Articles on this page are available in 3 other languages: Spanish (2), Chinese (Simplified) (4), Dutch (1) (learn more)

Overview

Brief Summary

Description

"Ermine are highly adaptable predators, easily invading small burrows to feed on voles, mice, and young rabbits. They also eat earthworms, frogs, and squirrels, climbing trees and swimming if necessary. Mother Ermine teach their young to hunt. Litters of 4 to 9 young are born in nests that are often located in rodent burrows. The newborns are blind and helpless, but in six weeks are almost adult-size. In the summer, the Ermine's coat is brown, but in the winter it is pure white except for the tip of the tail, which stays black. Ermine population density tends to fluctuate as rodent populations fluctuate."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Uppsala, 1:46, 823 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

The stoat is a carnivore, and a very skillful predator (1), typically feeding on birds and small mammals, particularly rabbits and small rodents, even taking prey as large as rats and grey squirrels (5). They hunt in a zigzag pattern, making use of features such as walls and hedgerows to provide cover, probing crevices and holes, and often standing alert on the hind legs to look around (1). Their exceptionally keen senses help them to locate prey; they try to get as close as possible to their target, before rushing in and dispatching it with a swift bite to the back of the neck (1). Males (dogs, bucks, jacks or hobs) (4) and females (bitches, does, or jills) (4) live in separate territories, which they defend against individuals of the same sex (2). In spring, males set off to search for females (2). Mating occurs in early summer, but births do not occur until the spring of the following year, as development of the fertilised egg is delayed (2) for 8 to 9 months (1). Between 6 and 12 blind, helpless kits are born per litter (2), after about 8 weeks the young stoats begin to hunt alongside their mother (1). Females are able to mate before they are fully weaned at just 60 to 70 days of age, whereas males are unable to breed until they reach at least 2 years of age (1). Females typically stay within or close to the area of birth, and males disperse and establish large territories that overlap several female ranges (1). Predators of stoats include owls, larger carnivores and hawks (2). The average life expectancy of a stoat is just 1.5 years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Stoats are found in wooded banks and forests as well as along ditches, marshes and in the dunes. They find places to hide in old rat and rabbit holes, under tree roots and in piles of wood, niches and tree hollows. If the opening is smaller than five centimeters, stoats cannot enter. They eat mainly (water) voles, but also like rabbits, birds and their eggs. Stoats appear brown in the summer and pure white in the winter. However, in the Netherlands, the animals are often only partially white. The tip of the stoat's tail is always black.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Stoats are elusive predators, with long, slender bodies and short legs (2). The pelage is reddish to ginger in colour with white or cream underparts (2). Some individuals turn either partially or fully white in winter (2). The tail has a black tip, a feature that allows stoats to be distinguished from weasels (2). The head, which is supported by a fairly long neck, is triangular in shape, and features bright black eyes, long whiskers and round ears (1). Male stoats are much larger than females (1). At birth the kits are covered with fine white hair, and a dark 'mane' of fur forms around the neck after the third week (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Circumboreal range throughout North America, Europe, and Asia, from Greenland and the Canadian and Siberian Arctic islands south to about 35°N (King 1983, Fagerstone 1987). In North America, this species is found throughout Alaska and Canada south through most of the northern United States to central California, northern Arizona (Berna 1991), northern New Mexico, Iowa, the Great Lakes region, Pennsylvania, and northern Virginia (Fagerstone 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Circumboreal range throughout North America, Europe, and Asia, from Greenland and the Canadian and Siberian Arctic islands south to about 35°N (King 1983, Fagerstone 1987). In North America, this species is found throughout Alaska and Canada south through most of the northern United States to central California, northern Arizona (Berna 1991), northern New Mexico, Iowa, the Great Lakes region, Pennsylvania, and northern Virginia (Fagerstone 1987). It has been introduced to New Zealand. In Europe, it is present as far south as 41ºN in Portugal (Santos Reis, 1983), and is found on most islands with the exception of Iceland, Svalbard, and some small North Atlantic islands. It does not occur on Mediterranean islands. In Japan, it is present in central mountains (northern and central Japan Alps) to northern part of Honshu (primarily above 1,200 m) and Hokkaido (Abe et al., 2005). Its vertical range is from sea level to 3,000 m (Pulliainen, 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Ermine are distributed all the way around northern part of the globe. They are found in the north temperate regions of Eurasia and North America. In the New World, they range from east to west in a broad belt from the Arctic Ocean and adjacent islands of the Canadian Archipelago southward into the northern United States. Ermine are absent from the Great Plains.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Ruff, S., D. Wilson. 1999. The Smithsonian Book of North American Mammals. Washington [D.C.]: Smithsonian Institution Press in association with the American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Ermine have a circumpolar distribution. They are found in the north temperate regions of Eurasia and North America. In the New World, they range from east to west in a broad belt from the Arctic Ocean and adjacent islands of the Canadian Archipelago southward into the northern United States. Ermine are absent from the Great Plains.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Ruff, S., D. Wilson. 1999. The Smithsonian Book of North American Mammals. Washington [D.C.]: Smithsonian Institution Press in association with the American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread and common throughout mainland Britain and Ireland (3), and occurs on a number of the larger islands around the UK (3). It is found throughout north temperate and cold parts of Eurasia and North America (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

At full adult size total body length from head to rump is 170 mm to 330 mm. Males are generally twice as large as females, with males weighing from 67 to 116 grams and females from 25 to 80 grams. The tail length is about 35% of the total body length, ranging from 42mm to 120mm. Ermine have the typical weasel form: long body, short legs, long neck supporting a triangular head, slightly protruding round ears, bright black eyes, and long whiskers. Their short, moderately fine fur is white in the winter and the tip of the tail is black. In the summer, the fur on the back is chocolate brown while the fur on the belly extending to the upper lip is yellowish white.

Range mass: 25 to 116 g.

Range length: 170 to 330 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 1.276 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

At full adult size total body length from head to rump is 170 mm to 330 mm. Males are generally twice as large as females, with males weighing from 67 to 116 grams and females from 25 to 80 grams. The tail length is about 35% of the total body length, ranging from 42 mm to 120 mm. Ermine have the typical weasel form: long body, short legs, long neck supporting a triangular head, slightly protruding round ears, bright black eyes, and long whiskers. Their short, moderately fine fur is white in the winter and the tip of the tail is black. In the summer, the dorsal fur is chocolate brown while the ventral fur extending to the upper lip is yellowish white.

Range mass: 25 to 116 g.

Range length: 170 to 330 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 1.276 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 34 cm

Weight: 182 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are approximately twice the size of females.

Length:
Average: 272 mm males; 240 mm females
Range: 219-343 mm males; 190-292 mm females

Weight:
Average: 80 g males; 54 g females
Range: 67-116 g males; 25-80 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Prefers wooded areas with thick understory near watercourses. Rarely occurs in heavily forested regions. Has adapted to a wide variety of habitats. Dens in hollow log or under log, stump, roots, brushpile, or rocks. In winter in southern Ontario, usually stayed beneath snow surface (Simms 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Ermine (Stoat) occupy a wide range of habitats. They are often found in successional or forest-edge habitats, in scrub, alpine meadows, marshes, riparian woodlands, hedgerows, and riverbanks that have high densities of small mammals, especially Microtus and Arvicola species (King, 1983). Pulliainen (1999) states that coniferous and mixed woodlands are preferred, but that many other habitats are used including tundra and the summits of fells and mountains. Dense forests and deserts are avoided (King, 1983). Specifically to Mongolia, they inhabit taiga, forest-steppe and rocky parts of the semi-desert. This species is a specialist predator of small mammals, but will occasionally feed on fruit, earthworms, insects, eggs, and birds (King, 1983). Its local distribution is typically related to that of small rodents and lagomorphs (King, 1983; Pulliainen, 1999). This species is nocturnal but are often seen in daylight hours. Estimates for home range size range from 4 to 200 hectares for males, most often falling between 10 to 40 hectares (King, 1983).

Its local distribution is typically related to that of small rodents and lagomorphs (King, 1983). They tend to avoid dense forest and deserts, and are often found in successional or forest-edge habitats, in scrub, alpine meadows, marshes, riparian woodlands, hedgerows, and riverbanks that have high densities of small mammals, especially Microtus and Arvicola (King, 1983). Estimates for home range size range from 4 to 200 hectares for males, most often falling between 10 to 40 hectares (King, 1983).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ermine prefer woodlands near rivers, marshes, shrubby fencerows, and open areas adjacent to forests or shrub borders. Although ermine live primarily on the ground, they climb trees and swim well.

Tree roots, hollow logs, stone walls, and rodent burrows are used as dens. Dens are usually around 300 mm below ground. Ermine line their nests with dry plant material, and fur and feathers from prey. Side cavities of burrows are used for storing food and as bathrooms.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; savanna or grassland ; forest ; scrub forest ; mountains

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ermine prefer riparian woodlands, marshes, shrubby fencerows, and open areas adjacent to forests or shrub borders. Although ermine are primarily terrestrial, they climb trees and swim well. Tree roots, hollow logs, stone walls, and rodent burrows are used as dens. Dens are usually around 300 mm below ground. Ermine line their nests with dry vegetation, and fur and feathers from prey. Side cavities of burrows are used as food caches and latrines.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; savanna or grassland ; forest ; scrub forest ; mountains

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits a range of habitats including open moor, woodland, farmland and marsh (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Mainly small mammals, and occasionally other small vertebrates and insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Ermine are carnivores that hunt mostly at night. They are predators on small, warm-blooded vertebrates, preferably mammalia of leporidae size and smaller. When mammalian prey is scarce, ermine eat aves, eggs, anura, actinopterygii, and insecta. In severe climates, ermine often hunt under snow and survive entirely on small rodentia and arvicolinae. Ermine must eat daily to meet their high energy demands. They store leftover meals as a way of dealing with these demands.

When an ermine senses a prey animal, it approaches as closely as possible. With incredible speed it grasps the back of the victim's head and neck with sharp teeth, and wraps its body and feet around the victim. The victim dies from repeated bites to the base of the skull. Ermine have keen senses that help them locate prey. leporidae and rodentia are mainly followed by scent, insecta by sound, and actinopterygii by sight.

Animal Foods: birds; mammals; amphibians; fish; eggs; insects

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Ermine are carnivores that hunt primarily at night. They are specialist predators on small, warm-blooded vertebrates, preferably mammals of rabbit size and smaller. When mammalian prey is scarce, ermine eat birds, eggs, frogs, fish, and insects. In severe climates, ermine frequently hunt under snow and survive entirely on small rodents and lemmings. Daily meals are essential to meet the ermine's exhorbitant energy and heat production demands. Ermine cache leftover meals as a way of dealing with these demands.

Once a potential prey is identified, the ermine approaches as closely as possible. With incredible speed it grasps the back of the victim's head and neck with sharp teeth, and wraps its body and feet around the victim. The victim dies from repeated bites to the base of the skull. Ermine have keen senses that help them locate prey. Hares and rodents are mainly followed by scent, insects by sound, and fish by sight.

Animal Foods: birds; mammals; amphibians; fish; eggs; insects

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Ermine are important predators on small mammal communities in the ecosystems in which they live.

Many ermine die from a parasitic worm that infects the nose. Eventually the worm causes holes to form in the skull and puts pressure on the brain, causing death. soricidae are believed to carry this parasite.

Commensal/Parasitic Species:

  • Skrjabingylus nasicola

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Ermine are fierce and aggressive, although small, animals.  Potential predators are larger carnivores including vulpes vulpes, urocyon cinereoargenteus, martes americana, martes pennanti, taxidea taxus, accipitridae, and occasionally felis silvestris.

Known Predators:

  • red foxes (Vulpes_vulpes)
  • gray foxes (Urocyon_cinereoargenteus)
  • American martens (Martes_americana)
  • fishers (Martes_pennanti)
  • American badgers (Taxidea_taxus)
  • raptors (Accipitridae)
  • domestic cats (Felis_silvestris)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Ermine are important predators on small mammal communities in the ecosystems in which they live.

Many ermine die from a parasitic nematode (Skrjabingylus nasicola) that infects the nasal passage, distorting the sinuses. Eventually the skull is perforated and pressure is exerted on the brain, causing death. Shrews are believed to be the carrier hosts of this parasite.

Commensal/Parasitic Species:

  • nematode worms

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Ermine are fierce and aggressive, although diminutive, animals.  Potential predators are larger carnivores including red fox, gray fox, martens, fishers, badgers, raptors, and occasionally domestic cats.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • K. Paviour-Smith, The biotic community of a salt meadow in New Zealand, Trans. R. Soc. N.Z. 83(3):525-554, from p. 542 (1956).
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but certainly exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Home range averages 12-16 ha (Jackson 1961). In southern Ontario, density over 95 ha averaged 6 per sq km; home range averaged 20-25 ha for males, smaller for females; most individuals remained on study site less than 1 year (Simms 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Ermine have keen senses of smell, vision, hearing, and touch that help them to locate prey. Most mustelidae are fairly quiet animals, but some vocalizations may be used for communication. Ermine probably use odor to let other ermine know they are ready to mate.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Ermine have keen senses of smell, vision, hearing, and touch that help them to locate prey. Most mustelids are fairly quiet animals, but some vocalizations may be used in intra-specific communication. Chemical cues are probably the main means of communicating reproductive readiness to potential mates.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Mainly nocturnal, can been seen frequently during the day.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average life span of an ermine is 1 to 2 years; the maximum is 7 years.

Range lifespan

Status: wild:
7 (high) years.

Typical lifespan

Status: wild:
1 to 2 years.

Average lifespan

Status: wild:
1-2 years.

Range lifespan

Status: captivity:
12.5 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The average life span of an ermine is 1 to 2 years; the maximum is 7 years.

Range lifespan

Status: wild:
7 (high) years.

Typical lifespan

Status: wild:
1 to 2 years.

Average lifespan

Status: wild:
1-2 years.

Range lifespan

Status: captivity:
12.5 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.5 years (captivity) Observations: One wild born specimen was 12-13 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds July-August. Gestation lasts 255 days. Litter of 4-9 (average 6-7) is born mid-April to early May. Females are sexually mature in 3-4 months, males in 12 months (probably). Delayed implantation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Both male and female ermine have many different mates.

Mating System: polygynandrous (promiscuous)

Ermine mate in late spring to early summer. Females produce only 1 litter per year. Young are born in April or May after an average pregnancy of 280 days, which includes an 8 to 9 month period in which the young do not develop. Longer days beginning in March trigger the young to begin developing. Litter size ranges from 3 to 18 offspring and averages 4 to 9. Young are blind and helpless. They are covered with fine white hair, and a prominent dark mane of dense fur develops around the neck by the third week (function unknown). The young grow quickly and are able to hunt with their mother by their eighth week. Although females do not reach adult size until a least 6 weeks after birth, they are able to mate when they are 60 to 70 days old, often before they are weaned. Males do not breed or grow to adult size until their second summer.

Females in nature may survive for at least 2 breeding seasons, while males generally do not survive this long. The number of offspring that each ermine has in its lifetime depends on the amount of food that is available.

Breeding interval: Ermine generally breed once yearly.

Breeding season: Ermine mate in late spring to early summer.

Range number of offspring: 3 to 18.

Average number of offspring: 4-9.

Average gestation period: 280 days.

Average weaning age: 8-10 weeks.

Average age at sexual or reproductive maturity (female): 60-70 days.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation ; embryonic diapause

Average birth mass: 2.3 g.

Average gestation period: 43 days.

Average number of offspring: 6.77.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
95 days.

Only females care for their offspring, nursing and protecting them until they become independent. The young are born blind and helpless.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ermine are a polygynous-promiscuous species, with males and females mating opportunistically.

Mating System: polygynandrous (promiscuous)

Ermine mate in late spring to early summer. Females are polyestrous, but produce only 1 litter per year. Young are born in April or May after an average gestation period of 280 days, which includes an 8 to 9 month period of developmental delay. Longer days beginning in March trigger the resumption of fetal development. Litter size ranges from 3 to 18 offspring and averages 4 to 9. The sex ratio is unequal. Young are blind and helpless. They are covered with fine white hair, and a prominent dark mane of dense fur develops around the neck by the third week (function unknown). The young grow quickly and are able to hunt with their mother by their eighth week. Although females do not reach adult size until a least 6 weeks after birth, they are able to mate when they are 60 to 70 days old, often before they are weaned. Males do not breed or gain adult dimensions until their second summer.

Females in nature may survive for at least 2 breeding seasons, while males generally do not survive this long. Reproductive success is highly dependent on food availability.

Breeding interval: Ermine generally breed once yearly.

Breeding season: Ermine mate in late spring to early summer.

Range number of offspring: 3 to 18.

Average number of offspring: 4-9.

Average gestation period: 280 days.

Average weaning age: 8-10 weeks.

Average age at sexual or reproductive maturity (female): 60-70 days.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation ; embryonic diapause

Average birth mass: 2.3 g.

Average gestation period: 43 days.

Average number of offspring: 6.77.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
95 days.

Females exclusively care for their offspring, nursing and protecting them until they become independent. The young are born blind and helpless.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustela erminea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTCTTATTCGGTGCATGAGCCGGAATAGTAGGGACTGCTCTCAGCCTACTAATCCGTGCTGAACTAGGTCAACCNGGCGCCCTGCTAGGAGATGACCAGGTATACAATGTGATCGTAACTGCTCACGCATTCGTAATAATTTTCTTCATAGTAATGCCCATCATGCTTGGGGGCTTTGGAAACTGACTTATCCCTCTAATAATCGGTGCACCCGATATAGCATTCCCACGAATAAATAACATAAGCTTTTGACTTCTCCCACCTTCTTTTCTCCTCCTATTAGCCTCTTCCATGGTAGAAGCAGGCGCAGGAACAGGATGAACTGTATACCCTCCTTTAGCAGGGAATCTAGCACATGCAGGAGCATCCGTAGACCTGGCAATTTTTTCACTACACTTAGCTGGTGTTTCATCTATCCTAGGGTCAATTAACTTTATCACTACTATTATCAACATGAAACCACCCGCTATATCGCAATACCAAACTCCGCTGTTTGTATGATCAGTTTTAATTACAGCCGTACTTCTTCTTCTATCCTTACCAGTACTAGCAGCCGGTATTACCATGCTACTCACAGATCGAAACCTAAACACTACTTTCTTTGACCCGGCCGGAGGAGGAGACCCCATCCTGTACCAACACCTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mustela erminea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 88
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as it is a wide circumpolar distribution, it is an abundant species with no significant major threat.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ermine are not considered threatened or endangered, although hunting pressure in some areas may impact populations severely.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ermine are not considered threatened or endangered, although hunting pressure in some areas may impact populations severely.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed under Appendix III of the Bern Convention, and classified as a species of conservation concern under the UK Biodiversity Action Plan, but not a priority species (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Total adult population size is unknown but certainly exceeds 100,000. The density and structure of populations of this species are unstable, due to short life spans and high reproductive capacity. Populations are greatly influenced by fluctuations in prey supply (especially small mammals) (King, 1983; Pulliainen, 1999). Population fluctuations of stoats and their prey tend to increase in magnitude at more northerly latitudes (Pulliainen, 1999), although fluctuations have also been recorded in Spain (Blanco, 1998; Palomo and Gisbert, 2002). In France, it was declining, but now has stabilized as a result of full protection. In Spain it has been speculated that the population may be declining as a results of declines in the southern water vole, Arvicola sapidus, (Palomo and Gisbert, 2002), but the population trend has not been quantified in Spain or Portugal (Palomo and Gisbert, 2002; Cabral et al., 2005). It is abundant in north-western and central Mongolia, but is rare in the eastern plains (Bannikov, 1954; Dulamtseren, 1970; Sokolov and Orlov, 1980). Despite population fluctuations, it is a widespread and abundant species, common in suitable habitats. However, in some parts of its range it is rare.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: On a range-wide scale, no major threats are known. Locally the species may be threatened by unrestricted trapping and habitat loss due to timber harvest or natural disturbance (Fagerstone 1987).

Subspecies M. e. haidarum of the Queen Charlotte Islands, British Columbia, apparently is declining as a result of habitat destruction caused by introduced mammals (COSEWIC 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
On a range-wide scale, no major threats are known. Locally the species may be threatened by unrestricted trapping and habitat loss due to timber harvest or natural disturbance (Fagerstone 1987). In the Iberian Peninsula the species is dependent on two Arvicola species, and these are declining, so loss of prey base may be a threat (Palomo and Gisbert, 2002). Habitat loss (e.g. as a result of urbanization: Pulliainen, 1999) is also a problem in parts of the range. The species is commonly hunted in Russia, where there is also a limited fur trade (McDonald pers. comm.). In western and central Europe, the stoat was frequently hunted for its white winter fur up until at least the 1930s, with c.30,000 pelts sold in Finland alone during that decade (Pulliainen, 1999). Availability of prey is the principal factor controlling population density (King, 1983; Pulliainen, 1999), but disease, parasites and other pressures can also contribute.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stoats are controlled by gamekeepers because they prey on gamebirds (3). Historically they were trapped extensively for their winter fur (ermine). At present, competition with foxes, declines of farmland bird populations, habitat loss (3) and the effects of rodenticides (5) may all be affecting stoats (3). Although the current status of stoats in the UK is unclear, it is apparent that the population has not shown an increase following the post-myxamatosis recovery of rabbit populations (4). This fact is cause for concern regarding the conservation status of this species (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Research into ermine coexistence with least weasels and long-tailed weasels is needed, with special attention given to habitat and prey selection, as well as a comparison of possible threats and examination of declines in these three species. Continued study of morphology and genetics is needed to clarify subspecific taxonomic status, and to identify evolutionarily significant populations requiring special conservation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in national parks, wilderness areas, and other protected habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
It is listed on Appendix III of the Bern Convention. The Indian population of Mustela erminea ferghanae is listed on CITES Appendix III. It occurs in many protected areas across its range. Monitoring of exploitation is required by the Bern Convention (McDonald pers. comm.). The species is protected under national legislation in some range states (e.g. Spain), although this is not necessarily enforced (Palomo and Gisbert, 2002). However, in many parts of its global range the species is not protected and trapping is quite legal (McDonald pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Research is currently being carried out to determine whether the populations of weasels and stoats, our smallest carnivores are in decline (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Ermine, and other Mustela species can take domestic fowl when they can gain access to them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans trap thousands of ermine each season, but the demand for pelts has recently decreased. The white winter fur has long been used in trimming coats and making stoles. Ermine are excellent at catching muridae, which makes them valuable to humans.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Ermine, and other Mustela species can take domestic fowl when they can gain access to them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans trap thousands of ermine each season, but the demand for pelts has recently decreased. The white winter fur has long been used in trimming coats and making stoles. Ermine are excellent mousers, which makes them valuable to humans.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Stoat

"Ermine" redirects here. For other uses, see Ermine (disambiguation).

The stoat (Mustela erminea), also known as the short-tailed weasel, is a species of Mustelidae native to Eurasia and North America, distinguished from the least weasel by its larger size and longer tail with a prominent black tip. The name ermine is often, but not always, used for the animal in its pure white winter coat, or the fur thereof.[2] Since the late 19th century, stoats have been introduced to New Zealand to control rabbits, but have had a devastating effect on native bird populations (see stoats in New Zealand).

It is classed by the IUCN as Least Concern, due to its wide circumpolar distribution, and because it does not face any significant threat to its survival.[1] It was named one of the world's top 100 "worst invasive species" by the IUCN Species Survival Commission's Invasive Species Specialist Group.[3]

The ermine luxury fur is often used by Catholic monarchs, Pontiffs and Cardinals who sometimes use it as the mozetta cape, and devotional images such as the Infant Jesus of Prague.

Etymology[edit]

The root word for "stoat" is likely either the Belgic and Dutch word stout ("bold")[4] or the Gothic word stautan ("to push").[5] According to John Guillim, in his Display of Heraldrie, the word "ermine" is likely derived from Armenia, the nation where it was thought the species originated,[4] though other authors have linked it to the Norman French from the Teutonic harmin (Anglo-Saxon hearma). This seems to come from the Lithuanian word šarmu.[5] In Ireland (where the least weasel does not occur), the stoat is referred to as weasel, while in North America it is called short-tailed weasel. A male stoat is called a dog, hob, or jack, while a female is called a bitch or jill. The collective noun for stoats is either gang or pack.[6]

Evolution[edit]

Skulls of a long-tailed weasel (top), a stoat (bottom left) and least weasel (bottom right), as illustrated in Merriam's Synopsis of the Weasels of North America

The stoat's direct ancestor was Mustela palerminea, a common carnivore in central and eastern Europe during the Middle Pleistocene,[7] and probably reached North America in its current form during the late Blancan or early Irvingtonian.[8] The stoat is the product of a process begun 5–7 million years ago, when northern forests were replaced by open grassland, thus prompting an explosive evolution of small, burrowing rodents. The stoat's ancestors were larger than the current form, and underwent a reduction in size to exploit the new food source. The stoat first arose in Eurasia, shortly after the long-tailed weasel arose as its mirror image in North America 2 million years ago. The stoat thrived during the Ice Age, as its small size and long body allowed it to easily operate beneath snow, as well as hunt in burrows. The stoat and the long-tailed weasel remained separated until half a million years ago, when falling sea levels exposed the Bering land bridge.[9]

Combined phylogenetic analyses indicate the stoat's closest living relative is the mountain weasel (Mustela altaica), though it is also closely related to the least weasel (Mustela nivalis) and long-tailed weasel (Mustela frenata). Its next closest relatives are the New World Colombian weasel (Mustela felipei) and the Amazon weasel (Mustela africana).[10]

Subspecies[edit]

As of 2005,[11] 37 subspecies are recognised.

Physical description[edit]

Build[edit]

Stoat (left) and least weasel (right) pelts - note the stoat's larger size and black tail-tip
Stoat skeleton

The stoat is entirely similar to the least weasel in general proportions, manner of posture, and movement, though the tail is relatively longer, always exceeding a third of the body length,[21] though it is shorter than that of the long-tailed weasel. The stoat has an elongated neck, the head being set exceptionally far in front of the shoulders. The trunk is nearly cylindrical, and does not bulge at the abdomen. The greatest circumference of body is little more than half its length.[22] The skull, although very similar to that of the least weasel, is relatively longer, with a narrower braincase. The projections of the skull and teeth are weakly developed, but stronger than those of the least weasel.[23] The eyes are round, black and protrude slightly. The whiskers are brown or white in colour, and very long. The ears are short, rounded and lie almost flattened against the skull. The claws are not retractable, and are large in proportion to the digits. Each foot has five toes. The male stoat has a curved baculum with a proximal knob which increases in weight as it ages.[24] Fat is deposited primarily along the spine and kidneys, then on gut mesenteries, under the limbs and around the shoulders. The stoat has four pairs of nipples, though they are only visible in females.[24]

A stoat in winter fur

The dimensions of the stoat are variable, but not as variable as the least weasel.[25] Unusual among the Carnivora, the size of stoats tends to decrease proportionally with latitude, in contradiction to Bergmann's rule.[7] Sexual dimorphism in size is pronounced, with males being 1.5-2.0 times the weight of females.[17] On average, males measure 187–325 mm (7.4–12.8 in) in body length, while females measure 170–270 mm (6.7–10.6 in). The tail measures 75–120 mm (3.0–4.7 in) in males and 65–106 mm (2.6–4.2 in) in females. In males, the hind foot measures 40.0–48.2 mm (1.57–1.90 in), while in females it is 37.0–47.6 mm (1.46–1.87 in). The height of the ear measures 18.0–23.2 mm (0.71–0.91 in) in males and 14.0–23.3 mm (0.55–0.92 in). The skulls of males measure 39.3–52.2 mm (1.55–2.06 in) in length, while those of females measure 35.7–45.8 mm (1.41–1.80 in). Males weigh 258 grams (9.1 oz), while females weigh less than 180 grams (6.3 oz).[25]

The stoat has large anal scent glands measuring 8.5 mm × 5 mm (0.33 in × 0.20 in) in males and smaller in females. Scent glands are also present on the cheeks, belly and flanks.[24] Epidermal secretions, which are deposited during body rubbing, are chemically distinct from the anal scent glands, which contain a higher proportion of volatile chemicals. When attacked or being aggressive, the stoat excretes the contents of its anal glands, producing a strong, musky odour produced by several sulphuric compounds, which is distinct from that of least weasels.[26]

Fur[edit]

The winter fur is very dense and silky, but quite closely lying and short, while the summer fur is rougher, shorter and sparse.[21] In summer, the fur is sandy-brown on the back and head and a white below. The division between the dark back and the light belly is usually straight, though this trait is only present in 13.5% of Irish stoats. The stoat moults twice a year. In spring, the moult is slow, starting from the forehead, across the back, toward the belly. In autumn, the moult is quicker, progressing in the reverse direction. The moult, initiated by photoperiod, starts earlier in autumn and later in spring at higher latitudes. In the stoat's northern range, it adopts a completely white coat (save for the black tail-tip) during the winter period.[24] Differences in the winter and summer coats are less apparent in southern forms of the species.[27] In the species' southern range, the coat remains brown, but is denser and sometimes paler than in summer.[24]

Behaviour[edit]

Reproduction and development[edit]

Young stoat

In the Northern hemisphere, mating occurs in the April–July period. In spring, the male's testes are enlarged, a process accompanied by an increase of testosterone concentration in the plasma. Spermatogenesis occurs in December, and the males are fertile from May–August, after which the testes regress. Stoats are not monogamous, with litters often being of mixed paternity. The gestation period lasts circa 280 days. Males play no part in rearing the young, which are born blind, deaf, toothless and covered in fine white or pinkish down. The milk teeth erupt after three weeks, and solid food is eaten after four weeks. The eyes open after five to six weeks, with the black tail-tip appearing a week later. Lactation ends after 12 weeks. Prior to the age of five to seven weeks, kits have poor thermoregulation, so they huddle for warmth when the mother is absent. Males become sexually mature at 10–11 months, while females are sexually mature at the age of 2–3 weeks whilst still blind, deaf and hairless, and are usually mated with adult males before being weaned.[28]

Territorial and sheltering behaviours[edit]

Stoat territoriality has a generally mustelid spacing pattern, with male territories encompassing smaller female territories, which they defend from other males. The size of the territory and the ranging behaviour of its occupants varies seasonally, depending on the abundance of food and mates. During the breeding season, the ranges of females remain unchanged, while males either become roamers, strayers or transients. Dominant older males have territories 50 times larger than those of younger, socially inferior males. Both sexes mark their territories with urine, faeces and two types of scent marks; anal drags are meant to convey territorial occupancy, and body rubbing is associated with agonistic encounters.[26]

The stoat does not dig its own burrows, instead using the burrows and nest chambers of the rodents it kills. The skins and underfur of rodent prey are used to line the nest chamber. The nest chamber is sometimes located in seemingly unsuitable places, such as among logs piled against the walls of houses. The stoat also inhabits old and rotting stumps, under tree roots, in heaps of brushwood, haystacks, in bog hummocks, in the cracks of vacant mud buildings, in rock piles, rock clefts, and even in magpie nests. Males and females typically live apart, but close to each other.[29] Each stoat has several dens dispersed within its range. A single den has several galleries, mainly within 30 cm (12 in) of the surface.[30]

Diet[edit]

Stoat surplus killing a family of chipmunks, as illustrated by Ernest Thompson Seton
Stoat killing a European rabbit

As with the least weasel, mouse-like rodents predominate in the stoat's diet. However, unlike the least weasel which almost exclusively feeds on small voles, the stoat regularly preys on larger rodent and lagomorph species. In Russia, its prey includes rodents such as European water voles, common hamsters, pikas, and others, which it overpowers in their burrows. Prey species of secondary importance include small birds, fish, and shrews and, more rarely, amphibians, lizards, and insects.[31] In Great Britain, European rabbits are an important food source, with the frequency in which stoats prey on them having increased between the 1960s and mid 1990s since the end of the myxomatosis epidemic. Typically, male stoats prey on rabbits more frequently than females do, which depend to a greater extent on smaller rodent species. British stoats rarely kill shrews, rats, squirrels and water voles, though rats may be an important food source locally. In Ireland, shrews and rats are frequently eaten. In mainland Europe, water voles make up a large portion of the stoat's diet. Hares are sometimes taken, but are usually young specimens.[32] In North America, where the ecological niche for rat and rabbit sized prey is taken by the larger long-tailed weasel, the stoat preys on mice, voles, shrews, and young cottontails.[33] In New Zealand, the stoat feeds principally on birds, including the rare kiwi, kaka, mohua, yellow-crowned parakeet, and New Zealand dotterel.[32] Cases are known of stoats preying on young muskrats. The stoat typically eats about 50 grams (1.8 oz) of food a day, which is equivalent to 25% of the animal's live weight.[34]

The stoat is an opportunistic predator, which moves rapidly and checks every available burrow or crevice for food. Because of their larger size, male stoats are less successful than females in pursuing rodents far into tunnels. Stoats regularly climb trees to gain access to birds' nests, and are common raiders of nest boxes, particularly those of large species. The stoat reputedly immobilises prey such as rabbits by mesmerising them with a "dance" (sometimes called the Weasel war dance), though this behaviour could be linked to Skrjabingylus infections.[32] When tackling large prey, the stoat bites the nape of the neck while grasping it with its forefeet, intertwines its body around the animal then scratches its lower body with its back feet. Contrary to popular belief, blood which flows from resulting wounds is not sucked, but lapped up. The stoat may surplus kill when the opportunity arises, though excess prey is usually cached and eaten later to avoid obesity, as overweight stoats tend to be at a disadvantage when pursuing prey into their burrows.[33] Small prey typically die instantly from a bite to the back of the neck, while larger prey, such as rabbits, typically die of shock, as the stoat's canine teeth are too short to reach the spinal column or major arteries.[32]

Communication[edit]

The stoat is a usually silent animal, but can produce a range of sounds similar to those of the least weasel. Kits produce a fine chirping noise. Adults trill excitedly before mating, and indicate submission through quiet trilling, whining and squealing. When nervous, the stoat hisses, and will intersperse this with sharp barks or shrieks and prolonged screeching when aggressive.[26]

Aggressive behaviour in stoats is categorised in these forms:[26]

  • Noncontact approach, which is sometimes accompanied by a threat display and vocalisation from the approached animal
  • Forward thrust, accompanied by a sharp shriek, which is usually done by stoats defending a nest or retreat site
  • Nest occupation, when a stoat appropriates the nesting site of a weaker individual
  • Kleptoparasitism, in which a dominant stoat appropriates the kill of a weaker one, usually after a fight

Submissive stoats express their status by avoiding higher-ranking animals, fleeing from them or making whining or squealing sounds.[26]

Range and population[edit]

The stoat has a circumboreal range throughout North America, Europe, and Asia, from Greenland and the Canadian and Siberian Arctic islands south to about 35°N. Stoats in North America are found throughout Alaska and Canada south through most of the northern United States to central California, northern Arizona, northern New Mexico, Iowa, the Great Lakes region, New England, and Pennsylvania, but is absent from most of the Great Plains, and the Southeastern United States. The stoat in Europe is found as far south as 41ºN in Portugal, and inhabits most islands with the exception of Iceland, Svalbard, the Mediterranean islands and some small North Atlantic islands. In Japan, it is present in central mountains (northern and central Japan Alps) to northern part of Honshu (primarily above 1,200 m) and Hokkaido. Its vertical range is from sea level to 3,000 m.[1]

Subspecies[edit]

Irish stoats (Mustela erminea hibernica (Thomas & Barrett-Hamilton)) has been recorded in Ireland.[35]

Introduction to New Zealand[edit]

Main article: Stoats in New Zealand

Stoats were introduced into New Zealand during the late 19th century to control rabbits and hares, but are now a major threat to native bird populations. The introduction of stoats was opposed by scientists in New Zealand and Britain, including the New Zealand ornithologist Walter Buller. The warnings were ignored and stoats began to be introduced from Britain in the 1880s, thus resulting in a noticeable decline in bird populations within six years.[36] Stoats are a serious threat to ground- and hole-nesting birds, since they have very little means of escaping predation. The highest rates of stoat predation occur after seasonal gluts in southern beechmast seeds, which encourage the reproduction of rodents on which stoats also feed, thus encouraging stoats to increase their own numbers.[37] For instance, the endangered takahe's wild population dropped by a third between 2006 and 2007, after a stoat plague triggered by the 2005–06 mast wiped out more than half the takahe in untrapped areas.[38]

Diseases and parasites[edit]

Tuberculosis has been recorded in stoats inhabiting the former Soviet Union and New Zealand. They are largely resistant to tularemia, but are reputed to suffer from canine distemper in captivity. Symptoms of mange have also been recorded.[39]

Stoats are vulnerable to ectoparasites associated with their prey and the nests of other animals on which they do not prey. The louse Trichodectes erminea is recorded in stoats living in Canada, Ireland and New Zealand. In continental Europe, 26 flea species are recorded to infest stoats, including Rhadinospylla pentacantha, Megabothris rectangulatus, Orchopeas howardi, Spilopsyllus ciniculus, Ctenophthalamus nobilis, Dasypsyllus gallinulae, Nosopsyllus fasciatus, Leptospylla segnis, Ceratophyllus gallinae, Parapsyllus n. nestoris, Amphipsylla kuznetzovi and Ctenopsyllus bidentatus. Tick species known to infest stoats are Ixodes canisuga, I. hexagonus, and I. ricinus and Haemaphysalis longicornis. Louse species known to infest stoats include Mysidea picae and Polyplax spinulosa. Mite species known to infest stoats include Neotrombicula autumnalis, Demodex erminae, Eulaelaps stabulans, Gymnolaelaps annectans, Hypoaspis nidicorva, and Listrophorus mustelae.[39]

The nematode Skrjabingylus nasicola is particularly serious to stoats, as it erodes the bones of the nasal sinuses and decreases fertility. One symptom includes fits, which may explain the "dancing" behaviour usually associated with hunting. Other nematode species known to infect stoats include Capillaria putorii, Molineus patens and Strongyloides martes. Cestode species known to infect stoats include Taenia tenuicollis, Mesocestoides lineatus and rarely Acanthocephala.[39]

Relationships with humans[edit]

Elizabeth I of England, "the Virgin Queen", painted with an ermine on her arm. In this painting the ermine has black spots over its entire body resembling heraldic ermine.

Folklore and mythology[edit]

In Irish mythology, stoats were viewed anthropomorphically as animals with families, which held rituals for their dead. They were also viewed as noxious animals prone to thieving, and their saliva was said to be able to poison a grown man. To encounter a stoat when setting out for a journey was considered bad luck, but one could avert this by greeting the stoat as a neighbour.[40] Stoats were also supposed to hold the souls of infants who died before baptism.[41] In the folklore of the Komi people of the Urals, stoats are symbolic of beautiful and coveted young women.[42] In the Zoroastrian religion, the stoat is considered a sacred animal, as its white winter coat represented purity. Similarly, Mary Magdalene was depicted as wearing a white stoat pelt as a sign of her reformed character. One popular European legend had it that a white stoat would die before allowing its pure white coat to be besmirched. When it was being chased by hunters, it would supposedly turn around and give itself up to the hunters rather than risk soiling itself.[43]

Fur use[edit]

Stoat skins are prized by the fur trade, especially in winter coat, and used to trim coats and stoles. The fur from the winter coat is referred to as ermine. There is also a design, also called ermine, which is inspired by the winter coat of the stoat but which is painted onto other furs, such as rabbit.[44] In Europe these furs are a symbol of royalty and high status; the ceremonial robes of members of the UK House of Lords and the academic hoods of the universities of Oxford and Cambridge are traditionally trimmed with ermine[44] although in practice rabbit or fake fur is now often used instead due to expense or animal rights concerns. Prelates of the Catholic Church still wear ecclesiastical garments featuring ermine (a sign of their status equal to that of the nobility). Cecilia Gallerani is depicted holding an ermine in her portrait, Lady with an Ermine. Henry Peacham's Emblem 75, which depicts an ermine being pursued by a hunter and two hounds, is entitled "Cui candor morte redemptus" ("Purity bought with his own death"). Peacham goes on to preach that men and women should follow the example of the ermine and keep their minds and consciences as pure as the legendary ermine keeps its fur.[45]

Ermine were also valued by the Tlingit and other indigenous peoples of the Pacific Northwest Coast. They could be attached to traditional regalia and cedar bark hats as status symbols, or they were also made into shirts.[46]

The stoat was a fundamental item in the fur trade of the Soviet Union, with no less than half the global catch coming from within its borders. The Soviet Union also contained the highest grades of stoat pelts, with the best grade North American pelts being comparable only to the 9th grade in the quality criteria of former Soviet stoat standards. However, stoat harvesting never became a specialty in any Soviet republic, with most stoats being captured incidentally in traps or near villages. Stoats in the Soviet Union were captured either with dogs or with box-traps or jaw-traps. Guns were rarely used, as they could damage the pelt.[47]

References[edit]

  1. ^ a b c Reid, F. & Helgen, K. (2008). Mustela erminea. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ Shorter Oxford English dictionary. United Kingdom: Oxford University Press. 2007. p. 3804. ISBN 0199206872. 
  3. ^ "100 of the World's Worst Invasive Species". Invasive Species Specialist Group. 
  4. ^ a b Coues 1877, pp. 124–125
  5. ^ a b Johnston 1903, p. 160
  6. ^ Harris & Yalden 2008, p. 456
  7. ^ a b Kurtén 1968, pp. 101–102
  8. ^ Kurtén 1980, p. 150
  9. ^ Macdonald 1992, p. 205
  10. ^ Harris & Yalden 2008, p. 458
  11. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  12. ^ a b c Heptner & Sludskii 2002, p. 1010
  13. ^ Merriam 1896, pp. 12–13
  14. ^ Merriam 1896, p. 15
  15. ^ a b Merriam 1896, pp. 11–12
  16. ^ Heptner & Sludskii 2002, p. 1014
  17. ^ a b c Harris & Yalden 2008, p. 459
  18. ^ a b Heptner & Sludskii 2002, p. 1012
  19. ^ Heptner & Sludskii 2002, p. 1013
  20. ^ Heptner & Sludskii 2002, p. 1011
  21. ^ a b Heptner & Sludskii 2002, p. 997
  22. ^ Coues 1877, pp. 117–121
  23. ^ Heptner & Sludskii 2002, p. 999
  24. ^ a b c d e Harris & Yalden 2008, p. 457
  25. ^ a b Heptner & Sludskii 2002, p. 1002
  26. ^ a b c d e Harris & Yalden 2008, pp. 460–461
  27. ^ Heptner & Sludskii 2002, p. 998
  28. ^ Harris & Yalden 2008, pp. 464–465
  29. ^ Heptner & Sludskii 2002, pp. 1021–1022
  30. ^ Harris & Yalden 2008, p. 461
  31. ^ Heptner & Sludskii 2002, p. 1018
  32. ^ a b c d Harris & Yalden 2008, p. 463
  33. ^ a b Verts & Carraway 1998, p. 417
  34. ^ Heptner & Sludskii 2002, p. 1020
  35. ^ Buckley, K., Stuart, P., Lawton, C and Sleeman, D.P. 2014. Skrjabingylus nasicicola (Leuckart, 1842) as a parasite of Irish stoats (Mustela ermine hibernica (Thomas and Barrett-Hamilton, 1895)) Ir Nat. J. 33: 14 - 18.
  36. ^ King, Carolyn (1984). Immigrant Killers. Auckland, NZ: Oxford University Press. ISBN 0-19-558121-0. 
  37. ^ Purdey, D. C.; C. M. King, B Lawrence (2004). "Age structure, dispersion and diet of a population of stoats (Mustela erminea) in southern Fiordland during the decline phase of the beechmast cycle". New Zealand Journal of Zoology (The Royal Society of New Zealand) 31 (3): 205–225. doi:10.1080/03014223.2004.9518373. Retrieved 2009-11-30. 
  38. ^ "Stoats decimating takahe in Fiordland". stuff.co.nz. 4 March 2008. Retrieved 23 April 2011. 
  39. ^ a b c Harris & Yalden 2008, p. 466
  40. ^ Monaghan, Patricia (2004) The encyclopedia of Celtic mythology and folklore: Facts on File library of religion and mythology, page 426, Infobase Publishing, ISBN 0-8160-4524-0
  41. ^ Daniels, Cora Linn & Stevans, C. M. Encyclopedia of Superstitions, Folklore, and the Occult Sciences of the World, Volume 2 (2003), The Minerva Group, Inc., ISBN 1-4102-0915-6
  42. ^ Laakso, Johanna (2005) Our otherness: Finno-Ugrian approaches to women's studies, or vice versa, Volume 2 of Finno-Ugrian studies in Austria, LIT Verlag Münster, ISBN 3-8258-8626-3
  43. ^ Sax, Boria (2001) The mythical zoo: an encyclopedia of animals in world myth, legend, and literature, ABC-CLIO, ISBN 1-57607-612-1
  44. ^ a b "A house of traditions". BBC News. January 19, 1999. 
  45. ^ The Minerva Britanna Project
  46. ^ Tlingit Ermine-Skin Shirt (Daa dugu k'oodas')
  47. ^ Heptner & Sludskii 2002, pp. 1029–1030

Bibliography[edit]

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Twenty subspecies are recognized in the New World, fewer in the Old World (King 1983). Of the seven subspecies that occur in Alaska, six are endemic to the state; Mustela erminea arctica occurs throughout mainland Alaska and northern Canada, M. e. kadiacensis only on the Kodiak archipelago, M. e. salva on Admiralty Island, M. e. initis on Chichagof and Baranof Islands, M. e. alascensis on the Southeast Alaska mainland and nearshore islands, and M. e. celenda and M. e. seclusa on several islands at the south end of the Alexander Archipelago (Hall 1981). Taxonomic status for many subspecies remains unclear and review based on more specimens is needed (e.g., recognition of M. e. seclusa as a subspecies was based on a single specimen; MacDonald and Cook 1996).

Recent studies of skull characteristics and ermine genetics suggest the existence of 3 clades (possibly 3 species) in North America, members of all of which are found in Southeast Alaska: a Beringian lineage including M. e. salva and M. e. kadiacensis distributed in Alaska, eastern Russia, Japan, and Ireland; a continental lineage including M. e. initis and M. e. alascensis occurring from Alaska and western Canada across the U.S. to Wisconsin, California and New Mexico; and an island lineage including M. e. celenda and M. e. seclusa distributed on Prince of Wales and adjacent islands in the Alexander Archipelago and Haida Gwaii (Queen Charlotte Islands), British Columbia (Eger 1990, Cook et al. 2001, Fleming and Cook 2002). Subspecies M. e. haidarum may be distinct enough to be reclassified as a separate species Mustela haidarum (previous name until 1951, Preble 1898), and under the rules of priority, would subsume both celenda and seclusa (MacDonald and Cook 2005).

See Eger (1990) for patterns of geographic skull variation in Nearctic populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!