Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Biology

Weasels are active at any time of day or night, and intersperse periods of activity with a rest period (3). They feed mainly on small rodents, rabbits, birds and eggs (3), killing prey with a bite to the neck (1). Their small size enables them to enter the tunnels of mice and voles whilst hunting (2), and they often take over the nests of their prey, lining their dens with fur from prey during cold weather (2). A number of dens will be used within the home range. Males and females occupy separate territories, and defend these against members of the opposite sex (2). During spring, males move around in search of a mate (2). The male and female often fight prior to copulation, and the male grabs the female by the neck before he mates (1). A single litter of between 4 and 6 (2) naked, blind and deaf (1) kits is produced each year; the kits are weaned after 3 to 4 weeks and begin to hunt well by 8 weeks of age (2), often accompanying their mother to hunt in 'gangs' (2). By 9 to 12 weeks after birth the family group starts to split up (1). Historically, weasels were believed to have magical powers, and were said to be able to bring their dead young back to life. It was also thought that they hypnotised their prey by dancing (4); in fact 'dancing' behaviour is thought to be a response to discomfort caused by internal parasites (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The smallest carnivores usually burn energy the fastest and have the most active lifestyles, so it is no surprise that the Least Weasel, the miniature among mustelids, consumes roughly half its body weight each day—equal to about two deer mice and a vole. As with other weasels, adult females may be half the size of adult males, and they mature much more rapidly; females are sexually mature at four months, males at eight months. Females produce two litters each year, unlike the larger, slower-breeding Ermine and Long-tailed Weasel. In the north, the fur of the Least Weasel turns from brown to white in winter, camouflaging them in the snow.

Adaptation: Large, shearing carnassial teeth at the back dominate the jaw structure of the Least Weasel, Mustela nivalis, as they do in all members of the weasel family.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1766.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Twelfth Edition, p. 69.  Laurentii Salvii, Uppsala, 1:1-532.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

A very small, slender carnivore. Males consistently larger than females. Long-bodied and short-legged. Head relatively small, snout broad, and ears small. Upper parts, legs, feet, and tail chest­nut to dark brown. Under­parts, including chin and throat, white to cream, which may or may not be clearly demarcated from the upper parts. Sometimes show brown spots or blotches on the underside. Tail around one-quarter of total length, slender, not bushy, brown above and below, slightly darker at tip. In life, the over­all impression is of a slender, elongated, brown mammal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Britain's smallest native carnivore (2), the weasel has a long slender body, and a short tail. The fur is ginger to a rich chocolate-russet brown in colour, and the underparts are creamy-white (2). The narrow head is supported on a long neck, and the legs are short (1). The large eyes are black, and the ears are rounded (1). In northern parts of the range, weasels turn white in winter, but they do not do so in the UK (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species has a circumboreal, Holartcic distribution, taking in much of Europe and North Africa, Asia and northern North America. It has been introduced in New Zealand, Malta, Crete, the Azore Islands, and apparently also Sao Tome off west Africa (Sheffield and King 1994). It is found throughout Europe and on many islands, including the Azores, Britain (but not Ireland), and all major Mediterranean islands. The populations on the Azores and Mediterranean islands (Malta and Crete) are widely considered introduced (Dobson, 1998; McDonald pers. comm.). It is also found on Honshu, Hokkaido, Kunashiri, Etorofu, and Sakhalin Islands in Japan (Abe et al., 2005) and northern Mongolia (Bannikov, 1954; Dulamtseren, 1970).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Least weasels are found throughout the Palearctic region (excluding Ireland, the Arabian Pennisula, and the Arctic Isles), in Japan, and in the Nearctic, from Alaska and northern Canada south to Wyoming and North Carolina (Honacki, 1982). A population of least weasels was introduced to New Zealand as well (Sheffield, 1994).

Biogeographic Regions: nearctic (Native ); palearctic (Native ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Restricted to the Nile Delta from Port Said to Alexandria south to Cairo, where it is very common. Also the Fayoum where reported­ly common.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Europe, North America, northern Asia south to Asia Minor. In Africa, Morocco, Algeria, and Egypt.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Circumboreal, Holarctic distribution. Western Hemisphere: most of Canada and Alaska south to British Columbia, Montana, Wyoming, Oklahoma, Missouri, Ohio, Virginia, and along the Appalachians to the Great Smoky Mountains (North Carolina, Tennessee). Range has expanded southward in the Great Plains since the mid-1960s as the climate has become cooler and more mesic (Frey 1992). Thought to be rare (though sometimes locally fairly common) throughout the range in the southeastern U.S., but actual status is uncertain (Handley 1991). Introduced in New Zealand, Malta, Crete, the Azore Islands, and apparently also Sao Tome off west Africa (Sheffield and King 1994). Ranges to 3660 m in mountains of Eurasia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Widespread throughout mainland Britain, and on large islands around the UK, but absent from Ireland (3). They also occur throughout much of Europe, reaching into Asia as far east as Japan, as well as in North America (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The body of least weasels is long and slender, with a long neck; a flat, narrow head; and short limbs. This animal has large black eyes and large, round ears. The feet have five fingers with sharp claws. Mass is dependent upon location, North American populations are the smallest and those found in northern Africa have the largest mass. Fur color is chocolate brown on the back and white with brown spots on the underparts. The summer coat is about 1 cm in length. The winter coat, which is about 1.5 cm in length, turns to all white in northern populations and remains brown in the southern populations (Sheffield, 1994).

Range mass: 30.0 to 55.0 g.

Range length: 165.0 to 205.0 mm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length (male) 36.1-43cm, (female) 32.6-36.9cm; Tail (male) 10.9-12.9cm, (female) 9.4-1 lcm; Weight (male) 60-130g, (female) 45-60g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 21 cm

Weight: 50 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 180-205 mm males; 165-180 mm females

Weight:
Range: 40-55 g males; 30-50 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Weasels tolerate a wide range of habitats, including forests, farmlands and cultivated fields, grassy fields and meadows, riparian woodlands, hedgerows, alpine meadows and forests, scrub, steppe and semi-deserts, prairies, and coastal dunes (Sheffield and King, 1994; Pulliainen, 1999). This species occurs from sea level to at least 3,860 m. It forms dens in crevices among tree roots, in hollow logs, or in abandoned burrows of other species. This species is a specialist diurnal predator of small mammals (especially rodents), although it will also occasionally feed on birds’ eggs, lizards, frogs, salamanders, fish, worms, and carrion (Sheffield and King, 1994). Food may be stored for the winter (Danzig, 1992). Habitat selection is usually determined by local distribution of rodents. Foraging individuals avoid open spaces, where they are most vulnerable to predation by raptors (Sheffield and King, 1994). They prefer dense, rank grassland where microtines (voles and lemmings) are abundant (McDonald pers. comm.).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Least weasels can survive in a wide variety of habitats, including open forests , farmlands, meadows, prairies, steppe, and semi-deserts. Least weasels avoid deep forests, sandy deserts, and open spaces. They are well adapted for the tundra (Sheffield, 1994).

Habitat Regions: temperate

Terrestrial Biomes: tundra ; taiga ; forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Weasels tolerate a wide range of habitats, including forests, farmlands and cultivated fields, grassy fields and meadows, riparian woodlands, hedgerows, alpine meadows and forests, scrub, steppe and semi-deserts, prairies, and coastal dunes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitat varies geographically and includes open forests, farmlands and cultivated areas, grassy fields and meadows, riparian woodlands, hedgerows, alpine meadows, scrub, steppe and semi-deserts, prairies, coastal dunes, and sometimes rural residential areas; snow cover is not an obstacle; generally avoids deep dense forest and sandy desert. When inactive, occupies burrow made by vole or mole, or rests in nest in hole in wall of building or under corn shock or similar site. Den site may change often. Young are born in abandoned underground burrows made by other mammals (or similar secluded sites).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in a range of habitats where there is good cover and plentiful prey, including woodland, grassland, sand dunes, mountains (3), urban areas, marshes and moors (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of least weasels is composed of small mammals, mainly rodents. When rodents are scarce, weasels will eat birds' eggs and nestlings. Their diet also ranges from insects to lizards. In the extreme northern populations they will eat the carcasses of brown lemmings. Males are better hunters and are more likely to hunt larger prey, while females will continue looking for small rodents (Sheffield, 1994).

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Specialist predator of small mammals, especially voles, lemmings, and other mice. When small rodents are scarce, may consume other small vertebrates, insects, or worms. Young are adept at killing mice at 7 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Least weasels are important predators of small mammals in the ecosystems in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Least weasels are aggressive and fierce and will attack animals much larger than themselves. Young in nests are preyed on by snakes, while adults may be preyed on by large birds of prey, such as owls and hawks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Mustela nivalis is prey of:
Buteo lagopus
Squamata
Strigiformes
Accipitridae

Based on studies in:
Russia (Tundra)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Mustela nivalis preys on:
Microtus
Microtus xanthognathus
Clethrionomys glareolus

Based on studies in:
Russia (Tundra)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range size varies with conditions; up to 26 ha in males, up to 7 ha in females; in England, average home range was 7-15 ha for males, 1-4 ha for females (King 1975). Basically solitary, except during breeding season and when females have young. High dispersal rate, good ability to colonize vacant habitat when rodent populations increase.

Density fluctuates with rodent populations; 0.2-1.0/ha in favorable conditions, average as low as 1-7/100 ha over wider areas (Erlinger 1974, Golley 1960, Sheffield and King 1994).

Mortality rate is high (overall annual rate is 75-90%); average age at death is less than one year. Predators include various Carnovora, raptors, and possibly snakes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Least weasels possess keen senses of smell, hearing, touch, and sight. As with most mammals they rely heavily on their sense of smell, communicating among themselves and locating prey by detecting scents.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Largely nocturnal but can be seen during the day. Most fre­quently encountered at night dashing across streets and disappearing beneath a parked car. Can be distinguished from rodents in these instances by the elongated body form, bounding gait, and relatively short tail. Nests in any cavity, pile of rocks, wall crevice, etc. Carnivorous, feeding on rats, mice, other small mammals, birds (up to the size of a pigeon), fish, and insects (including ants and cockroach­es). Also scavenges waste from restaurants. Sight and hearing very good, but hunts mainly by scent. Solitary and territorial though male territory may contain female territory. Territory marked by urine and scat and smells strongly. Defends itself vigorously when cornered. Predators include dogs, cats, and larger birds of prey, even crows. Female gives birth to up to a dozen (normally 4-9) kits in lined den. Can have 3 litters in a year. Vocal with a variety of snorts, spits, yelps, and whines. Den with kits can be located by their piping.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day or night throughout the year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Least weasels probably only live for several years after reaching adulthood and most die before reaching adulthood.

Range lifespan

Status: captivity:
9.1 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.1 years (captivity) Observations: One wild born specimen was still alive at 9.1 years of age (Richard Weigl 2005). Anecdotal reports of animals living more than 10 years are plausible but remain unverified.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating System: polygynous

In North America, central Europe, and the former USSR, breeding can occur throughout the year, but the most breeding occurs in the spring and late summer. Gestation in least weasels lasts from 34 - 37 days. Litters may range from 1 - 7. A higher number of offspring per litter can be found in northern populations. Newborns weigh from 1.1 g to 1.7 g and are wrinkled, pink, naked, blind, and deaf. After 49 - 56 days, they have reached their adult length. By week 6 males are larger than females. In 9 - 12 weeks the family groups begin to break up, and in 12 - 15 weeks least weasels reach their adult mass. Females that are born in the spring are sexually mature in three months and may breed in their first summer. Summer and autumn born females are not as well developed and cannot breed until the next summer (Sheffield, 1994).

Breeding interval: Least weasels can breed once or twice each year.

Breeding season: Least weasels breed in spring and late summer.

Range number of offspring: 1.0 to 7.0.

Range gestation period: 37.0 (high) days.

Range weaning age: 18.0 (low) days.

Range age at sexual or reproductive maturity (female): 4.0 to 8.0 months.

Range age at sexual or reproductive maturity (male): 4.0 to 8.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 2.6 g.

Average number of offspring: 5.

Newborns weigh from 1.1 g to 1.7 g and are naked, blind, and deaf. They are nursed and cared for in the burrow by their mother. After 49 to 56 days, they have reached their adult length. By week 6, males are larger than females. In 9 to 12 weeks the family groups begin to break up, and in 12 to 15 weeks the weasels reach their adult weight.

Females care for and nurse their young until they become independent.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

May breed throughout the year but mainly in spring and late summer. When rodents are plentiful, may breed in winter under snow. Gestation lasts 34-37 days, including the 10-12 days between fertilization and implantation. Litter size averages 4-5 in temperate zone, higher in arctic latitudes. Commonly two litters/year. Young are tended by both parents, weaned by 6-7 weeks. Family groups break up when young are about 9-12 weeks old. Spring-born females are sexually mature in 3-4 months (may produce a litter in their first summer), males in 8 months. Reproductive output increases when food is abundant (more young are born, greater survivorship).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustela nivalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA840-07|DQ533939|Mustela nivalis| AATCGATGATTATTTTCCACTAATCACAAAGACATCGGCACCCTTTACCTCTTATTTGGTGCATGAGCCGGAATAGTAGGTACTGCCCTC---AGTCTACTAATCCGCGCTGAACTTGGCCAACCTGGCGCTCTATTAGGAGAC---GACCAGGTTTATAACGTGATCGTGACTGCTCACGCATTTGTAATAATTTTCTTCATAGTGATACCTATCATGCTTGGGGGCTTTGGGAACTGACTTATTCCCTTAATA---ATTGGCGCACCTGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTTCCACCCTCTTTTCTTCTCCTACTGGCCTCCTCTATGGTAGAAGCGGGTGCAGGAACTGGGTGAACTGTATACCCCCCTCTAGCAGGGAACCTGGCACATGCTGGAGCATCCGTAGACCTA---GCAATCTTTTCTCTTCACTTAGCTGGTGTTTCATCTATTTTAGGGTCAATTAACTTCATCACTACTATTATCAACATAAAACCACCTGCTATATCACAGTACCAAACCCCATTATTCGTATGATCAGTATTAATTACAGCTGTACTTCTTCTCCTATCTCTGCCAGTTTTAGCAGCC---GGCATCACCATATTACTTACAGATCGAAATCTAAACACTACTTTCTTCGACCCGGCCGGAGGAGGAGACCCTATCTTGTACCAGCACCTATTTTGATTTTTTGGGCACCCGGAAGTATATATCCTAATTCTTCCAGGGTTTGGTATCATTTCACACGTTGTAACATATTACTCAGGAAAAAAA---GAACCATTCGGTTACATGGGAATAGTATGAGCAATAATATCAATTGGTTTCCTAGGATTTATCGTATGAGCCCACCATATATTTACCGTAGGCTTAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mustela nivalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Tikhonov, A., Cavallini, P., Maran, T., Kranz, A., Herrero, J., Giannatos, G., Stubbe, M., Conroy, J., Kryštufek, B., Abramov, A., Wozencraft, C., Reid, F. & McDonald, R.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Least weasels are generally widespread and abundant. Localized populations may be threatened by habitat destruction, but these animals are generally not threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as a species of conservation concern by the UK Biodiversity Action Plan, although not a priority species. Listed under Appendix III of the Bern Convention (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the European part of its range, there are documented population declines in some areas (e.g. Britain: Battersby, 2005), and suspected declines in others. Although it has a wide distribution, it is considered rare in North America (Sheffield and King, 1994). In Eurasia, it is relatively common, but not often seen (Sheffield and King, 1994). Local densities of 0.2 to 1.0 individuals per hectare can occur in favored habitats when prey are abundant (Sheffield and King, 1994). However, over wider areas, the average density may be as low as 1 to 7 per 100 hectares (Goszczynski, 1977). Populations fluctuate both seasonally and annually, sometimes involving large increases of up to 10-fold, concurrently or within 9 months of a population peak of small rodents, and lasting 6 to 18 months (Sheffield and King, 1994). Thought to be rare (though sometimes locally fairly common) throughout the range in the southeastern U.S., but actual status is uncertain (Handley 1991).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Threats include incidental poisoning with rodenticides (Sheffield and King, 1994) and persecution. The weasel prefers open agricultural habitats, which are declining owing to changes in agricultural practices (rural abandonment) in parts of Europe, as open fields undergo succession.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Populations of weasels are controlled because they take gamebird eggs and chicks (3). Likely threats include habitat loss and simplification, as well as predation by foxes. Agricultural changes have led in many areas to the loss or reduction of rough grasslands, which is prime habitat for the field vole, a key source of food for weasels (3). Evidence is building that rodenticides are having an effect on weasels and stoats, as they eat poisoned rodents (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is found in many protected areas. It is listed on Appendix III of the Bern Convention (Pulliainen, 1999), and is protected under national and sub-national legislation in a number of range states (e.g. Sichuan, China: Yi-Ming et al., 2000). Monitoring is required to quantify the population trend in Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Research is currently being carried out to determine whether the populations of weasels and stoats, our smallest carnivores are in decline (4). Weasels are not legally protected in the UK (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Least weasels have been hunted and trapped by humans throughout the world (Sheffield, 1994). The help keep in check the populations of many species of rodents that are potentially harmful to agriculture.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Least weasel

The least weasel (Mustela nivalis) is the smallest member of the Mustelidae (as well as the smallest of the Carnivora), native to Eurasia, North America and North Africa, though it has been introduced elsewhere. It is classed as Least Concern by the IUCN, due to its wide distribution and presumably large population.[1] Despite its small size, the least weasel is a fierce hunter, capable of killing a rabbit 5-10 times its own weight.[2]

Contents

Evolution

Within the genus Mustela, the least weasel is a relatively unspecialised form, as evidenced by its pedomorphic skull, which occurs even in large subspecies.[3] Its direct ancestor was Mustela praenivalis, which lived in Europe during the Middle Pleistocene and Villafranchian. M. praenivalis itself was probably preceded by M. pliocaenica of the Pliocene. The modern species probably arose during the Late Pleistocene.[4] The least weasel is the product of a process begun 5-7 million years ago, when northern forests were replaced by open grassland, thus prompting an explosive evolution of small, burrowing rodents. The weasel's ancestors were larger than the current form, and underwent a reduction in size to exploit the new food source. The least weasel thrived during the Ice Age, as its small size and long body allowed it to easily operate beneath snow, as well as hunt in burrows. It probably crossed to North America through the Bering land bridge 200,000 years ago.[5]

Subspecies

The least weasel has a high geographic variation, a fact which has historically led to numerous disagreements among biologists studying its systematics. Least weasel subspecies are divided into 3 categories:[6]

  • The pygmaea-rixosa group (small weasels): Tiny weasels with short tails and pedomorphic skulls, which turn pure white in winter. They inhabit northern European Russia, Siberia, the Russian Far East, Finland, northern Scandinavian Peninsula, Mongolia, northeastern China, Japan and North America.
  • The boccamela group (large weasels): Very large weasels with large skulls, relatively long tails and lighter coloured pelts. Locally, they either do not turn white or only partially in winter. They inhabit Transcaucasia, from western Kazakhstan to Semirechye and in the flat deserts of Middle Asia.
  • The nivalis group (average weasels): Medium-sized weasels, with tails of moderate length, representing a transitional form between the former two groups. They inhabit the middle and southern regions of European Russia, Crimea, Ciscaucasus, western Kazakhstan, southern and middle Urals and montane parts of Middle Asia, save for Koppet Dag.

As of 2005,[7] 18 subspecies are recognised.

Physical description

Skeleton, as illustrated in Lydekker's The New Natural History
Skulls of a long-tailed weasel (top), a stoat (bottom left) and least weasel (bottom right), as illustrated in Merriam's Synopsis of the Weasels of North America

The least weasel has a thin, greatly elongated and extremely flexible body with a small, yet elongated, blunt-muzzled head which is no thicker than the neck. The eyes are large, bulging and dark coloured. The legs and tail are relatively short, the latter constituting less than half its body length. The feet are armed with sharp, dark claws, and the soles are heavily haired.[15] The skull, especially that of the small rixosa group, has an infantile appearance when compared with that of other members of the genus Mustela (in particular, the stoat and kolonok). This is expressed in the relatively large size of the cranium and shortened facial region.[16] The skull is, overall, similar to that of the stoat, but smaller, though the skulls of large male weasels tend to overlap in size with those of small female stoats.[17] It usually has 4 pairs of nipples, but these are only visible in females. The baculum is short (16–20 mm), with a thick, straight shaft. Fat is deposited along the spine, kidneys, gut mesentries and around the limbs. The least weasel has muscular anal glands under the tail, which measure 7 x 5 mm, and contain sulphurous volatiles, including thietanes and dithiacyclopentanes. The smell and chemical composition of these chemicals are distinct from those of the stoat.[17] The least weasel moves by jumping, the distance between the tracks of the fore and hind limbs being 18–35 cm.[18]

Dimensions vary geographically, to an extent rarely found among other mammals. Least weasels of the vulgaris group, for example, may outweigh the smaller races by almost four times. In some large subspecies, the male may be 1.5 times longer than the female. Variations in tail length are also variable, constituting from 13-30% of the length of the body. Average body length in males is 130–260 mm, while females average 114–204 mm. The tail measures 12–87 mm in males and 17–60 mm in females. Males weigh 36-250 grams, while females weigh 29.5-117 grams.[19]

The winter fur is dense, but short and closely fitting. In northern subspecies, the fur is soft and silky, but coarse in southern forms. The summer fur is very short, sparser and rougher. The upper parts in the summer fur are dark, but vary geographically from dark-tawny or dark-chocolate to light pale tawny or sandy. The lower parts, including the lower jaw and inner sides of the legs, are white. The dividing line between the dark upper and light lower parts is straight, but sometimes forms an irregular line. In winter, the fur is pure white, and only exhibits black hairs in rare circumstances.[16]

Behaviour

Reproduction and development

The least weasel mates in April–July, with a 34-37 day gestation period. In the northern hemisphere, the average litter size consists of 6 kits, which reach sexual maturity in 3–4 months. Males may mate during their first year of life, though this is usually unsuccessful. They are fecund in February–October, though the early stages of spermatogenesis do occur throughout the winter months. Anestrus in females lasts from September-February.[20]

The female raises its kits alone, which are 1.5-4.5 grams in weight when born. Newborn kits are born pink, naked, blind and deaf, but gain a white coat of downy fur at the age of 4 days. At 10 days, the margin between the dark upper parts and light under parts becomes visible. The milk teeth erupt at 2–3 weeks of age, at which point they are weaned, though lactation can last 12 weeks. The eyes and ears open at 3–4 weeks of age, and by 8 weeks, killing behaviour is developed. The family breaks up after 9–12 weeks.[20]

Least weasel killing an adult brown rat, as illustrated in Brehm's Animals of the world. Such incidences however are rare, as the brown rat's aggressive nature allows it to effectively deter weasels from attacking it.[21]

Territorial and social behaviours

The least weasel has a typical Mustelid territorial pattern, consisting of exclusive male ranges encompassing multiple female ranges. The population density of each territory depends greatly on food supply and reproductive success, thus the social structure and population density of any given territory is unstable and flexible. Like the stoat, the male least weasel extends its range during spring or during food shortages. Its scent marking behaviour is similar to the stoat's; it uses faeces, urine and anal and dermal gland secretions, the latter two of which are deposited by anal dragging and body rubbing. The least weasel does not dig its own dens, but nest in the abandoned burrows of other species such as moles and rats.[22] The burrow entrance measures about 2.5 cm across and leads to the nest chamber located up to 15 cm below-ground. The nest chamber (which is used for sleeping, rearing kits and storing food) measures 10 cm in diametre, and is lined with straw and the skins of the weasel's prey.[23]

Least weasel attacking a European hare, as exhibited in the Natural History Museum of Genoa

The least weasel has four basic vocalisations; a guttural hiss emitted when alarmed, which is interspersed with short screaming barks and shrieks when provoked. When defensive, it emits a shrill wail or squeal. During encounters between males and females or between a mother and kits, the least weasel emits a high-pitched trilling. The species' way of expressing aggression is similar to that of the stoat. Dominant weasels exhibit lunges and shrieks during aggressive encounters, while subdominant weasels will emit submissive squeals.[22]

Diet

The least weasel feeds predominantly on mouse-like rodents, including mice, hamsters, gerbils and others. It usually does not attack adult hamsters and rats. Frogs, fish, small birds and bird eggs are rarely eaten. It can deal with adult pikas and gerbils, but usually cannot overcome brown rats and sousliks. Exceptional cases are known of least weasels killing prey far larger than themselves, such as capercaillie, hazel hen and hares.[24] Rabbits are commonly taken, but are usually young specimens. Rabbits become an important food source during the spring, when small rodents are scarce and rabbit kits plentiful. Male least weasels take a higher proportion of rabbits than females, as well as an overall greater variety of prey. This is linked to the fact that being larger, and having vaster territorial ranges than females, males have more opportunities to hunt a greater diversity of prey.[25] The least weasel forages undercover, to avoid foxes and birds of prey. It is adapted for pursuing its prey down tunnels, though it may also bolt prey from their burrows and kill it in the open.[25] It kills small prey, such as voles, with a bite to the occipital region of the skull[24] or the neck, dislocating the cervical vertebrae. Large prey typically dies of blood loss or shock.[25] When food is abundant, only a small portion of the prey is eaten, usually the brain. The average daily food intake is 35 grams, which is equivalent to 30-35% of its body weight.[24]

Range

The least weasel has a circumboreal, Holarctic distribution, encompassing much of Europe and North Africa, Asia and northern North America, though it has been introduced in New Zealand, Malta, Crete, the Azore Islands and also Sao Tome off west Africa. It is found throughout Europe and on many islands, including the Azores, Britain (but not Ireland), and all major Mediterranean islands. It also occurs on Honshu and Hokkaido islands in Japan and on Kunashir, Iturup, and Sakhalin Islands in Russia.[1]

Predators and competitors

Least weasels driven from a mountain hare carcass by a stoat, as illustrated in Barrett-Hamilton's A History of British Mammals

The least weasel is small enough to be preyed upon by a range of other predators.[26] Least weasel remains have been found in the excrement of red foxes, sables, steppe and forest polecat, stoats, eagle owls and buzzards.[27] The owls most efficient at capturing least weasels are barn, barred and great horned owls. Other birds of prey threatening to the least weasel include broad-winged and rough-legged buzzards. Some snake species may prey on the least weasel, including the black rat snake and copperhead.[23] Aside from its smaller size, the least weasel is more vulnerable to predation than the stoat because it lacks a black predator deflection mark on the tail.[26]

In areas where the least weasel is sympatric with the stoat, the two species compete with each other for rodent prey. The weasel manages to avoid overly competing with the stoat by living in more upland areas, and preying on smaller prey and being capable of entering smaller holes. The least weasel actively avoids encounters with stoats, though female weasels are less likely to stop foraging in the presence of stoats, likely because their smaller size allows them to quickly escape in holes.[28]

Diseases and parasites

Ectoparasites known to infest weasels include the louse Trichodectes mustelae and the mites Demodex and Psoregates mustela. The species may catch fleas from the nests and burrows of its prey. Flea species known to infest weasels include Ctenophthalmus bisoctodentatus and Palaeopsylla m. minor, which they get from moles, P. s. soricis, which they get from shrews, Nosopsyllus fasciatus, which they get from rodents and Dasypsyllus gallinulae which they get from birds.[26]

Helminths known to infest weasels include the trematode Alaria, the nematodes Capillaria, Filaroides and Trichinella and the cestode Taenia. Least weasels are commonly infected with Skrjabingylus nasicola, which burrows into their skulls and causes fits.[26]

In folklore and mythology

17th century print of a weasel confronting a basilisk

The Ancient Macedonians believed that to see a weasel was a good omen. In some districts of Macedon, women who suffered from headaches after having washed their heads in water drawn overnight would set the problem down to the fact that a weasel had previously used the water as a mirror, but they would refrain from mentioning the animal's name, for fear that it would destroy their clothes. Similarly, a popular superstition in southern Greece had it that the weasel had previously been a bride, who was transformed into a bitter animal which would destroy the wedding dresses of other brides out of jealousy.[29] According to Pliny the Elder, the weasel is the only animal capable of killing the basilisk;

To this dreadful monster the effluvium of the weasel is fatal, a thing that has been tried with success, for kings have often desired to see its body when killed; so true is it that it has pleased Nature that there should be nothing without its antidote. The animal is thrown into the hole of the basilisk, which is easily known from the soil around it being infected. The weasel destroys the basilisk by its odour, but dies itself in this struggle of nature against its own self.[30]

The Chippewa believed that the weasel could kill the dreaded wendigo giant by rushing up its anus.[31] In Inuit mythology, the weasel is credited with both great wisdom and courage, and whenever a mythical Inuit hero wished to accomplish a valorous task, he would generally change himself into a weasel.[32] According to Matthew Hopkins, a witch hunter general during the English Civil War, weasels were the familiars of witches.[33]

References

Notes

  1. ^ a b c Tikhonov, A., Cavallini, P., Maran, T., Kranz, A., Herrero, J., Giannatos, G., Stubbe, M., Conroy, J., Kryštufek, B., Abramov, A., Wozencraft, C., Reid, F. & McDonald, R. (2008). Mustela nivalis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ Macdonald 1992, p. 208
  3. ^ Heptner & Sludskii 2002, p. 972
  4. ^ Kurtén 1968, pp. 102–103
  5. ^ Macdonald 1992, p. 205
  6. ^ Heptner & Sludskii 2002, pp. 975–978
  7. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001438. 
  8. ^ Heptner & Sludskii 2002, p. 982
  9. ^ Heptner & Sludskii 2002, p. 980
  10. ^ Heptner & Sludskii 2002, p. 981
  11. ^ Heptner & Sludskii 2002, p. 984
  12. ^ Heptner & Sludskii 2002, p. 978
  13. ^ Merriam 1896, pp. 14–15
  14. ^ Heptner & Sludskii 2002, p. 983
  15. ^ Heptner & Sludskii 2002, pp. 967–969
  16. ^ a b Heptner & Sludskii 2002, p. 969
  17. ^ a b Harris & Yalden 2008, p. 468
  18. ^ Heptner & Sludskii 2002, p. 991
  19. ^ Heptner & Sludskii 2002, pp. 970–972
  20. ^ a b Harris & Yalden 2008, p. 474
  21. ^ Harris & Yalden 2008, p. 154
  22. ^ a b Harris & Yalden 2008, pp. 471–472
  23. ^ a b Merritt & Matink 1987, p. 277
  24. ^ a b c Heptner & Sludskii 2002, pp. 987–988
  25. ^ a b c Harris & Yalden 2008, pp. 472–473
  26. ^ a b c d Harris & Yalden 2008, p. 475
  27. ^ Heptner & Sludskii 2002, p. 992
  28. ^ Harris & Yalden 2008, p. 469
  29. ^ Abbott, G. A. (1903), Macedonian Folklore, pp. 108-109, Cambridge University Press
  30. ^ Pliny the Elder, eds. John Bostock, Henry Thomas Riley (translators) (1855). "The Natural History". http://www.perseus.tufts.edu/cgi-bin/ptext?doc=Perseus%3Atext%3A1999.02.0137;query=chapter%3D%23358;layout=;loc=8.32. Retrieved 2009-06-10. 
  31. ^ Barnouw, Victor (1979) Wisconsin Chippewa Myths & Tales: And Their Relation to Chippewa Life, pp. 53, University of Wisconsin Press, ISBN 0-299-07314-9
  32. ^ Dufresne, Frank (2005), Alaska's Animals and Fishes, pp. 109, Kessinger Publishing, ISBN 1-4179-8416-3
  33. ^ Summers, Montague (2005) Geography of Witchcraft, pp. 29, Kessinger Publishing, ISBN 0-7661-4536-0

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The North American population sometimes is treated as a separate species, Mustela rixosa. Confusion has existed for a long time regarding the taxonomic status of this species and its subspecies, particularly in Europe (see Sheffield and King 1994; Wozencraft, in Wilson and Reeder 2005).

Reig (1997) examined skull variation in samples from North America, Central Europe, and Siberia and concluded that the Old World subspecies subpalmata warrants consideration as a separate species. Reig also suggested that subspecies M. nivalis rixosa of the eastern United States and adjacent southern Canada may be specifically distinct from M. n. eskimo of Alaska and adjacent Canada. Abramov and Baryshnikov (2000) separated only M. subpalmata
as specifically distinct from M. nivalis. Wozencraft (in Wilson and Reeder 2005) noted these proposals but retained all taxa within the species M. nivalis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!