007. Distribution and habitat associations of forest carnivores and an evaluation of the California Wildlife Habitat Relationships model for American marten in Sequoia and Kings Canyon National Parks. Arcata, CA: Humboldt State University. 90 p. Thesis. [77816]
  • 88. Johnson, W. N.; Paragi, Thomas F.; Katnik, Donald D. 1995. The relationship of wildfire to lynx and marten populations and habitat in interior Alaska. Final Report 95-01. Galena, AK: U.S. Fish and Wildlife Service, Koyukuk/Nowitna Refuge Complex. 145 p. [77606]
  • 103. Latour, Paul B.; Maclean, Norm; Poole, Kim G. 1994. Movements of martens, Martes americana, in burned and unburned taiga in the Mackenzie Valley, Northwest Territories. Canadian Field-Naturalist. 108(3): 351-354. [25918]
  • 109. Magoun, Audrey J.; Vernam, Donald J. 1986. An evaluation of the Bear Creek burn as marten (Martes americana) habitat in interior Alaska. Final Report: Special Project Cooperative Agreement AK-950-CAH-0. Fairbanks, AK: U.S. Department of the Interior; Alaska Deppartment of Fish and Game. 58 p. [76025]
  • 123. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1996. Marten selection of postfire seres in the Alaskan taiga. Canadian Journal of Zoology. 74: 2226-2237. [28567]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 155. Slough, Brian G. 1989. Movements and habitat use by transplanted marten in the Yukon Territory. The Journal of Wildlife Management. 53(1): 991-997. [76073]
  • 46. de Vos, Antoon. 1951. Recent findings in fisher and marten ecology and management. Transactions, 16th North American Wildlife Conference. 16: 498-507. [16609]
  • 84. Hinkes, Michael; Campbell, Bruce. 1980. Bear Creek burn: Winter reconnaissance report. Anchorage, AK: U.S. Department of the Interior, Bureau of Land Management, Anchorage District Office. 15 p. [78736]
  • 91. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Environment Yukon, Fish and Wildlife Branch: 1-36. [14071]
  • 104. Lieffers, Victor J.; Woodard, Paul M. 1995. Silvicultural systems for maintaining marten and fisher in the boreal forest. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 407-418. [76956]
  • 96. Koehler, Gary M.; Hornocker, Maurice G. 1977. Fire effects on marten habitat in the Selway-Bitterroot Wilderness. The Journal of Wildlife Management. 41(3): 500-505. [7637]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 189. Yeager, Lee E. 1950. Implications of some harvest and habitat factors on pine marten management. Transactions, 15th North American Wildlife Conference. 15: 319-334. [16768]
  • 161. Stephenson, Robert B. 1984. The relationship of fire history to furbearer populations and harvest. Research Final Report--Project No. W-222-2. Furbearer Research: Job No. 7.13R.--1 July 1982 through 30 June 1983. [Anchorage, AK]: Alaska Department of Fish and Game. 86 p. [76535]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indirect Effects of Fire: Response to fire and use of burned areas

More info for the terms: bog, cover, density, frequency, hardwood, mixed-severity fire, natural, succession, taiga, tree, wildfire

Fire may indirectly affect American marten abundance, home range characteristics and use, dispersal, and mortality.

Fire effects and abundance: Fire may temporarily displace American marten, as was suggested following the 1988 Yellowstone fires [67]. American marten have been detected immediately following fire [139] and in areas regenerating from fire over a wide range of stand ages. In Sequoia-Kings Canyon National Park, several American marten were detected from May to mid-October at sites with a recent history of fire (prescribed fire, wildfire from natural or accidental ignition). There were >10 American marten detections in areas burned in the past 2 to 30 years [68]. Interviews from trappers in interior Alaska suggested that there was no consistent numerical response of American marten to fire; some trappers observed higher American marten abundance in burned areas, while others observed lower abundance or complete absence in burned areas [88,161]. Trappers also noted that in areas with established American marten populations, extensive use of burned areas by American marten could occur as soon as 1 to 3 years after fire. High populations often developed within 3 to 5 years in some areas, though populations in other areas did not recover for 6 to 10 years [161]. Two juvenile American marten were found only in unburned bog habitats immediately after a 160,000-acre (65,000 ha) mixed-severity fire in a black spruce forest in southeastern Manitoba. Six months after the fire, one individual spent 86.0% of its time on burnt coniferous ridges and only 6.7% of its time in unburned bogs [139].

It is difficult to determine how American marten abundance changes over time in burned areas, because no studies to date (2010) had documented long-term trends from a single area. While a few studies present data from burned areas of different ages, the results are not comparable due to different times since fire, American marten survey methods, fire characteristics, and local differences in plant community response to fire. In burned boreal forest (white spruce, black spruce, paper birch, quaking aspen, balsam poplar) of interior Alaska, American marten track densities were higher in an area burned 6 years previously compared to an area burned 35 years previously [65]. One study found American marten abundance increased with time since fire. On the Kenai Peninsula, American marten were detected 4 times as frequently in forests regenerating from a wildfire 59 years previously compared to forests regenerating from a wildfire 37 years previously. The older forest—comprised of mature black spruce—contained "ample cover and structure for supporting marten and their prey", while the younger forest—containing a mixture of northern hardwood species and immature coniferous saplings—lacked appropriate cover, structure, and potentially prey habitat [8].

Other than the observations by trappers that some areas may experience higher American marten abundance following fire [161], only 1 source suggests that American marten numbers may increase following fire. A review of the effects of fire on furbearers reports that 15 to 18 years after a "large" forest fire in Yukon, 8 American marten were harvested in a burned area where none had been harvested previously [22].

A few studies report low detection rates or use of burned areas by American marten. In Ontario, American marten were essentially absent from "recently burned-over areas" of regenerating mixed or pure stands of quaking aspen and/or paper birch. The burned areas offered little cover and few denning options in trees [46]. In northwestern Montana, researchers had limited live trapping success in burned areas; trapping success was highest along the edge between a mature mixed-conifer forest and young lodgepole pine forest [77]. In southwestern Montana, American marten exhibited low use of areas burned 1 to 2 years earlier [53]. In eastern Newfoundland, black spruce-balsam fir forests that had burned approximately 15 to 20 years earlier had <25% canopy cover; American marten used these forests less than expected based on availability, while mature black spruce-balsam fir forests were used more than expected (P<0.05) [66]. In southeastern Labrador, American marten used black spruce-balsam fir forest burned 42 years previously in proportion to its availability [156].

One study documented higher American marten abundance in burned areas than in unburned areas and in a younger burned area than in an older burned area. American marten relative abundance was studied in burned and unburned boreal forests in interior Alaska by sampling winter tracks. Two burned areas of different ages were located in the study area: one 282,000-acre (114,000 ha) area that burned approximately 6 years prior to the study (younger burned area) and a 2 million-acre (829,000-ha) area that burned 35 years prior to the study (older burned area). At the time of sampling, the younger burned area was in the moss-herb/tall shrub-sapling stage of succession, with grasses, fireweed (Chamerion angustifolium), paper birch, quaking aspen, and balsam poplar dominating. The site was littered with fallen trees, contained abundant standing dead spruce, and had many inclusions of live, mature spruce and deciduous trees. The older burned area was in the dense tree stage of forest succession, with mosaics of pure and mixed stands of white spruce, quaking aspen, paper birch, balsam poplar, and willow. Across the entire study area, including both burned and unburned forest, some of the highest American marten track densities were found near or inside the younger burned area, concentrated around the perimeter. American marten track densities were higher in the younger burned area compared to the older burned area. The authors attributed this pattern to the high levels of deadfall and presumably abundant small mammal populations in the younger burned area [65].

Average density of American marten tracks inside and outside of the perimeter of an area burned 6 years previously in interior Alaska. Adapted from [65].
  Average tracks/km (range)
1985 (n=13) 1986 (n=14)
Inside 1.33 (0.31-3.64)* 2.11 (0.76-4.16)**
Outside 0.90 (0.21-1.75)* 1.16 (0.12-2.03)***
*Values with different numbers of * are significantly different (P<0.1).

One author suggests that wildfire in south-central Alaska may have prevented American marten from dispersing through several narrow valleys from the eastern to the western side of the Kenai Peninsula, resulting in low overall abundance [5].

Fire effects and home range: American marten have large home ranges, and though individuals may exhibit high fidelity to an established home range, they often use core areas of their home range, may shift their home range boundaries, or may make major movements within home ranges on a routine basis. American marten are also capable of long-distance dispersal (see Home range for more information). These characteristics of home ranges, patterns of use, and mobility likely help minimize the negative effects of fire on American marten.

One study from northwestern Montana reported that home range boundaries seemed to coincide with the edge of large open meadows and burned areas [78]. Several studies have documented American marten with home ranges largely or entirely within burned areas [88,103,109,178]. Twenty-one years after a taiga wildfire in the Northwest Territories, 11 of 12 adult American marten had home ranges that incorporated 3% to 92% of the burned area (x=53%). Home ranges of 1 adult and 1 juvenile were entirely within the burned area. The authors concluded that the majority of individuals used the burned area extensively but not intensively. They also observed that home range size was large in this area compared to other studies [103]. See Wildfire Case Study 1 and Wildfire Case Study 2 for additional examples of American marten predominantly using burned areas.

Though it seems likely that American marten home ranges may shift in response to postfire conditions, only one study has documented home range use before and after fire. Immediately after a 160,000-acre (65,000 ha) mixed-severity fire in boreal forest of southeastern Manitoba, one juvenile female increased her use of black spruce-tamarack bogs in the snow-free season. While home range size did not change after the fire, black spruce-tamarack bogs comprised 32.9% of her home range prior to the fire, and 35.2% after the fire. Bogs were the only cover type that did not burn in the fire [139,140].

Fire effects and dispersal: Though some studies have documented dispersal through or from burned areas [88,103,109,139,178], it is not clear that postfire conditions caused the dispersal. Immediately following a 160,000-acre (65,000 ha) mixed-severity wildfire in the boreal forests of southeastern Manitoba, a juvenile male was located for 2 weeks in unburned black spruce-tamarack bogs before radio contact was lost. This individual was eventually killed by a trapper 38 miles (61 km) away. The author suspected that dispersal was caused by postfire conditions, but the juvenile may not have established a territory prior to the fire, making dispersal inevitable [139]. See Wildfire Case Study 2 for additional examples of American marten dispersing from a burned area.

Fire effects and mortality: It is not clear whether American marten mortality rates increase following fire. In Alaska, researchers suggested that mortality may be higher for American marten with home ranges within burned areas compared to those that have at least part of their home range in unburned habitat, though the authors admitted that this assertion was based on a small sample size and circumstantial evidence [109].

Use of burned areas for specific life history activities: American marten have been documented using burned areas for foraging and hunting, resting, traveling, and reproduction.

Several studies have documented American marten using burned areas for hunting or foraging [23,88,91,109,123,161,178] (see Wildfire Case Study 1 and Wildfire Case Study 2 ). Biologists with the Alaska Department of Fish and Game observed American marten foraging along the edges of recently burned forest [91]. Approximately 20 years after fire in northwest Montana, a juvenile American marten was observed hunting on and under large-diameter logs (>15 inches (40 cm)) in open areas along a creek in regenerating lodgepole pine forest [23]. See Fire effects on food for more information.

A few studies have documented American marten resting in burned areas [109,139,178]. In the summer following a 160,000-acre (65,000 ha) mixed-severity wildfire in the boreal forests of southeastern Manitoba, one resting site was located on the edge of an unburned black spruce-tamarack bog and was formed by the roots of a fallen jack pine [139]. See Wildfire Case Study 1 for more information.

American marten may travel through burned areas ([43,53], review by [28]). In southwestern Montana, radio-collared American marten crossed through extensive areas burned 1 to 2 years previously but were never located within the areas via radio-telemetry or snow tracking [53]. One American marten in Montana moved 7 miles (11 km) in 1 day, traveling through large areas of coniferous forest burned 4 years previously [43]. In Alaska, American marten routinely traveled through and within black spruce forest burned by wildfire 7 to 8 years previously [109]. See Wildfire Case Study 1 for more information.

One study has documented American marten reproduction in a burned area. In the Northwest Territories, one female's home range contained unburned black spruce taiga and black spruce taiga regenerating 21 years after a high-severity wildfire. She denned in the burned area and produced young [103]. In central Alaska, biologists found low ovulation rates, high population turnover, high dispersal frequency, and a juvenile-biased age structure in early postfire seres, suggesting that recently burned areas lacked the conditions necessary for successful reproduction [123]. See Wildfire Case Study 2 for more information on this study.

  • 5. Bailey, Theodore N. 1980. Factors influencing furbearer populations and harvest on the Kenai National Moose Range, Alaska. In: Chapman, Joseph A.; Pursley, Duane, eds. Worldwide furbearer conference: Proceedings; 1980 August 3-11; Frostburg, MD. Volume 1. Frostburg, MD: Worldwide Furbearer Conference: 249-272. [77784]
  • 8. Baltensperger, Andrew P. 2009. Behavior and distribution of American marten (Martes americana) in relation to snow and forest cover on the Kenai Peninsula, Alaska. Fort Collins, CO: Colorado State University. 69 p. Thesis. [76964]
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 43. Coffin, Kenneth Wesley. 1994. Population characteristics and winter habitat selection by pine marten in southwest Montana. Bozeman, MT: Montana State University. 94 p. Thesis. [76932]
  • 53. Fager, Craig William. 1991. Harvest dynamics and winter habitat use of the pine marten in southwestern Montana. Bozeman, MT: Montana State University. 73 p. Thesis. [76939]
  • 65. Golden, Howard N. 1987. Survey of furbearer populations on the Yukon Flats National Wildlife Refuge. Final report: Cooperative Agreement Project 14-16-007-84-7416. [Fairbanks, AK: Alaska Department of Fish and Game; U.S. Fish and Wildlife Service. 86 p. [77607]
  • 66. Gosse, John W.; Cox, Rodney; Avery, Shawn W. 2005. Home-range characteristics and habitat use by American martens in eastern Newfoundland. Journal of Mammalogy. 86(6): 1156-1163. [76061]
  • 68. Green, Rebecca E. 2007. Distribution and habitat associations of forest carnivores and an evaluation of the California Wildlife Habitat Relationships model for American marten in Sequoia and Kings Canyon National Parks. Arcata, CA: Humboldt State University. 90 p. Thesis. [77816]
  • 77. Hawley, Vernon D. 1955. The ecology of the marten in Glacier National Park. Missoula, MT: The University of Montana. 131 p. Thesis. [76943]
  • 78. Hawley, Vernon D.; Newby, Fletcher E. 1957. Marten home ranges and population fluctuations. Journal of Mammalogy. 38(2): 174-184. [76091]
  • 88. Johnson, W. N.; Paragi, Thomas F.; Katnik, Donald D. 1995. The relationship of wildfire to lynx and marten populations and habitat in interior Alaska. Final Report 95-01. Galena, AK: U.S. Fish and Wildlife Service, Koyukuk/Nowitna Refuge Complex. 145 p. [77606]
  • 103. Latour, Paul B.; Maclean, Norm; Poole, Kim G. 1994. Movements of martens, Martes americana, in burned and unburned taiga in the Mackenzie Valley, Northwest Territories. Canadian Field-Naturalist. 108(3): 351-354. [25918]
  • 109. Magoun, Audrey J.; Vernam, Donald J. 1986. An evaluation of the Bear Creek burn as marten (Martes americana) habitat in interior Alaska. Final Report: Special Project Cooperative Agreement AK-950-CAH-0. Fairbanks, AK: U.S. Department of the Interior; Alaska Deppartment of Fish and Game. 58 p. [76025]
  • 123. Paragi, Thomas F.; Johnson, W. N.; Katnik, Donald D.; Magoun, Audrey J. 1996. Marten selection of postfire seres in the Alaskan taiga. Canadian Journal of Zoology. 74: 2226-2237. [28567]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 140. Raine, R. Michael. 1982. Ranges of juvenile fisher, Martes pennanti, and marten, Martes americana, in southeastern Manitoba. The Canadian-Field Naturalist. 96(4): 431-438. [64010]
  • 156. Smith Adam C.; Schaefer, James A. 2002. Home-range size and habitat selection by American marten (Martes americana) in Labrador. Canadian Journal of Zoology. 80(9): 1602-1609. [76110]
  • 46. de Vos, Antoon. 1951. Recent findings in fisher and marten ecology and management. Transactions, 16th North American Wildlife Conference. 16: 498-507. [16609]
  • 67. Greater Yellowstone Coordinating Committee. 1988. Greater Yellowstone Area fire situation, 1988. Final report. Billings, MT: U.S. Department of Agriculture, Forest Service, Custer National Forest. 207 p. [38771]
  • 91. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Environment Yukon, Fish and Wildlife Branch: 1-36. [14071]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 22. Bunnell, Fred L. 1980. Fire and furbearers. Unpublished report on file at: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 60 p. [Report prepared for: Department of Indian Affairs and Northern Development, Forest Resources Division]. [76967]
  • 161. Stephenson, Robert B. 1984. The relationship of fire history to furbearer populations and harvest. Research Final Report--Project No. W-222-2. Furbearer Research: Job No. 7.13R.--1 July 1982 through 30 June 1983. [Anchorage, AK]: Alaska Department of Fish and Game. 86 p. [76535]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat associations: Denning

More info for the terms: association, cover, selection, snag, tree

Denning sites provide protection from predators, inclement weather, and thermal stress (reviews by [18,28]).

Denning structures: American marten use a variety of structures for natal and maternal denning. Natal den structures include the cavities of live trees [18], snags [18,37,76,147,182], logs [18,76,147], stumps, woody debris piles [6], root wads [6,18], red squirrel middens [18], and rock piles [18,147]. In southern Wyoming, 3 natal dens were in snags averaging 26 inches (66 cm) DBH. In northeastern Oregon most tree cavity natal dens were in grand fir (84%), with 30% of the cavity trees alive. Trees averaged 33 inches (83 cm) DBH and were 75 feet (23 m) tall. Most of the hollow logs used as dens were grand fir, averaging 79 feet (24 m) long and 29 inches (73 cm) in diameter at the largest end. All logs had hollow chambers. Those chambers that could be measured averaged 8 to 10 inches (20-25 cm) in diameter inside. Underground natal dens were in rocky areas, under root wads, or under red squirrel middens. Natal dens were described as more secure than resting sites; they were dry, insulated, and inaccessible to predators other than other American marten [18]. In Grand Teton National Park, "nesting" sites were in hollow narrowleaf cottonwoods (Populus angustifolia) (7 standing and 1 fallen). The cavity at one nesting site was 33 feet (10 m) above the ground, and the entrance hole was 7 inches (18 cm) in diameter. Den height in standing trees ranged from 10 to 33 feet (3-10 m) above the ground. Mean DBH of 7 denning trees was 31 inches (79 cm) [76].

Maternal den structures include the branches, cavities or broken tops of live trees [89,106,147,154,187,188], snags [89,147,154], rock piles [32,58], logs [58,147,187,188], witch's brooms [106], and red squirrel nests or middens [147]. Five maternal dens in south-central Oregon were in large live or dead standing trees >29 inches (73 cm) DBH [89]. In northern Wisconsin, 6 of 7 maternal dens were in standing trees >20 inches (50 cm) DBH; no underground structures were used, and no association with coarse woody debris was found [63]. In northwestern Maine, 5 of 6 maternal dens were in hollow northern whitecedar logs or in mature northern whitecedar trees (DBH ranging from 20 to 30 inches (40-70 cm)); the remaining den was in a mature sugar maple [187,188]. In southern Wyoming, the mean diameter of 17 log maternal dens was 21 inches (53 cm), and 26 maternal dens were in snags averaging 22 inches (55 cm) DBH [147].

Structures (% of total) used as natal and maternal dens of female American marten in southern Wyoming. Adapted from [147].
Structure Natal dens (n=18) Maternal dens (n=97)
Log 6 18
Snag 17 27
Live tree 0 2
Rock 11 31
Red squirrel nest 0 4
Artificial log* 11 4
Red squirrel midden 56 12
Other** 0 3
*Logs from old cabins or slash piles.
**1 ground nest and 1 abandoned burrow of unknown origin.

Structures (% of total) used as natal and maternal denning sites by American marten in northeastern Oregon over 5 years (adapted from [18])
Structure Natal den (n=11) Maternal den (n=19)
Tree cavity 73 21
Hollow log 0 58
Underground 27 10
Slash pile 0 10

Use of denning structures may be influenced by availability. A study comparing denning sites in Oregon and Washington reported that structures varied by study area; females chose to den more often in coarse woody debris and slash in Oregon and in live trees and snags in Washington, which the authors attributed to availability. Trees used for denning were larger than what was generally available, with 90% and 76% of denning trees >20 inches (50 cm) DBH in Washington and Oregon, respectively [143].

Structures used by American marten for maternal denning in Oregon and Washington (% of total in parentheses) [143]
Structure Oregon Washington
Live tree 6 (19) 14 (54)
Snag 5 (16) 8 (31)
Single log- bole 10 (32) 1 (4)
Logging slash 9 (29) 2 (8)
Rock 0 1(4)
Animal burrow 1 (3) 0
Total 31 26

Denning habitat characteristics: Few studies describe in detail the habitat characteristics at American marten den sites, likely because few studies locate enough dens to make associations clear. In southern Wyoming, where researchers identified 18 natal dens and 97 maternity dens, structural characteristics associated with late-successional forests were important for den sites selected by females. For maternal dens, predictive models identified the number of red squirrel middens as the most important selection variable, followed by number of snags 10 to 15 inches (20-40 cm) DBH, number of snags ≥16 inches (41 cm) DBH, and number of hard logs ≥16 inches (41 cm) in diameter. For natal dens, number of middens, number of Engelmann spruce and subalpine fir >10 inches (20 cm) DBH, and number of hard logs ≥16 inches (41 cm) in diameter were the most important selection variables. Canopy cover was not significantly different at den sites compared to random sites, averaging 67.4% at natal dens, 58.2% at maternal dens, and 58.2% at random sites. The authors suggest that female American marten may be more selective in choosing natal dens than maternal dens, though this hypothesis was not tested [147]. On Vancouver Island, British Columbia, 7 natal dens were found in 30- to 40-year-old second-growth forest [6]. In the Northwest Territories, one female denned and produced young within an area burned 21 years previously [103].

  • 6. Baker, Judith Marie. 1993. Habitat use and spatial organization of pine marten on southern Vancouver Island, British Columbia. Burnaby, BC: Simon Fraser University. 134 p. Thesis. [76905]
  • 18. Bull, Evelyn L.; Heater, Thad W. 2000. Resting and denning sites of American martens in northeastern Oregon. Northwest Science. 74(3): 179-185. [37479]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 32. Carroll, Carlos. 2007. Interacting effects of climate change, landscape conversion, and harvest on carnivore populations at the range margin: marten and lynx in the northern Appalachians. Conservation Biology. 21(4): 1092-1104. [76051]
  • 37. Clark, T. W.; Campbell, T. M.; Hauptman, T. N.; Weaver, J. L. 1980. Habitat ecology of the pine marten in Jackson Hole, Wyoming. In: Clark, Tim W. Population organizational systems and regulatory mechanisms of a forest carnivore (pine martens) in Grand Teton National Park. Final report: Contract No. CX-1200-8-B026. Pocatello, ID: Idaho State University, Biology Department: 2-9. [76987]
  • 63. Gilbert, Jonathan H.; Wright, John L.; Lauten, David J., Probst, John R. 1997. Den and rest-site characteristics of American marten and fisher in northern Wisconsin. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 135-145. [65890]
  • 76. Hauptman, Tedd N. 1979. Spatial and temporal distribution and feeding ecology of the pine marten. Pocatello, ID: Idaho State University. 84 p. Thesis. [76933]
  • 89. Jones, Lawrence L. C.; Raphael, Martin G. 1994. Ecology of American martens in a lodgepole pine-bitterbrush community in south-central Oregon: an early progress report. Northwest Science. 68(2): 133. Abstract. [76515]
  • 103. Latour, Paul B.; Maclean, Norm; Poole, Kim G. 1994. Movements of martens, Martes americana, in burned and unburned taiga in the Mackenzie Valley, Northwest Territories. Canadian Field-Naturalist. 108(3): 351-354. [25918]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 143. Raphael, Martin G.; Jones, Lawrence L. C. 1995. Characteristics of resting and denning sites of American martens in central Oregon and western Washington. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 146-165. [76953]
  • 147. Ruggiero, Leonard F.; Pearson, Dean E.; Henry, Stephen E. 1998. Characteristics of American marten den sites in Wyoming. The Journal of Wildlife Management. 62(2): 663-673. [76060]
  • 154. Slauson, Keith M.; Zielinski, William J. 2009. Characteristics of summer and fall diurnal resting habitat used by American martens in coastal northwestern California. Northwest Science. 83(1): 35. [76044]
  • 182. Wilbert, Connie J. 1992. Spatial scale and seasonality of habitat selection by American martens in southeastern Wyoming. Laramie, WY: University of Wyoming. 91 p. Thesis. [77043]
  • 187. Wynne, Kathleen M.; Sherburne, J. A. 1984. Summer home range use by adult marten in northwestern Maine. Canadian Journal of Zoology. 62: 941-943. [76041]
  • 58. Francis, George Reid. 1958. Ecological studies of marten, Martes americana, in Algonquin Park, Ontario. Vancouver, BC: University of British Columbia. 74 p. [+ appendices]. Thesis. [76922]
  • 188. Wynne, Kathleen Mary. 1981. Summer home range use by adult marten in northwestern Maine. Orono, ME: University of Maine. 19 p. [+ appendices]. Thesis. [76915]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Sources of Mortality

More info for the terms: avoidance, natural

Diseases: American marten host several internal and external parasites, including helminths, fleas (Siphonaptera), and ticks (Ixodida) (review by ([165]). American marten in central Ontario carried both toxoplasmosis and Aleutian disease, but neither affliction was suspected to cause significant mortality [166]. High American marten mortality in Newfoundland was caused by encephalitis [59].

Sources of Mortality: American marten are susceptible to predation and mortality from other natural causes. Trapping pressure causes high mortality in some areas.

Predators: American marten are vulnerable to predation from raptors and other carnivores. Some authors suggest that the threat of predation may be an important factor shaping American marten habitat preferences, a hypothesis inferred from their avoidance of open areas and from behavioral observations of the Eurasian pine marten (Martes martes) (review by [28]).

Specific predators vary by geographic region. In Newfoundland, red foxes (Vulpes vulpes) were the most frequent predator, though coyote (Canis latrans) and other American marten were also responsible for some deaths [80]. In deciduous forests in northeastern British Columbia, most predation was attributed to raptors [132]. Of 18 American marten killed by predators in northeastern Oregon, 8 were killed by bobcats (Lynx rufus), 4 by raptors, 4 by other American marten, and 2 by coyotes. Throughout the distribution of American marten, other predators include the great horned owl (Bubo virginianus), bald eagle (Haliaeetus leucocephalus), golden eagle (Aquila chrysaetos), Canada lynx (L. canadensis), mountain lion (Puma concolor) (reviews by [38,166]), fisher (M. pennanti) [139,142], wolverine (Gulo gulo), grizzly bear (Ursus arctos horribilis), American black bear (U. americanus), and gray wolf (C. lupus) [178]. In northeastern Oregon, most predation (67%) occurred between May and August, and no predation occurred between December and February [20].

Other sources of mortality: Trapping is a major source of mortality in some areas. In east-central Alaska, 72% of observed mortality was from trapping [150]. Of 28 deaths of known cause in western Quebec, 16 resulted from commercial trapping, and 12 were from natural causes including injury (6), predation (4), starvation (1), and disease (1) [135]. In Newfoundland, 75% of the human-caused mortality was incidental from snares set for snowshoe hares; the remaining 25% was from traps intended for American marten. Natural mortality accounted for 28% of American marten deaths [80]. American marten mortality may be biased towards certain segments of the population; in north-central Maine there was "substantial" predation mortality of transient females [85]. In Newfoundland trapping deaths were biased towards males and juveniles [80].

Other sources of mortality include drowning [168], starvation [59,80,168], exposure [20], choking, and infections associated with injury [80]. During live trapping, high mortality may occur if individuals become wet in cold weather (review by [38]). Several chemical contaminants (PCBs, DDT, mercury, chlordane, mirex, dierldrin) are carried by American marten, though there is no conclusive evidence of harmful effects (review by ([165]).

Survival rates: Survival rates vary by geographic region, exposure to trapping, habitat quality, and age. In an unharvested population in northeastern Oregon, the probability of survival of American marten ≥9 months old was 0.55 for 1 year, 0.37 for 2 years, 0.22 for 3 years, and 0.15 for 4 years. The mean annual probability of survival was 0.63 for 4 years [20]. In a harvested population in east-central Alaska, annual adult survival rates ranged from 0.51 to 0.83 over 3 years of study. Juvenile survival rates were lower, ranging from 0.26 to 0.50 [150]. In Newfoundland, annual adult survival was 0.83. Survival of juveniles from October to April was 0.76 in a protected population, but 0.51 in areas open to snaring and trapping [80]. In western Quebec, natural mortality rates were higher in clearcut areas than in unlogged areas [135].

Life span: American marten in captivity may live for 15 years. The oldest individual documented in a wild population was 14.5 years old (review by [28]).

  • 20. Bull, Evelyn L.; Heater, Thad W. 2001. Survival, causes of mortality, and reproduction in the American marten in northeastern Oregon. Northwestern Naturalist. 82(1): 1-6. [76058]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 38. Clark, Tim W.; Anderson, Elaine; Douglas, Carman; Strickland, Marjorie. 1987. Martes americana. Mammalian Species. 289: 1-8. [76016]
  • 59. Fredrickson, Richard John. 1990. The effects of disease, prey fluctuation, and clear cutting on American marten in Newfoundland. Logan, UT: Utah State University. 86 p. Thesis. [76926]
  • 80. Hearn, Brian J. 2007. Factors affecting habitat selection and population characteristics of American marten (Martes americana atrata) in Newfoundland. Orono, ME: The University of Maine. 226 p. Dissertation. [76888]
  • 85. Hodgman, Thomas P.; Harrison, Daniel J.; Phillips, David M.; Elowe, Kenneth D. 1995. Survival of American marten in an untrapped forest preserve in Maine. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 86-99. [76951]
  • 132. Poole, Kim G.; Porter, Aswea D.; de Vries, Andrew; Maundrell, Chris; Grindal, Scott D.; St. Clair, Collen Cassady. 2004. Suitability of a young deciduous-dominated forest for American marten and the effects of forest removal. Canadian Journal of Zoology. 82(3): 423-435. [76099]
  • 135. Potvin, Francois; Breton, Laurier. 1995. Short-term effects of clearcutting on martens and their prey in the boreal forest of western Quebec. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 452-474. [76958]
  • 139. Raine, R. Michael. 1981. Winter food habits, responses to snow cover, and movements of fisher (Martes pennanti) and marten (Martes americana) in southwestern Manitoba. Winnipeg, MB: University of Manitoba. 144 p. Thesis. [76920]
  • 142. Raine, R. Michael. 1987. Winter food habits and foraging behaviour of fishers (Martes pennanti) and martens (Martes americana) in southeastern Manitoba. Canadian Journal of Zoology. 65(3): 745-747. [76121]
  • 150. Shults, Bradley Scott. 2001. Abundance and ecology of martens (Martes americana ) in interior Alaska. Fairbanks, AK: University of Alaska. 79 p. Thesis. [76896]
  • 165. Strickland, Marjorie A.; Douglas, Carman W. 1987. Marten. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 531-546. [50679]
  • 166. Strickland, Marjorie A.; Douglas, Carman W.; Novak, Milan; Hunziger, Nadine P. 1982. Marten: Martes americana. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 599-612. [76017]
  • 168. Thomasma, Linda Ebel. 1996. Winter habitat selection and interspecific interactions of American martens (Martes americana) and fishers (Martes pennanti) in the McCormick Wilderness and surrounding area. Houghton, MI: Michigan Technological University. 116 p. Dissertation. [76871]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History

More info for the terms: cover, density, litter, natural, parturition, polygamous, torpor, tree

Description: The American marten is a long, slender-bodied weasel about the size of a mink with relatively large rounded ears, short limbs, and a bushy tail.

American marten have a roughly triangular head and sharp nose. Their long, silky fur ranges in color from pale yellowish buff to tawny brown to almost black. Their head is usually lighter than the rest of their body, while the tail and legs are darker. American marten usually have a characteristic throat and chest bib ranging in color from pale straw to vivid orange (review by [38]). Sexual dimorphism is pronounced, with males averaging about 15% larger than females in length and as much as 65% larger in body weight (review by [38]). Body length ranges from 1.5 to 2.2 feet (0.5-0.7 m). Adult weight ranges from 1.1 to 3.1 pounds (0.5-1.4 kg) and varies by age and location. Other than size, sexes are similar in appearance (review by [28]).  

American marten in southwest Montana.

American marten have limited body-fat reserves, experience high mass-specific heat loss, and have a limited fasting endurance. In winter, individuals may go into shallow torpor daily to reduce heat loss (review by [136]).

Breeding: American marten reach sexual maturity by 1 year of age, but effective breeding may not occur before 2 years of age (review by [136]). In captivity, 15-year-old females bred successfully (reviews by [38,166]). In the wild, 12-year-old females were reproductive [166].

Adult American marten are generally solitary except during the breeding season (review by [38]). They are polygamous, and females may have multiple periods of heat (review by [166]). Females enter estrus in July or August (review by [136]), with courtship lasting about 15 days (review by [38]). Embryonic implantation is delayed until late winter, with active gestation lasting approximately a month. Females give birth in late March or April to a litter ranging from 1 to 5 kits (review by [136]). Annual reproductive output is low according to predictions based on body size. Fecundity varies by age and year and may be related to food abundance (review by [28]). In northeastern Oregon, low population reproductive rates were associated with high levels of predation on females prior to weaning kits [20].

Denning behavior: Females use dens to give birth and to shelter kits. Dens are classified as either natal dens, where parturition takes place, or maternal dens, where females move their kits after birth (review by [28]). American marten females use a variety of structures for natal and maternal denning, including the branches, cavities or broken tops of live trees [18,89,106,147,154,187,188], snags [18,37,76,89,147,154,182], stumps [6], logs [18,58,76,147,187,188], woody debris piles [6], witch's brooms [106], rock piles [18,32,58,147], and red squirrel (Tamiasciurus hudsonicus) nests or middens [18,147]. See Denning for more information on denning structures and habitats associated with denning.

Females prepare a natal den by lining a cavity with grass, moss, and leaves (review by ([165]). In southern Wyoming, females moved kits frequently to new maternal dens once kits were >13 weeks old [82]. In another study in southern Wyoming, the average number of maternal dens per individual was 10.8, ranging from 5 to 24 [147]. In northwestern Maine, females moved kits from tree-cavity natal dens to groundlevel log maternal dens when kits were 7 to 8 weeks old, then moved kits back into large tree dens when they gained coordination at 12 to15 weeks old [187,188]. In southern Wyoming, females did not move kits from aboveground to ground structures between natal and maternal denning; many natal dens were in ground structures [147].

In southern Wyoming, most females spent a majority of their time (>50%) attending dens in both preweaning and weaning periods, with less time spent at dens as kits aged. Females were often away from dens from dusk to midnight [82]. Paternal care has not been documented (review by [28]).

Development and dispersal of young: Weaning occurs at 42 days. Young emerge from dens at about 50 days but may be moved by their mother before this (review by [28]). In northwestern Maine, kits were active but poorly coordinated at 7 to 8 weeks, gaining coordination by 12 to15 weeks [187,188]. Young reach adult body weight around 3 months (review by [136]).

Kits generally stay in the company of their mother through the end of their first summer, and most disperse in the fall (review by [28]). The timing of juvenile dispersal is not consistent throughout American marten's distribution, ranging from early August to October (review by [28]). In south-central Yukon, young-of-the-year dispersed from mid-July to mid-September, coinciding with the onset of female estrus [3]. Observations from Oregon [19] and Yukon [3] suggest that juveniles may disperse in early spring. Of 9 juvenile American marten that dispersed in spring in northeastern Oregon, 3 dispersed a mean of 20.7 miles (33.3 km) (range: 17.4-26.8 miles (28.0-43.2 km)) and established home ranges outside of the study area. Three were killed after dispersing distances ranging from 5.3 to 14.6 miles (8.6-23.6 km), and 3 dispersed a mean of 5.0 miles (8.1 km) (range: 3.7-6.0 miles (6.0-9.6 km)) but returned and established home ranges in the area of their original capture. Spring dispersal ended between June and early August, after which individuals remained in the same area and established a home range [19].

Daily activity patterns: American marten activity patterns vary by region (review by ([165]), though in general, activity is greater in summer than in winter ([18], reviews by [38,136]). American marten may be active as much as 60% of the day in summer but as little as 16% of the day in winter (review by [136]). In north-central Ontario individuals were active about 10 to 16 hours a day in all seasons except late winter, when activity was reduced to about 5 hours a day [169,173]. In south-central Alaska, American marten were more active in autumn (66% active) than in late winter and early spring (43% active) [29]. In northeastern California, more time spent was spent traveling and hunting in summer than in winter, suggesting that reduced winter activity may be related to thermal and food stress or may be the result of larger prey consumption and consequent decrease in time spent foraging [190].

American marten may be nocturnal or diurnal. Variability in daily activity patterns has been linked to activity of major prey species ([190], review by ([165]), foraging efficiency [29], gender [30], reducing exposure to extreme temperatures ([29,178], review by [165]), season ([76,190], review by [136]), and timber harvest [169]. In northeastern California, activity in the snow-free season (May-December) was diurnal, while winter activity was largely nocturnal [190]. In Grand Teton National Park, American marten activity peaked at midnight and late morning in spring. In summer, activity peaked at midnight, early morning, and mid-afternoon [76]. In south-central Alaska, American marten were nocturnal in autumn, with strong individual variability in diel activity in late winter. Activity occurred throughout the day in late winter and early spring [29]. In western Newfoundland, American marten were more active at night than during the day in winter; this result contrasts with other studies but may be explained by the generally warmer temperatures of the study region [51].

Daily and seasonal movement: Daily distance traveled may vary by age [150], gender, habitat quality [169], season [76], prey availability, traveling conditions, weather, and physiological condition of the individual [110]. Year-round daily movements in Grand Teton National Park ranged from 0 to 2.83 miles (0-4.57 km), averaging 0.6 mile (0.9 km) (n=88) [76]. In Glacier National Park, Montana, year-round daily movements averaged 0.4 mile (0.6 km), ranging from 0.2 to 1.7 miles (0.1-2.8 km) [23]. One American marten in south-central Alaska repeatedly traveled 7 to 9 miles (11-14 km) overnight to move between 2 areas of home range focal activity [29]. Two individuals in southwestern Montana routinely moved >4 miles (7 km) overnight [43]. One individual in central Idaho moved as much as 9 miles (14 km) a day in winter, but movements were largely confined to a 1,280-acre (518 ha) [110] area. Juvenile American marten in east-central Alaska traveled significantly farther each day than adults (x=1.4 miles (2.2 km) vs. 0.9 mile (1.4 km); P=0.001) [150]. In north-central Ontario, daily linear distance traveled was greater for males than females and for adults in logged than in unlogged forest (P<0.0001) [169].

Studies from Wyoming suggest that immigration and emigration are most likely to occur in the fall [39,40,76], with males more likely to move more than females [40]. American marten may also make smaller seasonal movements. Several studies have documented a seasonal shift in home range [6,29,129] (see Home range for more information). Two studies have documented seasonal migration in elevation. In south-central Alaska individuals moved to higher elevations in spring and to lower elevations in autumn, which the author attributed to food availability [29]. At the Kenai National Wildlife Refuge, south-central Alaska, individuals moved to higher elevations during the snow season, likely seeking the increased thermal protection offered by deep snow [148].

Population structure: American marten populations may contain many transient individuals. Of 85 American marten captured in northwestern Montana, 35% were residents (present in study area for >3 months), 55% were transients (present for <1 week), and 9% were temporary residents (present for >1 week but <3 months) [78]. In Wyoming, less than half of the American marten observed in Grand Teton National Park were considered residents and 33% were considered transients. On the Bridger-Teton National Forest, Wyoming, 67% of the population was considered residents, 7% were temporary residents, and 26% were transients [39].

Population age structure depends heavily on whether or not a population is trapped. Age structure of trapped populations responds mostly to the timing and intensity of harvest (review by [28]). Age structure of populations may also fluctuate in response to prey availability (review by [136]). Over a 3-year study in east-central Alaska, age structure of a trapped population was 49% juvenile (<1 year old), 26% yearling (1-2 years old), and 25% adult (≥ 2 years old) [150].

Population density: Compared to other carnivores, American marten population density is low for their body size. One review reports population densities ranging from 0.4 to 2.5 individuals/km² [28]. Population density may vary annually [60,64] or seasonally [3]. It may be influenced by several factors. Low population densities have been associated with low abundance of prey species ([60,150], reviews by [28,136,165]), environmental stress (e.g., weather conditions) [150], logging ([126,128,158], reviews by [28,165]), and trapping pressure (114, review by ([165]).One study from southern Ontario found no detectible relationship between trapping mortality and changes in American marten density, though it did find some evidence of density-dependent population growth [60].

Home range: Home range size of the American marten is extremely variable, with differences attributable to sex [6,19,26,29,129,132,156,187,188], year [66], geographic area (review by [28]), prey availability ([19,66,80,150], review by [28,165]), cover type, quality or availability ([19,80,126,156,178], review by [28,165]), habitat fragmentation [80], reproductive status [90], resident status [23], predation [19], and population density (18,116, review by ([165]). Home range size does not appear to be related to body size for either sex [156]. Home range size ranged from 0.04 mile² (0.1 km²) in Maine to 6.1 miles² (15.7 km²) in Minnesota for males, and 0.04 mile² (0.1 km²) in Maine to 3.0 miles² (7.7 km²) in Wisconsin for females (review by ([165]). For a review of American marten home range size and variability throughout its range as of 1989, see Buskirk and Lyman [26]. For more recent home range information, see the following sources: Alaska [150], Idaho [176], Maine [129], Michigan [168], Montana [43], Oregon [19], Wisconsin [186], Wyoming [120], British Columbia [6,106,132], Labrador [156], Newfoundland [66], Quebec [64]. Home range estimates are difficult to compare between studies because of different techniques used to obtain locations and/or to calculate areas (review by ([165]).

Males generally exhibit larger home ranges than females [6,19,26,29,129,132,156,187,188], which some authors suggest is due to more specific habitat requirements of females (e.g., denning or prey requirements) that limit their ability to shift home range [129]. However, studies in east-central Alaska [150] and southeastern Quebec [64] did not find male home range to be larger than female. In both studies, 2 females exhibited unusually large home ranges; in one study both individuals were juvenile [150], and in the other study, much of the home range consisted of logged forest [64]. Males and females in northeastern California appeared to have approximately equal home range size [152].

Home range is generally larger in logged than unlogged areas [61,80,126,135,158,172], though all studies supporting this assertion are from New England or eastern Canada. In northern Maine, regenerating clearcuts (3-18 years old) comprised 16% to 50% of the home range of the adults studied [162]. In north-central Ontario, distances between core areas of individual home ranges were greater in logged (<5 to >30 years) than unlogged forest (P<0.001) [173]. In northeastern British Columbia, removal of immature forest cover of 17% of the study area resulted in home range shifts at the individual level but no detectable impact at the population level, though 5 American marten dispersed out of the treated area and 1 died [132]. In southeastern Quebec, most predictive models included an element of human or natural disturbance to explain increases in home range size; home ranges tended to be larger as road density increased or the landscape contained a higher proportion of unlogged stand with a light outbreak of eastern spruce budworm (Choristoneura fumiferana) [64].

In Wyoming, home range size varied with no apparent pattern relative to age, season, or year, including years with timber harvesting [120]. Similarly, home range sizes did not differ when comparing undisturbed to clearcut (100% removal) and selectively cut (40% removal)) habitat in Wyoming, though individuals may have shifted their home range in response to these disturbances [40].

Home ranges are indicated by scent-marking. American marten male pelts often show signs of scarring on the head and shoulders, suggesting intrasexual aggression that may be related to home range maintenance (review by ([165]). Home range overlap is generally minimal or nonexistent between adult males [3,23,29,30,40,76,186] but may occur between males and females [3,23,29,30,40,111], adult males and juveniles [29,148], and between females [30,40,178]. In northeastern Wisconsin a few individual male home ranges overlapped extensively (88% overlap) in winter [186]. In Grand Teton National Park, male home range overlap was small or nonexistent except in the fall [76]. On Vancouver Island, British Columbia, overlap within and between the sexes generally occurred at the periphery of home ranges [6].

Individual American marten tend to exhibit high fidelity to an established home range [19,29,120,129], though observations in Grand Teton National Park suggested that home range boundaries frequently shift [76]. In north-central Maine males tended to show more seasonal and year-round fidelity to home range than females, with some females exhibiting high home range fidelity while others abandoned or shifted home ranges seasonally [129]. In north-central Maine adult males shifted or expanded their home range when bordering males died [129]. In south-central Alaska, one male shifted home range completely, but most others showed small seasonal shifts in concentration areas within an established home range [29]. Seasonal shifts in home range were observed in Alaska [29] and Vancouver Island, British Columbia [6], but not at a different site in Alaska [148].

Observations from Alaska [29], California [113,152], Idaho [110], and Vancouver Island, British Columbia [6], suggest that American marten may concentrate activity within small parts of their home range. In Alaska [148] and on Vancouver Island [6], core use areas shifted seasonally. In northern California, individuals would occupy small areas of their home range for a few weeks, then completely shift activity to a new area [113]. In central Idaho, daily winter movements generally do not extend beyond a 1 mile² (260 ha²) area, though throughout the winter an overall area 12 to 15 miles² (3,100-3,900 ha²) was used [110].

Several authors have reported that home range boundaries appear to coincide with topographical or geographical features. In northeastern California, movements and home range boundaries were influenced by cover, topography (forest-meadow edges, open ridgetop, lakeshores), and other American marten [152]. In south-central Alaska, home range boundaries included creeks and a major river [29]. In an area burned 8 years previously in interior Alaska, home range boundaries coincided with transition areas between riparian and nonriparian habitats [178]. In northwestern Montana, home range boundaries appeared to coincide with the edge of large open meadows and burned areas; the authors suggested that open areas represent a "psychological rather than physical barrier" [78].

  • 3. Archibald, W. R.; Jessup, R. H. 1984. Population dynamics of the pine marten (Martes americana) in the Yukon Territory. In: Olson, Rod; Hastings, Ross; Geddes, Frank, eds. Northern ecology and resource management: Memorial essays honouring Don Gill. Edmonton, Alberta: The University of Alberta Press: 81-97. [76502]
  • 6. Baker, Judith Marie. 1993. Habitat use and spatial organization of pine marten on southern Vancouver Island, British Columbia. Burnaby, BC: Simon Fraser University. 134 p. Thesis. [76905]
  • 18. Bull, Evelyn L.; Heater, Thad W. 2000. Resting and denning sites of American martens in northeastern Oregon. Northwest Science. 74(3): 179-185. [37479]
  • 19. Bull, Evelyn L.; Heater, Thad W. 2001. Home range and dispersal of the American marten in northeastern Oregon. Northwestern Naturalist. 82(1): 7-11. [76059]
  • 20. Bull, Evelyn L.; Heater, Thad W. 2001. Survival, causes of mortality, and reproduction in the American marten in northeastern Oregon. Northwestern Naturalist. 82(1): 1-6. [76058]
  • 23. Burnett, Gary W. 1981. Movement and habitat use of American marten in Glacier National Park, MT. Missoula, MT: University of Montana. 103 p. Thesis. [76945]
  • 26. Buskirk, Steven W.; McDonald, Lyman L. 1989. Analysis of variability in home-range size of the American marten. The Journal of Wildlife Management. 53(4): 997-1004. [76069]
  • 28. Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7-37. [29930]
  • 29. Buskirk, Steven William. 1983. The ecology of marten in southcentral Alaska. Fairbanks, AK: University of Alaska. 142 p. Dissertation. [76929]
  • 30. Campbell, Thomas M., III. 1979. Short term effects of timber harvest on pine marten ecology. Fort Collins, CO: Colorado State University. 71 p. Thesis. [76941]
  • 32. Carroll, Carlos. 2007. Interacting effects of climate change, landscape conversion, and harvest on carnivore populations at the range margin: marten and lynx in the northern Appalachians. Conservation Biology. 21(4): 1092-1104. [76051]
  • 37. Clark, T. W.; Campbell, T. M.; Hauptman, T. N.; Weaver, J. L. 1980. Habitat ecology of the pine marten in Jackson Hole, Wyoming. In: Clark, Tim W. Population organizational systems and regulatory mechanisms of a forest carnivore (pine martens) in Grand Teton National Park. Final report: Contract No. CX-1200-8-B026. Pocatello, ID: Idaho State University, Biology Department: 2-9. [76987]
  • 38. Clark, Tim W.; Anderson, Elaine; Douglas, Carman; Strickland, Marjorie. 1987. Martes americana. Mammalian Species. 289: 1-8. [76016]
  • 39. Clark, Tim W.; Campbell, Thomas M., III; Hauptman, Tedd N. 1989. Demographic characteristics of American marten populations in Jackson Hole, Wyoming. Great Basin Naturalist. 49: 587-596. [76033]
  • 40. Clark, Tim W.; Campbell, Tom M. 1979. Population organization and regulatory mechanisms of pine martens in Grand Teton National Park, Wyoming. In: Linn, Robert M., ed. Proceedings, 1st conference on scientific research in the National Parks: Vol. 2; 1976 November 9-12; New Orleans, LA. Transactions and Proceedings No. 5. Washington, DC: U.S. Department of the Interior, National Park Service: 293-295. [76021]
  • 43. Coffin, Kenneth Wesley. 1994. Population characteristics and winter habitat selection by pine marten in southwest Montana. Bozeman, MT: Montana State University. 94 p. Thesis. [76932]
  • 51. Drew, Gary S.; Bissonette, John A. 1997. Winter activity patterns of American martens (Martes americana): rejection of the hypothesis of thermal-cost minimization. Canadian Journal of Zoology. 75(5): 812-816. [76114]
  • 60. Fryxell, John M.; Falls, J. Bruce; Falls, E. Ann; Brooks, Ronald J.; Dix, Linda; Strickland, Majorie A. 1999. Density dependence, prey dependence, and population dynamics of martens in Ontario. Ecology. 80(4): 1311-1321. [76066]
  • 61. Fuller, Angela K.; Harrison, Daniel J. 2005. Influence of partial timber harvesting on American martens in north-central Maine. The Journal of Wildlife Management. 69(2): 710-722. [76064]
  • 64. Godbout, Guillaume; Ouellet, Jean-Pierre. 2008. Habitat selection of American marten in a logged landscape at the southern fringe of the boreal forest. Ecoscience. 15(3): 332. [76048]
  • 66. Gosse, John W.; Cox, Rodney; Avery, Shawn W. 2005. Home-range characteristics and habitat use by American martens in eastern Newfoundland. Journal of Mammalogy. 86(6): 1156-1163. [76061]
  • 76. Hauptman, Tedd N. 1979. Spatial and temporal distribution and feeding ecology of the pine marten. Pocatello, ID: Idaho State University. 84 p. Thesis. [76933]
  • 78. Hawley, Vernon D.; Newby, Fletcher E. 1957. Marten home ranges and population fluctuations. Journal of Mammalogy. 38(2): 174-184. [76091]
  • 80. Hearn, Brian J. 2007. Factors affecting habitat selection and population characteristics of American marten (Martes americana atrata) in Newfoundland. Orono, ME: The University of Maine. 226 p. Dissertation. [76888]
  • 82. Henry, Stephen E.; O'Doherty, Erin C.; Ruggiero, Leonard F.; Van Sickle, Walter D. 1995. Maternal den attendance patterns of female American martens. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 78-85. [76950]
  • 89. Jones, Lawrence L. C.; Raphael, Martin G. 1994. Ecology of American martens in a lodgepole pine-bitterbrush community in south-central Oregon: an early progress report. Northwest Science. 68(2): 133. Abstract. [76515]
  • 90. Katnik, Donald D.; Harrison, Daniel J.; Hodgman, Thomas P. 1994. Spatial relations in a harvested population of marten in Maine. The Journal of Wildlife Management. 58(4): 600-607. [76063]
  • 106. Lofroth, Eric Carl. 1993. Scale dependent analyses of habitat selection by marten in the sub-boreal spruce biogeoclimatic zone, British Columbia. Burnaby, BC: Simon Fraser University. 128 p. Thesis. [76907]
  • 111. Martin, Sandra K. 1987. The ecology of the pine marten (Martes americana) at Sagehen Creek, California. Berkeley, CA: University of California. 239 p. Dissertation. [76909]
  • 120. O'Doherty, Erin C.; Ruggiero, Leonard F.; Henry, Stephen E. 1995. Home-range size and fidelity of American martens in the Rocky Mountains of southern Wyoming. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 123-134. [76952]
  • 126. Payer, David C. 1999. Influences of timber harvesting and trapping on habitat selection and demographic characteristics of marten. Orono, ME: The University of Maine. 298 p. Dissertation. [76897]
  • 128. Phillips, David M. 1994. Social and spatial characteristics, and dispersal of marten in a forest preserve and industrial forest. Orono, ME: University of Maine. 112 p. Thesis. [76928]
  • 129. Phillips, David M.; Harrison, Daniel J.; Payer, David C. 1998. Seasonal changes in home-range area and fidelity of martens. Journal of Mammalogy. 79(1): 180-190. [76038]
  • 132. Poole, Kim G.; Porter, Aswea D.; de Vries, Andrew; Maundrell, Chris; Grindal, Scott D.; St. Clair, Collen Cassady. 2004. Suitability of a young deciduous-dominated forest for American marten and the effects of forest removal. Canadian Journal of Zoology. 82(3): 423-435. [76099]
  • 135. Potvin, Francois; Breton, Laurier. 1995. Short-term effects of clearcutting on martens and their prey in the boreal forest of western Quebec. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 452-474. [76958]
  • 147. Ruggiero, Leonard F.; Pearson, Dean E.; Henry, Stephen E. 1998. Characteristics of American marten den sites in Wyoming. The Journal of Wildlife Management. 62(2): 663-673. [76060]
  • 148. Schumacher, Thomas V.; Bailey, Theodore N.; Portner, Mary F.; Bangs, Edward E.; Larned, William W. 1989. Marten ecology and distribution on the Kenai National Wildlife Refuge, Alaska. Draft manuscript. Soldotna, AK: U.S. Fish and Wildlife Service, Kenai National Wildlife Refuge. 67 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab, Missoula, MT; FEIS files. [78733]
  • 150. Shults, Bradley Scott. 2001. Abundance and ecology of martens (Martes americana ) in interior Alaska. Fairbanks, AK: University of Alaska. 79 p. Thesis. [76896]
  • 152. Simon, Terri Lee. 1980. An ecological study of the marten in the Tahoe National Forest, California. Sacramento, CA: California State University. 187 p. Thesis. [76935]
  • 154. Slauson, Keith M.; Zielinski, William J. 2009. Characteristics of summer and fall diurnal resting habitat used by American martens in coastal northwestern California. Northwest Science. 83(1): 35. [76044]
  • 156. Smith Adam C.; Schaefer, James A. 2002. Home-range size and habitat selection by American marten (Martes americana) in Labrador. Canadian Journal of Zoology. 80(9): 1602-1609. [76110]
  • 158. Soutiere, Edward C. 1989. Effects of timber harvesting on marten in Maine. The Journal of Wildlife Management. 43(4): 850-860. [76074]
  • 162. Steventon, Douglas; Major, John T. 1982. Marten use of habitat in a commercially clear-cut forest. The Journal of Wildlife Management. 46(1): 175-182. [76076]
  • 165. Strickland, Marjorie A.; Douglas, Carman W. 1987. Marten. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 531-546. [50679]
  • 166. Strickland, Marjorie A.; Douglas, Carman W.; Novak, Milan; Hunziger, Nadine P. 1982. Marten: Martes americana. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 599-612. [76017]
  • 168. Thomasma, Linda Ebel. 1996. Winter habitat selection and interspecific interactions of American martens (Martes americana) and fishers (Martes pennanti) in the McCormick Wilderness and surrounding area. Houghton, MI: Michigan Technological University. 116 p. Dissertation. [76871]
  • 169. Thompson, Ian D. 1986. Diet choice, hunting behaviour, activity patterns, and ecological energetics of marten in natural and logged areas. Kingston, ON: Queen's University at Kingston. 181 p. Dissertation. [76913]
  • 172. Thompson, Ian D.; Colgan, Patrick W. 1991. Effects of logging on home range characteristics and hunting activity of marten Martes americana in Ontario. In: Bobek, B.; Perzanowski, K.; Regelin, W., eds. Global trends in wildlife management: Transactions, 18th International Union of Game Biologists (IUGB) Congress; 1987 August; Krokow, Poland. Krakow-Warszawa, Poland: Swiat Press: 371-374. [27424]
  • 176. Tomson, Scott Dean. 1998. Ecology and summer/fall habitat selection of American marten in northern Idaho. Missoula, MT: University of Montana. 75 p. Thesis. [76921]
  • 136. Powell, Roger A.; Buskirk, Steven W.; Zielinski, William J. 2003. Fisher and marten (Martes pennanti and Martes americana). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: The Johns Hopkins University Press: 635-649. [64017]
  • 173. Thompson, Ian D.; Colgan, Patrick W. 1994. Marten activity in uncut and logged boreal forests in Ontario. The Journal of Wildlife Management. 58(2): 280-288. [76106]
  • 178. Vernam, Donald J. 1987. Marten habitat use in the Bear Creek Burn, Alaska. Fairbanks, AK: University of Alaska. 72 p. Thesis. [76940]
  • 182. Wilbert, Connie J. 1992. Spatial scale and seasonality of habitat selection by American martens in southeastern Wyoming. Laramie, WY: University of Wyoming. 91 p. Thesis. [77043]
  • 186. Wright, John L. 1999. Winter home range and habitat use by sympatric fishers (Martes pennanti) and American martens (Martes americana) in northern Wisconsin. Stevens Point, WI: University of Wisconsin. 73 p. Thesis. [76885]
  • 187. Wynne, Kathleen M.; Sherburne, J. A. 1984. Summer home range use by adult marten in northwestern Maine. Canadian Journal of Zoology. 62: 941-943. [76041]
  • 190. Zielinski, William J.; Spencer, Wayne D.; Barrett, Reginald H. 1983. Relationship between food habits and activity patterns of pine martens. Journal of Mammalogy. 64(3): 387-396. [76043]
  • 113. Martin, Sandra K.; Barrett, Reginald H. 1983. The importance of snags to pine marten habitat in the northern Sierra Nevada. In: Davis, Jerry W.; Goodwin, Gregory A.; Ockenfeis, Richard A., technical coordinators. Snag Habitat management: proceedings of the symposium; 1983 June 7-9; Flagstaff, AZ. Gen. Tech. Rep. RM-99. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 114-116. [17824]
  • 58. Francis, George Reid. 1958. Ecological studies of marten, Martes americana, in Algonquin Park, Ontario. Vancouver, BC: University of British Columbia. 74 p. [+ appendices]. Thesis. [76922]
  • 110. Marshall, William H. 1942. The biology and management of the pine marten in Idaho. Ann Arbor, MI: University of Michigan. 107 p. [+ appendices]. Dissertation. [76923]
  • 188. Wynne, Kathleen Mary. 1981. Summer home range use by adult marten in northwestern Maine. Orono, ME: University of Maine. 19 p. [+ appendices]. Thesis. [76915]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Regime Table

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

American martens have complex means of communication. In addition to the scent marking so common in Mustelidae, they use vocalizations (huffs, chuckles, and screams). Physical contact is important between mates as well as between mothers and their offspring. The role of visual cues in communication has not been reported, but in many Mustelids, body postures play an important role in communication. It is likely that these animals are similar to other members of their family in this respect.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

American martens have complex means of communication. In addition to the scent marking so common in Mustelidae, they use vocalizations (huffs, chuckles, and screams). Physical contact is important between mates as well as between mothers and their offspring. The role of visual cues in communication has not been reported, but in many Mustelids, body postures play an important role in communication. It is likely that these animals are similar to other members of their family in this respect.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Activity may peak at dusk and dawn in summer; frequently observed by day in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

American martens can live for up to 17 years in captivity. Although martens in the wild probably do not live as long as those in captivity, wild females are still able to breed at the age of 12 years.

Range lifespan

Status: captivity:
17 (high) years.

Average lifespan

Status: captivity:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

American martens can live for up to 17 years in captivity. Although martens in the wild probably do not live as long as those in captivity, wild females are still able to breed at the age of 12 years.

Range lifespan

Status: captivity:
17 (high) years.

Average lifespan

Status: captivity:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.8 years (captivity) Observations: Including the pre-implantation time, the total gestation time can take between 180 and 274 days. Record longevity in captivity is 17.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds in summer. Implantation is delayed; litter of 1-5 (average 3-4, less when food scarce) is born in spring. Young arre weaned in about 6 weeks, apparently independent by August in Maine (Wynne and Sherburne 1984). Males are sexually mature in 1 year, females in 1-2 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

One male may mate with many females during a year. When females are ready to breed, they alert males by making scent markings in their territories. Before mating, a pair will wrestle and play together.

Mating System: polygynous

Breeding season is in June and August, but American martens have a strange kind of pregnancy. The growing baby martens do not develop right away. They spend about 200 days in a kind of suspended animation before they connect to the uterus of the mother. After this happens, the embryos develop for only 28 days. The 1 to 5 blind young (kits) are born in late March or early April in dens lined with dried plant material.

The young martens grow quickly. Their eyes open by the age of 39 , and they only drink their mother's milk until they are 42 days old. They are as big as their parents by 3.5 months, although they cannot breed themselved until they are 15 to 24 months of age.

Breeding interval: Females may breed four times in a season at 6-17 day intervals. Breeding season occurs once per year.

Breeding season: Breeding season is in June to August.

Range number of offspring: 1 to 5.

Average number of offspring: 2.6.

Range gestation period: 220 to 275 days.

Average weaning age: 42 days.

Range age at sexual or reproductive maturity (female): 15 to 24 months.

Range age at sexual or reproductive maturity (male): 15 to 24 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 30 g.

Average number of offspring: 3.

Not much is known about the parental behavior of these animals. Because they are mammals, we know that the female provides her young with milk and with a home for the first part of their lives. It is not clear how much males interact with their offspring.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating has been described as polygynous. During estrus, females use scent marks to advertize their sexual condition. Courtship between males and females can be quite protracted, and involves tumbling, playing and wrestling. In captivity, females reportedly exhibit between 1 and 4 periods of sexual receptivity, each of which lasts from 1 to 4 days. These occur at 6 to 17 day intervals throughout the breeding season.

Mating System: polygynous

The breeding season occurs from June to August. Implantation of the fertilized eggs is delayed, and does not take place until February. Although the total period of pregancy is between 220 and 275 days, after implantation in the uterine lining, the embryos develop for only 28 days. The 1 to 5 blind young (kits) are born in late March or early April in dens lined with dried plant material.

The young grow quickly. Eyes open by the age of 39 days. Young martens are weaned after 42 days. Full size is reached very quickly, around 3.5 months after birth. Sexual maturity is reached at 15 to 24 months of age.

Breeding interval: Females may breed four times in a season at 6-17 day intervals. Breeding season occurs once per year.

Breeding season: Breeding season is in June to August.

Range number of offspring: 1 to 5.

Average number of offspring: 2.6.

Range gestation period: 220 to 275 days.

Average weaning age: 42 days.

Range age at sexual or reproductive maturity (female): 15 to 24 months.

Range age at sexual or reproductive maturity (male): 15 to 24 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 30 g.

Average number of offspring: 3.

Information on the parental behavior of these animals is not readily available. However, as mammals, we know that the female nurses her offspring and provides them with protection and a home for the first part of their lives. Even though the role of males in parental care is not clear,adult males and females have been seen together with immature animals, presumably their offspring. Although American martens are larely solitary, it is still possible that males have some association with their offspring during rearing.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Martes americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCACAAATCGATGATTATTCTCCACAAATCACAAAGACATCGGAACTCTTTACCTTTTATTTGGCGCATGAGCCGGAATGGTAGGCACTGCATTAAGCCTATTGATTCGCGCTGAATTAGGTCAACCTGGCGCTCTGCTGGGGGATGACCAAATTTACAATGTGATTGTAACCGCCCATGCATTTGTAATAATTTTCTTTATAGTGATGCCCATTATAATCGGGGGCTTCGGAAACTGACTAGTGCCCTTAATAATCGGTGCACCTGATATGGCATTCCCACGTATGAACAACATAAGCTTCTGACTTCTACCTCCCTCTTTCCTTCTACTCTTAGCCTCTTCCATAGTGGAGGCGGGCGCAGGAACAGGATGAACCGTATACCCCCCTCTAGCAGGAAATCTAGCACACGCAGGAGCATCCGTAGATCTGACAATCTTTTCTCTACACCTGGCAGGCGTCTCATCCATCTTGGGGGCCATCAACTTTATTACAACTATCATCAATATGAAGCCTCCTGCAATATCGCAATACCAAACCCCTCTATTCGTATGATCCGTCCTAATCACAGCCGTACTTCTACTCCTATCCCTGCCAGTGTTGGCAGCCGGCATTACCATACTACTTACAGACCGAAATCTAAATACTACCTTCTTCGACCCCGCCGGAGGAGGGGACCCCATCCTGTATCAACACCTGTTTTGATTTTTTGGGCACCCCGAGGTATACATCCTAATTTTACCAGGATTTGGAATCATCTCGCACGTCGTAACATATTACTCAGGAAAGAAGGAACCATTCGGTTACATGGGCATGGTTTGAGCAATAATATCCATTGGGTTCTTGGGATTCATTGTATGGGCCCATCACATGTTTACCGTGGGAATGGATGTTGACACACGAGCATACTTCACCTCAGCCACTATAATTATCGCAATTCCAACAGGAGTAAAAGTGTTTAGCTGACTAGCCACCCTTCACGGAGGAAACATTAAATGATCGCCGGCCATACTGTGGGCCCTGGGTTTTATCTTTCTTTTCACAGTGGGTGGTTTAACAGGTATTGTGCTATCAAACTCGTCATTGGATATCGTTCTCCACGACACATACTATGTAGTAGCCCACTTCCATTACGTTCTCTCAATGGGAGCAGTTTTCGCAATCATAGGCGGATTCGTCCACTGATTCCCCTTATTCACAGGTTATACACTAAACGATATTTGAGCAAAAATTCACTTCACGATCATATTCGTAGGAGTAAATATGACATTCTTCCCCCAACACTTCCTAGGCCTATCAGGCATGCCCCGACGATATTCCGACTACCCAGATGCCTACACCACATGAAACACAGTATCTTCCATAGGTTCATTCATTTCATTAACTGCGGTCATGCTAATAATCTTCATAATTTGAGAAGCATTCGCATCCAAACGAGAAGTACTAACTGTAGAACTCACCTCAACAAATATTGAATGATTACACGGATGTCCTCCTCCATACCACACATTCGAAGAACCAACCTACGTACTATCAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Martes americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in northern North America, timber harvest and excessive harvest led to extirpations in the southern part of the range; natural reestablishment and reintroduction programs (aided by reforestation and trapping restrictions) have contributed to a moderate comeback in some areas; adequate population data are unavailable for much of the range, but the total population size is at least several hundred thousand and the species can be regarded as secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as the species has a wide distribution range and is present in numerous protected areas. It may be undergoing to some localized declines due to hunting and habitat loss due to clear-cutting practices, however, reintroduction programs have contributed to a moderate comeback in some areas. Adequate population data are unavailable for much of the range, but the total population size is at least several hundred thousand individuals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection of pelts has reduced populations in many parts of the species range. The destruction of coniferous forest habitat has also led to decreased numbers. In spite of these threats, American martens are not considered endangered.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species, and several subspecies of American marten, have state and provincial legal status. Information on state- and province-level protection status of animals in the United States and Canada is available at NatureServe, though recent changes in status may not be included.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

Martes americana subsp. humboldtensis is listed as a Candidate subspecies [177].
  • 177. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection of pelts has reduced populations in many parts of the species range. The destruction of coniferous forest habitat has also led to decreased numbers. In spite of these threats, American martens are not considered endangered.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Adequate trend data are unavailable for much of the range. Natural reestablishment and reintroduction programs have contributed to a moderate comeback in some areas of the northern U.S. (northern New England, Great Lakes region) (e.g., see Nowak 1991, Evers 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Total population size is unknown but probably is at least several hundred thousand; for example, the harvest in North America in the 1983-1984 trapping season was nearly 190,000 (Novak et al. 1987). Newfoundland population was estimated at less than 500 in early the 1990s, down from 630-875 in the early 1980s (Snyder, 1986 COSEWIC report).

Although their continental range may have declined (Gibilisco, 1994), populations of martens have not suffered the magnitude of the decrease and the species is well distributed within its geographic ranges (Zielinski et al., 2001). Adequate population data are unavailable for much of the range. Population density was found to vary from about 0.5/km2 to 1.7/km2 of good habitats (Banfield, 1974). Reintroduction projects have been carried out in northern Michigan and Wisconsin and it appears that a self-sustaining population has been restored in that region (Slough, 1994). Reintroduction also has been attempted in New Hampshire and in various other parts of the northwestern United States and southwestern Canada (Nowak, 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Past extensive logging and trapping for pelts led to extirpation in some areas. Martens are susceptible to overharvest when food supplies are low (Thompson and Colgan 1987). Loss/degradation of habitat due to timber harvest remains a threat in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
The species still occurs throughout most of this range, but because of loss of habitat, it has been extirpated from many southeastern areas (Godin, 1977; Peterson, 1966). Marten distribution and demographic rates are affected by the loss of closed-canopy forest due to logging (Bissonette et al., 1997; Chapin et al. 1998; Payer and Harrison, 2003; Thompson, 1991). Martens are still legally trapped for their fur in most of the western states (Zielinski et al. 2001). By the early twentieth century excessive trapping had severely depleted M. americana in Alaska, Canada and the western conterminous United States. The range of this species has declined (Reid 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Better information on current abundance and population trend is needed throughout most of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: This species is protected in a large number of parks and refuges.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
In most state and provincial jurisdictions in western North America where it occurs, the American marten is managed as a furbearer. Protective regulations allowed the species to make a comeback in some areas, but in the eastern United States the marten survives only in small parts of Minnesota, New york and Maine (Blanchard, 1974; Mech, 1961; Mech and Rogers, 1977; Yocom, 1974). In the Pacific states, conservation measures should include a reevaluation of timber harvest plans that affect habitat in coastal forests, interagency cooperation on a coastal marten conservation assessment, and the collection of new survey information, especially on private lands in southwestern Washington and northwestern Oregon (Zielinski et al., 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species could possibly be considered a pest, in that it reduces the population of game species such as squirrels and rabbits. However, they live in areas that are usually sparsely populated by humans and are not likely to impacts humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Marten pelts are very valuable and are taken in controlled hunts.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

This species could possibly be considered a pest, in that it reduces the population of game species such as squirrels and rabbits. However, they live in areas that are usually sparsely populated by humans and are not likely to impacts humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Marten pelts are very valuable and are taken in controlled hunts.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Reintroduction by quick-release method resulted in greater dispersal than did gentle-release method (Davis 1983). Females with dependent young were more likely to remain in release area than were single adults (Hobson et al. 1989). For successful translocation, Slough (1989) recommended release of large numbers throughout the target area during October-January at temperatures above -20 C.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

American marten

The American marten or American pine marten[1] (Martes americana) is a North American member of the family Mustelidae, sometimes referred to as the pine marten. The name "pine marten" is derived from the common but distinct Eurasian species of Martes. It differs from the fisher (Martes pennanti) in that it is smaller in size and lighter in colour.

Distribution and habitat[edit]

The American marten is broadly distributed in northern North America. From north to south its range extends from the northern limit of treeline in arctic Alaska and Canada to northern New Mexico. From east to west its distribution extends from Newfoundland and south west to Napa County, California. In Canada and Alaska, American marten distribution is vast and continuous. In the western United States, American marten distribution is limited to mountain ranges that provide preferred habitat. Over time, the distribution of American marten has contracted and expanded regionally, with local extirpations and successful recolonizations occurring in the Great Lakes region and some parts of the Northeast.[3] The American marten has been reintroduced in several areas where extinction occurred.[4]

Treedmarten.jpg

The marten lives in mature coniferous or mixed forests in Alaska and Canada, the Pacific Northwest of the United States[5] and south into Northern New England[6][7][8] and through the Rocky Mountains and Sierra Nevada. Small groups of martens live in the Midwest in Minnesota and Wisconsin. Trapping and destruction of forest habitat have reduced its numbers, but it is still much more abundant than the larger fisher. The Newfoundland subspecies of this animal (Martes americana atrata) is considered to be threatened.

Home range[edit]

Compared to other carnivores, American marten population density is low for their body size. One review reports population densities ranging from 0.4 to 2.5 individuals/km2.[3] Population density may vary annually[9] or seasonally.[10] Low population densities have been associated with low abundance of prey species.[3]

Home range size of the American marten is extremely variable, with differences attributable to sex,[11][12][13][14] year, geographic area,[3] prey availability,[3][15] cover type, quality or availability,[3][15] habitat fragmentation,[16] reproductive status, resident status, predation,[17] and population density.[15] Home range size does not appear to be related to body size for either sex.[11] Home range size ranged from 0.04 sq mi (0.1 km2) in Maine to 6.1 sq mi (15.7 km2) in Minnesota for males, and 0.04 sq mi (0.1 km2) in Maine to 3.0 sq mi (7.7 km2) in Wisconsin for females.[15]

Males generally exhibit larger home ranges than females,[11][12][13][14] which some authors suggest is due to more specific habitat requirements of females (e.g., denning or prey requirements) that limit their ability to shift home range.[12] However, unusually large home ranges were observed for 4 females in two studies (Alaska[18] and Quebec[9]). Males and females in northeastern California appeared to have approximately equal home range size.[19]

Home ranges are indicated by scent-marking. American marten male pelts often show signs of scarring on the head and shoulders, suggesting intrasexual aggression that may be related to home range maintenance.[15] Home range overlap is generally minimal or nonexistent between adult males[10][13][20] but may occur between males and females,[10][13] adult males and juveniles,[13][21] and between females.[22]

Several authors have reported that home range boundaries appear to coincide with topographical or geographical features. In northeastern California, movements and home range boundaries were influenced by cover, topography (forest-meadow edges, open ridgetop, lakeshores), and other American marten.[19] In south-central Alaska, home range boundaries included creeks and a major river.[13] In an area burned 8 years previously in interior Alaska, home range boundaries coincided with transition areas between riparian and nonriparian habitats.[22] In northwestern Montana, home range boundaries appeared to coincide with the edge of large open meadows and burned areas; the authors suggested that open areas represent a "psychological rather than physical barriers".[23]

Description[edit]

Skull

The American marten is a long, slender-bodied weasel about the size of a mink with relatively large rounded ears, short limbs, and a bushy tail. American marten have a roughly triangular head and sharp nose. Their long, silky fur ranges in colour from pale yellowish buff to tawny brown to almost black. Their head is usually lighter than the rest of their body, while the tail and legs are darker. American marten usually have a characteristic throat and chest bib ranging in color from pale straw to vivid orange.[4] Sexual dimorphism is pronounced, with males averaging about 15% larger than females in length and as much as 65% larger in body weight.[4] Body length ranges from 1.5 to 2.2 feet (0.5–0.7 m). Adult weight ranges from 1.1 to 3.1 pounds (0.5–1.4 kg) and varies by age and location. Other than size, sexes are similar in appearance.[3] American marten have limited body-fat reserves, experience high mass-specific heat loss, and have a limited fasting endurance. In winter, individuals may go into shallow torpor daily to reduce heat loss.[24]

Behavior[edit]

American marten activity patterns vary by region,[15] though in general, activity is greater in summer than in winter.[4][24] American marten may be active as much as 60% of the day in summer but as little as 16% of the day in winter.[24] In north-central Ontario individuals were active about 10 to 16 hours a day in all seasons except late winter, when activity was reduced to about 5 hours a day. In south-central Alaska, American marten were more active in autumn (66% active) than in late winter and early spring (43% active).[13] In northeastern California, more time spent was spent traveling and hunting in summer than in winter, suggesting that reduced winter activity may be related to thermal and food stress or may be the result of larger prey consumption and consequent decrease in time spent foraging.[25]

American marten may be nocturnal or diurnal. Variability in daily activity patterns has been linked to activity of major prey species,[15][25] foraging efficiency,[13] gender, reducing exposure to extreme temperatures,[13][15][22] season,[20][24][25] and timber harvest. In northeastern California, activity in the snow-free season (May–December) was diurnal, while winter activity was largely nocturnal.[25] In south-central Alaska, American marten were nocturnal in autumn, with strong individual variability in diel activity in late winter. Activity occurred throughout the day in late winter and early spring.[13]

Daily distance traveled may vary by age,[18] gender, habitat quality, season,[20] prey availability, traveling conditions, weather, and physiological condition of the individual. Year-round daily movements in Grand Teton National Park ranged from 0 to 2.83 miles (0–4.57 km), averaging 0.6 mile (0.9 km, observations of 88 individuals).[20] One marten in south-central Alaska repeatedly traveled 7 to 9 miles (11–14 km) overnight to move between 2 areas of home range focal activity.[13] One individual in central Idaho moved as much as 9 miles (14 km) a day in winter, but movements were largely confined to a 1,280-acre (518 ha) area. Juvenile American marten in east-central Alaska traveled significantly farther each day than adults (1.4 miles (2.2 km) vs. 0.9 mile (1.4 km)).[18]

Weather factors[edit]

American marten standing in a snowy glade

Weather may impact American marten activity, resting site use, and prey availability. Individuals may become inactive during storms or extreme cold.[15][26] In interior Alaska, a decrease in above-the-snow activity occurred when ambient temperatures fell below −4°F (−20°C).[22] In southeastern Wyoming, temperature influenced resting site location. Above-snow sites were used during the warmest weather, while subnivean sites were used during the coldest weather, particularly when temperatures were low and winds were high following storms. High mortality may occur if American marten become wet in cold weather, as when unusual winter rains occur during live trapping.[4] In southeastern Wyoming, temperature was linked to resting site use; above-snow sites were used during the warmest weather, while subnivean sites were used during the coldest weather. In Yosemite National Park, drought conditions increased the diversity of prey items; American marten consumed fish and small mammal species made more accessible by low snow conditions in a drought year.[26]

A snowy habitat in many parts of the range of the American marten provides thermal protection[21] and opportunities for foraging and resting.[20] American marten may travel extensively under the snowpack. Subnivean travel routes of >98 feet (30 m) were documented in northeastern Oregon,[27] >33 feet (10 m) on the Upper Peninsula of Michigan,[27] and up to 66 feet (20 m) in Wyoming.[20]

American marten are well adapted to snow. On the Kenai Peninsula, individuals navigated through deep snow regardless of depth, with tracks rarely sinking >2 inches (5 cm) into the snowpack. Snowfall pattern may affect distribution, with the presence of American marten linked to deep snow areas.[21]

Adaptations to deep snow are particularly important in areas where the American marten is sympatric with the fisher, which may compete with and/or prey on American marten. In California, American marten were closely associated with areas of deep snow (>9 inches (23 cm)/winter month), while fishers were more associated with shallow snow (<5 inches (13 cm)/winter month). Overlap zones were areas with intermediate snow levels. Age and recruitment ratios suggested that there were few reproductive American marten where snow was shallow and few reproductive fishers where snow was deep.[28]

Where deep snow accumulates, American marten prefer cover types that prevent snow from packing hard and have structures near the ground that provide access to subnivean sites.[29] While American marten select habitats with deep snow, they may concentrate activity in patches with relatively shallow snow. In north-central Idaho, American marten activity was highest in areas where snow depths were <12 inches (30 cm). This was attributed to easier burrowing for food and more shrub and log cover.[30]

Reproduction[edit]

Breeding[edit]

American marten reach sexual maturity by 1 year of age, but effective breeding may not occur before 2 years of age.[24] In captivity, 15-year-old females bred successfully.[4][31] In the wild, 12-year-old females were reproductive.[31]

Adult American marten are generally solitary except during the breeding season.[4] They are polygamous, and females may have multiple periods of heat.[31] Females enter estrus in July or August,[24] with courtship lasting about 15 days.[4] Embryonic implantation is delayed until late winter, with active gestation lasting approximately a month. Females give birth in late March or April to a litter ranging from 1 to 5 kits.[24] Annual reproductive output is low according to predictions based on body size. Fecundity varies by age and year and may be related to food abundance.[3]

Denning behavior[edit]

Females use dens to give birth and to shelter kits. Dens are classified as either natal dens, where parturition takes place, or maternal dens, where females move their kits after birth.[3] American marten females use a variety of structures for natal and maternal denning, including the branches, cavities or broken tops of live trees, snags,[20] stumps, logs,[20] woody debris piles, witch's brooms, rock piles, and red squirrel (Tamiasciurus hudsonicus) nests or middens. Females prepare a natal den by lining a cavity with grass, moss, and leaves.[15] They frequently move kits to new maternal dens once kits are 7–13 weeks old. Most females spend more than 50% of their time attending dens in both preweaning and weaning periods, with less time spent at dens as kits aged. Paternal care has not been documented.[3]

Development of young[edit]

American marten

Weaning occurs at 42 days. Young emerge from dens at about 50 days but may be moved by their mother before this.[3] In northwestern Maine, kits were active but poorly coordinated at 7 to 8 weeks, gaining coordination by 12 to 15 weeks. Young reach adult body weight around 3 months.[24]

Kits generally stay in the company of their mother through the end of their first summer, and most disperse in the fall.[3] The timing of juvenile dispersal is not consistent throughout American marten's distribution, ranging from early August to October.[3] In south-central Yukon, young-of-the-year dispersed from mid-July to mid-September, coinciding with the onset of female estrus.[10] Observations from Oregon[17] and Yukon[10] suggest that juveniles may disperse in early spring. Of 9 juvenile American marten that dispersed in spring in northeastern Oregon, 3 dispersed a mean of 20.7 miles (33.3 km) (range: 17.4–26.8 miles (28.0–43.2 km)) and established home ranges outside of the study area. Three were killed after dispersing distances ranging from 5.3 to 14.6 miles (8.6–23.6 km), and 3 dispersed a mean of 5.0 miles (8.1 km) (range: 3.7–6.0 miles (6.0–9.6 km)) but returned and established home ranges in the area of their original capture. Spring dispersal ended between June and early August, after which individuals remained in the same area and established a home range.[17]

Food habits[edit]

American marten are opportunistic predators, influenced by local and seasonal abundance and availability of potential prey.[24] They require about 80 kcal/day while at rest, the equivalent of about 3 voles (Microtus, Myodes, and Phenacomys spp.).[15] Voles dominate diets throughout the American marten's geographic range,[24] though larger prey—particularly snowshoe hares—may be important, particularly in winter.[21] Red-backed voles (Myodes spp.) are generally taken in proportion to their availability, while meadow voles (Microtus' spp.) are taken in excess of their availability in most areas. Deer mice (Peromyscus maniculatus) and shrews (Soricidae) are generally eaten less than expected, but may be important food items in areas lacking alternative prey species.[3] Birds were the most important prey item in terms of frequency and volume on the Queen Charlotte Islands, British Columbia. Fish may be important in coastal areas.[32]

American marten diet may shift seasonally[13][19][21][25][30] or annually.[13][26] In general, diet is more diverse in summer than winter, with summer diets containing more fruit, other vegetation, and insects. Diet is generally more diverse in the eastern and southern parts of American marten's distribution compared to the western part,[24] though there is high diversity in the Pacific states. American marten exhibit the least diet diversity in the subarctic, though diversity may also be low in areas where the diet is dominated by large prey species (e.g., snowshoe hares or red squirrels).[33]

American marten may be important seed dispersers; seeds generally pass through the animal intact, and seeds are likely germinable. One study from Chichagof Island, southeast Alaska, found that Alaska blueberry (Vaccinium alaskensis) and ovalleaf huckleberry (V. ovalifolium) seeds had higher germination rates after passing through the gut of American marten compared to seeds that dropped from the parent plant. Analyses of American marten movement and seed passage rates suggested that American marten could disperse seeds long distances: 54% of the distances analyzed were >0.3 mile (0.5 km).[34]

Mortality[edit]

Life span[edit]

American marten in captivity may live for 15 years. The oldest individual documented in a wild was 14.5 years old. Survival rates vary by geographic region, exposure to trapping, habitat quality, and age. In an unharvested population in northeastern Oregon, the probability of survival of American marten ≥9 months old was 0.55 for 1 year, 0.37 for 2 years, 0.22 for 3 years, and 0.15 for 4 years. The mean annual probability of survival was 0.63 for 4 years.[35] In a harvested population in east-central Alaska, annual adult survival rates ranged from 0.51 to 0.83 over 3 years of study. Juvenile survival rates were lower, ranging from 0.26 to 0.50.[18] In Newfoundland, annual adult survival was 0.83. Survival of juveniles from October to April was 0.76 in a protected population, but 0.51 in areas open to snaring and trapping.[16] In western Quebec, natural mortality rates were higher in clearcut areas than in unlogged areas.[36]

Predators[edit]

American marten are vulnerable to predation from raptors and other carnivores. The threat of predation may be an important factor shaping American marten habitat preferences, a hypothesis inferred from their avoidance of open areas and from behavioral observations of the European pine marten (Martes martes).[3] Specific predators vary by geographic region. In Newfoundland, red foxes (Vulpes vulpes) were the most frequent predator, though coyote (Canis latrans) and other American marten were also responsible for some deaths.[16] In deciduous forests in northeastern British Columbia, most predation was attributed to raptors.[14] Of 18 American marten killed by predators in northeastern Oregon, 8 were killed by bobcats (Lynx rufus), 4 by raptors, 4 by other American marten, and 2 by coyotes. Throughout the distribution of American marten, other predators include the great horned owl (Bubo virginianus), bald eagle (Haliaeetus leucocephalus), golden eagle (Aquila chrysaetos), Canada lynx (L. canadensis), mountain lion (Puma concolor),[4][31] fisher (M. pennanti), wolverine (Gulo gulo), grizzly bear (Ursus arctos horribilis), American black bear (U. americanus), and gray wolf (C. lupus).[22] In northeastern Oregon, most predation (67%) occurred between May and August, and no predation occurred between December and February.[35]

Hunting[edit]

The fur of the American marten is shiny and luxuriant, resembling that of the closely related sable. At the turn of the twentieth century, the American marten population was depleted due to the fur trade. The Hudson's Bay Company traded in pelts from this species among others. Numerous protection measures and reintroduction efforts have allowed the population to increase, but deforestation is still a problem for the marten in much of its habitat. American marten are trapped for their fur in all but a few states and provinces where they occur.[24] The highest annual trapping rate in North America was in 1820 (272,000).[15]

Trapping is a major source of American marten mortality in some populations[18][36] and may account for up to 90% of all deaths in some areas.[3] Overharvesting has contributed to local extirpations.[37] Trapping may impact population density, sex ratios and age structure.[3][15][24] Juveniles are more vulnerable to trapping than adults,[16][37] and males are more vulnerable than females.[3][16] American marten are particularly vulnerable to trapping mortality in industrial forests.[24]

Other[edit]

Other sources of mortality include drowning,[27] starvation,[38] exposure,[35] choking, and infections associated with injury.[16] During live trapping, high mortality may occur if individuals become wet in cold weather.[4]

American marten host several internal and external parasites, including helminths, fleas (Siphonaptera), and ticks (Ixodida).[15] American marten in central Ontario carried both toxoplasmosis and Aleutian disease, but neither affliction was suspected to cause significant mortality.[31] High American marten mortality in Newfoundland was caused by encephalitis.[38]

References[edit]

 This article incorporates public domain material from the United States Department of Agriculture document "Martes americana".

  1. ^ a b Reid, F. & Helgen, K. (2008). "Martes americana". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 7 February 2010. 
  2. ^ Martes americana, MSW3
  3. ^ a b c d e f g h i j k l m n o p q r Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7–37.
  4. ^ a b c d e f g h i j Clark, Tim W.; Anderson, Elaine; Douglas, Carman; Strickland, Marjorie (1987). "Martes americana". Mammalian Species 289: 1–8. doi:10.2307/3503918. 
  5. ^ Larrison, Patrick and Larrison, Earl J. (1976). Mammals of the Northwest ISBN 0-914516-04-3
  6. ^ List of Vermont's Wild Mammals. (PDF) Retrieved on 2011-05-28.
  7. ^ List of Wild Mammals in Maine. (PDF) . Retrieved on 2011-05-28.
  8. ^ List of New Hampshire Wildlife. Wildlife.state.nh.us. Retrieved on 2011-05-28.
  9. ^ a b Godbout, Guillaume; Ouellet, Jean-Pierre (2008). "Habitat selection of American marten in a logged landscape at the southern fringe of the boreal forest". Ecoscience 15 (3): 332–342. doi:10.2980/15-3-3091. 
  10. ^ a b c d e Archibald, W. R.; Jessup, R. H. (1984). Population dynamics of the pine marten (Martes americana) in the Yukon Territory. In: Olson, Rod; Hastings, Ross; Geddes, Frank, eds. Northern ecology and resource management: Memorial essays honouring Don Gill. Edmonton, Alberta: The University of Alberta Press: 81–97
  11. ^ a b c Smith, Adam C; Schaefer, James A (2002). "Home-range size and habitat selection by American marten (Martes americana) in Labrador". Canadian Journal of Zoology 80 (9): 1602–1609. doi:10.1139/z02-166. 
  12. ^ a b c Phillips, David M.; Harrison, Daniel J.; Payer, David C (1998). "Seasonal changes in home-range area and fidelity of martens". Journal of Mammalogy 79 (1): 180–190. doi:10.2307/1382853. JSTOR 1382853. 
  13. ^ a b c d e f g h i j k l m Buskirk, Steven William. (1983). The ecology of marten in southcentral Alaska. Fairbanks, AK: University of Alaska. Dissertation
  14. ^ a b c Poole, Kim G.; Porter, Aswea D.; Vries, Andrew de; Maundrell, Chris; Grindal, Scott D.; St. Clair, Colleen Cassady (2004). "Suitability of a young deciduous-dominated forest for American marten and the effects of forest removal". Canadian Journal of Zoology 82 (3): 423–435. doi:10.1139/z04-006. 
  15. ^ a b c d e f g h i j k l m n Strickland, Marjorie A.; Douglas, Carman W. (1987). Marten. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 531–546
  16. ^ a b c d e f Hearn, Brian J. (2007). Factors affecting habitat selection and population characteristics of American marten (Martes americana atrata) in Newfoundland. Orono, ME: The University of Maine. Dissertation
  17. ^ a b c Bull, Evelyn L.; Heater, Thad W (2001). "Home range and dispersal of the American marten in northeastern Oregon". Northwestern Naturalist 82 (1): 7–11. doi:10.2307/3536641. JSTOR 3536641. 
  18. ^ a b c d e Shults, Bradley Scott. (2001). Abundance and ecology of martens (Martes americana) in interior Alaska. Fairbanks, AK: University of Alaska. Thesis
  19. ^ a b c Simon, Terri Lee. (1980). An ecological study of the marten in the Tahoe National Forest, California. Sacramento, CA: California State University. Thesis
  20. ^ a b c d e f g h Hauptman, Tedd N. (1979). Spatial and temporal distribution and feeding ecology of the pine marten. Pocatello, ID: Idaho State University. Thesis
  21. ^ a b c d e Schumacher, Thomas V.; Bailey, Theodore N.; Portner, Mary F.; Bangs, Edward E.; Larned, William W. (1989). Marten ecology and distribution on the Kenai National Wildlife Refuge, Alaska. Draft manuscript. Soldotna, AK: U.S. Fish and Wildlife Service, Kenai National Wildlife Refuge. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab, Missoula, MT; FEIS files
  22. ^ a b c d e Vernam, Donald J. (1987). Marten habitat use in the Bear Creek burn, Alaska. Fairbanks, AK: University of Alaska. Thesis
  23. ^ Hawley, Vernon D.; Newby, Fletcher E (1957). "Marten home ranges and population fluctuations". Journal of Mammalogy 38 (2): 174–184. doi:10.2307/1376307. JSTOR 1376307. 
  24. ^ a b c d e f g h i j k l m n Powell, Roger A.; Buskirk, Steven W.; Zielinski, William J. (2003). Fisher and marten: Martes pennanti and Martes americana. In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: The Johns Hopkins University Press: pp. 635–649 ISBN 978-0-8018-7416-1
  25. ^ a b c d e Zielinski, William J.; Spencer, Wayne D.; Barrett, Reginald H (1983). "Relationship between food habits and activity patterns of pine martens". Journal of Mammalogy 64 (3): 387–396. doi:10.2307/1380351. JSTOR 1380351. 
  26. ^ a b c Hargis, Christina Devin. (1981). Winter habitat utilization and food habits of the pine marten (Martes americana) in Yosemite National Park. Berkeley, CA: University of California. Thesis
  27. ^ a b c Thomasma, Linda Ebel. (1996). Winter habitat selection and interspecific interactions of American martens (Martes americana) and fishers (Martes pennanti) in the McCormick Wilderness and surrounding area. Houghton, MI: Michigan Technological University. Dissertation
  28. ^ W B Krohn, K D Elowe, R B Boone (1995). "Relations among fishers, snow, and martens: development and evaluation of two hypotheses". Forestry Chronicle 71 (1): 97–105. doi:10.5558/tfc71097-1. 
  29. ^ Buskirk, Steven W.; Powell, Roger A. Habitat ecology of fishers and American martens. in Buskirk, pp. 283–296
  30. ^ a b Koehler, Gary M.; Hornocker, Maurice G (1977). "Fire effects on marten habitat in the Selway-Bitterroot Wilderness". Journal of Wildlife Management 41 (3): 500–505. doi:10.2307/3800522. JSTOR 3800522. 
  31. ^ a b c d e Strickland, Marjorie A.; Douglas, Carman W.; Novak, Milan; Hunziger, Nadine P. (1982). Marten: Martes americana. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press, pp. 599–612 ISBN 0-8018-2353-6
  32. ^ Nagorsen, David W.; Campbell, R. Wayne; Giannico, Guillermo R. (1991). Winter food habits of marten, Martes americana, on the Queen Charlotte Islands. The Canadian Field-Naturalist. 105(1): 55–59
  33. ^ Martin, Sandra K. 1994. Feeding ecology of American martens and fishers, in Buskirk, pp. 297–315
  34. ^ Hickey, Jena R. (1997). The dispersal of seeds of understory shrubs by American martens, Martes americana, on Chichagof Island, Alaska. Laramie, WY: University of Wyoming. Thesis
  35. ^ a b c Bull, Evelyn L.; Heater, Thad W (2001). "Survival, causes of mortality, and reproduction in the American marten in northeastern Oregon". Northwestern Naturalist 82 (1): 1–6. doi:10.2307/3536640. JSTOR 3536640. 
  36. ^ a b Potvin, Francois; Breton, Laurier. (1995). Short-term effects of clearcutting on martens and their prey in the boreal forest of western Quebec. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12–16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 452–474
  37. ^ a b Berg, William E.; Kuehn, David W. Demography and range of fishers and American martens in a changing Minnesota landscape, in Buskirk, pp. 262–271
  38. ^ a b Fredrickson, Richard John. (1990). The effects of disease, prey fluctuation, and clear cutting on American marten in Newfoundland. Logan, UT: Utah State University. Thesis.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Before 1953, two species of martens, Martes americana and M. caurina, were recognized in North America. Subsequently, based on morphometric data (Wright 1953), these two polytypic forms were found to "intergrade" in Montana, and they were synonymized under Martes americana, which came to be considered as comprising two subspecies groups (americana and caurina). However, based on genetic data, Hicks and Carr (1997) and McGowan et al. (1999) suggested that the caurina and americana groups may indeed represent two distinct species. Phylogenetic studies based on molecular data identified 2 reciprocally monophyletic clades among North American martens (e.g., Stone and Cook 2002, Small et al. 2003). Divergence occurred in isolated eastern and western glacial refugia during the late Pleistocene (Stone and Cook 2002). Subsequent studies suggest that M. caurina may have persisted in multiple refugia (e.g., Slauson et al. 2009). Despite the molecular data, Wozencraft (in Wilson and Reeder 2005) followed Wright (1953) and Hall (1981) and regarded caurina and americana as subspecies groups rather than as species.

Dawson and Cook (2012) reviewed all previous studies of morphological and molecular variation in North American martens, including several not cited in the preceding paragraph. They also looked at additional, previously unpublished genetic data. Dawson and Cook determined that the conclusions from the previous morphological study by Wright (1953) were based on inadequate sampling and outdated taxonomic concepts. Overall, the authors concluded that the pattern of molecular and morphological variation in North American martens supports the recognition of M. americana and M. caurina as distinct species with independent evolutionary histories. Regarding subspecies, they concluded that most of the nominal taxa in eastern North America are not supported by existing data (but see McGowan et al. 1999), whereas the subspecific classification in the west (i.e., within M. caurina) "more accurately reflects patterns of underlying geographic variation resulting from isolation in disjunct forest refugia during the last glaciation (Slauson et al. 2009)."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The scientific name of the American marten is Martes americana (Turton) (Mustelidae) [38,184].

As many as 14 American marten subspecies have been recognized in the past. Some authorities suggest that subspecies partitioning
was completely arbitrary, noting that many of the differences between subspecies were relicts of small sample size, variable coat
color, or inadequate sampling. Two subspecies groups have been tentatively recognized based on cranial characters, fossil history [38], and mitochondrial DNA analyses [31]. The groups intergrade morphologically and genetically, indicating hybridization [136].

Martes americana americana subspecies group, including:

Martes americana abieticola Preble

Martes americana abietinoides Gray

Martes americana actuosa (Osgood)

Martes americana americana (Turton)

Martes americana atrata (Bangs)

Martes americana brumalis Bangs

Martes americana kenaiensis (Elliot) [136]

Martes americana caurina subspecies group, including:

Martes americana caurina (Merriam)

Martes americana humboldtensis Grinnell and Dixon

Martes americana nesophila (Osgood)

Martes americana origenes Rhoads

Martes americana vancouverensis Grinnell and Dixon

Martes americana vulpina (Rafinesque)

Martes americana sierrae Grinnell and Storer [136]


Because most studies do not indicate subspecies or subspecies group, this review synthesizes information about the American marten
at the species level.
  • 38. Clark, Tim W.; Anderson, Elaine; Douglas, Carman; Strickland, Marjorie. 1987. Martes americana. Mammalian Species. 289: 1-8. [76016]
  • 31. Carr, Steven M.; Hicks, Shawn A. 1995. Are there two species of marten in North America? Genetic and evolutionary relationships within Martes. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12-16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 15-28. [76948]
  • 136. Powell, Roger A.; Buskirk, Steven W.; Zielinski, William J. 2003. Fisher and marten (Martes pennanti and Martes americana). In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: The Johns Hopkins University Press: 635-649. [64017]
  • 184. Wilson, Don E.; Reeder, DeeAnn M., eds. 2005. Mammal species of the world: A taxonomic and geographic reference, [Online]. 3rd ed. Baltimore, MD: Johns Hopkins University Press. 2,142 p. Washington, DC: Smithsonian National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals; American Society of Mammalogists (Producers). Available: http://www.vertebrates.si.edu/msw/mswcfapp/msw/index.cfm [69038]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

American marten

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!