Articles on this page are available in 3 other languages: Spanish (2), Chinese (Simplified) (4), Dutch (1) (learn more)

Overview

Brief Summary

The weasel is so small, that it can follow mice into their own network of tunnels. Of all the Wadden Islands, the weasel is only found on the island of Sylt. In the past,you could find weases on Ameland and Terschelling, but are no longer found there. Weasels are also having a hard time surviving in many places on the mainland. This is often because many of their hunting grounds are mowed, resulting in fewer voles and therefore, fewer weasels.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Weasels are active at any time of day or night, and intersperse periods of activity with a rest period (3). They feed mainly on small rodents, rabbits, birds and eggs (3), killing prey with a bite to the neck (1). Their small size enables them to enter the tunnels of mice and voles whilst hunting (2), and they often take over the nests of their prey, lining their dens with fur from prey during cold weather (2). A number of dens will be used within the home range. Males and females occupy separate territories, and defend these against members of the opposite sex (2). During spring, males move around in search of a mate (2). The male and female often fight prior to copulation, and the male grabs the female by the neck before he mates (1). A single litter of between 4 and 6 (2) naked, blind and deaf (1) kits is produced each year; the kits are weaned after 3 to 4 weeks and begin to hunt well by 8 weeks of age (2), often accompanying their mother to hunt in 'gangs' (2). By 9 to 12 weeks after birth the family group starts to split up (1). Historically, weasels were believed to have magical powers, and were said to be able to bring their dead young back to life. It was also thought that they hypnotised their prey by dancing (4); in fact 'dancing' behaviour is thought to be a response to discomfort caused by internal parasites (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Britain's smallest native carnivore (2), the weasel has a long slender body, and a short tail. The fur is ginger to a rich chocolate-russet brown in colour, and the underparts are creamy-white (2). The narrow head is supported on a long neck, and the legs are short (1). The large eyes are black, and the ears are rounded (1). In northern parts of the range, weasels turn white in winter, but they do not do so in the UK (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The smallest carnivores usually burn energy the fastest and have the most active lifestyles, so it is no surprise that the Least Weasel, the miniature among mustelids, consumes roughly half its body weight each day—equal to about two deer mice and a vole. As with other weasels, adult females may be half the size of adult males, and they mature much more rapidly; females are sexually mature at four months, males at eight months. Females produce two litters each year, unlike the larger, slower-breeding Ermine and Long-tailed Weasel. In the north, the fur of the Least Weasel turns from brown to white in winter, camouflaging them in the snow.

Adaptation: Large, shearing carnassial teeth at the back dominate the jaw structure of the Least Weasel, Mustela nivalis, as they do in all members of the weasel family.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1766.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Twelfth Edition, p. 69.  Laurentii Salvii, Uppsala, 1:1-532.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Least weasels are found throughout the Palearctic region (excluding Ireland, the Arabian Pennisula, and the Arctic Isles), in Japan, and in the Nearctic, from Alaska and northern Canada south to Wyoming and North Carolina (Honacki, 1982). A population of least weasels was introduced to New Zealand as well (Sheffield, 1994).

Biogeographic Regions: nearctic (Native ); palearctic (Native ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species has a circumboreal, Holartcic distribution, taking in much of Europe and North Africa, Asia and northern North America. It has been introduced in New Zealand, Malta, Crete, the Azore Islands, and apparently also Sao Tome off west Africa (Sheffield and King 1994). It is found throughout Europe and on many islands, including the Azores, Britain (but not Ireland), and all major Mediterranean islands. The populations on the Azores and Mediterranean islands (Malta and Crete) are widely considered introduced (Dobson, 1998; McDonald pers. comm.). It is also found on Honshu, Hokkaido, Kunashiri, Etorofu, and Sakhalin Islands in Japan (Abe et al., 2005) and northern Mongolia (Bannikov, 1954; Dulamtseren, 1970).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Circumboreal, Holarctic distribution. Western Hemisphere: most of Canada and Alaska south to British Columbia, Montana, Wyoming, Oklahoma, Missouri, Ohio, Virginia, and along the Appalachians to the Great Smoky Mountains (North Carolina, Tennessee). Range has expanded southward in the Great Plains since the mid-1960s as the climate has become cooler and more mesic (Frey 1992). Thought to be rare (though sometimes locally fairly common) throughout the range in the southeastern U.S., but actual status is uncertain (Handley 1991). Introduced in New Zealand, Malta, Crete, the Azore Islands, and apparently also Sao Tome off west Africa (Sheffield and King 1994). Ranges to 3660 m in mountains of Eurasia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Least weasels are native to the Nearctic and Palearctic regions and have been introduced to the Australian region. They are found throughout Europe and northern Asia (excluding Ireland, the Arabian Pennisula, and Artic islands), in Japan, and throughout North America. In North America they range from Alaska and northern Canada south to Wyoming and North Carolina. A population of least weasels was introduced to New Zealand as well.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread throughout mainland Britain, and on large islands around the UK, but absent from Ireland (3). They also occur throughout much of Europe, reaching into Asia as far east as Japan, as well as in North America (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The body of least weasels is long and slender, with a long neck; a flat, narrow head; and short limbs. This animal has large black eyes and large, round ears. The feet have five fingers with sharp claws. Mass is dependent upon location, North American populations are the smallest and those found in northern Africa have the largest mass. Fur color is chocolate brown on the back and white with brown spots on the underparts. The summer coat is about 1 cm in length. The winter coat, which is about 1.5 cm in length, turns to all white in northern populations and remains brown in the southern populations (Sheffield, 1994).

Range mass: 30.0 to 55.0 g.

Range length: 165.0 to 205.0 mm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Least weasels are long and slender, with a long neck, a narrow head, and short limbs. They have large, black eyes and large, round ears. The feet have five fingers with sharp claws. The mass of least weasels varies depending upon their location. In North America least weasels range in weight from 30 to 55 grams, with males being slightly larger than females. Total length ranges from 165 to 205 mm, tail length ranges from 22 to 40 mm. Fur color is chocolate brown on their back and white with brown spots on the underparts. The summer coat is about 1 cm in length. The winter coat, which is about 1.5 cm in length, turns to all white in northern populations and remains brown in southern populations.

Range mass: 30.0 to 55.0 g.

Range length: 165.0 to 205.0 mm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 21 cm

Weight: 50 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 180-205 mm males; 165-180 mm females

Weight:
Range: 40-55 g males; 30-50 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Least weasels can survive in a wide variety of habitats, including open forests , farmlands, meadows, prairies, steppe, and semi-deserts. Least weasels avoid deep forests, sandy deserts, and open spaces. They are well adapted for the tundra (Sheffield, 1994).

Habitat Regions: temperate

Terrestrial Biomes: tundra ; taiga ; forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Weasels tolerate a wide range of habitats, including forests, farmlands and cultivated fields, grassy fields and meadows, riparian woodlands, hedgerows, alpine meadows and forests, scrub, steppe and semi-deserts, prairies, and coastal dunes (Sheffield and King, 1994; Pulliainen, 1999). This species occurs from sea level to at least 3,860 m. It forms dens in crevices among tree roots, in hollow logs, or in abandoned burrows of other species. This species is a specialist diurnal predator of small mammals (especially rodents), although it will also occasionally feed on birds’ eggs, lizards, frogs, salamanders, fish, worms, and carrion (Sheffield and King, 1994). Food may be stored for the winter (Danzig, 1992). Habitat selection is usually determined by local distribution of rodents. Foraging individuals avoid open spaces, where they are most vulnerable to predation by raptors (Sheffield and King, 1994). They prefer dense, rank grassland where microtines (voles and lemmings) are abundant (McDonald pers. comm.).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Habitat varies geographically and includes open forests, farmlands and cultivated areas, grassy fields and meadows, riparian woodlands, hedgerows, alpine meadows, scrub, steppe and semi-deserts, prairies, coastal dunes, and sometimes rural residential areas; snow cover is not an obstacle; generally avoids deep dense forest and sandy desert. When inactive, occupies burrow made by vole or mole, or rests in nest in hole in wall of building or under corn shock or similar site. Den site may change often. Young are born in abandoned underground burrows made by other mammals (or similar secluded sites).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least weasels do well in a wide variety of habitats, including open forests, farmlands, meadows, prairies, steppe, and semi-deserts. Least weasels avoid deep forests, sandy deserts, and open spaces. They are well adapted for the tundra regions.

Habitat Regions: temperate

Terrestrial Biomes: tundra ; taiga ; forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in a range of habitats where there is good cover and plentiful prey, including woodland, grassland, sand dunes, mountains (3), urban areas, marshes and moors (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of least weasels is composed of small mammals, mainly rodents. When rodents are scarce, weasels will eat birds' eggs and nestlings. Their diet also ranges from insects to lizards. In the extreme northern populations they will eat the carcasses of brown lemmings. Males are better hunters and are more likely to hunt larger prey, while females will continue looking for small rodents (Sheffield, 1994).

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Specialist predator of small mammals, especially voles, lemmings, and other mice. When small rodents are scarce, may consume other small vertebrates, insects, or worms. Young are adept at killing mice at 7 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of least weasels is composed of small mammals, mainly rodents like Peromyscus leucopus and Microtus pennsylvanicus. When rodents are scarce, weasels will eat Aves, Insecta, and Squamata. The size of prey that least weasels are able to hunt depends on burrow size of the prey. If the weasel is too large to fit into the burrow it is unlikely that they will be able to hunt those animals. Because females are smaller, they are able to hunt smaller prey than males. Least weasels will kill more prey than they can eat at the time and will store this surplus in their burrows for later consumption.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Least weasels are important predators of small mammals in the ecosystems in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least weasels are aggressive and fierce and will attack animals much larger than themselves. Young in nests are preyed on by snakes, while adults may be preyed on by large birds of prey, such as owls and hawks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Least weasels play an important role in controlling rodent populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Least weasels are aggressive and fierce and will attack animals much larger than themselves. Young in nests are preyed on by Squamata, while adults may be preyed on by large birds of prey, such as Strigiformes and Accipitridae.

Known Predators:

  • owls (Strigiformes)
  • hawks (Accipitridae)
  • snakes (Serpentes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Mustela nivalis is prey of:
Buteo lagopus
Squamata
Strigiformes
Accipitridae

Based on studies in:
Russia (Tundra)

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Mustela nivalis preys on:
Microtus
Microtus xanthognathus
Clethrionomys glareolus

Based on studies in:
Russia (Tundra)

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Home range size varies with conditions; up to 26 ha in males, up to 7 ha in females; in England, average home range was 7-15 ha for males, 1-4 ha for females (King 1975). Basically solitary, except during breeding season and when females have young. High dispersal rate, good ability to colonize vacant habitat when rodent populations increase.

Density fluctuates with rodent populations; 0.2-1.0/ha in favorable conditions, average as low as 1-7/100 ha over wider areas (Erlinger 1974, Golley 1960, Sheffield and King 1994).

Mortality rate is high (overall annual rate is 75-90%); average age at death is less than one year. Predators include various Carnovora, raptors, and possibly snakes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Least weasels possess keen senses of smell, hearing, touch, and sight. As with most mammals they rely heavily on their sense of smell, communicating among themselves and locating prey by detecting scents.

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Least weasels possess keen senses of smell, hearing, touch, and sight. As with most mammals they rely heavily on their sense of smell, communicating among themselves and locating prey by detecting scents.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day or night throughout the year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Least weasels probably only live for several years after reaching adulthood and most die before reaching adulthood.

Range lifespan

Status: captivity:
9.1 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Least weasels probably only live for several years after reaching adulthood and most die before reaching adulthood.

Range lifespan

Status: captivity:
9.1 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.1 years (captivity) Observations: One wild born specimen was still alive at 9.1 years of age (Richard Weigl 2005). Anecdotal reports of animals living more than 10 years are plausible but remain unverified.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating System: polygynous

In North America, central Europe, and the former USSR, breeding can occur throughout the year, but the most breeding occurs in the spring and late summer. Gestation in least weasels lasts from 34 - 37 days. Litters may range from 1 - 7. A higher number of offspring per litter can be found in northern populations. Newborns weigh from 1.1 g to 1.7 g and are wrinkled, pink, naked, blind, and deaf. After 49 - 56 days, they have reached their adult length. By week 6 males are larger than females. In 9 - 12 weeks the family groups begin to break up, and in 12 - 15 weeks least weasels reach their adult mass. Females that are born in the spring are sexually mature in three months and may breed in their first summer. Summer and autumn born females are not as well developed and cannot breed until the next summer (Sheffield, 1994).

Breeding interval: Least weasels can breed once or twice each year.

Breeding season: Least weasels breed in spring and late summer.

Range number of offspring: 1.0 to 7.0.

Range gestation period: 37.0 (high) days.

Range weaning age: 18.0 (low) days.

Range age at sexual or reproductive maturity (female): 4.0 to 8.0 months.

Range age at sexual or reproductive maturity (male): 4.0 to 8.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 2.6 g.

Average number of offspring: 5.

Newborns weigh from 1.1 g to 1.7 g and are naked, blind, and deaf. They are nursed and cared for in the burrow by their mother. After 49 to 56 days, they have reached their adult length. By week 6, males are larger than females. In 9 to 12 weeks the family groups begin to break up, and in 12 to 15 weeks the weasels reach their adult weight.

Females care for and nurse their young until they become independent.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

May breed throughout the year but mainly in spring and late summer. When rodents are plentiful, may breed in winter under snow. Gestation lasts 34-37 days, including the 10-12 days between fertilization and implantation. Litter size averages 4-5 in temperate zone, higher in arctic latitudes. Commonly two litters/year. Young are tended by both parents, weaned by 6-7 weeks. Family groups break up when young are about 9-12 weeks old. Spring-born females are sexually mature in 3-4 months (may produce a litter in their first summer), males in 8 months. Reproductive output increases when food is abundant (more young are born, greater survivorship).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: polygynous

Pregancy in least weasels lasts from 34 to 37 days. Litters may range from 1 to 7 young. A higher number of offspring per litter can be found in northern populations. In the wild it is possible to have two litters per year, but there is a high death rate in the second litter.  Females that are born in the spring are mature in four months and may breed in their first summer. Summer and autumn born females are not as well developed and cannot breed until the next summer. Males reach sexual maturity at 8 months old.

Breeding interval: Least weasels can breed once or twice each year.

Breeding season: Least weasels breed in spring and late summer.

Range number of offspring: 1.0 to 7.0.

Range gestation period: 37.0 (high) days.

Range weaning age: 18.0 (low) days.

Range age at sexual or reproductive maturity (female): 4.0 to 8.0 months.

Range age at sexual or reproductive maturity (male): 4.0 to 8.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 2.6 g.

Average number of offspring: 5.

Newborns weigh from 1.1 g to 1.7 g and are naked, blind, and deaf. They are nursed and cared for in the burrow by their mother. After 49 to 56 days, they have reached their adult length. By week 6, males are larger than females. In 9 to 12 weeks the family groups begin to break up, and in 12 to 15 weeks the weasels reach their adult weight.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustela nivalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAATCGATGATTATTTTCCACTAATCACAAAGACATCGGCACCCTTTACCTCTTATTTGGTGCATGAGCCGGAATAGTAGGTACTGCCCTCAGTCTACTAATCCGCGCTGAACTTGGTCAACCTGGCGCTCTATTAGGAGACGACCAGGTTTATAACGTGATCGTGACTGCTCACGCATTTGTAATAATTTTCTTCATAGTAATACCTATCATGCTTGGGGGTTTTGGGAACTGACTTATTCCCTTAATAATTGGCGCACCTGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTTCCACCCTCTTTTCTTCTCCTACTGGCCTCCTCTATGGTAGAAGCGGGTGCAGGGACTGGATGAACTGTATACCCTCCTCTAGCAGGGAACCTGGCACATGCTGGAGCATCCGTAGACCTAGCAATCTTTTCTCTTCACTTAGCTGGTGTTTCATCTATTTTAGGGTCAATTAACTTCATCACCACTATTATCAACATAAAACCACCTGCTATATCACAGTACCAAACCCCATTATTCGTATGATCAGTCTTAATTACAGCTGTACTTCTTCTCCTATCTCTGCCAGTTTTAGCAGCCGGCATCACCATATTACTTACAGATCGAAATCTAAACACTACTTTCTTCGACCCGGCCGGAGGAGGAGACCCTATCTTGTACCAACACCTATTTTGATTTTTTGGGCACCCGGAAGTATATATCCTAATTCTTCCAGGGTTTGGTATTATTTCACACGTTGTAACATATTACTCAGGAAAAAAAGAACCATTCGGTTACATGGGGATAGTATGAGCAATAATATCAATTGGTTTCCTAGGATTTATCGTATGAGCCCACCATATATTTACCGTAGGCTTAGACGTTGACACACGAGCATATTTCACCTCAGCTACCATGATCATCGCCATCCCCACTGGAGTAAAAGTATTCAGCTGACTTGCCACCCTACATGGAGGAAATATCAAATGATCCCCTGCTATGTTATGAGCCTTGGGGTTTATTTTTCTATTTACAGTAGGGGGTCTAACGGGCATTGTACTATCAAATTCATCACTAGACATTGTCCTTCACGACACATATTATGTAGTAGCACACTTCCACTACGTCCTCTCAATAGGGGCAGTGTTTGCAATTATAGGCGGATTCGTTCACTGATTCCCACTATTCACAGGCTATACCCTAAATGATGTATGAGCAAAAATTCATTTCACAATTATATTTGTAGGAGTAAACACAACATTCTTTCCTCAACATTTCCTAGGCCTATCAGGTATGCCTCGACGCTACTCCGATTACCCAGATGCTTATACAACATGAAATACAGTATCCTCCATAGGATCGTTCATCTCATTAACAGCAGTTATACTAATAATCTTCATGATTTGAGAAGCCTTCGCATCCAAACGAGAAGTATTGACAGTAGAACTAACCTCAACTAATATCGAATGACTACATGGATGCCCTCCTCCATATCACACATTCGAAGAACCAACCTATGTACTATCAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mustela nivalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Least weasels are generally widespread and abundant. Localized populations may be threatened by habitat destruction, but these animals are generally not threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Tikhonov, A., Cavallini, P., Maran, T., Kranz, A., Herrero, J., Giannatos, G., Stubbe, M., Conroy, J., Kryštufek, B., Abramov, A., Wozencraft, C., Reid, F. & McDonald, R.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least weasel populations are not considered threatened.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as a species of conservation concern by the UK Biodiversity Action Plan, although not a priority species. Listed under Appendix III of the Bern Convention (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In the European part of its range, there are documented population declines in some areas (e.g. Britain: Battersby, 2005), and suspected declines in others. Although it has a wide distribution, it is considered rare in North America (Sheffield and King, 1994). In Eurasia, it is relatively common, but not often seen (Sheffield and King, 1994). Local densities of 0.2 to 1.0 individuals per hectare can occur in favored habitats when prey are abundant (Sheffield and King, 1994). However, over wider areas, the average density may be as low as 1 to 7 per 100 hectares (Goszczynski, 1977). Populations fluctuate both seasonally and annually, sometimes involving large increases of up to 10-fold, concurrently or within 9 months of a population peak of small rodents, and lasting 6 to 18 months (Sheffield and King, 1994). Thought to be rare (though sometimes locally fairly common) throughout the range in the southeastern U.S., but actual status is uncertain (Handley 1991).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats include incidental poisoning with rodenticides (Sheffield and King, 1994) and persecution. The weasel prefers open agricultural habitats, which are declining owing to changes in agricultural practices (rural abandonment) in parts of Europe, as open fields undergo succession.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of weasels are controlled because they take gamebird eggs and chicks (3). Likely threats include habitat loss and simplification, as well as predation by foxes. Agricultural changes have led in many areas to the loss or reduction of rough grasslands, which is prime habitat for the field vole, a key source of food for weasels (3). Evidence is building that rodenticides are having an effect on weasels and stoats, as they eat poisoned rodents (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is found in many protected areas. It is listed on Appendix III of the Bern Convention (Pulliainen, 1999), and is protected under national and sub-national legislation in a number of range states (e.g. Sichuan, China: Yi-Ming et al., 2000). Monitoring is required to quantify the population trend in Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Research is currently being carried out to determine whether the populations of weasels and stoats, our smallest carnivores are in decline (4). Weasels are not legally protected in the UK (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Least weasels have been hunted and trapped by humans throughout the world (Sheffield, 1994). The help keep in check the populations of many species of rodents that are potentially harmful to agriculture.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Least weasels have been hunted and trapped by humans throughout the world. They help keep in check the populations of many species of rodents that are potentially harmful to agriculture.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The North American population sometimes is treated as a separate species, Mustela rixosa. Confusion has existed for a long time regarding the taxonomic status of this species and its subspecies, particularly in Europe (see Sheffield and King 1994; Wozencraft, in Wilson and Reeder 2005).

Reig (1997) examined skull variation in samples from North America, Central Europe, and Siberia and concluded that the Old World subspecies subpalmata warrants consideration as a separate species. Reig also suggested that subspecies M. nivalis rixosa of the eastern United States and adjacent southern Canada may be specifically distinct from M. n. eskimo of Alaska and adjacent Canada. Abramov and Baryshnikov (2000) separated only M. subpalmata as specifically distinct from M. nivalis. Wozencraft (in Wilson and Reeder 2005) noted these proposals but retained all taxa within the species M. nivalis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!