Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

American Martens are widely distributed in northern forests across Canada and into Alaska. Only 200 years ago, they were also abundant in the southeastern United States. Smaller than the Fisher and larger than the Ermine, Martens are omnivores, including insects, fruits, and seeds as well as birds and small-to-medium-sized mammals in their diet. Martens most frequently hunt on the ground, but they are capable climbers, and will pursue Red Squirrels in trees. Martens are solitary and territorial.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Turton, W., 1806.  A general system of nature, through the three grand kingdoms of animals, vegetables, and minerals.  Lackington and Allen.  London, 1:60.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

American martens occur accross most of North America from Alaska through much of forested Canada, into the northeastern United States, and south along northern California, south in the Sierra Nevada and Rocky Mountains.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

American martens, Martes americana, are found in the northern reaches of North America. The species is present from Newfoundland and Nova Scotia west to Alaska and south into sections of the rocky mountain range and California. Martens are found sporadically in parts of New York state, Michigan, Minnesota, Maine, and Wisconsin. Although populations were greater in the southeastern portion of the species range in Colonial times, loss of forest habitat in these areas has restricted their range. Programs for reintroduction of these animals in Minnesota and Ontario may help populations to recover.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout Canada and Alaska, south through the Rockies, Sierra Nevada, northern Great Lakes Region, and northern New England. See map in Clark et al. (1987) for comparison of present and historical range.

Zielinski et al. (2001) described the distribution of martens in coastal California, Oregon, and Washington from 1900 to 1949 using museum and trapping records and compared it to recent (1989-1998) detections at camera and track-plate stations. Martens were detected at only 12 of 237 (5.1%) survey sample units. Martens are absent from most of the historical range of the subspecies humboldtensis in California and also may have declined on the Olympic Peninsula of Washington. Few data exist from northwestern Oregon and southwestern Washington, but the limited amount of protected public land and absence of reported road kills are reasons for concern for populations in this region. Martens still occur in the central and southern coastal mountains of Oregon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male American martens measure 360 to 450 mm, with the tail adding 150 to 230 mm more. Weights of males range between 470 and 1,300 g. Females are slightly smaller and lighter, with head-body lengths between 320 and 400 mm, and tails measuring 135 to 200 mm. Females weigh betweeen 280 and 850 g.

The fur is long and shiny. The head is gray, legs and tail are very dark brown or black, the chest has a cream colored patch, and the back is light brown.

American martens are long, slender animals. Eyes are large and ears are cat-like. Claws are sharp and curved.

Range mass: 280 to 1,300 g.

Range length: 320 to 450 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 3.579 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 68 cm

Weight: 1568 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 560-680 mm males; 500-600 mm females

Weight:
Range: 470-1,250 g males; 280-850 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is typically associated with late-seral coniferous forests characterized by closed canopies, large trees, and
abundant standing and down woody material (Buskirk and Powell, 1994; Thompson and Harestad, 1994). It dens in hollow trees or logs, in rocky crevices, or in burrows. The marten is primarly nocturnal and partly arboreal but spends considerable time on the ground. The diet consists mostly of rodents and other small mammals and also includes birds, insects, fruit and carrion (Nowak, 2005). Average home size throughout North America is 8.1 km2 for males and 2.3 km2 for females, and degree of overlap varies (Powell, 1994).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Martes americana is found primarily in mature, northern forests. These animals are closely associated with lodgepole pine, Douglas fir, spruce, and mixed harwood forests. They tend to be found in structurally complex, mature forests, and can occur at all elevations where such habitat exists. They den in hollow trees, crevices, or vacant ground burrows.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Usually in dense deciduous, mixed, or (especially) coniferous upland and lowland forest. May use rocky alpine areas. In central Rockies, associated in winter mainly with old-growth forest. In Newfoundland, prefers undisturbed mature coniferous or mixed forest. When inactive, occupies hole in dead or live tree or stump, abandoned squirrel nest, conifer crown, rock pile, burrow, snow cavity, etc.; uses mainly subnivean sites, often associated with coarse woody debris, in winter. Young are born in a den, usually in a hollow tree, sometimes in rock den.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Martes americana is an opportunistic feeder. The diet consists primarily of small mammals, including squirrels and rodents. Occasionally birds, fruit, nuts, insects, and carrion are eaten as well. American martens usually kill their prey with a quick, powerful bite to the back of the prey animal's neck. American martens sometimes have fast-paced chases in trees with a favorite prey item, red squirrels.

American martens eat mostly meat. They are willing to eat any animal they can catch. Most of the time, they catch squirrels and micebut can sometimes eat birds, fruit, nuts, insects, and carrion.

American martens kill their prey with a quick, powerful bite to the back of the prey animal's neck. They sometimes have fast-paced chases in trees with red squirrels.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet consists mainly of small mammals, birds, insects, carrion. Berries and other vegetable matter eaten in season. Forages in trees and on ground (mostly). Tracks prey, ambushes, robs nests, excavates burrows, uses hunting perches (Spencer and Zielinski 1983). Also exploits subnivean prey (voles, red squirrels, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As predators, American martens may have significant impact on prey populations, helping to structure the forest community.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators have not been reported for American martens. However, it is likely that young martens may be vulnerable to large carnivores like wolves or owls.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Martes americana preys on:
Ochotonidae
Arvicolinae
Spermophilus
Junco hyemalis
Corvus corax
Clethrionomys californicus
Microtus longicaudus
Microtus xanthognathus
Arborimus longicaudus

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: In the absence of good occurrence specifications and adequate population data, an estimate of the number of occurrences is not possible. But surely there are hundreds of fairly distinct populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is unknown but probably is at least several hundred thousand; for example, the harvest in North America in the 1983-1984 trapping season was nearly 190,000 (Novak et al. 1987). Newfoundland population was estimated at less than 500 in early the 1990s, down from 630-875 in the early 1980s (Snyder, 1986 COSEWIC report).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range size is quite variable, usually averages less than 10 sq km, may be larger when food scarce; male range usually is larger than female range; see Slough (1989) for detailed summary of home ranges in several areas; see also Phillips et al. (1998). Male home range may overlap those of multiple females.

Basically solitary. Densities of about l-2 per sq km have been recorded in early fall.

Young may disperse 25 miles or more.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

American martens have complex means of communication. In addition to the scent marking so common in Mustelidae, they use vocalizations (huffs, chuckles, and screams). Physical contact is important between mates as well as between mothers and their offspring. The role of visual cues in communication has not been reported, but in many Mustelids, body postures play an important role in communication. It is likely that these animals are similar to other members of their family in this respect.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Activity may peak at dusk and dawn in summer; frequently observed by day in winter. Foraging activity is nocturnal in winter, diurnal in summer in Sierra Nevada; appararently synchronous with activity of prey (Zielinski et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

American martens can live for up to 17 years in captivity. Although martens in the wild probably do not live as long as those in captivity, wild females are still able to breed at the age of 12 years.

Range lifespan

Status: captivity:
17 (high) years.

Average lifespan

Status: captivity:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.8 years (captivity) Observations: Including the pre-implantation time, the total gestation time can take between 180 and 274 days. Record longevity in captivity is 17.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating has been described as polygynous. During estrus, females use scent marks to advertize their sexual condition. Courtship between males and females can be quite protracted, and involves tumbling, playing and wrestling. In captivity, females reportedly exhibit between 1 and 4 periods of sexual receptivity, each of which lasts from 1 to 4 days. These occur at 6 to 17 day intervals throughout the breeding season.

Mating System: polygynous

The breeding season occurs from June to August. Implantation of the fertilized eggs is delayed, and does not take place until February. Although the total period of pregancy is between 220 and 275 days, after implantation in the uterine lining, the embryos develop for only 28 days. The 1 to 5 blind young (kits) are born in late March or early April in dens lined with dried plant material.

The young grow quickly. Eyes open by the age of 39 days. Young martens are weaned after 42 days. Full size is reached very quickly, around 3.5 months after birth. Sexual maturity is reached at 15 to 24 months of age.

Breeding interval: Females may breed four times in a season at 6-17 day intervals. Breeding season occurs once per year.

Breeding season: Breeding season is in June to August.

Range number of offspring: 1 to 5.

Average number of offspring: 2.6.

Range gestation period: 220 to 275 days.

Average weaning age: 42 days.

Range age at sexual or reproductive maturity (female): 15 to 24 months.

Range age at sexual or reproductive maturity (male): 15 to 24 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 30 g.

Average number of offspring: 3.

Information on the parental behavior of these animals is not readily available. However, as mammals, we know that the female nurses her offspring and provides them with protection and a home for the first part of their lives. Even though the role of males in parental care is not clear,adult males and females have been seen together with immature animals, presumably their offspring. Although American martens are larely solitary, it is still possible that males have some association with their offspring during rearing.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in summer. Implantation is delayed; litter of 1-5 (average 3-4, less when food scarce) is born in spring. Young arre weaned in 6 weeks, apparently independent by August in Maine (Wynne and Sherburne 1984). Males are sexually mature in 1 year, females in 1-2 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Martes americana

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0292-06|AY598542|Martes americana| AATCGATGATTATTCTCCACAAATCACAAAGACATCGGCACTCTTTACCTTTTATTTGGCGCATGAGCCGGAATAGTAGGCACTGCATTA---AGCCTATTGATTCGCGCTGAATTAGGTCAACCTGGCGCTCTACTGGGAGAT---GACCAAATTTACAATGTGATTGTAACCGCCCATGCATTTGTAATAATTTTCTTTATAGTGATGCCCATTATAATTGGGGGCTTCGGAAACTGACTAGTGCCCTTAATA---ATCGGTGCACCTGATATGGCATTCCCACGTATAAACAACATAAGCTTCTGACTTCTACCTCCCTCTTTCCTTCTACTCTTAGCCTCTTCCATAGTGGAGGCGGGCGCAGGAACAGGATGAACCGTATACCCCCCTCTAGCAGGGAATCTAGCACACGCAGGAGCATCCGTAGATCTG---ACAATCTTCTCTCTACACCTGGCAGGCGTCTCATCTATCTTAGGGGCCATCAACTTCATTACAACTATCATCAATATGAAGCCTCCTGCAATATCGCAATACCAAACCCCTCTATTCGTATGATCCGTCCTAATCACAGCCGTACTTCTACTCTTATCCCTGCCAGTGTTGGCAGCC---GGCATTACCATACTACTTACAGACCGAAATCTAAACACTACCTTCTTCGACCCCGCCGGAGGAGGGGACCCCATCCTGTATCAACACCTGTTTTGATTTTTTGGACACCCCGAGGTATACATCTTAATTTTACCAGGATTTGGAATCATCTCGCACGTTGTAACATATTACTCAGGAAAGAAG---GAACCATTCGGTTACATGGGCATGGTTTGAGCAATAATATCTATTGGGTTCTTGGGATTCATTGTATGAGCCCATCACATGTTTACCGTGGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Martes americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 14
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern as the species has a wide distribution range and is present in numerous protected areas. It may be undergoing to some localized declines due to hunting and habitat loss due to clear-cutting practices, however, reintroduction programs have contributed to a moderate comeback in some areas. Adequate population data are unavailable for much of the range, but the total population size is at least several hundred thousand individuals.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Collection of pelts has reduced populations in many parts of the species range. The destruction of coniferous forest habitat has also led to decreased numbers. In spite of these threats, American martens are not considered endangered.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in northern North America, south to the northeastern U.S. and the mountains of the western U.S.; timber harvest and excessive harvest led to extirpations in the southern part of the range; natural reestablishment and reintroduction programs (aided by reforestation and trapping restrictions) have contributed to a moderate comeback in some areas; adequate population data are unavailable for much of the range, but the total population size is at least several hundred thousand and the species can be regarded as secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total population size is unknown but probably is at least several hundred thousand; for example, the harvest in North America in the 1983-1984 trapping season was nearly 190,000 (Novak et al. 1987). Newfoundland population was estimated at less than 500 in early the 1990s, down from 630-875 in the early 1980s (Snyder, 1986 COSEWIC report).

Although their continental range may have declined (Gibilisco, 1994), populations of martens have not suffered the magnitude of the decrease and the species is well distributed within its geographic ranges (Zielinski et al., 2001). Adequate population data are unavailable for much of the range. Population density was found to vary from about 0.5/km2 to 1.7/km2 of good habitats (Banfield, 1974). Reintroduction projects have been carried out in northern Michigan and Wisconsin and it appears that a self-sustaining population has been restored in that region (Slough, 1994). Reintroduction also has been attempted in New Hampshire and in various other parts of the northwestern United States and southwestern Canada (Nowak, 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Adequate population data are unavailable for much of the range. Natural reestablishment and reintroduction programs have contributed to a moderate comeback in some areas of the northern U.S. (northern New England, Great Lakes region) (e.g., see Nowak 1991, Evers 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The species still occurs throughout most of this range, but because of loss of habitat, it has been extirpated from many southeastern areas (Godin, 1977; Peterson, 1966). Marten distribution and demographic rates are affected by the loss of closed-canopy forest due to logging (Bissonette et al., 1997; Chapin et al. 1998; Payer and Harrison, 2003; Thompson, 1991). Martens are still legally trapped for their fur in most of the western states (Zielinski et al. 2001). By the early twentieth century excessive trapping had severely depleted M. americana in Alaska, Canada and the western conterminous United States. The range of this species has declined (Reid 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Past extensive logging and trapping for pelts led to extirpation in some areas. Susceptible to overharvest when food supplies are low (Thompson and Colgan 1987). Loss/degradation of habitat due to timber harvest remains a threat in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In most state and provincial jurisdictions in western North America where it occurs, the American marten is managed as a furbearer. Protective regulations allowed the species to make a comeback in some areas, but in the eastern United States the marten survives only in small parts of Minnesota, New york and Maine (Blanchard, 1974; Mech, 1961; Mech and Rogers, 1977; Yocom, 1974). In the Pacific states, conservation measures should include a reevaluation of timber harvest plans that affect habitat in coastal forests, interagency cooperation on a coastal marten conservation assessment, and the collection of new survey information, especially on private lands in southwestern Washington and northwestern Oregon (Zielinski et al., 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: In the Pacific states, conservation measures should include a reevaluation of timber harvest plans that affect habitat in coastal forests, interagency cooperation on a coastal marten conservation assessment, and the collection of new survey information, especially on private lands in southwestern Washington and northwestern Oregon (Zielinski et al. 2001).

Reintroduction by quick-release method resulted in greater dispersal than did gentle-release method (Davis 1983). Females with dependent young were more likely to remain in release area than were single adults (Hobson et al. 1989). For successful translocation, Slough (1989) recommended release of large numbers throughout the target area during October-January at temperatures above -20 C.

See Strickland et al. (1982), U.S. Forest Service (1993), and Thomas et al. (1993) for forest management guidelines.

See Lacy and Clark (1993) for a population model that permits managers to simulate various levels of timber harvesting, commercial trapping, and other factors to estimate their effects on marten populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected in at least several parks and refuges.

Needs: In the Pacific Northwest, habitat conservation measures proposed/implemented for the spotted owl and marbled murrelet, and for riparian zones, generally are sufficient to prevent the extirpation of this species, but ongoing management reassessment, monitoring, and adaptive management are important (U.S. Forest Service et al. 1993; see also Thomas et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species could possibly be considered a pest, in that it reduces the population of game species such as squirrels and rabbits. However, they live in areas that are usually sparsely populated by humans and are not likely to impacts humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Marten pelts are very valuable and are taken in controlled hunts.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Trapped for fur in some areas. Commonly known as American or Canadian sable in the fur trade (Clark et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American marten

The American marten (Martes americana) is a North American member of the family Mustelidae, sometimes referred to as the pine marten. The name "pine marten" is derived from the common but distinct Eurasian species of Martes. It differs from the fisher (Martes pennanti) in that it is smaller in size.

Contents

Distribution and habitat

The American marten is broadly distributed in northern North America. From north to south its range extends from the northern limit of treeline in arctic Alaska and Canada to northern New Mexico. From east to west its distribution extends from Newfoundland to California. In Canada and Alaska, American marten distribution is vast and continuous. In the western United States, American marten distribution is limited to mountain ranges that provide preferred habitat. Over time, the distribution of American marten has contracted and expanded regionally, with local extirpations and successful recolonizations occurring in the Great Lakes region and some parts of the Northeast.[2] The American marten has been reintroduced in several areas where extinction occurred.[3]

Treedmarten.jpg

The marten lives in mature coniferous or mixed forests in Alaska and Canada, the Pacific Northwest of the United States[4] and south into Northern New England[5][6][7] and through the Rocky Mountains and Sierra Nevada. Small groups of martens live in the Midwest in Minnesota and Wisconsin. Trapping and destruction of forest habitat have reduced its numbers, but it is still much more abundant than the larger fisher. The Newfoundland subspecies of this animal (Martes americana atrata) is considered to be threatened.

Home range

Compared to other carnivores, American marten population density is low for their body size. One review reports population densities ranging from 0.4 to 2.5 individuals/km2.[2] Population density may vary annually[8] or seasonally.[9] Low population densities have been associated with low abundance of prey species.[2]

Home range size of the American marten is extremely variable, with differences attributable to sex,[10][11][12][13] year, geographic area,[2] prey availability,[2][14] cover type, quality or availability,[2][14] habitat fragmentation,[15] reproductive status, resident status, predation,[16] and population density.[14] Home range size does not appear to be related to body size for either sex.[10] Home range size ranged from 0.04 sq mi (0.1 km2) in Maine to 6.1 sq mi (15.7 km2) in Minnesota for males, and 0.04 sq mi (0.1 km2) in Maine to 3.0 sq mi (7.7 km2) in Wisconsin for females.[14]

Males generally exhibit larger home ranges than females,[10][11][12][13] which some authors suggest is due to more specific habitat requirements of females (e.g., denning or prey requirements) that limit their ability to shift home range.[11] However, unusually large home ranges were observed for 4 females in two studies (Alaska[17] and Quebec[8]). Males and females in northeastern California appeared to have approximately equal home range size.[18]

Home ranges are indicated by scent-marking. American marten male pelts often show signs of scarring on the head and shoulders, suggesting intrasexual aggression that may be related to home range maintenance.[14] Home range overlap is generally minimal or nonexistent between adult males[9][12][19] but may occur between males and females,[9][12] adult males and juveniles,[12][20] and between females.[21]

Several authors have reported that home range boundaries appear to coincide with topographical or geographical features. In northeastern California, movements and home range boundaries were influenced by cover, topography (forest-meadow edges, open ridgetop, lakeshores), and other American marten.[18] In south-central Alaska, home range boundaries included creeks and a major river.[12] In an area burned 8 years previously in interior Alaska, home range boundaries coincided with transition areas between riparian and nonriparian habitats.[21] In northwestern Montana, home range boundaries appeared to coincide with the edge of large open meadows and burned areas; the authors suggested that open areas represent a "psychological rather than physical barriers".[22]

Description

Skull

The American marten is a long, slender-bodied weasel about the size of a mink with relatively large rounded ears, short limbs, and a bushy tail. American marten have a roughly triangular head and sharp nose. Their long, silky fur ranges in color from pale yellowish buff to tawny brown to almost black. Their head is usually lighter than the rest of their body, while the tail and legs are darker. American marten usually have a characteristic throat and chest bib ranging in color from pale straw to vivid orange.[3] Sexual dimorphism is pronounced, with males averaging about 15% larger than females in length and as much as 65% larger in body weight.[3] Body length ranges from 1.5 to 2.2 feet (0.5–0.7 m). Adult weight ranges from 1.1 to 3.1 pounds (0.5–1.4 kg) and varies by age and location. Other than size, sexes are similar in appearance.[2] American marten have limited body-fat reserves, experience high mass-specific heat loss, and have a limited fasting endurance. In winter, individuals may go into shallow torpor daily to reduce heat loss.[23]

Behavior

American marten activity patterns vary by region,[14] though in general, activity is greater in summer than in winter.[3][23] American marten may be active as much as 60% of the day in summer but as little as 16% of the day in winter.[23] In north-central Ontario individuals were active about 10 to 16 hours a day in all seasons except late winter, when activity was reduced to about 5 hours a day. In south-central Alaska, American marten were more active in autumn (66% active) than in late winter and early spring (43% active).[12] In northeastern California, more time spent was spent traveling and hunting in summer than in winter, suggesting that reduced winter activity may be related to thermal and food stress or may be the result of larger prey consumption and consequent decrease in time spent foraging.[24]

American marten may be nocturnal or diurnal. Variability in daily activity patterns has been linked to activity of major prey species,[14][24] foraging efficiency,[12] gender, reducing exposure to extreme temperatures,[12][14][21] season,[19][23][24] and timber harvest. In northeastern California, activity in the snow-free season (May–December) was diurnal, while winter activity was largely nocturnal.[24] In south-central Alaska, American marten were nocturnal in autumn, with strong individual variability in diel activity in late winter. Activity occurred throughout the day in late winter and early spring.[12]

Daily distance traveled may vary by age,[17] gender, habitat quality, season,[19] prey availability, traveling conditions, weather, and physiological condition of the individual. Year-round daily movements in Grand Teton National Park ranged from 0 to 2.83 miles (0–4.57 km), averaging 0.6 mile (0.9 km, observations of 88 individuals).[19] One marten in south-central Alaska repeatedly traveled 7 to 9 miles (11–14 km) overnight to move between 2 areas of home range focal activity.[12] One individual in central Idaho moved as much as 9 miles (14 km) a day in winter, but movements were largely confined to a 1,280-acre (518 ha) area. Juvenile American marten in east-central Alaska traveled significantly farther each day than adults (1.4 miles (2.2 km) vs. 0.9 mile (1.4 km)).[17]

Weather factors

Snowmarten.jpg

Weather may impact American marten activity, resting site use, and prey availability. Individuals may become inactive during storms or extreme cold.[14][25] In interior Alaska, a decrease in above-the-snow activity occurred when ambient temperatures fell below −4 °F (−20 °C).[21] In southeastern Wyoming, temperature influenced resting site location. Above-snow sites were used during the warmest weather, while subnivean sites were used during the coldest weather, particularly when temperatures were low and winds were high following storms. High mortality may occur if American marten become wet in cold weather, as when unusual winter rains occur during live trapping.[3] In southeastern Wyoming, temperature was linked to resting site use; above-snow sites were used during the warmest weather, while subnivean sites were used during the coldest weather. In Yosemite National Park, drought conditions increased the diversity of prey items; American marten consumed fish and small mammal species made more accessible by low snow conditions in a drought year.[25]

Snow is an important habitat feature in many parts of the range of the American marten, providing thermal protection[20] and opportunities for foraging and resting.[19] American marten may travel extensively under the snowpack. Subnivean travel routes of >98 feet (30 m) were documented in northeastern Oregon,[26] >33 feet (10 m) on the Upper Peninsula of Michigan,[26] and up to 66 feet (20 m) in Wyoming.[19]

American marten are well adapted to snow. On the Kenai Peninsula, individuals navigated through deep snow regardless of depth, with tracks rarely sinking >2 inches (5 cm) into the snowpack. Snowfall pattern may affect distribution, with the presence of American marten linked to deep snow areas.[20]

Adaptations to deep snow are particularly important in areas where the American marten is sympatric with the fisher, which may compete with and/or prey on American marten. In California, American marten were closely associated with areas of deep snow (>9 inches (23 cm)/winter month), while fishers were more associated with shallow snow (<5 inches (13 cm)/winter month). Overlap zones were areas with intermediate snow levels. Age and recruitment ratios suggested that there were few reproductive American marten where snow was shallow and few reproductive fishers where snow was deep.[27]

Where deep snow accumulates, American marten prefer cover types that prevent snow from packing hard and have structures near the ground that provide access to subnivean sites.[28] While American marten select habitats with deep snow, they may concentrate activity in patches with relatively shallow snow. In north-central Idaho, American marten activity was highest in areas where snow depths were <12 inches (30 cm). This was attributed to easier burrowing for food and more shrub and log cover.[29]

Reproduction

Breeding

American marten reach sexual maturity by 1 year of age, but effective breeding may not occur before 2 years of age.[23] In captivity, 15-year-old females bred successfully.[3][30] In the wild, 12-year-old females were reproductive.[30]

Adult American marten are generally solitary except during the breeding season.[3] They are polygamous, and females may have multiple periods of heat.[30] Females enter estrus in July or August,[23] with courtship lasting about 15 days.[3] Embryonic implantation is delayed until late winter, with active gestation lasting approximately a month. Females give birth in late March or April to a litter ranging from 1 to 5 kits.[23] Annual reproductive output is low according to predictions based on body size. Fecundity varies by age and year and may be related to food abundance.[2]

Denning behavior

Females use dens to give birth and to shelter kits. Dens are classified as either natal dens, where parturition takes place, or maternal dens, where females move their kits after birth.[2] American marten females use a variety of structures for natal and maternal denning, including the branches, cavities or broken tops of live trees, snags,[19] stumps, logs,[19] woody debris piles, witch's brooms, rock piles, and red squirrel (Tamiasciurus hudsonicus) nests or middens. Females prepare a natal den by lining a cavity with grass, moss, and leaves.[14] They frequently move kits to new maternal dens once kits are 7–13 weeks old. Most females spend >50% of their time attending dens in both preweaning and weaning periods, with less time spent at dens as kits aged. Paternal care has not been documented.[2]

Development of young

American marten

Weaning occurs at 42 days. Young emerge from dens at about 50 days but may be moved by their mother before this.[2] In northwestern Maine, kits were active but poorly coordinated at 7 to 8 weeks, gaining coordination by 12 to 15 weeks. Young reach adult body weight around 3 months.[23]

Kits generally stay in the company of their mother through the end of their first summer, and most disperse in the fall.[2] The timing of juvenile dispersal is not consistent throughout American marten's distribution, ranging from early August to October.[2] In south-central Yukon, young-of-the-year dispersed from mid-July to mid-September, coinciding with the onset of female estrus.[9] Observations from Oregon[16] and Yukon[9] suggest that juveniles may disperse in early spring. Of 9 juvenile American marten that dispersed in spring in northeastern Oregon, 3 dispersed a mean of 20.7 miles (33.3 km) (range: 17.4–26.8 miles (28.0–43.2 km)) and established home ranges outside of the study area. Three were killed after dispersing distances ranging from 5.3 to 14.6 miles (8.6–23.6 km), and 3 dispersed a mean of 5.0 miles (8.1 km) (range: 3.7–6.0 miles (6.0–9.6 km)) but returned and established home ranges in the area of their original capture. Spring dispersal ended between June and early August, after which individuals remained in the same area and established a home range.[16]

Food habits

American marten are opportunistic predators, influenced by local and seasonal abundance and availability of potential prey.[23] They require about 80 kcal/day while at rest, the equivalent of about 3 voles (Microtus, Myodes, and Phenacomys spp.).[14] Voles dominate diets throughout the American marten's geographic range,[23] though larger prey—particularly snowshoe hares—may be important, particularly in winter.[20] Red-backed voles (Myodes spp.) are generally taken in proportion to their availability, while meadow voles (Microtus' spp.) are taken in excess of their availability in most areas. Deer mice (Peromyscus maniculatus) and shrews (Soricidae) are generally eaten less than expected, but may be important food items in areas lacking alternative prey species.[2] Birds were the most important prey item in terms of frequency and volume on the Queen Charlotte Islands, British Columbia. Fish may be important in coastal areas.[31]

American marten diet may shift seasonally[12][18][20][24][29] or annually.[12][25] In general, diet is more diverse in summer than winter, with summer diets containing more fruit, other vegetation, and insects. Diet is generally more diverse in the eastern and southern parts of American marten's distribution compared to the western part,[23] though there is high diversity in the Pacific states. American marten exhibit the least diet diversity in the subarctic, though diversity may also be low in areas where the diet is dominated by large prey species (e.g., snowshoe hares or red squirrels).[32]

American marten may be important seed dispersers; seeds generally pass through the animal intact, and seeds are likely germinable. One study from Chichagof Island, southeast Alaska, found that Alaska blueberry (Vaccinium alaskensis) and ovalleaf huckleberry (V. ovalifolium) seeds had higher germination rates after passing through the gut of American marten compared to seeds that dropped from the parent plant. Analyses of American marten movement and seed passage rates suggested that American marten could disperse seeds long distances: 54% of the distances analyzed were >0.3 mile (0.5 km).[33]

Mortality

Life span

American marten in captivity may live for 15 years. The oldest individual documented in a wild was 14.5 years old. Survival rates vary by geographic region, exposure to trapping, habitat quality, and age. In an unharvested population in northeastern Oregon, the probability of survival of American marten ≥9 months old was 0.55 for 1 year, 0.37 for 2 years, 0.22 for 3 years, and 0.15 for 4 years. The mean annual probability of survival was 0.63 for 4 years.[34] In a harvested population in east-central Alaska, annual adult survival rates ranged from 0.51 to 0.83 over 3 years of study. Juvenile survival rates were lower, ranging from 0.26 to 0.50.[17] In Newfoundland, annual adult survival was 0.83. Survival of juveniles from October to April was 0.76 in a protected population, but 0.51 in areas open to snaring and trapping.[15] In western Quebec, natural mortality rates were higher in clearcut areas than in unlogged areas.[35]

Predators

American marten are vulnerable to predation from raptors and other carnivores. The threat of predation may be an important factor shaping American marten habitat preferences, a hypothesis inferred from their avoidance of open areas and from behavioral observations of the European pine marten (Martes martes).[2] Specific predators vary by geographic region. In Newfoundland, red foxes (Vulpes vulpes) were the most frequent predator, though coyote (Canis latrans) and other American marten were also responsible for some deaths.[15] In deciduous forests in northeastern British Columbia, most predation was attributed to raptors.[13] Of 18 American marten killed by predators in northeastern Oregon, 8 were killed by bobcats (Lynx rufus), 4 by raptors, 4 by other American marten, and 2 by coyotes. Throughout the distribution of American marten, other predators include the great horned owl (Bubo virginianus), bald eagle (Haliaeetus leucocephalus), golden eagle (Aquila chrysaetos), Canada lynx (L. canadensis), mountain lion (Puma concolor),[3][30] fisher (M. pennanti), wolverine (Gulo gulo), grizzly bear (Ursus arctos horribilis), American black bear (U. americanus), and gray wolf (C. lupus).[21] In northeastern Oregon, most predation (67%) occurred between May and August, and no predation occurred between December and February.[34]

Hunting

The fur of the American marten is shiny and luxuriant, resembling that of the closely related sable. At the turn of the twentieth century, the American marten population was depleted due to the fur trade. The Hudson's Bay Company traded in pelts from this species among others. Numerous protection measures and reintroduction efforts have allowed the population to increase, but deforestation is still a problem for the marten in much of its habitat. American marten are trapped for their fur in all but a few states and provinces where they occur.[23] The highest annual trapping rate in North America was in 1820 (272,000).[14]

Harvest is a major source of American marten mortality in trapped populations[17][35] and may account for up to 90% of all deaths in some areas.[2] Overharvesting has contributed to local extirpations.[36] Trapping may impact population density, sex ratios and age structure.[2][14][23] Juveniles are more vulnerable to trapping than adults,[15][36] and males are more vulnerable than females.[2][15] American marten are particularly vulnerable to trapping mortality in industrial forests.[23]

Other

Other sources of mortality include drowning,[26] starvation,[37] exposure,[34] choking, and infections associated with injury.[15] During live trapping, high mortality may occur if individuals become wet in cold weather.[3]

American marten host several internal and external parasites, including helminths, fleas (Siphonaptera), and ticks (Ixodida).[14] American marten in central Ontario carried both toxoplasmosis and Aleutian disease, but neither affliction was suspected to cause significant mortality.[30] High American marten mortality in Newfoundland was caused by encephalitis.[37]

Links

References

 This article incorporates public domain material from the United States Department of Agriculture document "Martes americana".

  1. ^ Reid, F. & Helgen, K. (2008). "Martes americana". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41648. Retrieved 07 February 2010. 
  2. ^ a b c d e f g h i j k l m n o p q r Buskirk, Steven W.; Ruggiero, Leonard F. 1994. American marten. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 7–37.
  3. ^ a b c d e f g h i j Clark, Tim W.; Anderson, Elaine; Douglas, Carman; Strickland, Marjorie (1987). "Martes americana". Mammalian Species 289: 1–8. 
  4. ^ Larrison, Patrick and Larrison, Earl J. (1976) Mammals of the Northwest ISBN 0-914516-04-3
  5. ^ List of Vermont's Wild Mammals. (PDF) . Retrieved on 2011-05-28.
  6. ^ List of Wild Mammals in Maine. (PDF) . Retrieved on 2011-05-28.
  7. ^ List of New Hampshire Wildlife. Wildlife.state.nh.us. Retrieved on 2011-05-28.
  8. ^ a b Godbout, Guillaume; Ouellet, Jean-Pierre (2008). "Habitat selection of American marten in a logged landscape at the southern fringe of the boreal forest". Ecoscience 15 (3): 332–342. doi:10.2980/15-3-3091. http://guillaume.godbout.com/profession/fichiers/Godbout_et_Ouellet_2008.pdf. 
  9. ^ a b c d e Archibald, W. R.; Jessup, R. H. 1984. Population dynamics of the pine marten (Martes americana) in the Yukon Territory. In: Olson, Rod; Hastings, Ross; Geddes, Frank, eds. Northern ecology and resource management: Memorial essays honouring Don Gill. Edmonton, Alberta: The University of Alberta Press: 81–97
  10. ^ a b c Smith, Adam C; Schaefer, James A (2002). "Home-range size and habitat selection by American marten (Martes americana) in Labrador". Canadian Journal of Zoology 80 (9): 1602–1609. doi:10.1139/z02-166. 
  11. ^ a b c Phillips, David M.; Harrison, Daniel J.; Payer, David C (1998). "Seasonal changes in home-range area and fidelity of martens". Journal of Mammalogy 79 (1): 180–190. doi:10.2307/1382853. JSTOR 1382853. 
  12. ^ a b c d e f g h i j k l m Buskirk, Steven William. 1983. The ecology of marten in southcentral Alaska. Fairbanks, AK: University of Alaska. Dissertation
  13. ^ a b c Poole, Kim G.; Porter, Aswea D.; Vries, Andrew de; Maundrell, Chris; Grindal, Scott D.; St. Clair, Colleen Cassady (2004). "Suitability of a young deciduous-dominated forest for American marten and the effects of forest removal". Canadian Journal of Zoology 82 (3): 423–435. doi:10.1139/z04-006. 
  14. ^ a b c d e f g h i j k l m n Strickland, Marjorie A.; Douglas, Carman W. 1987. Marten. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 531–546
  15. ^ a b c d e f Hearn, Brian J. 2007. Factors affecting habitat selection and population characteristics of American marten (Martes americana atrata) in Newfoundland. Orono, ME: The University of Maine. Dissertation
  16. ^ a b c Bull, Evelyn L.; Heater, Thad W (2001). "Home range and dispersal of the American marten in northeastern Oregon". Northwestern Naturalist 82 (1): 7–11. doi:10.2307/3536641. JSTOR 3536641. 
  17. ^ a b c d e Shults, Bradley Scott. 2001. Abundance and ecology of martens (Martes americana) in interior Alaska. Fairbanks, AK: University of Alaska. Thesis
  18. ^ a b c Simon, Terri Lee. 1980. An ecological study of the marten in the Tahoe National Forest, California. Sacramento, CA: California State University. Thesis
  19. ^ a b c d e f g h Hauptman, Tedd N. 1979. Spatial and temporal distribution and feeding ecology of the pine marten. Pocatello, ID: Idaho State University. Thesis
  20. ^ a b c d e Schumacher, Thomas V.; Bailey, Theodore N.; Portner, Mary F.; Bangs, Edward E.; Larned, William W. 1989. Marten ecology and distribution on the Kenai National Wildlife Refuge, Alaska. Draft manuscript. Soldotna, AK: U.S. Fish and Wildlife Service, Kenai National Wildlife Refuge. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab, Missoula, MT; FEIS files
  21. ^ a b c d e Vernam, Donald J. 1987. Marten habitat use in the Bear Creek burn, Alaska. Fairbanks, AK: University of Alaska. Thesis
  22. ^ Hawley, Vernon D.; Newby, Fletcher E (1957). "Marten home ranges and population fluctuations". Journal of Mammalogy 38 (2): 174–184. doi:10.2307/1376307. JSTOR 1376307. 
  23. ^ a b c d e f g h i j k l m n Powell, Roger A.; Buskirk, Steven W.; Zielinski, William J. 2003. Fisher and marten: Martes pennanti and Martes americana. In: Feldhamer, George A.; Thompson, Bruce C.; Chapman, Joseph A., eds. Wild mammals of North America: Biology, management, and conservation. 2nd ed. Baltimore, MD: The Johns Hopkins University Press: pp. 635–649 ISBN 978-0-8018-7416-1
  24. ^ a b c d e Zielinski, William J.; Spencer, Wayne D.; Barrett, Reginald H (1983). "Relationship between food habits and activity patterns of pine martens". Journal of Mammalogy 64 (3): 387–396. doi:10.2307/1380351. JSTOR 1380351. 
  25. ^ a b c Hargis, Christina Devin. 1981. Winter habitat utilization and food habits of the pine marten (Martes americana) in Yosemite National Park. Berkeley, CA: University of California. Thesis
  26. ^ a b c Thomasma, Linda Ebel. 1996. Winter habitat selection and interspecific interactions of American martens (Martes americana) and fishers (Martes pennanti) in the McCormick Wilderness and surrounding area. Houghton, MI: Michigan Technological University. Dissertation
  27. ^ W B Krohn, K D Elowe, R B Boone (1995). "Relations among fishers, snow, and martens: development and evaluation of two hypotheses". Forestry Chronicle 71 (1): 97–105. 
  28. ^ Buskirk, Steven W.; Powell, Roger A. Habitat ecology of fishers and American martens. in Buskirk, pp. 283–296
  29. ^ a b Koehler, Gary M.; Hornocker, Maurice G (1977). "Fire effects on marten habitat in the Selway-Bitterroot Wilderness". Journal of Wildlife Management 41 (3): 500–505. doi:10.2307/3800522. JSTOR 3800522. 
  30. ^ a b c d e Strickland, Marjorie A.; Douglas, Carman W.; Novak, Milan; Hunziger, Nadine P. (1982) Marten: Martes americana. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press, pp. 599–612 ISBN 0-8018-2353-6
  31. ^ Nagorsen, David W.; Campbell, R. Wayne; Giannico, Guillermo R. 1991. Winter food habits of marten, Martes americana, on the Queen Charlotte Islands. The Canadian Field-Naturalist. 105(1): 55–59
  32. ^ Martin, Sandra K. 1994. Feeding ecology of American martens and fishers, in Buskirk, pp. 297–315
  33. ^ Hickey, Jena R. 1997. The dispersal of seeds of understory shrubs by American martens, Martes americana, on Chichagof Island, Alaska. Laramie, WY: University of Wyoming. Thesis
  34. ^ a b c Bull, Evelyn L.; Heater, Thad W (2001). "Survival, causes of mortality, and reproduction in the American marten in northeastern Oregon". Northwestern Naturalist 82 (1): 1–6. doi:10.2307/3536640. JSTOR 3536640. http://www.fs.fed.us/pnw/pubs/journals/pnw_2001_bull001.pdf. 
  35. ^ a b Potvin, Francois; Breton, Laurier. 1995. Short-term effects of clearcutting on martens and their prey in the boreal forest of western Quebec. In: Proulx, Gilbert; Bryant, Harold N.; Woodard, Paul M., eds. Martes: taxonomy, ecology, techniques, and management: Proceedings of the 2nd international Martes symposium; 1995 August 12–16; Edmonton, AB. Edmonton, AB: University of Alberta Press: 452–474
  36. ^ a b Berg, William E.; Kuehn, David W. Demography and range of fishers and American martens in a changing Minnesota landscape, in Buskirk, pp. 262–271
  37. ^ a b Fredrickson, Richard John. 1990. The effects of disease, prey fluctuation, and clear cutting on American marten in Newfoundland. Logan, UT: Utah State University. Thesis.

Bibliography

  • Buskirk, Steven W.; Harestad, Alton S.; Raphael, Martin G.; Powell, Roger A., eds. (1994) Martens, sables, and fishers: Biology and conservation. Ithaca, NY: Cornell University Press, ISBN 0-8014-2894-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Before 1953, two species of martens, Martes americana and M. caurina, were recognized in North America. Subsequently, these two polytypic forms were found to intergrade in Montana and British Columbia, and they were synonymized under Martes americana, which is now considered to comprise two subspecies groups (americana and caurina). However, based on genetic data, Hicks and Carr (1997) and McGowan et al. (1999) suggested that the caurina and americana groups may indeed represent two distinct species. Wozencraft (in Wilson and Reeder 2005) noted that most authorities have regarded caurina and americana as subspecies groups rather than as species. Molecular data suggest that the caurina and americana subspecies groups are not the result of independent colonzations of North America (Stone and Cook 2002).

McGowan et al. (1999) documented substantial genetic divergence between populations in Newfoundland and Labrador.

Youngman and Schueler (1991) synonymized Martes nobilis with Martes americana; the former previously was thought to be an extinct Pleistocene-Holocene species.

Martes americana may be conspecific with Old World M. martes, M. melampus, and M. zibellina (Wozencraft, in Wilson and Reeder 1993, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!