Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Description

Long-tailed Weasels are voracious predators, foraging day and night for small vertebrates, and scavenging for carrion when necessary. In captivity, adults can consume an amount equal to one-third their own body weight in 24 hours. In the wild they may store food in a burrow or near a kill site. They are solitary except for the July-August breeding season. Both males and females maintain territories, marking them with chemical secretions from anal glands. Litters usually comprise 4-5 pups, born in a den. In 12 weeks they reach full adult body weight and begin hunting for food, pursuing mates, and establishing territories. Foxes, raptors, Coyotes, domestic dogs and cats, and rattlesnakes all prey on Long-tailed Weasels, and although they can live in a variety of habitats, population densities are low. In some locations they are endangered, and in others, considered threatened or species of concern.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Lichtenstein, M.H.C., 1831.  Darstellung neuer oder wenig bekannter Saugethiere, pl. 42 and corresponding text.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Long-tailed weasels have the largest distribution of any mustelid in the Western Hemisphere. The range of the long-tail weasel includes most of North America, extending from just north of the United States-Canadian border and south to Central America to northern South America (Sheffield and Thomas, 1997). In South America it is known from Columbia, Venezuela, Ecuador, Peru, and Bolivia (Eisenberg, 1989; Emmons and Feer, 1990; King, 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The range of long-tailed weasels includes most of North America, extending from just north of the United States-Canada border south throughout Central America to northern South America.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The range of the long-tail weasel includes most of North America, extending from just north of the United States-Canadian border and south to Central America to northern South America (Baker, 1983). Long-tailed weasels have the largest distribution of any mustelid in the Western Hemisphere.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southern Canada, most all of the contiguous U.S., and south to Venezuela and Bolivia, excluding the southwestern deserts of the U.S. (Wozencraft, in Wilson and Reeder 1993; Sheffield and Thomas 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Long-tailed weasels have a long slender body and head. Their long bodies and flexible backs allow them to enter the burrows of rodents and other animals that are smaller than them. On average, males are larger than females. These weasels have long, bushy tails that make up about 50% of their total body length. Long-tailed weasels have a small, narrow head with long whiskers, and short legs. Their fur is composed of short, soft underfur covered by shiny guard hair. They are cinnamon brown in color with white under parts that have a yellow tinge. Long-tailed weasels have a black tip to their tail, even in their all white winter phase. This differentiates them from the smaller least weasel, which doesn't have a black-tipped tail. Twice a year these weasels shed their fur, once in the spring and again in the fall. They shed in response to changes in daylength. The coat of animals in northern populations is white in the winter and brown in the summer, while those in southern populations are brown year round. Head and body length ranges from 203 to 266 mm, tail length ranges from 76 to 152 mm.

Range mass: 80 to 450 g.

Average mass: 150.6 g.

Range length: 203.0 to 266.0 mm.

Sexual Dimorphism: male larger

Average basal metabolic rate: 1.344 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Long-tail weasels have a long slender body, similar to other weasels. On average, males are larger than females. These weasels have long, bushy tails that are about 50% of their total body length. Body length varies between 330 and 420 mm in males and 280 to 350 mm in females, tail length is from 132 to 294 mm in males, and 112 to 245 mm in females. Long-tailed weasels have a small, narrow head with long whiskers. They also have short legs. The fur is composed of short, soft underfur covered by shiny guard hair. They are cinnamon brown in color with white under parts that have a yellow tinge. Twice a year these weasels shed their fur, once in the spring and again in the fall. This process is controlled by photoperiod. The coat of animals in northern populations is white in the winter and brown in the summer, while those in southern populations are brown year round (Baker, 1983).

Range mass: 80 to 450 g.

Average mass: 150.6 g.

Range length: 203.0 to 266.0 mm.

Sexual Dimorphism: male larger

Average basal metabolic rate: 1.344 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 55 cm

Weight: 267 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 330-420 mm males; 280-350 mm females

Weight:
Range: 160-450 g males; 80-250 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in a wide variety of habitats, usually near water. Favored habitats include brushland and open woodlands, field edges, riparian grasslands, swamps, and marshes (Sheffield, in Wilson and Ruff 1999). Dens are in abandoned burrow made by other mammal, rock crevice, brushpile, stump hollow, or space among tree roots; one individual may use multiple dens. Tolerant of close proximity to humans.

M. frenata is usually most abundant in late seral stages or ecotones where prey diversity is greatest (Wilson and Ruff, 1999). Its diet consists mainly of rodents and other small mammals. It is primarily nocturnal but is frequently active by day. It can climb and swim, but apparently not as well as M. erminea. Waterways provide access to suitable habitat and are a natural avenue far dispersal, particularly in areas that otherwise are unsuitable (Fagerstone, 1987). Home ranges vary from 4 to 120 ha and may overlap. Basically solitary, though more social where prey is abundant and habitat optimal.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Long-tailed weasels have adapted well to the changes in environment caused by humans. Long-tailed weasels are found in temperate and sub-tropical habitats in North and Central America. These habitats range from crop fields to small wooded areas to suburban areas. They are not found in deserts or thick, dense forests. Their burrows and nests are made in hollow logs, rock piles, and under barns. Sometimes, instead of building a new nest, long-tailed weasels use rodent burrows.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: chaparral ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Long-tailed weasels are found in temperate and tropical habitats in North and Central America. These habitats range from crop fields to small wooded areas to suburban areas. They are not found in deserts or thick, dense forests. Their burrows and nests are in hollow logs, rock piles, and under barns. Sometimes instead of building a new nest, long-tailed weasels take over the burrow of one of their prey (Baker, 1983).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: chaparral ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Found in a wide variety of habitats, usually near water. Favored habitats include brushland and open woodlands, field edges, riparian grasslands, swamps, and marshes (Sheffield, in Wilson and Ruff 1999). Dens are in abandoned burrow made by other mammal, rock crevice, brushpile, stump hollow, or space among tree roots; one individual may use multiple dens. Tolerant of close proximity to humans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Male home range is 10-160 ha, varying with location and prey availability; female range averages smaller than male range (Jackson 1961, Caire et al. 1989, Johnson et al. 1993). In Indiana, based on radio-tagged individuals, mean home range size (95% adaptive kernel contour area) was 51.8 ha for adult females and 180.3 ha for adult males (Gehring and Swihart 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The main prey of long-tailed weasels is small rodents like Peromyscus leucopus and Microtus pennsylvanicus. Females, with smaller bodies, have better luck capturing small rodents because their bodies can fit inside rodent burrows. Males pursue larger animals, for example Sylvilagus floridanus. While mammals are the food of choice, long-tailed weasels eat a wide range of foods, including Aves, Malacostraca, and Squamata. In the summer their diet includes fruits and berries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Main prey are small rodents. Females, with smaller bodies, have better success in hunting small rodents because their bodies can fit inside the small rodent burrows. Males pursue larger animals, such as eastern cottontail rabbits. While mammals are the food of choice, these weasels eat a wide range of food, from birds to reptiles, and in the summer their diet includes fruits and berries (Baker, 1983).

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on small mammals, occasionally birds, other small vertebrates, and insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Long-tailed weasels help to control populations of rodents and rabbits.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Long-tailed weasels are feisty and aggressive and will threaten animals much larger than themselves. They may be preyed upon by larger animals, such as large Strigiformes, Canis latrans, or large snakes, such as Sistrurus catenatus. They are especially vulnerable to predation as young.

Known Predators:

  • owls (Strigiformes)
  • coyotes (Canis_latrans)
  • rattlesnakes (Crotalidae)
  • eastern massasauga rattlesnakes (Sistrurus_catenatus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Long-tailed weasels help to control populations of rodents and rabbits.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Long-tailed weasels are feisty and aggressive and will threaten animals much larger than themselves. They may be preyed upon by larger animals, such as large owls, coyotes, or large snakes, such as eastern massasauga rattlesnakes. They are especially vulnerable to predation as young.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Mustela frenata is prey of:
Strigiformes
Crotalus
Canis latrans

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Basically solitary, though more social where prey is abundant and habitat optimal. Population density averages 1 per 7-40 acres (Jackson 1961), depending upon habitat and environmental conditions (Baker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Long-tailed weasels communicate among themselves with visual, sound, and scent cues. Females emit an attractive scent when they are ready to mate. Body language and sounds are used to communicate when weasels confront each other.

Long-tailed weasels have well-developed senses of sight, hearing, and smell, which allows them to be efficient and sensitive predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Long-tailed weasels communicate among themselves with visual, sound, and scent cues. Females emit an attractive scent when they are ready to mate. Body language and sounds are used to communicate when weasels confront each other.

Long-tailed weasels have well-developed senses of sight, hearing, and smell, which allows them to be efficient and sensitive predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Primarily nocturnal, but frequently can be seen during daytime.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Many long-tailed weasels die before reaching one year old. However, once they have reached adulthood they may live for several years. The lifespan of long-tailed weasels in the wild is not well known.

Average lifespan

Status: captivity:
8.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Many long-tailed weasels die before reaching one year old. However, once they have reached adulthood they may live for several years. The lifespan of long-tailed weasels in the wild is not well known.

Average lifespan

Status: captivity:
8.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.8 years (captivity) Observations: Males first mate when they are about one year of age (Virginia Hayssen et al. 1993). One specimen lived 8.8 years in captivity (Richard Weigl 2005). Maximum longevity could be slightly underestimated, though.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating System: polygynous

Mating for long-tailed weasels occurs in the mid-summer months. After copulation, implantation of the embryo is delayed and the egg does not begin to develop until March, making the total time that the female is pregnant around 280 days. Birth occurs from late April to early May, and the average size of the litter is six. Females mate in their first summer, but males wait until the following spring.

Breeding interval: Long-tailed weasels mate once each year.

Breeding season: Young are born from April to May.

Range number of offspring: 4.0 to 8.0.

Range gestation period: 337.0 (high) days.

Average gestation period: 280.0 days.

Average weaning age: 36.0 days.

Range age at sexual or reproductive maturity (female): 3.0 to 12.0 months.

Range age at sexual or reproductive maturity (male): 3.0 to 12.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous ; delayed implantation

Average birth mass: 3.1 g.

Average number of offspring: 6.2.

At birth, young weasels weigh about 3 grams. They are born helpless, with eyes closed, and with pink, wrinkled skin and white fur. At fourteen days their white fur begins to thicken, and size differentiation makes it easy to tell males from females. At 36 days old young weasels eyes open and they begin to be weaned and to eat foods brought back to the nest by their mother. They learn how to kill prey from the mother, and by 56 days they are able to kill prey on their own. Soon after they become independent.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating System: polygynous

Mating for long-tailed weasels occurs in the mid-summer months. After copulation, implantation is delayed and the egg does not begin to develop until March, making the total gestation time around 280 days. Birth occurs from late April to early May, and the average size of the litter is six. At birth young weasels weigh about 3 grams. They are pink with wrinkled skin, and they have white fur. At fourteen days, the white hair begins to thicken, and size differentiation makes it easy to tell males from females. At 36 days young weasels are weaned and can eat food brought back to the nest by the mother. They learn how to kill prey from the mother and by 56 days old they are able to kill prey on their own. Females mate in their first summer, but males wait until the following spring (Baker, 1983).

Breeding interval: Long-tailed weasels mate once each year.

Breeding season: Young are born from April to May.

Range number of offspring: 4.0 to 8.0.

Range gestation period: 337.0 (high) days.

Average gestation period: 280.0 days.

Average weaning age: 36.0 days.

Range age at sexual or reproductive maturity (female): 3.0 to 12.0 months.

Range age at sexual or reproductive maturity (male): 3.0 to 12.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous ; delayed implantation

Average birth mass: 3.1 g.

Average number of offspring: 6.2.

At birth, young weasels weigh about 3 grams. They are born helpless, with eyes closed, and with pink, wrinkled skin and white fur. At fourteen days their white fur begins to thicken, and size differentiation makes it easy to tell males from females. At 36 days old young weasels eyes open and they begin to be weaned and to eat foods brought back to the nest by their mother. They learn how to kill prey from the mother, and by 56 days they are able to kill prey on their own. Soon after they become independent.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds July-August. Gestation lasts 205-337 days (average 279); implantation delayed. Litter size is 1-12 (average 4-7). In north, one litter is born in April-May; nests with young have been found in November in southeastern U.S. Weaning begins at about 5 weeks. Young begin to disperse at about 11-12 weeks (see Johnson et al. 1993). Females are sexually mature in 3-4 months (in captivity) or usually 2 years in southern Canada (see Johnson et al. 1993), males in about 1 year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Mustela frenata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Mustela frenata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAATCGATGGTTATTTTCTACTAATCATAAAGACATTGGCACCCTTTACCTCCTATTCGGTGCATGAGCCGGAATAGTAGGAACTGCCCTCAGTCTTCTAATCCGTGCTGAATTAGGTCAACCCGGCGCCCTGCTAGGAGACGACCAGATTTATAATGTAATCGTAACCGCTCACGCATTTGTGATAATTTTCTTCATGGTAATACCTATTATACTTGGAGGTTTTGGTAACTGACTCATCCCCTTAATAATTGGTGCACCTGATATAGCATTCCCACGAATAAATAACATAAGTTTCTGGCTTCTACCCCCTTCCTTCCTCCTCCTTCTGGCCTCTTCGATAGTAGAAGCAGGTGTAGGAACAGGATGAACTGTTTACCCCCCTCTAGCAGGAAACCTGGCACACGCAGGAGCATCCGTAGACCTAGCAATTTTTTCTCTACACTTAGCAGGTGTTTCATCCATTTTAGGGTCTATCAACTTTATCACAACAATCATCAACATAAAACCGCCCGCTATATCACAATACCAAACTCCTTTATTCGTATGATCTGTTTTAATTACAGCTGTATTACTACTTCTATCCTTGCCAGTGCTAGCAGCCGGTATTACTATATTACTCACAGATCGTAATCTGAATACTACCTTCTTTGATCCAGCCGGAGGAGGAGACCCTATCCTATATCAACACCTATTCTGATTTTTCGGACATCCAGAAGTATACATCCTAATTCTCCCTGGGTTTGGTATTATTTCACACGTTGTAACATACTACTCAGGAAAAAAAGAACCTTTTGGTTATATGGGAATAGTATGAGCTATAATGTCAATCGGTTTCTTAGGGTTTATCGTATGGGCCCACCATATGTTTACTGTAGGCTTAGACGTAGACACACGAGCATATTTCACCTCAGCTACTATAATTATTGCTATTCCAACAGGTGTTAAAGTGTTCAGCTGACTAGCTACTCTGCACGGAGGAAATATTAAATGATCTCCAGCTATACTATGGGCCTTAGGATTTATCTTTTTATTTACAGTGGGTGGTTTAACGGGTATTGTATTATCAAATTCATCACTAGACATTGTCCTTCATGATACATACTACGTAGTAGCTCACTTCCACTATGTTCTTTCAATAGGGGCAGTATTTGCAATTATGGGCGGATTCGTCCATTGATTCCCATTATTTACAGGCTATACCCTAAACGATATCTGAGCAAAAATTCATTTTACAATTATATTCGTAGGAGTAAATACAACATTCTTTCCTCAACACTTCCTAGGATTATCAGGTATACCTCGACGCTATTCTGATTATCCAGATGCATATACAACATGAAACACAGTATCTTCCATGGGCTCATTCATTTCATTAACAGCAGTAATACTGATAATCTTCATAATTTGAGAAGCCTTCGCATCCAAACGAGAAGTGTTGACAGTAGAGTTAACCTCAACAAACATCGAATGATTACATGGATGTCCTCCTCCATACCACACATTTGAAGAACCAACCTATGTGTTATCAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as the species has a wide distribution range and is relatively common across its range. This species is tolerant to a moderate amount of land-use change and can often benefit from human presence. However, M. frenata populations generally fluctuate, and they frequently become locally extinct in response to changes in prey numbers (King 1989).

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Long-tailed weasels are abundant and widespread. They do well in a variety of habitats and are not currently threatened.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Long-tailed weasels are widespread and fairly common throughout their range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Long-tailed weasels are widespread and fairly common throughout their range (Wilson and Ruff, 1999). M. frenata is difficult to census. Estimates of densities vary widely by habitat and prey availability (King, 1989). Population density was found to vary from about 1/2.6 ha to 1/260 ha (Nowak, 2005). Jackson (1961) found population density averages 1 per 7-40 acres, depending upon habitat and environmental conditions (Baker 1983). M. frenata populations are more stable than those of M. erminea or M. nivalis. However, M. frenata populations generally fluctuate, and they frequently become locally extinct in response to changes in prey numbers (King, 1989).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Movements of radio-tagged weasels in Indiana were consistent with the notion that long-tailed weasels may be sensitive to agriculturally induced fragmentation of habitat and the importance of maintaining landscape connectivity for species conservation (Gehring and Swihart, 2004). Additional threats include monoculture and drainage of wetlands. Perhaps affected directly and indirectly by pesticide use (effects on reproduction, habitat, and/or food supply).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Threats include monoculture and "clean" farming and drainage of wetlands. Perhaps affected directly and indirectly by pesticide use (effects on reproduction, habitat, and/or food supply).

Movements of radio-tagged weasels in Indiana were consistent with the notion that long-tailed weasels may be sensitive to agriculturally induced fragmentation of habitat and the importance of maintaining landscape connectivity for species conservation (Gehring and Swihart 2004).

Prairie subspecies longicauda declined significantly in the northern Great Plains in the mid-1900s due to intense agricultural activity, use of pesticides, and habitat degradation, but the subspecies still is widespread and stable in its Canadian range (Johnson et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in many protected areas across its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Long-tailed weasels have been know to raid captive poultry flocks. They are efficient predators and, like other members of their family, will kill and store as many prey as they can find. As a result they may kill entire flocks in a single night.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Long-tailed weasel pelts are taken by trappers, but there is little demand for them. Long-tailed weasels are excellent at controlling mouse and rat populations, so are beneficial to farmers because they eliminate these pests.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Long-tailed weasels are known to raid poultry flocks (Baker, 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The pelts of long-tailed weasels were available in the fur trade but were not a popular commodity. Long-tailed weasels are good mousers and ratters, so farmers do not mind having weasels around their farms because they eliminate these pests (Baker, 1983).

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-tailed weasel

The long-tailed weasel (Mustela frenata), also known as the bridled weasel or big stoat is a species of mustelid distributed from southern Canada throughout all the United States and Mexico, southward through all of Central America and into northern South America.

Evolution[edit]

Skulls of a long-tailed weasel (top), a stoat (bottom left) and least weasel (bottom right), as illustrated in Merriam's Synopsis of the Weasels of North America

The long-tailed weasel is the product of a process begun 5–7 million years ago, when northern forests were replaced by open grassland, thus prompting an explosive evolution of small, burrowing rodents. The long-tailed weasel's ancestors were larger than the current form, and underwent a reduction in size to exploit the new food source. The long-tailed weasel arose in North America 2 million years ago, shortly before the stoat evolved as its mirror image in Eurasia. The species thrived during the Ice Age, as its small size and long body allowed it to easily operate beneath snow, as well as hunt in burrows. The long-tailed weasel and the stoat remained separated until half a million years ago, when falling sea levels exposed the Bering land bridge, thus allowing the stoat to cross into North America. However, unlike the latter species, the long-tailed weasel never crossed the land bridge, and did not spread into Eurasia.[2]

Physical description[edit]

The long-tailed weasel is one of the largest members of the genus Mustela in North America, with a total length of 300–350 mm (11.8–13.78 in.) and a tail comprising 40–70% of the head and body length. In most populations, females are 10–15% smaller than males,[3] thus making them about the same size as large male stoats.[4] The eyes are black in daylight, but glow bright emerald green when caught in a spotlight at night.[5] The dorsal fur is brown in summer, while the underparts are whitish and tinged with yellowish or buffy brown from the chin to the inguinal region. The tail has a distinct black tip. Long-tailed weasels in Florida and the southwestern US may have facial markings of a white or yellowish colour. In northern areas in winter, the long-tailed weasel's fur becomes white, sometimes with yellow tints, but the tail retains its black tip.[3] The long-tailed weasel moults twice annually, once in autumn (October to mid-November) and once in spring (March–April). Each moult takes about 3–4 weeks and is governed by day length and mediated by the pituitary gland. Unlike the stoat, whose soles are thickly furred all year, the long-tailed weasel's soles are naked in summer.[4] The long-tailed weasel has well-developed anal scent glands, which produce a strong and musky odour. Unlike skunks, which spray their musk, the long-tailed weasel drags and rubs its body over surfaces in order to leave the scent,[6] to mark their territory and, when startled or threatened, to discourage predators.[7]

Behavior[edit]

Reproduction and development[edit]

The long-tailed weasel mates in July–August, with implantation of the fertilized egg on the uterine wall being delayed until about March. The gestation period lasts 10 months, with actual embryonic development taking place only during the last four weeks of this period, an adaptation to timing births for spring, when small mammals are abundant. Litter size generally consists of 5–8 kits, which are born in April–May. The kits are born partially naked, blind and weighing 3 grams, about the same weight of a hummingbird. The long-tailed weasel's growth rate is rapid, as by the age of three weeks, the kits are well furred, can crawl outside the nest and eat meat. At this time, the kits weigh 21–27 grams. At five weeks of age, the kit's eyes open, and they become physically active and vocal. Weaning begins at this stage, with the kits emerging from the nest and accompanying the mother in hunting trips a week later. The kits are fully grown by autumn and, by this time, the family disbands. The females are able to breed at 3–4 months of age, while males become sexually mature at 15–18 months.[6]

Denning and sheltering behaviour[edit]

The long-tailed weasel dens in ground burrows, under stumps or beneath rock piles. It usually does not dig its own burrows, but commonly uses abandoned chipmunk holes. The 22–30 cm (8.66–11.8 in.) diameter nest chamber is situated around 60 cm (23.6 in.) from the burrow entrance, and is lined with straw and the fur of prey.[6]

Diet[edit]

Long-tailed weasel in winter fur attacking a quail, as illustrated in Popular Science Monthly

The long-tailed weasel is a fearless and aggressive hunter which may attack animals far larger than itself. When stalking, it waves its head from side to side in order to pick up the scent of its prey. It hunts small prey, such as mice, by rushing at them and kills them with one bite to the head. With large prey, such as rabbits, the long-tailed weasel strikes quickly, taking its prey off guard. It grabs the nearest part of the animal and climbs upon its body, maintaining its hold with its feet. The long-tailed weasel then manoevres itself to inflict a lethal bite to the neck.[8]

The long-tailed weasel is an obligate carnivore which prefers its prey to be fresh or alive, eating only the carrion stored within its burrows. Rodents are almost exclusively taken when they are available. Its primary prey consists of mice, rats, squirrels, chipmunks, shrews, moles and rabbits. Occasionally, it may eat small birds, bird eggs, reptiles, amphibians, fish, earthworms and some insects. The species has also been observed to take bats from nursery colonies. It occasionally surplus kills, usually in spring when the kits are being fed, and again in autumn. Some of the surplus kills may be cached, but are usually left uneaten. Kits in captivity eat from ¼–½ of their body weight in 24 hours, while adults eat only one fifth to one third. After killing its prey, the long-tailed weasel laps up the blood, but does not suck it, as is popularly believed. With small prey, also the fur, feathers, flesh and bones are consumed, but only some flesh is eaten from large prey. When stealing eggs, the long-tailed weasel removes each egg from its nest one at a time, then carries it in its mouth to a safe location where it bites off the top and licks out the contents or if they have babies in the den they may hold it in their mouth all the way back to them.[8]

Subspecies[edit]

As of 2005,[9] 42 subspecies are recognised.

References[edit]

Notes[edit]

  1. ^ Reid, F. & Helgen, K. (2008). Mustela frenata. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2010. Database entry includes a brief justification of why this species is of least concern
  2. ^ Macdonald 1992, p. 205
  3. ^ a b Feldhamer, Thompson & Chapman 2003, p. 651
  4. ^ a b Merritt & Metinko 1987, p. 280
  5. ^ Schwartz & Schwartz 2001, p. 303
  6. ^ a b c Merritt & Metinko 1987, p. 282
  7. ^ http://www.esf.edu/aec/adks/mammals/longtailed_weasel.htm
  8. ^ a b Schwartz & Schwartz 2001, pp. 306–307
  9. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  10. ^ Merriam 1896, pp. 26–28
  11. ^ Merriam 1896, pp. 31–32
  12. ^ Merriam 1896, p. 24
  13. ^ Merriam 1896, pp. 22–24
  14. ^ Merriam 1896, pp. 28–29
  15. ^ Merriam 1896, pp. 29–30
  16. ^ Merriam 1896, pp. 20–21
  17. ^ Merriam 1896, pp. 16–18
  18. ^ a b Merriam 1896, pp. 25–26
  19. ^ Merriam 1896, p. 19
  20. ^ Merriam 1896, pp. 21–22
  21. ^ Merriam 1896, p. 21
  22. ^ Merriam 1896, pp. 30–31
  23. ^ Merriam 1896, pp. 18–19

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!